E-clonal antibodies: selection of full-length IgG antibodies using ...

PROTOCOL

E-clonal antibodies: selection of full-length IgG antibodies using bacterial periplasmic display Yariv Mazor1,2, Thomas Van Blarcom1,2, Brent L Iverson1,3 & George Georgiou1,2 1Institute

for Cellular and Molecular Biology, University of Texas at Austin, Austin, Texas 78712, USA. 2Department of Chemical Engineering, University of Texas at Austin, Austin, Texas 78712, USA. 3Department of Chemistry and Biochemistry, University of Texas at Austin, Austin, Texas 78712, USA. Correspondence should be addressed to G.G. ([email protected]).

© 2008 Nature Publishing Group http://www.nature.com/natureprotocols

Published online 23 October 2008; doi:10.1038/nprot.2008.176

Here we describe a protocol for the selection of full-length IgG antibodies from repertoires displayed on Escherichia coli. In the method described here, full-length heavy and light chains are assembled in the periplasm into aglycosylated IgGs that are fully functional for antigen binding. Expression of an inner membrane-tethered Fc-binding protein is used to capture the IgG molecules and anchor them to the cell. Following outer-membrane permeabilization, fluorescently labeled ligand-binding library clones are selected by multiple rounds of fluorescence-activated cell sorting. Selection of a comprehensive set of IgG clones can typically be obtained within 3–4 weeks, a timescale that is comparable with most prevalent antibody display technologies. The isolated antibodies are well expressed in bacteria and exhibit affinities per binding site in the nanomolar range.

INTRODUCTION Recombinant antibodies are increasingly being used as clinical diagnostic/therapeutic reagents. The success of genetically engineered therapeutic monoclonal antibodies (mAbs) as a group is manifest in higher FDA approval rates compared with small-molecule drugs1. This has led to their increased representation in the therapeutic pipeline of most major pharmaceutical companies and has spurred interest in new platform technologies that aid in their discovery1. Methods for isolating mAbs Currently, mAbs are selected from hybridomas2, immortalized B cells3, immunized transgenic mice4 or from large collections of recombinant antibody fragments expressed in microorganisms and screened by techniques such as ribosome, phage, bacteria or yeast display5–9. The selection of antibodies from recombinant/ immortalized mammalian cells or from transgenic mice is laborious, time consuming and does not allow the tailoring of important features such as improvement in affinity, stability and expression levels. As an alternative, the use of recombinant antibody technologies on the basis of combinatorial library selection has matured considerably. In particular, several display methods and other library screening techniques have been developed for isolating antigen-specific molecules from large collections of recombinant antibody fragments10. Many of these screening platforms share four key steps with the procedure for antibody generation by the immune system in vivo: (i) generation of genotypic diversity; (ii) coupling of genotype to phenotype; (iii) application of selective pressure; and (iv) amplification of desired genes. Phage display is the most widespread method for the selection of antibody fragments of desired antigen specificity from large libraries. However, over the last decade, microbial surface display has emerged as an increasingly important alterative, especially for the facile isolation of high-affinity antibody fragments. Advantages and limitations of microbial surface display The major advantage of microbial surface display, namely yeast display and E. coli display, is the ability to screen using fluorescenceactivated cell sorting (FACS)11,12. FACS as a high-throughput screening methodology has the distinct advantage of using

1766 | VOL.3 NO.11 | 2008 | NATURE PROTOCOLS

real-time quantitative multiparameter fluorescence analysis. The combination of surface display and FACS enables precise control over which members of a cell population are selected on the basis of the simultaneous presence of various individual parameters, such as expression and affinity. Recent advances in equipment technology and fluorescent probes have resulted in microbial display becoming a suitable alternative or complement to phage display13. Yeast display has been used to isolate antibodies from large repertoires as well as to increase their affinity, specificity and stability14. Antibodies specific for various antigens have been used in this system including those specific for the small-molecule fluorescein, peptides and T-cell receptors14. Numerous display systems have been engineered for both Grampositive and Gram-negative bacteria, but only a few have demonstrated the ability to display antibody fragments and other binding proteins in an accessible manner6,15–17. Of the available systems, only the E. coli-based Lpp-OmpA, PECS and APEx systems have been successfully used to engineer antibodies9,18,19, including the affinity maturation of scFv antibody fragments specific for: the haptens digoxin and methamphetamine; and for the protective antigen component of Bacillus anthracis, which was affinity-enhanced over 100-fold9,19–21. The expression maturation of a Fab was also performed using a variation of the original APEx system22. A significant downside of all the high-throughput antibody screening technologies available to date is their reliance on microbial expression of antibody fragments and, in particular, on the display of scFvs and Fabs. These monovalent fragments, although relatively easy to produce in E. coli, exhibit short serum half-lives and often show low thermodynamic stability and considerably lower apparent affinity compared with their corresponding full-length IgG counterparts23. Therefore, for the vast majority of clinical applications, antibody fragments isolated from combinatorial libraries must first be converted to full-length IgG, then expressed in mammalian cells. Further, in all but one of the known display technologies (PECS is the exception), the protein of interest must be expressed as either a C- or N-terminal fusion to an anchoring segment. As a result, many of the antibodies

PROTOCOL

Overview of E-clonal: a microbial periplasmic display method We have previously developed an E. coli-based technology named E-clonal for the isolation of full-length IgG antibodies from combinatorial libraries24 (Fig. 1). This technology was recently used for the isolation of several IgG antibodies with nanomolar affinities toward the protective antigen of B. anthracis from a mouse immune library24. The system is based on the expression of intact IgG antibodies that are secreted into the E. coli periplasm, where they are captured by an Fc-binding NlpA-ZZ fusion protein that tethers the IgGs to the inner membrane. NlpA-ZZ is a chimeric protein composed of the leader peptide and first six amino acids of the E. coli new lipoprotein A (NlpA) fused in-frame to the N-terminus of the so-called ZZ domain, a tandem repeated IgGbinding B domain derived from Staphylococcus aureus protein-A25. NlpA was identified and characterized in E. coli as a nonessential lipoprotein that exclusively localizes to the inner membrane26,27. Upon secretion into the periplasm and cleavage of the leader peptide, the N-terminal cysteine of the NlpA sequence is fatty acylated and the NlpA-ZZ chimera becomes tethered to the inner membrane of E. coli. Following outer-membrane permeabilization by Tris-EDTA and lysozyme treatment, the inner membranecaptured IgG is displayed on the resulting E. coli spheroplasts and can bind exogenously added fluorescent antigen. Fluorescently labeled spheroplasts are then readily distinguished and isolated by FACS. As the viability of EDTA–lysozyme-treated cells following spheroplasting is low, sorted cells cannot be collected into liquid media and propagated for subsequent rounds of sorting as done with bacterial and yeast surface display6,28. In this technology, a DNA fragment corresponding to the VL-Ck and VH domains is rescued from the sorted cells by PCR. Yet an advantage of this approach is that the amplification of DNA from pooled cells can be carried out under mutagenic conditions before subcloning. Thus, after each round of selection, random mutations can be introduced into the isolated genes, simplifying further rounds of directed evolution. The E-clonal technology is a highly integrated and comprehensive platform for antibody discovery, optimization and production. The ability to carry out both antibody isolation and expression in E. coli provides several important technical advantages compared with the existing antibody technologies. First, the E-clonal platform is the only technology that delivers the isolation of full-length IgG antibodies from libraries expressed in bacteria. In contrast, existing screening technologies result in the isolation of antibody fragments, which then must be converted to full-length antibodies and expressed in mammalian cells. Recently, a platform for the display of small libraries of IgG on the surface of mammalian cells was described29. Using an Epstein-Barr virus-derived episomal vector, chicken-immunized libraries were displayed as chicken–human chimeric IgG1 molecules on the surface of HEK293c18 cells and screened for specific antigen binding by a combination of magnetic beads and FACS. Nevertheless, this technology is time consuming, cumbersome, expensive and does not allow for the screening of very large libraries because of the transfection capabilities of mammalian cells. Second, the improved stability and avidity of bivalent IgG molecules aid in the selection of rare clones that may not be

Outer membrane

Periplasmic space ZZ CDQSSS

Inner membrane Cytoplasm Outer-membrane permeabilization Cells labeling with fluorescent antigen Ag

CDQSSS

Ag

Ag

ZZ

Cytoplasm FACS

FL2 (expression)


that are isolated following library screening can only fold in the context of a fusion protein and cannot be expressed independently.

105

Q1

104

Q2 Recovery of antigenspecific lgGs

Sorting gate

103 102

Q4

Q3 102

103

104

5

10

FL1 (affinity)

Figure 1 | The E-clonal technology: libraries of full-length IgG antibodies expressed in the periplasm of E. coli are captured by an inner-membranetethered NlpA-ZZ fusion protein. Following outer-membrane disruption, the inner-membrane-captured IgG antibodies specifically bind fluorescently labeled antigen and are enriched by FACS.

discovered using monovalent antibody fragments and existing display methodologies. An increased ability to isolate rare clones, perhaps even some with lower initial affinity, is particularly valuable for maintaining diversity among selected clones from either naive or synthetic libraries as well as from libraries derived from immunized animals. Third, in the method described here, the IgG antibodies are initially expressed in their native form as soluble, nonfusion proteins in the periplasmic space of E. coli. Consequently, these proteins are not selected to fold or be expressed in the context of a fusion partner protein, as is the case with other display technologies. Fourth, expression in E. coli is a robust technology allowing yields of IgG in the g liter1 range and generally a higher degree of protein product homogeneity than can be obtained in mammalian cells that typically secrete multiple glycoforms30. Nevertheless, bacterially produced E-clonal IgG antibodies are not glycosylated. Fc-glycosylation is essential for the recognition of Fcg-receptors and has an important function in linking IgG antibody-mediated immune responses with cellular effector functions31,32. Recruitment of the innate immune system is critical for certain therapeutic mechanisms in cancer and autoimmune diseases. In summary, bacterial techniques for IgG isolation and expression should reduce reliance on the substantially more time consuming technologies including hybridomas and the expression of IgG in mammalian cells. NATURE PROTOCOLS | VOL.3 NO.11 | 2008 | 1767

PROTOCOL


Figure 2 | Map of plasmid pMAZ360-IgG for expression of soluble intact IgGs in the E. coli periplasm. VH and Vk genes are cloned as NheI/HindIII and NcoI/NotI restriction fragments, respectively. The vector facilitates convenient cloning of VH and Vk domains linked to human g1 and k constant domains, respectively, as a bicistronic operon downstream of the lac promoter. This plasmid carries an ampicillin selection marker and contains the packaging signal of f1, enabling the packaging of the plasmid as ssDNA in the presence of a helper phage.

Expression of soluble full-length IgG antibody libraries in the E. coli periplasm is carried out from the pMAZ360-IgG expression vector (Fig. 2). This plasmid facilitates convenient cloning of VH and Vk genes linked to human g1 and k constant domains, respectively, as a bicistronic operon downstream from a lac promoter. The first cistron, comprised of the light chain followed by two stop codons, is placed before a second cistron consisting of the heavy chain. Both the light and heavy chains are fused at the N-terminus to a pelB leader sequence for secretion into the periplasm. However, any other signal sequence that ensures efficient translocation across the membrane (e.g., phoA, OmpA, etc.) may be employed instead. This plasmid carries an ampicillin selection marker and contains the packaging signal of f1, which enables packaging of the plasmid as single-stranded (ss) DNA in the presence of helper phage. This protocol describes a general approach for the selection of antibody fragments from immunized repertoires. The protocol does not provide details on library construction; however, the E-clonal approach described in this work is not restricted to natural repertoires and can be readily adapted for all other antibody library designs. Pools of VH and VL genes from any given design strategy can be easily introduced separately into the pMAZ360-IgG expression vector as NheI/HindIII and NcoI/NotI restriction fragments, respectively. The DNA plasmid pool of the generated pMAZ360IgG library is then introduced into JUDE-1 cells harboring plasmid pBAD33-NlpA-ZZ. The latter plasmid allows the expression of the NlpA-ZZ inner membrane-tethered fusion protein under control of the araBAD promoter and also carries a chloramphenicol selection marker. The resulting E-clonal IgG library cells carrying both plasmids are then subjected to the selection procedure described below. Selection procedure An overview of the E-clonal selection process can be seen in Figure 1. E. coli JUDE-1 cells carrying plasmids pBAD33-NlpA-ZZ

MATERIALS REAGENTS . E. coli strains: JUDE-1—DH10B (Invitrogen) harboring the ‘F’ factor derived from XL1-blue (Stratagene) (available by request from the Georgiou lab, contact [email protected]) . Plasmid pMAZ360-IgG for expression of soluble full-length IgG antibodies in the E. coli periplasm and plasmid pBAD33-NlpA-ZZ for expression of the NlpA-ZZ fusion protein (available by request from the Georgiou lab, contact [email protected]) . VentR DNA polymerase (New England Biolabs, cat. no. M0254S) . Taq DNA polymerase with ThermoPol buffer (New England Biolabs, cat. no. M0267S) . Deoxynucleotide solution mix (New England Biolabs, cat. no. N0447) . Restriction enzymes (New England Biolabs): NheI (cat. no. R0131S), HindIII (cat. no. R0104S), NcoI (cat. no. R0193S), NotI (cat. no. R0189S) . T4 DNA ligase (New England Biolabs, cat. no. M0202S)


NcoI NotI RBS PLAC

VL pelB

NheI HindIII RBS CL

VH

CH1

CH2

CH3

pelB

pMAZ360-IgG

F1ori

AmpR

and pMAZ360-IgG library DNA are initially induced overnight for expression of soluble IgG molecules in the bacterial periplasm. Next, library cells are induced for expression of the inner membrane-tethered Fc-binding protein (NlpA-ZZ). The latter stably captures the soluble IgG molecules and secures them to the periplasmic face of the inner membrane (Steps 1–7). Next, library cells are converted to spheroplasts by disruption of the outer membrane using Tris-EDTA and lysozyme treatment (Steps 8–14). Disruption of the outer membrane normally results in the leakage of periplasmic proteins from the cells. However, in this case, the IgG antibodies remain bound to the cell wall by the inner-membrane-anchored NlpA-ZZ fusion protein. Once the outer membrane has been disrupted, IgG-displaying cells are incubated with fluorescently labeled antigen (Steps 15–18). Clones expressing IgGs that specifically recognize the labeled antigen are then selected by FACS (Steps 19–22). For better selectivity and for the isolation of clones exhibiting improved dissociation rates, cells collected after the first sort are immediately resorted on the flow cytometer (Steps 23–24). Next, a DNA fragment corresponding to the Vk-Ck-VH sequence of the IgG gene of sorted cells is PCR-amplified, digested, recloned into pMAZ360-IgG vector and transformed into fresh cells containing the pBAD33-NlpA-ZZ plasmid (Steps 25–36). The resulting transformants are then grown, induced for expression of IgG and NlpAZZ and subjected to additional rounds of sorting and resorting until the population is sufficiently enriched for antigen binding (Steps 37– 39). Once it is determined that the library population is specifically enriched with binders for the antigen of interest, individual clones are grown in 96-well plates, induced for expression of soluble IgG and antigen-specific clones are identified by ELISA (Steps 40–58). Finally, positive clones with confirmed high ELISA signals are expressed and full-length IgG antibodies are purified using protein-A chromatography (Steps 59–73).

. Isopropyl-b-D-thiogalactopyranoside, dioxane free (Calbiochem, cat. no. 420322)

. L-(+)-Arabinose (MP Biosciences, cat. no. 100706; see REAGENT SETUP) . Skimmed milk powder (Labscientific, cat. no. M0841) . Bovine serum albumin, fraction V (EMD Biosciences, cat. no. 12657) . Chicken egg white lysozyme (EMD Biosciences, cat. no. 4403) . Agarose (Sigma, cat. no. A0169) . Ampicillin (EMD Biosciences, cat. no. 171254; see REAGENT SETUP) . Chloramphenicol (Sigma-Aldrich, cat. no. C1919; see REAGENT SETUP) . D-(+)-Glucose (MP Biomedicals, cat. no. 152527; see REAGENT SETUP) . Glycerol (Sigma-Aldrich, cat. no. G7893-1L; see REAGENT SETUP) . Difco Luria Bertani (LB) (Becton Dickinson, cat. no. 244620) . Difco 2xYT (Becton Dickinson, cat. no. 244020) . Difco terrific broth (TB) (Becton Dickinson, cat. no. 243820) . Difco SOB medium (Becton Dickinson, cat. no. 244310)

PROTOCOL . SOC medium (Invitrogen, cat. no. 15544-034) . PBS, PBST, PBSB and PBSM (see REAGENT SETUP) . Tween-20 (EMD Biosciences, cat. no. 9480) . BugBuster HT Protein Extraction Reagent (Novagen, cat. no. 70922) . Tris-sucrose buffer (see REAGENT SETUP) . EDTA solution (see REAGENT SETUP) . MgCl2 solution (see REAGENT SETUP) . H2SO4 solution (see REAGENT SETUP) . Loading/washing buffer (see REAGENT SETUP) . Elution buffer (see REAGENT SETUP) . Neutralization buffer (see REAGENT SETUP) . Chicken anti-human IgG Fc (GeneTex, cat. no. GTX77544) . Horseradish peroxidase (HRP)-conjugated goat anti-human IgG antibodies © 2008 Nature Publishing Group http://www.nature.com/natureprotocols

(Jackson ImmunoResearch Laboratories, cat. no. 109-035-003)

. TMB+ substrate-chromogen (DAKO, cat. no. S1599) . UltraLink immobilized protein A (Pierce, cat. no. 20333) . Coomassie plus protein assay reagent (Pierce, cat. no. 23238) . Primer 5¢ VL library amplifier: CGGATAACAATTTCACACAGG . Primer 3¢ VH library amplifier: AGTTCCACGACACCGTCACCG EQUIPMENT

. Disposable plastic columns (Pierce, cat. no. 29920) . Slide-A-lyser dialysis cassette, 10,000 MWCO, 0.5–3 ml capacity (Pierce, cat. no. 66405)

. Nitrocellulose desalting membrane, 0.025 mm (Millipore, cat. no. VSWP00010)

. Electroporation cuvettes, 0.2-cm gap (Fisher Scientific, cat. no. FB102) . BD Falcon biodish XL 245 mm 245 mm petri dishes (Becton Dickinson, cat. no. 351040)

. 100 mm 15 mm Petri dishes (VWR, cat. no. 25384-342) . Zymoclean gel DNA recovery kit (Zymo Research, cat. no. D4001) . QIAprep spin miniprep kit (Qiagen, cat. no. 27104) . Sterile 96-well cell culture cluster, round bottom with lid (Costar Life Sciences/Costar, cat. no. 3799)

. Nonsterile 96-well EIA/RIA plate, flat bottomed without a lid (Corning Life Sciences/Costar, cat. no. 3590)

. Sorting flow cytometer with appropriate lasers and detectors . Gel electropheresis system . Incubator 30, 37 1C . Shaker 25, 30 and 37 1C, 250 r.p.m. . Microplate reader (BioTek Instruments Inc., model ELx808) . Gene Pulser electroporation apparatus . Thermal cycler REAGENT SETUP Ampicillin solution Dissolve ampicillin powder at 100 mg ml1 in distilled deionized H2O. Filter through 0.2 mM filter. Aliquot in 1-ml portions. Can be

stored at 20 1C indefinitely. Thawed aliquots should be freshly diluted 1,000-fold into solid or liquid media. Chloramphenicol solution Dissolve chloramphenicol powder at 30 mg ml1 in ethanol. Aliquot in 1-ml portions. Can be stored at 20 1C indefinitely. Aliquots should be freshly diluted 1,000-fold into solid or liquid media. Glucose solution Dissolve 400 g in 1 liter of sterile distilled deionized H2O (40% wt/vol), filter-sterilize and store at room temperature (25 1C) for up to 1 year. Arabinose solution Dissolve 20 g in 100 ml of sterile distilled deionized H2O (20% wt/vol), filter-sterilize and store at 4 1C for up to 1 year. 2xYTGA agar plates Dissolve 31 g of Difco 2xYT powder and 18 g of agar in distilled H2O to a volume of 1 liter and autoclave. Cool agar mixture with stirring until below 50 1C, add 50 ml of 40% (wt/vol) glucose and ampicillin solution, mix and pour plates. Plates can be stored for up to 4 months at 4 1C. 2xYTGAC agar plates Dissolve 31 g of Difco 2xYT powder and 18 g of agar in distilled H2O to a volume of 1 liter and autoclave. Cool agar mixture with stirring until below 50 1C, add 50 ml of 40% (wt/vol) glucose, ampicillin solution and chloramphenicol solution, mix and pour plates. Plates can be stored for up to 4 months at 4 1C. Glycerol solution 50% (vol/vol) in sterile distilled deionized H2O. Autoclave and store at room temperature indefinitely. PBS buffer 8.1 mM Na2HPO4, 1.47 mM KH2PO4, 2.68 mM KCl, 137 mM NaCl in distilled deionized H2O. Adjust to pH 7.4 and autoclave. Can be stored at room temperature indefinitely. PBST buffer Add 0.05% (vol/vol) Tween-20 to PBS buffer. PBSB buffer Add bovine serum albumin to PBS buffer to a final concentration of 2% (wt/vol) and filter-sterilize. Can be stored at 4 1C for up to 6 months. PBSM buffer Add skimmed milk powder to PBS buffer to a final concentration of 2% (wt/vol) and filter-sterilize. Can be stored at 4 1C for up to several days. Tris-sucrose buffer 0.75 M sucrose, 0.1 M Tris-HCl in distilled deionized H2O. Adjust to pH 8 and filter-sterilize. Can be stored at 4 1C for up to 1 year. EDTA solution 1 mM EDTA in distilled deionized H2O. Adjust to pH 8 and filter-sterilize. Can be stored at 4 1C for up to 1 year. MgCl2 solution 0.5 M MgCl2 in distilled deionized H2O. Filter-sterilize and store at 4 1C for up to 1 year. H2SO4 solution 1 M H2S04 in distilled deionized H2O. Keep from light and store at room temperature for up to 1 year. Loading/washing buffer 20 mM Na2HPO4, 2 mM NaH2PO4 in distilled deionized H2O. Adjust to pH 8 and autoclave. Can be stored at room temperature for up to 1 year. Elution buffer 0.1 M of citric acid in distilled deionized H2O. Adjust to pH 3, filter-sterilize and store at room temperature for up to 6 months. Neutralization buffer 1 M Tris-HCl in distilled deionized H2O. Adjust to pH 9, filter-sterilize and store at room temperature for up to 6 months.

PROCEDURE Growth of IgG library cells 1| Thaw frozen aliquots of E. coli JUDE-1 cells carrying plasmids pBAD33-NlpA-ZZ and pMAZ360-IgG library DNA on ice. Also defrost cells carrying a characterized pMAZ360-IgG plasmid encoding for an IgG for which a fluorescently conjugated antigen and the pBAD33-NlpA-ZZ plasmid are available; these cells will be used as a positive control. Cells carrying pBAD33-NlpA-ZZ alone should also be defrosted for use as a negative control. 2| Dilute the library cells (pMAZ360-IgG library + pBAD33-NlpA-ZZ) into 1 liter of TB medium supplemented with 100 mg ml1 ampicillin, 30 mg ml1 chloramphenicol and 2% (wt/vol) glucose to give a starting OD600 of 0.2 (OD600 ¼ 1.0 correspond to B5 108 cells). The number of library cells in the inoculum should exceed the complexity of the used library by at least tenfold to reduce the probability of losing unique clones. Inoculate positive control cells in 5 ml of TB medium supplemented with 100 mg ml1 ampicillin, 30 mg ml1 chloramphenicol and 2% (wt/vol) glucose to give a starting OD600 of 0.2. m CRITICAL STEP The presence of 2% glucose allows the effective suppression of antibody expression during bacterial growth. m CRITICAL STEP Inoculating a positive-control IgG for an irrelevant antigen ensures that the protocol was followed correctly, as the signal for both affinity and expression can be detected on the flow cytometer. Further, using an antibody specific for an irrelevant antigen as a control ensures that the library is not contaminated and enriched for the control antibody. 3| Grow the cultures at 30 1C and 250 r.p.m. to an OD600 of 1.0 (B3–4 h). 4| Centrifuge 100 ml of the library culture, and all of the positive control culture, at 4,000g for 10 min at 4 1C. NATURE PROTOCOLS | VOL.3 NO.11 | 2008 | 1769

PROTOCOL 5| Decant supernatant and resuspend the library pellet in 100 ml (the positive control pellet should be resuspended in 5 ml) of TB medium supplemented with 100 mg m1 ampicillin, 30 mg ml1 chloramphenicol and 1 mM isopropyl b-D-thiogalactopyranoside (IPTG) for induction of IgG protein. At this point, inoculate negative-control cells carrying only plasmid pBAD33-NlpA-ZZ in 5 ml of TB medium, 30 mg ml1 chloramphenicol and 2% (wt/vol) glucose to give a starting OD600 of 0.2. ? TROUBLESHOOTING 6| Grow all three cultures for 16 h at 25 1C and 250 r.p.m.


7| The following day, induce the library culture and control cells by adding a final concentration of 0.2% (wt/vol) arabinose for expression of NlpA-ZZ protein and incubate for an additional 3 h at 25 1C and 250 r.p.m. m CRITICAL STEP Induction of NlpA-ZZ following overnight expression of the IgG allows IgG assembly before capture by the inner-membrane-tethered ZZ domain. Spheroplasting of IgG library cells 8| For outer-membrane permeabalization by Tris-EDTA and lysozyme treatment (spheroplasting), transfer OD600 ¼ 5.0 of freshly induced library cells and control cells into a sterile microcentrifuge tube and centrifuge at 4,000g for 5 min at room temperature. m CRITICAL STEP Typically, at least tenfold oversampling of the library population is used for efficient coverage of library diversity. With large libraries (4109 clones), use multiple microcentrifuge samples of OD600 ¼ 5.0 for adequate library coverage; it is not recommended to exceed OD600 ¼ 5.0 per sample, as it decreases the efficiency of the spheroplasting procedure. 9| Decant supernatant, wash the cells with 1 ml of PBS and centrifuge at 2,000g for 5 min at room temperature. 10| Decant supernatant and resuspend the pellet in 350 ml of ice-cold solution of Tris-sucrose buffer. 11| Slowly swirl the tube while adding 700 ml of ice-cold solution of 1 mM EDTA dropwise and incubate at room temperature for 3 min. 12| Add 50 ml of ice-cold freshly made 20 mg ml1 egg white lysozyme in Tris-sucrose buffer and incubate at room temperature for 20 min on a rotator at 30–60 r.p.m. Treatment with lysozyme causes the hydrolysis of the b-linkage between N-acetylmuramic acid and N-acetylglucosamine of the peptidoglycan layer in the bacterial cell wall. 13| Add 50 ml of ice-cold 0.5 M MgCl2 and incubate at 4 1C for 15 min on a rotator. The addition of MgCl2 brings the cells back into suspension. 14| Centrifuge at 8,000g for 10 min at 4 1C, decant the supernatant and resuspend the resulting spheroplast pellet in 1 ml of ice-cold PBSB. m CRITICAL STEP The resulting spheroplast pellet is very viscous and thus hard to resuspend compared with a normal nontreated cell pellet. Centrifugation at higher speeds or for longer times increases the difficulty of resuspension. It is recommended to pipette up and down thoroughly until all clumped spheroplasts resuspend into a homogeneous solution. Residual cell aggregates dramatically reduce the efficiency and specificity of labeling, and hence the sorting of the library. Large aggregates of cells are seen on the flow cytometer as one event with higher forward scattering and side scattering. Therefore, two positive spheroplasts aggregated with a dozen negative spheroplasts result in one event with twice the fluorescence as compared to a single positive spheroplast event. This greatly reduces the enrichment efficiency especially in the final rounds of sorting. Labeling of library cells for flow cytometry sorting 15| For two-color FACS based on antigen binding (affinity) and expression of the displayed antibody library, fluorescently label control and library cells with the latter at an excess of at least tenfold the library size in an appropriate final volume of PBSB buffer. Typically, cells are labeled at a concentration of 2 105 cells per ml (50 ml for 1 107 cells) in a sterile 0.5-ml microcentrifuge tube. This enables minimal use of the fluorescent probe while still preventing the spheroplasts from aggregating. For characterizing a library population or a single clone, it is convenient to work with a quantity of cells that forms a visible pellet after centrifugation, usually 1 107 cells. For affinity, label spheroplasts with blue-exciting/ green-emitting fluorophore-conjugated antigen (e.g., Alexa Fluor 488) at a final concentration of 500 nM. Initial antigen labeling concentrations may vary with the antigen of interest. A starting point of 500 nM is generally sufficient to enrich IgGs with adequate binding characteristics; subsequent rounds of sorting at decreasing concentrations can be used to obtain clones that bind with higher affinity. For IgG expression, label spheroplasts with Alexa Fluor 647-chicken anti-human IgG Fc-specific diluted 1:50. m CRITICAL STEP Differerent fluorophores can be used to detect affinity and expression based on the available lasers and detectors on the flow cytometer being used. However, it is best to use two fluorophores or fluorescent proteins that exhibit minimal spectral overlap with each other to minimize the need for compensation and potential loss of signal. Although the above-mentioned fluorophores (Alexa Fluor 488 and 647) are ideal, as they are excited at different wavelengths, have negligible 1770 | VOL.3 NO.11 | 2008 | NATURE PROTOCOLS

spectral overlap and demonstrate high fluorescent signals when used on the flow cytometer, other combinations of fluorescent dyes can be used. When using two fluorophores that have spectral overlap, it is advantageous to label the antigen with the fluorophore that excites at the lower wavelength, as the majority of the compensation will be directed toward the expression signal. As the majority of the population will give a positive signal for expression and not for affinity, compensation of the expression signal to account for spectral overlap with the affinity signal will minimize the chances for loss of the low-affinity antibodies during selection. It is useful to use the same fluorophore to detect antigen binding of the positive control IgG as well as the library to ensure that the protocol has been followed correctly and that the cytometer lasers and detectors are properly aligned. For affinity, the concentration of the antigen probe should be fivefold higher than the expected affinity of the antibodies to be isolated and at a concentration of at least tenfold more than that of the displayed antibodies in the analyzed sample. Assuming 1 104 captured IgGs per bacteria, the IgG concentration in the sample is calculated as follows: (1 104 IgG per cell) (1 107 cells per 50 ml) ¼ 3 nM Therefore, the lowest recommended antigen-labeling concentration should be 30 nM for this volume. If a secondary reagent is required (i.e., the antigen is not directly conjugated to a fluorophore), working dilutions should be determined by titration. For expression, the working dilutions of the primary (and secondary if necessary) reagent(s) should be determined by titration. 16| Centrifuge samples at 8,000g for 5 min at 4 1C and decant the supernatant. ’ PAUSE POINT Keep the cell pellet on ice shielded from light until flow cytometric analysis. Pellets of labeled cells can be stored at 4 1C for up to 48 h before loading on the flow cytometer. 17| Set up a FACS machine equipped with both a 488-nm and a 633-nm laser (on the basis of using Alexa Fluor 488 and 647). Emission of Alexa Fluor 488 and Alexa Fluor 647 should be detected through a 530/30 and a 670/20 band-pass filter, respectively. m CRITICAL STEP Fluorophores with spectral overlap (typically those excited with the same laser) can be used, but compensation is required to account for cross talk between fluorescence-detection channels. Additional controls will be required for proper compensation (i.e., labeled for only affinity and only for expression). 18| Resuspend cell pellet in PBSB buffer immediately before applying to the flow cytometer and load the labeled cell sample using an appropriate FACS tube. m CRITICAL STEP Sorting of library cells on FACSAria is performed under a sorting mode of 20,000 events per second; it is recommended that the labeled cells are diluted to the appropriate concentration before loading onto the FACS machine. This will maintain the instrument at low pressure and will prevent clogging of the fluidic system. Optimal resuspension volumes vary according to the FACS machine used; typically, the volume should be at least 500 ml and the cell concentration should not exceed 108 cells per ml.

3

10

2

Q4

Q3 10

2

3

10

4

10

3

10

2

10

Q3

5

Q4

10

10

Alexa Fluor 488 (affinity)

2

3

10

10

4

10

5


c

d 10

5

10

4

10

3

10

2

Q2

Q1

Q3

Q4

10

2

3

10

10

4


10

5

Alexa Fluor 647 (expression)

Figure 3 | Representative flow cytometry data. (a) Negative-control cells expressing only NlpA-ZZ proteins, double-labeled with Alexa Fluor 488-antigen conjugated and Alexa Fluor 647-chicken anti-human IgG Fc. (b) Positivecontrol cells expressing NlpA-ZZ proteins, and IgG antibodies, double-labeled with Alexa Fluor 488-antigen conjugated and Alexa Fluor 647-chicken antihuman IgG Fc. (c) Library cells labeled for the initial round of FACS sorting. Cells are double-labeled as above to evaluate antigen binding and IgG expression, respectively. The red outline indicates a typical sort gate collecting approximately the top 5% of the population displaying the highest fluorescent intensities. (d) Library cells following three rounds of FACS selection. Enriched population of antigen-specific clones is indicated by the appearance of a diagonal population in the double-positive quadrant (Q2). As the population becomes enriched, a tighter sort gate is set, collecting the top 0.5–1% fluorescent events.

10



Library FACS sorting 19| Before analysis of the library cells, use the double-labeled negative control to determine appropriate settings for the flow cytometer. Create a dot-plot for detection of the forward-scattering and side-scattering signals of the cell population and set an appropriate gate excluding debris and aggregated cells (usually less than 5% of the sample). Create a second dot-plot a b for detection of the antigen binding and IgG expression Q2 Q2 Q1 5 5 Q1 10 10 fluorescent emission signals and adjust the settings to ensure that the double-negative control populations fall in the 4 4 10 10 appropriate quadrant (Fig. 3a).



PROTOCOL

5

10

Q1

Q2

4

10

3

10

2

10

Q3

Q4

10

2

10

3

10

4

10

5


NATURE PROTOCOLS | VOL.3 NO.11 | 2008 | 1771

PROTOCOL 20| Load the positive control IgG and ensure that the gates are set properly and that IgG expression and affinity signals are being properly detected (Fig. 3b). ? TROUBLESHOOTING


21| Load library cells and draw an appropriate sort gate in the double-positive quadrant to isolate cells that are positive for both antigen binding and IgG expression. Typically, 70% of the clones in a mouse immune library express full-length IgG as evidenced by immunoblotting of randomly picked clones as well as by DNA sequencing24. Among library cells exposed to an antigen in round one of FACS selection, B0.1–1% of the cells fall into the double-positive quadrant (Q2), indicating both expression and affinity. For the first round of sorting, it is customary to be conservative to ensure isolation of all potentially unique binders. Therefore, set a gate that will collect B5% of the total population of cells (Fig. 3c). As the population becomes enriched during subsequent rounds of sorting, a tighter sort window can be drawn, collecting the top 0.5–1% of cells (Fig. 3d). ? TROUBLESHOOTING 22| Perform FACS at rates high enough to minimize the abort rate. Rates of 20,000 s1 are typically used for a FACSAria flow cytometer and 40,000 s1 for a MoFlo flow cytometer. m CRITICAL STEP It is recommended to sort tenfold more cells than the number of transformants to maximize the chances of full coverage of the library diversity. However, time constraints limit the fold coverage for exceedingly large libraries X109 variants. 23| Collect the sorted spheroplasts and immediately resort them on the flow cytometer using the same collection gate used for the initial sort. For better selectivity, we recommend resorting the collected spheroplasts immediately after the initial FACS. As no additional probe is provided, only clones exhibiting slow dissociation rates will endure the second selection cycle. During the resort, a higher percentage of the labeled spheroplasts are present in the sort gate compared with the original sort. Recovery of the spheroplasts following resorting concludes one round of FACS. For the subsequent rounds of FACS, it is recommended to sort 10–100 the number of events resorted in the previous round. ? TROUBLESHOOTING 24| Collect the resorted spheroplasts in a microcentrifuge tube. m CRITICAL STEP It is recommended to immediately proceed to PCR recovery of the IgG genes from the collected spheroplasts (Step 25). PCR recovery of sorted spheroplasts and recloning of Ig genes for subsequent rounds of FACS sorting 25| Dilute the resorted spheroplast sample 20-fold in sterile distilled deionized H2O and PCR-recover a fragment corresponding to the Vk-Ck-VH sequence from DNA plasmid pMAZ360-IgG of sorted cells using primers 5¢ VL library amplifier and 3¢ VH library amplifier. m CRITICAL STEP In the course of FACS sorting, recovered cells are collected at a pace of 500–700 events per ml. Hence, for libraries of B109 variants, following the first round of sorting, the recovered spheroplasts are collected in several milliliters of PBS buffer (the FACS sheath fluid). We have found that PCRs carried out in the presence of PBS fail to consistently generate a PCR product. However, dilution of the recovered spheroplast sample 20 with sterile distilled deionized H2O circumvents this problem. For recovered samples of less than 0.2 ml, we recommend to dilute the sample 20 with sterile distilled deionized H2O, whereas for large volume samples, it is recommended to concentrate the cells either by filtration or centrifugation. 26| For PCR, combine the following components in a 100-ml PCR tube: Component

Volume (ll)

100 sorted spheroplasts in PBS 10 ThermoPol Buffer dNTP mix (10 mM each) 5¢ Vk library amplifier primer (50 mM) 3¢ VH library amplifier primer (50 mM) Taq DNA polymerase (5 U ml1)

5 10 2 1 1 1

Final concentration 5 1 (200 mM) (0.5 mM) (0.5 mM) (0.05 U ml1)

m CRITICAL STEP Utilizing Vent polymerase instead of Taq polymerase results in poorer recovery. 27| Amplify DNA in a thermocycler using the following PCR program: Cycle number

Denaturation

Annealing

Polymerization

1 2–30 31

95 1C for 10 min 1 min at 94 1C —

— 1 min at 55 1C —

— 1 min and 40 s at 72 1C 5 min and 40 s at 72 1C

’ PAUSE POINT Store PCR samples at 4 1C overnight or at 20 1C indefinitely. 1772 | VOL.3 NO.11 | 2008 | NATURE PROTOCOLS

PROTOCOL 28| Separate the PCR product on a 1% (wt/vol) agarose gel for 30 min at 120 V. The fragment corresponding to Vk-Ck-VH is B1,300 bp in size. ? TROUBLESHOOTING 29| Excise the bands of the appropriate size and extract-purify the DNA from the gel using Zymoclean gel DNA recovery kit according to the protocol supplied by the manufacturer. ’ PAUSE POINT Store the purified PCR product at 20 1C indefinitely.


30| Digest the Vk-Ck-VH gene segment and plasmid pMAZ360-IgG with restriction enzymes NcoI and HindIII for 2 h at 37 1C according to the manufacturer ’s instructions. 31| Separate the reaction mixtures on a 1% (wt/vol) agarose gel, excise the corresponding digested fragments with an approximate size of B1,150 bp and gel-purify the DNA from the gel as described in Step 29. ’ PAUSE POINT Store the digested DNA products at 20 1C indefinitely. 32| Ligate 100 fmol of digested pMAZ360-IgG plasmid with 200 fmol of the digested Vk-Ck-VH fragment in a total volume of 20 ml at 25 1C for 4 h using T4 DNA ligase according to the manufacturer ’s instructions. 33| Heat-inactivate the reaction tube for 10 min at 70 1C and then desalt the ligation product on a nitrocellulose membrane for 2 h at room temperature. ’ PAUSE POINT Store the desalted ligation product at 20 1C indefinitely. 34| Transform the ligation product into E. coli JUDE-1 electrocompetent cells carrying plasmid pBAD33-NlpA-ZZ (for generation of electrocompetent JUDE-1 E. coli, please refer to Box 1). Mix 200 ml of electrocompetent cells with a total of 400 ng of ligated DNA in prechilled 0.2-cm cuvettes and apply a pulse at the setting of 25 mF, 2.5 kV, 200 O using Gene Pulser. This should give rise to B5 107 transformants per electroporation. 35| Immediately add 2 ml of SOC medium, transfer the mixture into a sterile 15-ml Falcon tube and incubate at 37 1C for 1 h. 36| Spread transformants on 2xYTGAC 600 cm2 plates and incubate overnight at 30 1C. 37| Scrape the cells and transfer into a sterile tube with LB medium supplemented with 100 mg ml1 ampicillin, 30 mg ml1 chloramphenicol and 2% (wt/vol) glucose and vortex vigorously. ’ PAUSE POINT Freeze aliquots of cells after adding glycerol to the cultures to a final concentration of 15% (vol/vol) in a sterile 2-ml cryogenic vials and store at 80 1C indefinitely. 38| For subsequent rounds of FACS sorting, inoculate 100 ml of TB medium supplemented with 100 mg ml1 ampicillin, 30 mg ml1 chloramphenicol and 2% (wt/vol) glucose with fresh transformants or an aliquot of glycerol stock cells to give a starting OD600 of 0.2. 39| Repeat Steps 1–38 until the population is enriched for double-positive cells. Enrichment is determined by an increase in the percentage of events falling into the double-positive quadrant monitoring both expression and affinity (compare Fig. 3c with Fig. 3d). Typically, this requires 3–5 rounds of FACS selection. ? TROUBLESHOOTING

BOX 1 | PROTOCOL FOR PREPARATION OF ELECTROCOMPETENT JUDE-1 E. COLI CELLS CARRYING PLASMID pBAD33-NlpA-ZZ (a) Pick a single selected colony and inoculate in 5 ml of SOB medium and grow for 16 h at 37 1C and 250 r.p.m. in a shaker. (b) Inoculate 0.5 liters of SOB medium with 5 ml of the fresh overnight culture. (c) Grow cells at 37 1C and 250 r.p.m. to an OD600 of 1.0. (d) Chill the cells on ice for 30 min and then centrifuge the cells at 4,500g for 15 min at 4 1C. (e) Decant the supernatant and resuspend the pellet in a total of 0.5 liters of ice-cold sterile distilled deionized H2O. (f) Centrifuge as in Step (c), and resuspend the pellet in a total of 250 ml of ice-cold sterile distilled deionized H2O. (g) Centrifuge as in Step (c), and resuspend the pellet in a total of 50 ml of ice-cold sterile distilled deionized H2O. (h) Centrifuge as in Step (c), and resuspend the pellet in a total of 1.5 ml of ice-cold sterile distilled deionized H2O and use within 2 h. The cells should preferably give 1011 CFU mg1 DNA using 10 pg of supercoiled pUC18. ’ PAUSE POINT For long-term storage, resuspend the cell pellet of Step (f) in ice-cold sterile distilled deionized H2O containing 10% (vol/vol) glycerol, aliquot (200 ml) in 2 ml of sterile cryogenic vials, freeze on dry-ice and keep at 80 1C until required.


PROTOCOL Screening of clones by ELISA 40| Following several rounds of FACS resulting in increased fluorescent signal for affinity and expression, individual clones can be selected at random and tested for antigen binding by ELISA. For this, ligate the recovered Vk-Ck-VH gene segment from the last round of FACS into pMAZ360-IgG expression vector and transform as in Step 34 into fresh E. coli JUDE-1 cells not carrying plasmid pBAD33-NlpA-ZZ. This allows for the expression of soluble nonanchored IgG antibodies.


41| Spread serial dilutions of the transformants on 2xYTGA plates and incubate overnight at 30 1C. m CRITICAL STEP Plating serial dilutions of the transformants on several plates is essential for obtaining plates with separated individual colonies. 42| Pick individual colonies and inoculate into sterile round-bottomed 96-well plates containing 200 ml of LB medium supplemented with 100 mg ml1 ampicillin and 2% (wt/vol) glucose and grow overnight at 30 1C and 150 r.p.m. on a shaker platform. These plates will serve as master plates for subsequent evaluation of potential candidate binders. 43| The next day, inoculate fresh round-bottomed 96-well plates containing 190 ml of TB medium supplemented with 100 mg ml1 ampicillin and 2% (wt/vol) glucose with 10 ml of the overnight culture and grow for 3 h at 30 1C and 150 r.p.m. on a shaker platform. ’ PAUSE POINT Viable cells can be recovered from the master plates for up to 2 weeks of storage at 4 1C. For longer storage of up to 2 years, glycerol stocks of the master plates should be prepared by adding glycerol to the plate (20% (vol/vol) final concentration) and placing in 80 1C. 44| Centrifuge the plates for 15 min at 4,500g at 4 1C and decant the supernatant. 45| Resuspend the cell pellet in TB medium supplemented with 100 mg ml1 ampicillin, 1 mM IPTG and grow for 16 h at 25 1C and 150 r.p.m. on a shaker platform. m CRITICAL STEP It is recommended to begin Step 48 in parallel with Step 45 to save time. 46| Centrifuge the plates as in Step 44 and lyse the cell pellets by resuspending in 200 ml of 20% (vol/vol) BugBuster HT in PBS, and then incubate the plates at room temperature for 1 h at 150 r.p.m. 47| Centrifuge the plates as in Step 44 and transfer 150 ml of the soluble cell extracts into fresh 96-well plates. ’ PAUSE POINT Store the plates at 4 1C until further use and up to a maximum of 2 weeks. 48| Coat ELISA plates with 100 ml of the experimental antigen in each well at a final concentration of 5 mg ml1 in PBS and incubate at 4 1C for 16 h. In addition, coat an additional ELISA plate with a control antigen to eliminate clones producing nonspecific antibodies that react with multiple unrelated antigens. 49| Decant the solution from the ELISA plates and wash two times with PBST. 50| Block the ELISA plates for 2 h at room temperature with 250 ml of PBSM-blocking buffer. 51| Wash three times with PBST and then apply 75 ml of PBSM. 52| Transfer 25 ml of soluble cell extract prepared in Step 47 into the ELISA plates and incubate for 1 h at room temperature. 53| Wash three times with PBST. 54| Apply 100 ml of HRP-conjugated goat anti-human IgG antibodies (1/10,000 dilution in PBSM) and incubate for 1 h at room temperature. 55| Wash three times with PBST. 56| Develop the ELISA by applying 100 ml of the chromogenic HRP substrate, TMB. 57| Wait for blue color to develop (1–30 min) and terminate color development by applying 50 ml of 1 M H2SO4 (color will turn to yellow). ? TROUBLESHOOTING 58| Read the plates at 450 nm using a UV-vis plate reader. Select clones that exhibit the highest ELISA signal (at least five times above background) for further characterization. Expression and purification of soluble full-length IgG antibodies 59| Inoculate a single selected colony of JUDE-1 cells harboring plasmid pMAZ360-IgG in 10 ml of LB medium supplemented with 100 mg ml1 ampicillin and 2% (wt/vol) glucose and grow for 16 h at 30 1C and 250 r.p.m. in a shaker. 1774 | VOL.3 NO.11 | 2008 | NATURE PROTOCOLS

PROTOCOL 60| The next day, dilute the culture into 200 ml of TB medium supplemented with 100 mg ml1 ampicillin and 2% (wt/vol) glucose to give a starting OD600 of 0.2 and grow the culture at 30 1C and 250 r.p.m. to an OD600 of 1.0 (approximately 3–4 h). 61| Centrifuge at 4,500g for 10 min at 4 1C and decant the supernatant. 62| Resuspend the pellet in TB medium supplemented with 100 mg ml1 ampicillin and 1 mM IPTG and grow for 16 h at 25 1C and 250 r.p.m. 63| The next day, centrifuge the overnight-induced culture at 4,500g for 10 min at 4 1C and decant the supernatant. 64| Resuspend the pellet in 20 ml of BugBuster HT and rotate for 2 h at room temperature.


65| Clarify cell extract by centrifugation at 18,000g for 20 min at 4 1C. 66| Dilute the clarified supernatant 1:1 with loading buffer. 67| Equilibrate 1 ml of protein A sepharose beads by washing with 50 ml of washing buffer. 68| Mix the diluted clarified supernatant with the equilibrated protein A beads and rotate for 1 h at room temperature. 69| Apply the mixture into a 5-ml disposable column and allow packing by gravity flow. 70| Wash extensively with washing buffer by gravity until no reading is obtained by fractions checked on a spectrophotometer at A280. 71| Elute bound IgG antibody with elution buffer by gravity flow and collect 0.5-ml fractions into microcentrifuge tubes containing 150 ml of neutralization buffer. 72| Analyze protein-containing fractions on a 12% (wt/vol) SDS-polyacrylamide gel by electrophoresis under nonreducing conditions. 73| Combine fully assembled IgG containing fractions and dialyze against 5 L PBS for 16 h at 4 1C using slide-A-lyser dialysis cassette, 10,000 MWCO, according to the manufacturer’s instructions. ’ PAUSE POINT Filter-sterilize and store at 4 1C for up to 3 months.

TIMING Steps 1–24, one round of FACS selection—library growth, spheroplasting, labeling and FACS sorting: 2 d Steps 25–37, PCR recovery, cloning and transformation: 2 d Step 40–58, ELISA screenings: 3 d Steps 59–73, expression and purification of soluble IgG antibodies: 4 d ? TROUBLESHOOTING Troubleshooting advice can be found in Table 1. TABLE 1 | Troubleshooting table. Step 5

Problem Low IgG expression levels

Possible reason Degraded IPTG

Solution Always induce with freshly prepared IPTG

20

Low fluorescent emission signal for positive-control IgG expression levels

Poor IgG induction. Error in protocol. Labeling concentration is too low

See Troubleshooting solution for Step 5. Test for the expression of IgG by running a western blot. Different probes will require optimization of labeling concentrations. If the probe recommended in this protocol is not used, the concentration may have to be altered and compared with cells not expressing anything to ensure that nonspecific binding is not occurring

Low fluorescent emission signal for positive-control IgG antigen binding

Labeling concentration is too low. Labeling time is too short

Ensure that the labeling concentration is at least equivalent to the affinity of the antibody tested. Increase probe concentration and compare with cells not expressing anything to ensure that nonspecific binding is not occurring. Increase the incubation time (continued) NATURE PROTOCOLS | VOL.3 NO.11 | 2008 | 1775

PROTOCOL


TABLE 1 | Troubleshooting table (continued). Step

Problem

Possible reason

Solution

21

Low fluorescent emission signal for library IgG expression levels

Poor IgG induction. Error in protocol. Library may contain a high percentage of clones with early termination codons or frameshifts

See Troubleshooting solution for Steps 5 and 20. Ensure that the positive-control IgG is labeling correctly. Sequence several clones from the library to determine if there is a high percentage of clones with early termination codons or frameshifts

Low fluorescent emission signal for library IgG antigen binding

Very few clones in the library are likely to bind the antigen, so they will not be detectable during early rounds of FACS. Spectral overlap with the fluorophore used to detect expression levels. Labeling concentration is too low. Antigen is not properly conjugated

See Troubleshooting solution for Step 20. Ensure that the positive-control IgG is labeled correctly. Ensure that the emission wavelength of the fluorophore used to detect affinity is not overlapped by the one used to detect expression (see Step 15 CRITICAL STEP for details). Continue with several rounds of FACS to determine if the affinity signal increases. Test the conjugated antigen to ensure that both the antigen and the fluorophore are present

Event rate during resort is much lower than during the sort

Cells collected are diluted in the sheath fluid and result in low event rates during the resort (o1,000 events per second compared with 410,000)

Sample tube versus sheath fluid pressure differential can be increased, so the sample flow is increased, but this will only increase the event rate to a certain level

Fluorescent signals decrease at lower event rates

Typical flow cytometry phenomena

Scan the control samples at the same lower event rate as the sorted cells and adjust the sorting gates to keep the percentages consistent. Apply these adjusted gates for resorting

Number of cells collected following the resort are much lower than that required to cover library diversity following round of sorting

See Troubleshooting advice for Step 21. The sample collected following sorting should result in higher percentages of events falling into the original gate set for high affinity and expression, but this increase will be much lower in the earlier rounds of sorting

See Troubleshooting advice for Step 21. Initially, sort a 10- to 50-fold excess before performing the resort. This number can be decreased during subsequent rounds of FACS if enrichment is occurring

28

No PCR product

Resorted cells were not diluted in deionized H2O before conducting the PCR. The wrong polymerase was used

Ensure that the spheroplasts are diluted in deionized H2O (see Step 25 CRITICAL STEP for details). Ensure that Taq polymerase was used instead of Vent polymerase (see Step 26 CRITICAL STEP for details)

39

No enrichment for antigen binding

IgG affinity is too low to detect a signal at the concentrations used

Increase the antigen concentration and repeat the protocol. Attempt to use the antigen conjugated to a fluorophore with a higher extinction coefficient and/or quantum yield to increase the signal

57

No detectable ELISA signal

No specific binders or binders are specific to the conjugated form of the antigen only. Antibodies are not expressed at high enough levels with respect to their affinity

Test clones (or final round of FACS) specificity by flow cytometry using the original antigen probe used for FACS as well as the antigen conjugated to another fluorophore or biotin (to be used with streptavidin fluorophore conjugate for flow cytometric detection), as the antibody specificity may be conjugate specific. The ELISA should also be performed using plates coated with the conjugated antigen used for FACS. Clones may have to be expressed in larger volumes and the sample concentrated before performing the ELISA for IgG concentration to be in the range of its affinity

23



PROTOCOL ANTICIPATED RESULTS This protocol provides guidelines for the isolation of full-length IgG antibodies from repertoire libraries expressed in E. coli by FACS selection. Typically, immune libraries with a diversity of B107 clones should yield a double-positive population after approximately three rounds of FACS as indicated by the appearance of a diagonal population in the double-positive quadrant (Fig. 3d). If this does not occur, increasing antigen concentration along with additional rounds of screening should be considered. Following several rounds of successful enrichment, monoclonal clones conferring the highest ELISA signal in antigen binding screening can be expressed in a soluble form at yields of 0.5–3 mg liter1 in standard flasks and at yields of up to 50 mg liter1 using fermentation. Higher yields exceeding 1 g liter1 can be obtained by additional fermentation optimization33. The protocol described in this article can be adapted for the isolation of specific clones from naive repertoires. However, in this case, it may be more difficult to obtain a signal in the double-positive quadrant after as little as three rounds of selection, so additional rounds of FACS screening and regrowth may be required. This is a result of a lower total number of antigenbinding clones present in the initial library combined with a larger initial library size. The number of rounds required to obtain reasonable enrichment in most cases will depend on the nature of the antigen and will vary with each antigen. Another parameter to be considered before adapting this protocol for selection of naive libraries is repertoire size. Sorting a library greater than 5 109 clones solely by FACS would be time consuming and challenging. Commercially available flow cytometers are competent for sorting mode of up to 40,000 s1 permitting the scanning of B108 events per hour; hence the screening of libraries larger than 109 is difficult considering that at least tenfold the initial library size should be screened to get satisfactory coverage of the library diversity. Published online at http://www.natureprotocols.com/ Reprints and permissions information is available online at http://npg.nature.com/ reprintsandpermissions/ 1. Imai, K. & Takaoka, A. Comparing antibody and small-molecule therapies for cancer. Nat. Rev. Cancer 6, 714–727 (2006). 2. Kohler, G. & Milstein, C. Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256, 495–497 (1975). 3. Li, J. et al. Human antibodies for immunotherapy development generated via a human B cell hybridoma technology. Proc. Natl. Acad. Sci. USA 103, 3557–3562 (2006). 4. Fishwild, D.M. et al. High-avidity human IgG kappa monoclonal antibodies from a novel strain of minilocus transgenic mice. Nat. Biotechnol. 14, 845–851 (1996). 5. Winter, G., Griffiths, A.D., Hawkins, R.E. & Hoogenboom, H.R. Making antibodies by phage display technology. Annu. Rev. Immunol. 12, 433–455 (1994). 6. Boder, E.T. & Wittrup, K.D. Yeast surface display for screening combinatorial polypeptide libraries. Nat. Biotechnol. 15, 553–557 (1997). 7. Daugherty, P.S., Olsen, M.J., Iverson, B.L. & Georgiou, G. Development of an optimized expression system for the screening of antibody libraries displayed on the Escherichia coli surface. Protein Eng. 12, 613–621 (1999). 8. Lipovsek, D. & Pluckthun, A. In-vitro protein evolution by ribosome display and mRNA display. J. Immunol. Methods 290, 51–67 (2004). 9. Harvey, B.R. et al. Anchored periplasmic expression, a versatile technology for the isolation of high-affinity antibodies from Escherichia coli-expressed libraries. Proc. Natl. Acad. Sci. USA 101, 9193–9198 (2004). 10. Hoogenboom, H.R. Selecting and screening recombinant antibody libraries. Nat. Biotechnol. 23, 1105–1116 (2005). 11. Daugherty, P.S., Iverson, B.L. & Georgiou, G. Flow cytometric screening of cellbased libraries. J. Immunol. Methods 243, 211–227 (2000). 12. Hayhurst, A. & Georgiou, G. High-throughput antibody isolation. Curr. Opin. Chem. Biol. 5, 683–689 (2001). 13. Daugherty, P.S. Protein engineering with bacterial display. Curr. Opin. Struct. Biol. 17, 474–480 (2007). 14. Chao, G. et al. Isolating and engineering human antibodies using yeast surface display. Nat. Protoc. 1, 755–768 (2006). 15. Benhar, I. Design of synthetic antibody libraries. Expert Opin. Biol. Ther. 7, 763–779 (2007). 16. Chen, W. & Georgiou, G. Cell-surface display of heterologous proteins: from highthroughput screening to environmental applications. Biotechnol. Bioeng. 79, 496–503 (2002). 17. Samuelson, P., Gunneriusson, E., Nygren, P.A. & Stahl, S. Display of proteins on bacteria. J. Biotechnol. 96, 129–154 (2002). 18. Francisco, J.A., Earhart, C.F. & Georgiou, G. Transport and anchoring of betalactamase to the external surface of Escherichia coli. Proc. Natl. Acad. Sci. USA 89, 2713–2717 (1992).

19. Chen, G. et al. Isolation of high-affinity ligand-binding proteins by periplasmic expression with cytometric screening (PECS). Nat. Biotechnol. 19, 537–542 (2001). 20. Daugherty, P.S., Chen, G., Olsen, M.J., Iverson, B.L. & Georgiou, G. Antibody affinity maturation using bacterial surface display. Protein Eng. 11, 825–832 (1998). 21. Harvey, B.R. et al. Engineering of recombinant antibody fragments to methamphetamine by anchored periplasmic expression. J. Immunol. Methods 308, 43–52 (2006). 22. Jeong, K.J., Seo, M.J., Iverson, B.L. & Georgiou, G. APEx 2-hybrid, a quantitative protein–protein interaction assay for antibody discovery and engineering. Proc. Natl. Acad. Sci. USA 104, 8247–8252 (2007). 23. Worn, A. & Pluckthun, A. Stability engineering of antibody single-chain Fv fragments. J. Mol. Biol. 305, 989–1010 (2001). 24. Mazor, Y., Blarcom, T.V., Mabry, R., Iverson, B.L. & Georgiou, G. Isolation of engineered, full-length antibodies from libraries expressed in Escherichia coli. Nat. Biotechnol. 25, 563–565 (2007). 25. Nilsson, B. et al. A synthetic IgG-binding domain based on staphylococcal protein A. Protein Eng. 1, 107–113 (1987). 26. Yu, F., Inouye, S. & Inouye, M. Lipoprotein-28, a cytoplasmic membrane lipoprotein from Escherichia coli. Cloning, DNA sequence, and expression of its gene. J. Biol. Chem. 261, 2284–2288 (1986). 27. Yamaguchi, K., Yu, F. & Inouye, M. A single amino acid determinant of the membrane localization of lipoproteins in E. coli. Cell 53, 423–432 (1988). 28. Dane, K.Y., Chan, L.A., Rice, J.J. & Daugherty, P.S. Isolation of cell specific peptide ligands using fluorescent bacterial display libraries. J. Immunol. Methods 309, 120–129 (2006). 29. Akamatsu, Y., Pakabunto, K., Xu, Z., Zhang, Y. & Tsurushita, N. Whole IgG surface display on mammalian cells: Application to isolation of neutralizing chicken monoclonal anti-IL-12 antibodies. J. Immunol. Methods 327, 40–52 (2007). 30. Raju, T.S., Briggs, J.B., Borge, S.M. & Jones, A.J. Species-specific variation in glycosylation of IgG: evidence for the species-specific sialylation and branchspecific galactosylation and importance for engineering recombinant glycoprotein therapeutics. Glycobiology 10, 477–486 (2000). 31. Radaev, S. & Sun, P.D. Recognition of IgG by Fcgamma receptor. The role of Fc glycosylation and the binding of peptide inhibitors. J. Biol. Chem. 276, 16478–16483 (2001). 32. Jefferis, R. & Lund, J. Interaction sites on human IgG-Fc for FcgammaR: current models. Immunol. Lett. 82, 57–65 (2002). 33. Simmons, L.C. et al. Expression of full-length immunoglobulins in Escherichia coli: rapid and efficient production of aglycosylated antibodies. J. Immunol. Methods 263, 133–147 (2002).
