Trees DOI 10.1007/s00468-009-0328-x
ORIGINAL PAPER
Effect of chilling on photosynthesis and antioxidant enzymes in Hevea brasiliensis Muell. Arg. Jing Mai Æ Ste´phane Herbette Æ Marc Vandame Æ Boonthida Kositsup Æ Poonpipope Kasemsap Æ Eric Cavaloc Æ Jean-Louis Julien Æ Thierry Ame´glio Æ Patricia Roeckel-Drevet
Received: 24 October 2008 / Revised: 12 March 2009 / Accepted: 18 March 2009 Ó Springer-Verlag 2009
Abstract The aim of the present study was to assess the tolerance of Hevea brasiliensis to chilling temperatures since rubber production has been extended to sub-optimal environments. PB260 clone was used to analyze the responses of leaves chilled at 10°C during 96 h, as well as their recovery at 28°C. Some key parameters were used to evaluate photosynthetic apparatus functioning, membrane damage (electrolyte leakage) and oxidative stress. A shortterm response versus a long-term one have been recorded, the time point of 24 h, when stomata closure was effective, being the border between the two responses. Pn decreased dramatically at 1 h, and Fv/Fm was slightly affected. NPQ reached its maximal level between 4 and 7 h. Lipid peroxidation and membrane lysis were observed between 48
Communicated by W. Bilger. J. Mai S. Herbette J.-L. Julien P. Roeckel-Drevet (&) UMR547 PIAF, Universite´ Blaise Pascal, 24 av des Landais, 63177 Aubie`re, France e-mail:
[email protected] M. Vandame T. Ame´glio UMR547 PIAF, INRA, 134 av du Bre´zet, 63100 Clermont-Ferrand, France B. Kositsup CIRAD, UPR Ecosyste`mes de plantations, Research and Development Building, Kasetsart University, Chatuchak, Bangkok 10900, Thailand B. Kositsup P. Kasemsap Department of Horticulture, Faculty of Agriculture, Kasetsart University, Bangkok 10900, Thailand E. Cavaloc Michelin, CPN/A, Ladoux, 63040 Clermont-Ferrand Cedex 9, France
and 96 h. Activities of antioxidant enzymes increased, along with the induction of antioxidant gene expression. Finally, the plants were capable to recover (net photosynthetic rate, photochemical efficiency, antioxidant enzymes activities) when placed back to 28°C showing that PB260 can withstand long-term chilling. Keywords Chlorophyll fluorescence Lipid peroxidation Net photosynthetic rate Oxidative stress Stomatal conductance Hevea brasiliensis
Introduction Rubber tree (Hevea brasiliensis Muell. Arg.) is a commercial latex-producing species belonging to the Euphorbiaceae family, that originates from the Amazonian rain forest (Wycherley 1992). It has been spread over the whole tropical belt to guarantee the worldwide production of natural rubber. A mean annual temperature around 28 ± 2°C with a diurnal variation of about 7°C is the optimal temperature requirement for rubber (Rao et al. 1998). Many reasons (i.e. bioaggressors and international rubber demand) prompted attempts to cultivate rubber tree in marginal environments. For instance, in South America, the yield of rubber is limited by an Ascomycota fungus, Microcyclus ulei, causing the devastating South American Leaf Blight (SALB). A promising strategy to thwart M. ulei is to develop Hevea culture in dryer and colder areas (Jacob et al. 1999). The increase in international rubber demand and competition by other agricultural crops also stimulated the rubber culture under marginal conditions (Pushparajah 1983). As a consequence, rubber production has been extended to many sub-optimal environments worldwide during the late 1970s, such as in northeast India, highlands
123
Trees
and coastal areas of Vietnam, southern China and the southern plateau of Brazil (Raj et al. 2005), all the areas having varied climatic constraints. Although these areas satisfy the basic requirements for rubber most of the time, there are also stress situations such as low temperature, dry periods, and typhoons (Dey et al. 1998; Priyadarshan and Goncalves 2003). Besides the damages and the low growth caused by the lowest temperatures, each year the production of latex is stopped for a period of 1–3 months in the coldest areas (Rao et al. 1998; Jacob et al. 1999). Although considerable progress has been made to produce high latex yielding clones in the past, rubber breeding and selection has now been re-emphasized to increase resistance to biotic and abiotic stresses (Venkatachalam et al. 2006). In particular, selection for low temperature tolerance is necessary for the extension of Hevea culture to marginal areas where SALB is not infecting rubber trees. The physiological dysfunctions (i.e. alteration of metabolic processes, decrease in enzymatic activities and reduction of photosynthetic capacity) experienced by tropical and subtropical native plants when exposed to nonfreezing temperatures below 12°C for periods in excess of a critical period of time is called chilling injury (Allen and Ort 2001). These impairments are frequently related to changes in membrane permeability as cell membrane systems are the primary sites of cold injury (Thomashow 1999). Membrane damage following chilling has been evaluated through measurements of the rates of solute and electrolyte leakage (Simon 1974). Lipid peroxidation in membranes is also a possible cause for loss of fluidity and function (Barclay and McKersie 1994). Cold stress enhances the production of free radicals that provoke the formation of lipid radicals which form covalent bonds, thus rigidifying the membrane (Alonso et al. 1997). Malondialdehyde (MDA) is one of the final products of stressinduced lipid peroxidation of polyunsaturated fatty acids (Leshem 1987) and it is considered as a marker for cold sensitivity (Queiroz et al. 1998; Campos et al. 2003). Regarding photosynthesis, chilling can disrupt major components such as the thylakoid electron transport, the carbon reduction cycle and the stomatal conductance (for review see Allen and Ort 2001). Chlorophyll fluorescence measurements have been commonly used to investigate the effect of low temperature on the functioning of the photosynthetic apparatus (Fracheboud et al. 1999; Tambussi et al. 2004). Chilling temperatures inhibit leaf net photosynthetic rate (Pn) which is a complex parameter resulting from many partial photosynthetic processes including photochemical activities; the common interpretation is that the excess of absorbed energy is mainly due to the lower efficiency of secondary, ‘‘dark’’ photosynthetic reactions. The excess of energy in the photosynthetic apparatus causes accumulation of reactive oxygen species (ROS) and
123
results in the oxidative stress if ROS are not efficiently scavenged (Asada 1996). To cope with elevated levels of ROS, aerobic cells have evolved a range of non-enzymatic and enzymatic antioxidant systems. Antioxidant enzymes have been shown to tolerate low temperature stress (McKersie et al. 1993; Prasad et al. 1994; Baek and Skinner 2003). In the present study, to get insight into the effect of chilling temperatures in Hevea, we have analyzed changes in various physiological, biochemical and molecular parameters accompanying the responses of Hevea leaves chilled at 10°C during 96 h, as well as their recovery at 28°C. To get the most complete view of the chilling effects, a series of parameters known to be differently affected by the chilling temperatures have been monitored. Parameters followed, such as quenching of chlorophyll fluorescence, net photosynthetic rate, stomatal conductance, electrolyte leakage, MDA contents, as well as assays of antioxidant enzymatic activities and analyses of antioxidant gene expression via quantitative RT-PCR allowed to evaluate the photosynthetic activity, the functioning of the photosynthetic apparatus, the level of oxidative stress and the antioxidant system in cold-stressed Hevea plants.
Materials and methods Plant material and growth conditions Hevea brasiliensis PB260, one of the most planted clones in the last decade, was used in the study. Plants were potted in large containers (33 l) filled with a commercial soil mixture (Humustar, Champeix, France) and supplemented with a algospeedÒ fertilizer solution (1 g l-1, Algochimie, Chateau-Renault, France) containing N:P:K:Mg in the ratio 17:7:22:3. Plants were grown in a greenhouse at 28°C/20°C (day/night) under a 12 h photoperiod (200 lmol photons m-2 s-1) at a relative humidity of 80%. Clones showing three whorls of leaves were placed in a growth chamber under 12 h photoperiod (250 lmol photons m2 s-1) at 28 ± 1°C for at least 3 days prior to cold treatment and recovery experiments. The cold treatment was imposed by moving plants to a growth chamber at 10°C, 1 h after the beginning of the day period. Light characteristics were not changed. Depending upon the experiments, chilling stress was imposed for the duration of 4, 24, 96 or 192 h. Chilling exposures were conducted under a 12 h photoperiod. For recovery experiments, the plants were placed back in the initial growth chamber at 28°C. The 12 h photoperiod was respected. All the measurements of various parameters (described below) were performed on fully expanded leaves of the second whorl.
Trees
Measurements of chlorophyll fluorescence, photosynthesis and stomatal conductance In vivo chlorophyll fluorescence was recorded using a portable chlorophyll fluorometer (Mini-Pam, Walz, Effeltrich, Germany). Fluorescence was first measured after 1 h light-acclimation. Dark acclimation was done afterwards for the second set of fluorescence measurements. The leaves were adapted in darkness for 10 min to allow relaxation of fluorescence quenching associated with thylakoid membrane energization (Krause et al. 1983). Minimal fluorescence (F0) and maximal fluorescence (Fm) were obtained by imposing a 1 s saturating flash to the leaf in order to reduce all the PSII reaction centers. The maximum potential photochemical efficiency of PSII was expressed as the ratio Fv/Fm = (Fm - F0)/Fm (Butler 1978). Similarly, F0 m was obtained on light-acclimated leaves by imposing the same saturating flash. Non-photochemical quenching (NPQ) was estimated as NPQ = (Fm/ F0 m) - 1 (Bilger and Bjo¨rkman 1990). Measurements of net photosynthetic rate and stomatal conductance were made with a portable open gas exchange measurement system (LI-6400, Li-cor system USA) at photon flux density of 1,200 lmol m-2 s-1 (using a LED radiation source) and CO2 concentration of 350 lmol mol-1. These measurements were performed in parallel with the chlorophyll fluorescence recordings. Electrolyte leakage To evaluate membrane injury, three freshly cut leaf disks of homogenous size (1.5 cm2) excised from leaves of homogenous size and age were immersed in 15 ml flasks of demineralised water for 24 h at room temperature before the first electrolytic conductivity measurement (C1), which was performed with conductimeter 315i (WTW, Weilheim, Germany). Total conductivity (C2) was obtained after autoclaving of the flasks (120°C, 30 min). The relative electrolyte leakage was calculated as (C1/C2)% (Herbette et al. 2005). Estimation of lipid peroxidation The MDA content of leaves was determined using a thiobarbituric acid (TBA) reaction described by Hodges et al. (1999). Plant tissue samples were homogenized with inert sand in 1:25 [g fresh weight (FW): ml] 80:20 (v:v) ethanol:water. A 1 ml aliquot of appropriately diluted sample was added to a test tube with 1 ml of either (i) -TBA solution comprised of 20.0% (w/v) trichloroacetic acid and 0.01% butylated hydroxytoluene, or (ii) ?TBA solution containing the above plus 0.65% TBA. Samples were then mixed vigorously, heated at 95°C in a block heater for
25 min, cooled, and centrifuged at 3,0009g for 10 min. Absorbances were read at 440, 532, and 600 nm. MDA equivalents were calculated as follows (Hodges et al. 1999). 1. 2. 3.
[(Abs 532?TBA) - (Abs 600?TBA) - (Abs 532-TBA - Abs 600-TBA)] = A [(Abs 440?TBA - Abs 600?TBA)0.0571] = B MDA equivalents (nM ml-1) = (A - B/eMDA) 106 with eMDA = 157,000 M-1 cm-1
Protein extraction and antioxidant enzymes activities Leaf samples were ground in liquid nitrogen and homogenized in extraction medium (100 mM HEPES–NaOH, pH 7.5 for all enzymatic assays except for SOD assay where K-Phosphate pH 7.5 extraction medium was used), using 200 mg FW per ml of buffer. The samples were then centrifuged at 5,0009g at 4°C for 10 min. The supernatant was used for the protein and enzyme analysis. Protein concentration was determined by the method of Bradford modified by Stoscheck (1990). Ascorbate peroxidase (APX, EC 1.11.1.11) activity was assayed according to the protocol of Foyer and Halliwell (1976). 50 ll of extract was incubated with 950 ll of mix buffer (100 mM HEPES–NaOH, pH 7.5, 50 mM ascorbate) for 5 min at 25°C. The reaction was started by adding 50 ll 10 mM H2O2. APX activity was determined as a decrease in absorbance at 290 nm for 3 min due to ascorbate oxidation. APX activity was calculated using an extinction coefficient of 2.8 mM-1 cm-1. Glutathion reductase (GR, EC1.6.4.2) activity was determined as a decrease in absorbance at 340 nm for 3 min due to oxidation of NADPH, by using the method of Foyer and Halliwell (1976) modified as follows. 50 ll of extract was incubated with 950 ll of mix buffer (50 mM HEPES–NaOH, pH 7.5, 5 mM EDTA, 3 mM MgCl2) for 5 min at 25°C. Before starting the reaction, 50 ll of NADPH 3 mM was added. After 2 min the reaction was started by adding 10 ll of GSSG 0.1 M. GR activity was calculated using the extinction coefficient 6.2 mM-1 cm-1. Dehydroascorbate reductase (DHAR EC 1.8.5.1) activity was assayed by the increase in absorbance for 3 min at 265 nm using a modified protocol of Guo et al. (2006). 50 ll of extract was incubated with 950 ll of mix buffer (100 mM HEPES–NaOH, pH 7.5, 10 mM EDTA) for 5 min at 25°C. The reaction was started by adding 10 ll GSH (3 mM). DHAR activity was calculated using the extinction coefficient 1.4 mM-1 cm-1. Superoxide dismutase (SOD, EC 1.15.1.1) activity was determined by using a modified protocol of McCord and Fridovich (1969). The activity was assayed in a reaction mixture containing 50 mM K-phosphate (pH 7.5), 4 mM xanthine, 0.025 U xanthine oxidase and 50 ll extract. After 5 min at 25°C,
123
Trees
the reaction was started by adding the nitroblue tetrazolium (NBT) 0.5 mM. One unit of SOD activity was defined as the amount of crude enzyme extract required to cause 50% inhibition of the rate of NBT reduction at 560 nm. For each enzyme activity assayed, corrections were made by following the same steps without extract. Cloning, sequencing of antioxidant enzyme cDNA from Hevea brasiliensis RNAs were first isolated from leaves using the method described by Chang et al. (1993). Final RNA pellets were resuspended in RNase-free water and stored at -80°C. First strand cDNAs were synthesized by reverse transcription using 2 lg of total RNA in a final reaction volume of 20 ll TM using the Super Script III first strand synthesis system for RT-PCR (Invitrogen, Paisley, UK) according to the manufacturer’s instructions. For chloroplast Cu–Zn superoxide dismutase (SOD), dehydroascorbate reductase (DHAR) and glutathione reductase (GR), since no Hevea sequences were available in Genbank, PCR amplifications were performed as described by Drevet et al. (1995) using degenerated
primers designed in highly conserved protein domains found among known plant genes (Table 1). The amplified products were ligated into PGEM-T vector (Promega, Charbonnie`res, France), transformed into DH5a E. coli strain and sequenced. The sequences have been submitted to Genbank (http:// www.ncbi.nlm.nih.gov/BankIt/) and can now be found under the following accession numbers: EU 526131, EU 526129, and EU 526130 for Cu–Zn SOD, GR and DHAR, respectively. The sequences permitted the choice of genespecific primers which are presented in Table 2. For ascorbate peroxidase (APX) and glutathione peroxidase (GPX), Hevea sequences were available in Genbank. The primers designed from these sequences are described in Table 2. Expression analyses by quantitative real-time PCR The resulting single stranded cDNA was thereafter used as a template in quantitative real-time PCR (QPCR) reactions. The cDNA was normalized in dependence of the level of constitutively expressed 18S rRNA (Nualpun et al. 2005). QPCR reactions were carried out with gene-specific
Table 1 Degenerated primers used in cloning of genes coding for antioxidant enzymes in Hevea brasiliensis Identification
Sequence (50 ? 30 )
Dehydroascorbate reductase
Forward 50 GACTGYCCNTTTWSCCAA30 Reverse 50 CCABTTCTTRWARTGHCC30
Glutathione reductase
Forward 50 GCHGTDTTYTGYATHCC30
Cu–Zn superoxide dismutase
Forward 50 CCRACMACWCCACAWGC30
Reverse 50 CATDGTHCARAAYTCYTC30 Reverse 50 CCGGTGACCTGGGAAAC30 M, R, W, S, Y, H, D, B and N are standard abbreviations for oligo nucleotide synthesis. M = A/C, R = A/G, W = A/T, S = C/G, Y = C/T, H = A/C/T, D = A/G/T, B = C/G/T, N = A/C/G/T
Table 2 Primers used in quantitative real-time PCR in the measurement of the expression of genes coding for antioxidant enzymes in Hevea brasiliensis Identification Ascorbate peroxidase
Sequence (50 ? 30 )
Accession numbers
Forward 50 GAAGGTCGTCTGCCTAATGC30
AF 457210
Reverse 50 TTCCTTCTGTCCAGCCAAG30 Glutathione peroxidase
Forward 50 AGATTCTGGCTTTCCCCTGT30 Reverse 50 GTCCCCAAAAATTCCACCTT30
AF 242650
Dehydroascorbate reductase
Forward 50 CCTGAGAAGGCTTCAGTTGG30
EU 526130
Reverse 50 TAATGCCCCAATGCAATCTC30 Glutathione reductase
Forward 50 GTGTATTCCCACCGTGCTG30 0
Reverse 5 TGAAGAGCAGGCAATAGAGC3 Cu–Zn superoxide dismutase
EU 526129 0
Forward 50 GCAACAATTGCGGATAAACA30
EU 526131
Reverse 50 ACACCACAAGCCAATCTTCC 30 Hevea brasiliensis rRNA18S
Forward 50 CAAAGCAAGCCTACGCTCTG 30 Reverse 50 CGCTCCACCTAAGAACG 30
123
AB 268099
Trees
primers (Table 2) using the following mixture: 2 ll of diluted cDNA, 0.25 ll of diluted SYBR Green (Sigma, St. Louis, USA) (1:1,000 in 25% dimethyl sulfoxide), 1 U of Platinum Taq DNA polymerase (Invitrogen, Paisley, UK) and 200 nM of each gene-specific primer in a final volume TM of 25 ll. QPCR reactions were carried out in a iCycler iQ (Bio-Rad, Hercules, CA, USA). The PCR program was as follows: incubation for 10 min at 95°C, then 10 min at 94°C, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 57°C for 30 s and extension at 72°C for 40 s, followed by melting curve analysis to check specificity of fragment amplification. For each sample, three to five replicates were used for QPCR analysis. The method to calculate the relative expression ratio was described by Pfaffl (2001). Ratio ¼ with
ðEtarget Þ
DCt targetðcontrolsampleÞ
ðEref ÞDCt refðcontrolsampleÞ E = 10ð1=slopeÞ 1
Statistical analysis Two different groups of three plants were used for the chilling time course at 10°C, as well as for the recovery time course at 28°C and for the corresponding control time courses. For MDA one measurement was done on each group of plant, for each time point. For Pn, Gs, enzyme activities and QPCR ratio, two measurements were done on each group of plants for each time point. For Fv/Fm and NPQ, four measurements were done on each group of plants for each time point. For each parameter, ANOVA was performed with the repeated factor ‘‘group’’, and the
fixed factor ‘‘time’’ (Stagraphics Plus version 5.1). When the factor ‘‘time’’ was significant, Fisher LSD tests (P \ 0.05) were performed. When time showed no significant effect (for recovery of Pn after 4 h at 10°C) a unique t test was performed to compare the means at 0 and 24 h of recovery (P \ 0.05). The mean values and standard errors of mean values (SEM) are shown on the figures.
Results Evaluation of photosynthetic capacity and membrane injury during chilling stress The probabilities obtained after ANOVA on Pn, Gs, Fv/Fm, NPQ, MDA and conductivity data are shown in Table 3. The time course of the net photosynthetic rate (Pn), stomatal conductance (Gs) and quantum yield of PSII were followed at 10°C during 192 h. Pn was highly affected when the temperature was lowered from 28 to 10°C, being reduced to approximately one half of the control values after 1 h at 10°C and then decreasing regularly (Fig. 1a). During the same time course, the Gs increased significantly to reach a maximum at 4 h of chilling. A significant decrease was observed after 7 h of chilling (Fig. 1b). From 24 to 192 h, Gs values measured at 10°C were low compared to the values obtained at 28°C. These results indicate that the decrease in net photosynthetic rate is not caused by the closure of stomata, at least during the first 7 h of chilling. We examined changes in Fv/Fm ratio to determine the effect of chilling treatment on the maximum quantum efficiency of PSII photochemistry. Before the chilling
Table 3 Probabilities produced by ANOVA on data sets from Figs. 1, 2, 3, 4, 5, 6 and 7 Pn
Gs
Fv/Fm
NPQ
MDA
Conductivity Fig. 3b
Pn (recovery after 4 h at 10°C) Fig. 4
Pn (recovery after 24 h at 10°C) Fig. 4
Pn (recovery after 96 h at 10°C) Fig. 4
Fig. 1a
Fig. 1b
Fig. 2a
Fig. 2b
Fig. 3a
A (time)
0.0000
0.0000
0.0000
0.0000
B (group)
0.4564
0.4102
0.0014
0.4094
0.0150
0.0000
0.9163
0.0002
0.0000
0.0198
0.4312
0.1225
0.0130
0.0636
DHAR Fig. 5
GR Fig. 5
APX Fig. 5
SOD Fig. 5
DHAR recovery Fig. 6
GR recovery Fig. 6
APX recovery Fig. 6
SOD recovery Fig. 6
A (time)
0.0481
0.0000
0.0000
0.0447
0.0462
0.0002
0.0000
ND
B (group)
0.5479
0.4657
0.2773
0.1510
0.6696
0.2362
0.7841
ND
DHAR Q-PCR Fig. 7
GR Q-PCR Fig. 7
APX Q-PCR Fig. 7
GPX Q-PCR Fig. 7
SOD Q-PCR Fig. 7
A (time)
0.0012
0.0043
0.0000
0.0000
0.0005
B (group)
0.6146
0.6847
0.7521
0.5344
0.8339
The analyses were done on two independent groups of three plants during a kinetic. The P values showing the level of significance of each effect (time and group of plants) are presented
123
Trees
a
16
a
12 a
Fv/Fm
0.8
8 b
4
c
c
d
e
ef
fg
g
b
b
c d 0.4
e
b 0.3
bc
0.8
0.2 cd
0.1
d
cd
cd
c
c
0.4
c
c
d
cd
1
4
7
24
48
72
96
144
0
Evaluation of net photosynthetic rate during recovery at 28°C The probabilities obtained after ANOVA on Pn recovery data are shown in Table 3. Plant recovery at 28°C was estimated following 4, 24 or 96 h of chilling to verify if the changes observed at these times were reversible or not. After 4 h of chilling treatment, net photosynthetic rate was not strongly affected and its values returned to the
1
4
7
24
48
72
96
144
192
Fig. 2 Chlorophyll a fluorescence measurements. Time course of the changes in maximum photochemical efficiency of photosystem II Fv/ Fm, Fv = Fm - F0 (a), and the NPQ of chlorophyll fluorescence (b) at 10°C (white bars) and 28°C (black bars), the values given are mean values ± SEM of eight replicates. Different letters indicate significant treatment differences (P \ 0.05) for Fisher’s LSD pairwise comparisons
a MDA equivalents (nmol .ml-1)
treatment, Fv/Fm ratio was 0.8 showing the good physiological state of plants (Fig. 2a). It was slightly affected after 1 h at 10°C and a gradual but significant decrease of Fv/Fm ratio was observed thereafter. The NPQ of chlorophyll fluorescence is commonly accepted as an indicator of the appearance of mechanisms to prevent overexcitation of reaction centers in the photosynthetic apparatus (Ivanov and Edwards 2000). At 10°C, NPQ increased significantly from 0 to 4 h, remained stable from 4 to 7 h and decreased steadily to reach values lower than those obtained from control plants at 72 h (Fig. 2b). The content of MDA, one of the most frequently used indicator of lipid peroxidation, was measured following the time course of the chilling treatment. MDA production was stimulated during the period of cold treatment (Fig. 3a). It became significantly greater than the initial value (0 h) after 72 h of cold treatment, whereas no variation was found in plants kept at 28°C. Conductivity measurements showed that membrane leakage was significantly increased from 96 h of cold treatment (Fig. 3b). No significant variation was found in control plants during the time course at 28°C.
d
Hour
1.2
a
1
b bc
0.8 0.6
bc
c
0.4 0.2 0
0
b Electrolytic leakage (%)
Fig. 1 Time course of the changes in net photosynthetic rate Pn (a) and stomatal conductance Gs (b) in leaves of Hevea brasiliensis plants grown at 10°C (white bars) and 28°C (black bars). The values given are mean values ± SEM (standard error of mean) of four replicates. Different letters indicate significant treatment differences (P \ 0.05) for Fisher’s LSD pairwise comparisons
cd
0
192
Hour
123
f
b
b
0 0
f
a b
b
e
a
a
0.4
b
g
b Gs (mol m-2s-1)
1.2
NPQ
Pn (µmol m-2s-1)
a
24
72
96
192
50 a 40 b 30 20 10
c d
d
0 0
48
96
144
192
Hour
Fig. 3 Time course of the changes in MDA equivalent levels (a), and electrolyte leakage (b) at 10°C (white bars) and 28°C (black bars). The values are presented as mean values ± SEM of two replicates. Different letters indicate significant treatment differences (P \ 0.05) for Fisher’s LSD pairwise comparisons
reference value obtained before chilling, between 1 and 24 h at 28°C (Fig. 4). A significant difference was observed between the means at 0 h and after 24 h at 28°C
Trees
DHAR activities remained constant in control plants during the time course. In chilled plants, the specific activity of APX increased greatly between 1 and 7 h, then decreased from 7 to 72 h. A second significant increase in APX activity was observed at the end of chilling treatment (96 h). A significant increase in SOD activity was observed after 7 h of cold treatment. For both APX and SOD activities, only slight variations were observed in plants kept at 28°C. After 96 h of chilling treatment, the plants were placed at 28°C and measurement of DHAR, GR, and APX activities were carried out during a time course recovery of 120 h. SOD activity was not measured since it was not different from the control activity after 96 h of chilling (control: 9.22 ± 1.06 U mg-1 protein; 96 h (10°C): 8.20 ± 1.02 U mg-1 protein). After 48 h of recovery, the DHAR activities increased slightly compared to the end of chilling treatment, and then decreased following the time course of the recovery (Fig. 6). After 96 h of recovery, DHAR activity was back to reference value obtained when the plants were kept at 28°C. GR and APX activities decreased regularly during the time course of recovery (Fig. 6). APX and GR activities were recovered after 96 h at 28°C.
Pn (% of recovery)
160 a
120
a
80
b
b
40
ab
ab
96
120
c c cdcd
0 0
24
48
72
144
168
Hour
Fig. 4 Time course of net photosynthetic rate recovery (28°C) after previous chilling. The recovery was followed after a chilling period at 10°C of 4 h (filled circles) 24 h (filled squares) or 96 h (filled triangles). The results are expressed as a percentage of recovery of net photosynthetic rate compared to the initial value of Pn obtained before the chilling treatment at 28°C. The values are presented as mean values ± SEM of four replicates. Different letters indicate significant treatment differences (P \ 0.05) for Fisher’s LSD pairwise comparisons
(P = 0.0309). When the plants were submitted to 24 h of chilling, 24 h at 28°C were necessary to recover their initial level of net photosynthetic rate. After a chilling stress of 96 h, 96–144 h at 28°C were necessary for the recovery of their net photosynthetic rate. Antioxidant enzymes activities
Expression of antioxidant genes in response to chilling stress
350
DHAR
a
a
GR
200 160
280 210
b
abc
140
bc bc
70
ab
120
b
bc
b b
b
b
b
80
b 40
c a
APX
800
c
16
bc
bc
d
400
ab
abc
b
600
a
SOD
fg
bc
c
e f
200
bc
12 8
bc
g
4
0
unit .(mg protein)-1
nmol .(mg protein)-1 min-1
The P values showing the level of significance for the ANOVA tests on Q-PCR ratio are shown in Table 3. The expression levels of critical genes implicated in oxidative metabolism were followed by real-time quantitative polymerase chain reaction in order to gain insights into the regulation of the antioxidant capacities in Hevea. Relative expressions were measured at various times during the chilling treatment and the relative expression ratio of genes tested ranged between 0.3 and 3. No significant variation of DHAR and GR expression was observed during the first
nmol .(mg protein)-1 min-1
Fig. 5 Time course of the changes in antioxidant enzyme activities in leaves of H. brasiliensis at 10°C (white bars) and 28°C (black bars). Mean values ± SEM of four replicates are shown. Different letters indicate significant treatment differences (P \ 0.05) for Fisher’s LSD pairwise comparisons
nmol .(mg protein)-1 min . -1
The P values showing the level of significance for the ANOVA tests on enzyme activities are shown in Table 3. To understand the effect of the chilling treatment on the antioxidant capacities of Hevea, we analyzed the enzymatic activities ensuring the supply/regeneration of the primary antioxidants ascorbate and glutathione, i.e. dehydroascorbate peroxidase (DHAR) and glutathione reductase (GR), as well as the enzymatic activities of the main ROS scavengers, i.e. ascorbate peroxidase (APX) and SOD (Fig. 5). DHAR activity increased after 1 h of chilling stress, and from 72 to 96 h. Specific activity of GR increased dramatically at 96 h of chilling. Both GR and
0 0
1
4
7
24
48
72
96
0
1
4
7
24
48
72
96
Hour
123
Trees 3
a
16
ab
DHAR
12
ab c
GR
a 3
b
2
bc
1
c a
4
APX
3
b cd
1
d
bc c
c c
c
b
ab
3
bc cd
2
bcd cd
cd
cd d
c
a
3 b
2
cd
bc
cd
c
1
3
c
2
bc
1
1
APX
ab
Relative expression ratio
GR
4
a
2
4
c
GPX
Relative enzyme activities ratio
8 4
a ab
DHAR
de
d
e
a b
bc
2
cd
d
d
1
e
e
0 0
24
48
72
96
120
e
Fig. 6 Time course of antioxidant enzyme activities during recovery at 28°C. The plants were first exposed to chilling at 10°C for 96 h. The results are expressed as ratios relative to the enzymatic activity of the control (plants maintained at 28°C). Mean values ± SEM of four replicates are shown. Different letters indicate significant treatment differences (P \ 0.05) for Fisher’s LSD pairwise comparisons
48 h at 10°C. A significant increase in both gene expressions was observed after 96 h of chilling (Fig. 7a, b). For APX and GPX, the expression was increased 2.5 and 2.8fold respectively at 24 h. For both enzymes, this increase was followed by a strong decrease in gene expression at 72 h (Fig. 7c, d). Subsequently, the value for GPX increased again to the initial ratio of 1 after 96 h of chilling (Fig. 7d). Transcript level of the chloroplastic Cu-Zn SOD did not show any significant variation of its accumulation during 96 h of chilling treatment (Fig. 7e).
Discussion This study analyzes the H. brasiliensis response to chilling stress in order to define critical steps in reply to cold temperatures. Plants were subjected to cold treatments (10°C for 4, 24 or 96 h) and were then placed back to the initial optimum growth conditions (28°C) to assess their response during recovery. During the 96 h of cold treatment, we observed a short-term response versus a longterm one, the time point of 24 h, when stomata closure is effective, being the border between these two responses.
123
SOD
Hour
b
2 1
bc
bc
bc
cd
bcd
cd
d
0 0
1
4
7
24
48
72
96
Hour
Fig. 7 Q-PCR analysis of antioxidant enzymes gene expression during chilling period. The cDNA was normalized in dependence of the level of constitutively expressed 18S rRNA. The method to calculate the relative expression ratio was described by Pfaffl (2001). Dehydroascorbate peroxidase (a), glutathione reductase (b), ascorbate peroxidase (c), glutathione peroxidase (d), superoxide dismutase (e). The values are presented as the mean values ± SEM of four replicates. Different letters indicate significant treatment differences (P \ 0.05) for Fisher’s LSD pairwise comparisons
One of the most rapid effects of chilling was the decrease of net photosynthetic rate after only 1 h at 10°C. According to Allen and Ort (2001), the declines in photosynthesis observed at cold temperatures have been attributed to several possible causes among which are a photoprotective mechanism in photosystems by energy dissipation, the loss of enzymatic activities participating in the Calvin cycle, the stomatal closure which compromises gas exchange and CO2 fixation. Here, it is most probably the temperature dependence of enzymatic activity which causes the drop in photosynthesis. For Alam et al. (2005), low temperature modified the whole leaf gas exchange and chloroplast photochemical activities in rubber tree. In our experiments, the decline of net photosynthetic rate observed from 1 to 7 h was not due to the stomata closure. On the contrary, we observed an increase in their opening
Trees
at these times. Such increase has been observed in several chilling sensitive species as an early response to chilling (reviewed in Allen and Ort 2001). The stomata closed after 24 h of chilling most probably to prevent water deficit. It is known that chilling can induce water loss because cold reduces root hydraulic conductivity and substantially inhibits water uptake from the soil (Ame´glio et al. 1990; Cochard et al. 2000; Wilkinson et al. 2001). The decrease of photochemical efficiency of photosystem (PS) II (Fv/Fm) in PB260 indicates the reduced capacity of PS II to utilize incident light (Jung et al. 1998). During the first day of chilling treatment, Fv/Fm ratio was slightly affected (at 1 and 7 h, Fv/Fm still represented 88 and 83% of the initial value, respectively), while the net photosynthetic rate was drastically decreased (60–70% of decrease after 1–7 h), showing that chilling temperatures inhibit the net photosynthetic rate more than the photochemical activities. The drop in net photosynthetic rate can be attributed to the temperature sensitivity of Calvin cycle enzymes (Holaday et al. 1992). As a consequence, the absorbed energy may become excessive due to the lower energetic demand for carbon fixation. At the same time, the increased level of NPQ indicates that a photoprotective process of the PSII was taking place. We can suppose that the excitation pressure on PSII reaction centers is alleviated by the xanthophyll cycle diverting photon energy into heat via zeaxanthin (Gilmore et al. 1995; Xu et al. 1999; Li et al. 2003; Sui et al. 2007). The opening of stomata between 0 and 24 h of chilling could be related to the increase of NPQ. Indeed, Tallman (2004) has supposed that the increase of NPQ through the conversion of violaxanthin to zeaxanthin decreases the supply of carotenoid precursor for abscisic acid (ABA) biosynthesis. It is known that depletion in the endogenous plant hormone ABA liberates guard cells to extrude protons and accumulates the ions and water needed to increase guard cell turgor and open stomata (Assmann and Wang 2001; Hetherington 2001; Schroeder et al. 2001). Excitation energy that is not used for photochemistry can be transferred to O2 as the terminal electron acceptor to create ROS such as superoxide anion (O.2 ) and then hydrogen peroxide (H2O2). During the Fenton reaction, hydroxyl radicals are formed as the main cell damaging product of H2O2 (Foyer et al. 1994). To cope with elevated levels of ROS, aerobic cells have evolved a range of nonenzymatic and enzymatic antioxidant systems. We measured the enzymatic activity of several major antioxidant enzymes to further analyze the physiology of Hevea at cold temperatures. The chilling treatment caused an increase of DHAR activity as early as after 1 h of chilling. It is possible that this peak reflects the increased demand for ascorbate as a primary antioxidant. Once used, ascorbic acid can be regenerated from its oxidized form in a reaction
catalyzed by DHAR, one of several mechanisms of ascorbate reduction. Because ascorbic acid is the major reductant in plants, DHAR serves to regulate their redox state (Chen et al. 2003). The increase in DHAR activity was followed by an increase in APX and SOD activities before 24 h of chilling. These increased antioxidant enzymes activities were probably aimed at controlling the increase in photosynthesis-dependent ROS accumulation. From 24 to 96 h of chilling treatment, the net photosynthetic rate continued to decrease, and Fv/Fm ratio markedly decreased which indicated a photoinhibition process. In this process, the reaction centers of PSII may be reversibly inactivated or destroyed (Chow 1994; Alam and Jacob 2002; Govindachary et al. 2004; Feng and Cao 2005). After 24 h of chilling, NPQ decreasing was associated with a decrease in Fm. According to Logan et al. (2007), NPQ is underestimated when the Fm values are quenched, and its use in the measurement of thermal dissipation of excess energy should be avoided in these conditions. Although NPQ can be underestimated, the photoprotective process may be less efficient. The low net photosynthetic rate observed after 24 h was probably not sufficient to maintain the thylakoid proton gradient necessary for the supply of zeaxanthin and to maintain the resulting NPQ of chlorophyll fluorescence. Indeed, zeaxanthin is synthesized from violaxanthin by a violaxanthin de-epoxidase which is active when the luminal pH decreases to a critical threshold (Szabo´ et al. 2005). A recent study demonstrates that a critical lumen acidification is needed for the sufficient supply of zeaxanthin for the NPQ to occur under moderate light, even though the violaxanthin de-epoxidase is functional at higher luminal pH (Kotabova´ et al. 2008). In a tobacco plant in which the chloroplastic NADPH dehydrogenase (NDH) gene had been disrupted, the lower NPQ was attributed to an inefficient proton gradient across thylakoid membranes, due to the lacking of NDH-dependent cyclic electron flow around PSI at chilling temperature under low irradiance (Li et al. 2004). An alternative hypothesis to explain the NPQ decrease would be a deficiency in ascorbate after 24 h, since violaxanthin de-epoxidase requires ascorbate as reductant (Hager 1969). It has been shown that ascorbate deficiency can limit violaxanthin de-epoxidase activity in vivo in Arabidopsis mutants that maintain far lower than wild-type levels of ascorbate. (Mu¨ller-Moule´ et al. 2002). The excess in energy which cannot be dissipated by the photochemical- or NPQ-processes, would ultimately induce a great accumulation of ROS leading to an oxidative stress. MDA production, an indicator of lipid peroxidation, was significantly increased at 72 h, suggesting that an oxidative stress took place in leaf cells. Alam and Jacob (2002) also observed an accumulation of MDA in the leaves of rubber tree cultivated in cool mountains with high
123
Trees
irradiance in the south Indian state of Kerala. Following excessive production of ROS, cell damage has occurred, as shown by the increase in electrolyte leakage at 96 h. At the end of the chilling time course (96 h), DHAR, GR and APX activities increased dramatically. A high activity of these enzymes is an indirect evidence for an increased production of highly damaging ROS (Hola´ et al. 2007). We hypothesize that the augmentation of the APX, GR, and DHAR activities may not be enough to protect membranes from ROS damages, as the production of MDA and electrolyte leakage were maximal at 96 h. Besides enzyme activity measurements, transcript accumulation was monitored for several isoforms. Difference between enzyme activities and mRNA levels was observed, indicating that the control of the expression of plant antioxidant defenses is complex and operates at several levels (Lu et al. 2007). A significant increase in transcript accumulation was observed after 24 h of chilling for APX and GPX, both genes being involved in ROS reduction. At 96 h, accumulation of transcripts was observed for GR and DHAR which are involved in the reduction of the main primary antioxidants glutathione and ascorbate, respectively. Under non-stress condition, glutathione and ascorbate are reduced and thus keep the cell environment reduced. Under stress condition like chilling, they may become more oxidized because of their role in ROS reduction. The increases in GR and DHAR activities and transcripts strongly suggest a response to cope with an accumulation of ROS. The increase in GPX transcript level at 96 h confirms its important role in defense against membrane lipid peroxidation (Yoshimura et al. 2004; Herbette et al. 2005, 2007). A recovery analysis at 28°C was carried out in order to understand if the damages observed after 96 h of chilling were reversible. The clone PB260 was able to recover after 4, 24, or 96 h at 10°C in net photosynthetic rate, photochemical efficiency of PSII, stomatal conductance (data not shown) after 4, 24, or 96 h at 10°C. The activities of APX, GR and DHAR were back to values obtained before chilling after 96–120 h at 28°C. These data showed that the clone PB260 can withstand 96 h of chilling with moderate light, without irreversible damage to its photosynthetic apparatus. The different complementary tools used in our study have brought forward key times of the time course where important physiological changes occurred. Using the present work as a reference, similar experiments will be carried out with a series of different clones to evaluate their capacities to withstand chilling stress. Acknowledgments We are indebted to Dr. David Biron (Canadian scientist) for English grammar and syntax corrections. We are very grateful to the two anonymous referees for their insightful comments
123
which substantially improved this paper. This work was supported in part by MICHELIN (Clermont-Ferrand, France).
References Alam B, Jacob J (2002) Overproduction of photosynthetic electrons is associated with chilling injury in green leaves. Photosynthetica. 40(1):91–95. doi:10.1023/A:1020110710726 Alam B, Nair DB, Jacob J (2005) Low temperature stress modifies the photochemical efficiency of a tropical tree species Hevea brasiliensis: effects of varying concentration of CO2 and photon flux density. Photosynthetica 43(2):247–252. doi:10.1007/ S11099-005-0040-z Allen DJ, Ort DR (2001) Impacts of chilling temperatures on photosynthesis in warm-climate plants. Trends Plant Sci 6(1):36–42. doi:10.1016/S1360-1385(00)01808-2 Alonso A, Queiroz C, Magalhaes A (1997) Chilling stress leads to increased cell membrane rigidity in roots of coffee (Coffea arabica L.) seedlings. Biochim Biophys Acta Biomembr 1323(1):75–84. doi:10.1016/S0005-2736(96)00177-0 Ame´glio T, Morizet J, Cruiziat P, Martignac M (1990) The effects of root temperature on water flux, potential and root resistance in sunflower. Agronomie 10:331–340. doi:10.1051/agro:19900407 Asada K (1996) Radical production and scavenging in chloroplasts. In: Baker NR (ed) Photosynthesis and the environment. Kluwer, Dordrecht, pp 123–150. doi:10.1007/0-306-48135-9 Assmann SM, Wang XQ (2001) From milliseconds to millions of years: guard cells and environmental responses. Curr Opin Plant Biol 4(5):421–428. doi:10.1016/S1369-5266(00)00195-3 Baek KH, Skinner D (2003) Alteration of antioxidant enzyme gene expression during cold acclimation of near-isogenic wheat lines. Plant Sci 165(6):1221–1227. doi:10.1016/S0168-9452(03) 00329-7 Barclay K, McKersie B (1994) Peroxidation reactions in plant membranes: effects of free fatty acids. Lipids 29(12):877–882. doi:10.1007/BF02536256 Bilger W, Bjo¨rkman O (1990) Role of the xanthophyll cycle in photoprotection elucidated by measurements of light-induced absorbency changes, fluorescence and photosynthesis in leaves of Hedera canariensis. Photosynth Res 25(3):173–185. doi: 10.1007/BF00033159 Butler WL (1978) Energy distribution in the photochemical apparatus of photosynthesis. Annu Rev Plant Physiol 29:345–378. doi: 10.1146/annurev.pp.29.060178.002021 Campos PS, Quartin Vn, Ramalho Jc, Nunes MA (2003) Electrolyte leakage and lipid degradation account for cold sensitivity in leaves of Coffea sp. plants. J Plant Physiol 160(3):283–292. doi: 10.1078/0176-1617-00833 Chang S, Puryear J, Cairney J (1993) A simple and efficient method for isolating RNA from pine trees. Plant Mol Biol Rep 11(2):113–116. doi:10.1007/BF02670468 Chen Z, Young TE, Ling J, Chang SC, Gallie DR (2003) Increasing vitamin C content of plants through enhanced ascorbate recycling. Proc Natl Acad Sci USA 100(6):3525–3530. doi: 10.1073/pnas.0635176100 Chow WS (1994) Photoprotection and photoinhibitory damage. In: Bittar EE (ed) Advanced molecular and cell biology. JAI Press Inc, Greenwich, pp 150–196 Cochard H, Martin R, Gross P, Bogeat-Triboulot MB (2000) Temperature effects on hydraulic conductance and water relations of Quercus robur L. J Exp Bot 51(348):1255–1259 Dey SK, Chandrashekar TR, Nair DB, Vijayakumar KR, Jacob J, Sethuraj MR (1998) Effect of some agro-climatic factors on the
Trees growth of rubber (Hevea brasiliensis) in a humid and dry subhumid location. Indian J Nat Rub Res 11:104–109 Drevet JR, Swevers L, Iatrou K (1995) Development regulation of a silkworm gene encoding multiple GATA-type transcription factors by alternative splicing. J Mol Biol 246(1):43–53. doi: 10.1006/jmbi.1994.0064 Feng YL, Cao KF (2005) Photosynthesis and photoinhibition after night chilling in seedlings of two tropical tree species grown under three irradiances. Photosynthetica 43(4):567–574. doi: 10.1007/s11099-005-0089-8 Foyer CH, Halliwell B (1976) The presence of glutathione and glutathione reductase in chloroplasts: a proposed role in ascorbic acid metabolism. Planta 133:21–25. doi:10.1007/BF00386001 Foyer CH, Lelandais M, Kunert KJ (1994) Photooxidative stress in plants. Physiol Plant 92:696–717. doi:10.1111/j.1399-3054. 1994.tb03042.x Fracheboud Y, Haldimann P, Leipner J, Stamp P (1999) Chlorophyll fluorescence as a selection tool for cold tolerance of photosynthesis in maize (Zea mays L.). J Exp Bot 50:1533–1540. doi: 10.1093/jexbot/50.338.1533 Gilmore AM, Hazlett TL, Govindjee (1995) Xanthophyll cycledependent quenching of photosystem II chlorophyll a fluorescence: formation of a quenching complex with a short fluorescence lifetime. Proc Natl Acad Sci USA 92:2273–2277. doi:10.1073/pnas.92.6.2273 Govindachary S, Bukhov NG, Joly D, Carpentier R (2004) Photosystem II inhibition by moderate light under low temperature in intact leaves of chilling-sensitive and -tolerant plants. Physiol Plant 121(2):322–333. doi:10.1111/j.0031-9317.2004.00305.x Guo FX, Zhang MX, Chen Y, Zhang WH, Xu SJ, Wang JH, An LZ (2006) Relation of several antioxidant enzymes to rapid freezing resistance in suspension cultured cells from alpine Chorispora bungeana. Cryobiology 52(2):241–250. doi:10.1016/j.cryobiol. 2005.12.001 Hager A (1969) Lichtbedingte pH-Erniedrigung in einem Chloroplasten-Kompartiment als Ursache der enzymatischen Violaxanthin- ? Zeaxanthin-Umwandlung; Beziehungen zur Photophosphorylierung. Planta 89:224–243. doi:10.1007/ BF00385028 Herbette S, Menn AL, Rousselle P, Ameglio T, Faltin Z, Branlard G, Eshdat Y, Julien JL, Drevet JR, Roeckel-Drevet P (2005) Modification of photosynthetic regulation in tomato overexpressing glutathione peroxidase. Biochim Biophys Acta 1724(1– 2):108–118. doi:10.1016/j.bbagen.2005.04.018 Herbette S, Roeckel-Drevet P, Drevet JR (2007) Seleno-independent glutathione peroxidases. More than simple antioxidant scavengers. FEBS J. doi:10.1111/j.1742-4658.2007.05774.x Hetherington AM (2001) Guard cell signaling. Cell 107(6):711–714. doi:10.1016/S0092-8674(01)00606-7 Hodges DM, DeLong JM, Forney CF, Prange RK (1999) Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 207(4):604–611. doi: 10.1007/S004250050524 Hola´ D, Kocova´ M, Wilhelmova´ Rothova´ O, Na Benesova´ M (2007) Recovery of maize (Zea mays L.) inbreds and hybrids from chilling stress of various duration: photosynthesis and antioxidant enzymes. J Plant Physiol 164(7):868–877. doi: 10.1016/j.jplph.2006.04.016 Holaday AS, Martindale W, Alred R, Brooks AL, Leegood RC (1992) Changes in activities of enzymes of carbon metabolism in leaves during exposure of plants to low temperature. Plant Physiol 98:1105–1114. doi:10.1104/pp.98.3.1105 Ivanov B, Edwards G (2000) Influence of ascorbate and the Mehler peroxidase reaction on non-photochemical quenching of
chlorophyll fluorescence in maize mesophyll chloroplasts. Planta 210(5):765–774. doi:10.1007/s004250050678 Jacob J, Annmalainathan K, Alam BM, Sathick MB, Thapaliyal AP, Devakumar AS (1999) Physiological constraints for cultivation of Hevea brasiliensis in certain unfavourable agroclimatic regions of India. Indian J Nat Rub Res 12:1–16 Jung S, Steffen KL, Jae Lee H (1998) Comparative photoinhibition of a high and a low altitude ecotype of tomato (Lycopersicon hirsutum) to chilling stress under high and low light conditions. Plant Sci 134(1):69–77. doi:10.1016/S0168-9452(98)00051-X Kotabova´ E, Kana R, Kysela´kova´ H, Lı´pova´ L, Nova´k O, Ilı´k P (2008) A pronounced light-induced zeaxanthin formation accompanied by an unusually slight increase in non-photochemical quenching: a study with barley leaves treated with methyl viologen at moderate light. J Plant Physiol 165(15):1563–1571. doi:10.1016/j.jplph.2008.01.005 Krause GH, Briantais JM, Vernotte C (1983) Characterization of chlorophyll fluorescence spectroscopy at 77 KI. DpH-dependent quenching. Biochim Biophys Acta Bioenerg. doi:10.1016/ 0005-2728(83)90116-0 Leshem YY (1987) Membrane phospholipid catabolism and Ca2? activity in control of senescence. Physiol Plant 69:551–559. doi: 10.1111/j.1399-3054.1987.tb09239.x Li XG, Meng QW, Jiang GQ, Zou Q (2003) The susceptibility of cucumber and sweet pepper to chilling under low irradiance is related to energy dissipation and water–water cycle. Photosynthetica 41(2):259–265. doi:10.1023/B:PHOT.0000011959. 30746.c0 Li XG, Duan W, Meng QW, Zou Q, Zhao SJ (2004) The function of chloroplastic NAD(P)H dehydrogenase in tobacco during chilling stress under low irradiance. Plant Cell Physiol 45(1):103– 108. doi:10.1093/pcp/pch011 Logan BA, Adams WW, Demmig-Adams B (2007) Avoiding common pitfalls of chlorophyll fluorescence analysis under field conditions. Funct Plant Biol 34(9):853–859. doi:10.1071/ FP07113 Lu P, Sang WG, Ma KP (2007) Activity of stress-related antioxidative enzymes in the invasive plant crofton weed (Eupatorium adenophorum). J Integr Plant Biol 49(11):1555–1564. doi: 10.1111/j.1774-7909.2007.00584.x McCord J, Fridovich I (1969) Superoxide dismutase: an enzymic function for erythrocuprein (hemocuprein). J Biol Chem 244:6049–6055 McKersie BD, Chen YR, De Beus M, Bowler SR, Inze´ D, D’Halluin K, Botterman J (1993) Superoxide dismutase enhances tolerance of freezing stress in transgenic alfalfa (Medicago sativa L.). Plant Physiol 103:1155–1163. doi:10.1104/pp.103.4.1155 Mu¨ller-Moule´ P, Conklin PL, Niyogi KK (2002) Ascorbate deficiency can limit violaxanthin de-epoxidase activity in vivo. Plant Physiol 128:970–977. doi:10.1104/pp.010924 Nualpun S, Pluang S, Russell FD, Wallie S (2005) Molecular cloning of a new cDNA and expression of 3-hydroxy-3-menthylglutarylCoA synthase gene from Hevea brasiliensis. Planta 221:502– 512. doi:10.1007/s00425-004-1463-7 Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29(9):e45. doi: 10.1093/nar/29.9.e45 Prasad TK, Anderson MD, Martin BA, Stewart CR (1994) Evidence for chilling-induced oxidative stress in maize seedlings and a regulatory role for hydrogen peroxide. Plant Cell 6:65–74 Priyadarshan PM, de Goncalves SP (2003) Hevea gene pool for breeding. Genet Resour Crop Evol 50:101–114. doi: 1023/A:1022972320696 Pushparajah E (1983) Problems and potentials for establishing Hevea under difficult environmental conditions. Planter 59:242–251
123
Trees Queiroz CGS, Alonso A, Mares-Guia M, Magalha˜es AC (1998) Chilling-induced changes in membrane fluidity and antioxidant enzyme activities in Coffea Arabica L. roots. Biol Plant 41(3):403–413. doi:10.1023/A:1001802528068 Raj S, Das G, Pothen J, Dey S (2005) Relationship between latexyield of Hevea brasiliensis and antecedent environmental parameters. Int J Biometeorol 49:189–196. doi:10.1007/s00484004-0222-6 Rao PS, Saraswathyamma CK, Sethuraj MR (1998) Studies on the relationship between yield and meteorological parameters of para rubber tree (Hevea brasiliensis). Agr Forest Meteorol 90(3):235–245. doi:10.1016/S0168-1923(98)00051-3 Schroeder JI, Kwak JM, Allen GJ (2001) Guard cell abscisic acid signalling and engineering drought hardiness in plants. Nature 410:327–330. doi:10.1038/35066500 Simon E (1974) Phospholipids and plant membrane permeability. New Phytol 73:377–420. doi:10.1111/j.1469-8137.1974. tb02118.x Stoscheck CM (1990) Quantitation of protein. Methods Enzymol 182:50–69. doi:10.1016/0076-6879(90)82008-P Sui N, Li M, Liu XY, Wang N, Fang W, Meng QW (2007) Response of xanthophyll cycle and chloroplastic antioxidant enzymes to chilling stress in tomato over-expressing glycerol-3-phosphate acyltransferase gene. Photosynthetica 45(3):447–454. doi: 10.1007/s11099-007-0074-5 Szabo´ I, Bergantino E, Giacometti GM (2005) Light and oxygenic photosynthesis: energy dissipation as a protection mechanism against photo-oxidation. EMBO Rep. doi:10.1038/sj.embor. 7400460. Review Tallman G (2004) Are diurnal patterns of stomatal movement the result of alternating metabolism of endogenous guard cell ABA and accumulation of ABA delivered to the apoplast around guard cells by transpiration? J Exp Bot 167(1):19–26. doi:10.1093/ jxb/erh212
123
Tambussi E, Bartoli C, Guimet J, Beltrano J, Araus J (2004) Oxidative stress and photodamage of low temperatures in soybean (Glycine max L. Merr.) leaves. Plant Sci. doi:10.1016/ j.plantsci.2004.02.018 Thomashow MF (1999) Plant cold acclimation: freezing tolerance genes and regulatory mechanisms. Ann Rev Plant Physiol Plant Mol Biol 50:571–599. doi:10.1146/annurev.arplant.50.1.571 Venkatachalam P, Priya P, Gireesh T, Amma Saraswathy, Thulaseedharan A (2006) Molecular cloning and sequencing of a polymorphic band from rubber tree [Hevea brasiliensis (Muell.) Arg.]: the nucleotide sequence revealed partial homology with praline-specific permease gene sequence. Curr Sci 90:1510–1515 Wilkinson S, Clephan AL, Davies WJ (2001) Rapid low temperatureinduced stomatal closure occurs in cold-tolerant Commelina communis leaves but not in cold-sensitive tobacco leaves, via a mechanism that involves apoplastic calcium but not abscisic acid. Plant Physiol 126:1566–1578. doi:10.1104/pp.126.4.1566 Wycherley PR (1992) The genus Hevea—botanical aspects. In: Sethural MR, Mathew NM (eds) Natural rubber: biology cultivation and technology. Developments in crop science, vol 23. Elsevier, Amsterdam, pp 50–66 Xu CC, Jeon YA, Lee CH (1999) Relative contributions of photochemical and non-photochemical routes to excitation energy dissipation in rice and barley illuminated at a chilling temperature. Physiol Plant. doi:10.1034/j.1399-3054.1999. 100411.x Yoshimura K, Miyao K, Gaber A, Takeda T, Kanaboshi H, Miyasaka H, Shigeoka S (2004) Enhancement of stress tolerance in transgenic tobacco plants overexpressing Chlamydomonas glutathione peroxidase in chloroplasts or cytosol. Plant J. doi: 10.1046/j.1365-313X.2003.01930.x
