ISSN 10227954, Russian Journal of Genetics, 2013, Vol. 49, No. 5, pp. 503–510. © Pleiades Publishing, Inc., 2013. Original Russian Text © B.R. Kuluev, A.V. Knyazev, M.G. Safiullina, A.V. Chemeris, 2013, published in Genetika, 2013, Vol. 49, No. 5, pp. 587–594.
PLANT GENETICS
Effect of Constitutive Expression of ARGOSLIKE Gene on Sizes of Cells and Organs of Transgenic Tobacco Plants B. R. Kuluev, A. V. Knyazev, M. G. Safiullina, and A. V. Chemeris Institute of Biochemistry and Genetics of Ufa Scientific Center, Russian Academy of Sciences, Ufa, 450054 Russia email:
[email protected] Received June 8, 2012
Abstract—Transgenic tobacco plants that overexpress the ARGOSLIKE (ARL) gene of Arabidopsis thaliana have been developed. The transgenic plants possessed increased sizes of leaves and stem, whereas the magni tude of flowers was modified to a lesser degree. The increase in the organ sizes was a result of stimulation of cell expansion; the cell quantity in the organ was even decreased. Ectopic expression of the ARL gene was pro moted in order to increase in the level of mRNA of tobacco expansin NtEXPA5. It has been shown that the ARL gene of A. thaliana can be used to obtain transgenic plants with increased sizes of the leaves and stem. DOI: 10.1134/S1022795413040078
INTRODUCTION The sizes of plant organs depend mainly on the reg ulation of both cell division and cell expansion, which are interrelated closely by a number of signal mole cules [1]. The main cell expansionlimiting factor is rigidity of plant cell wall, which consist of macro and microfibrils of cellulose submerged into the matrix of glucanes, pectine, and various structural proteins [2]. The extension of the cell wall is under the control of a number of expansincoding genes, which takes a part in the breaking of noncovalent bonds between cellu lose microfibrils and glucanes transversal bridges [2]. Expansin participates in almost all formbuilding and destructive processes in plants [3, 4]. An analysis of riceplant promoters of expansin genes revealed the binding domains to auxines, gibberellins, brassinoster oids, cytokinins, and ethylene [5]. The binding glu canes of dicotyledone cell wall are represented mainly by xyloglucanes, the biosynthesis and degradation of which is under the control of xyloglucane endotrans glucosilases [6]. This group of enzymes catalyzes the splitting, elongation, and transfer of xyloglucan endotransglycosylases [7]. The ARGOSLIKE (ARL) gene also codes some protein that controls cell expan sion; however, its location, structure, and function are currently under discussion [8]. The gene expression is stimulated by auxines, cytokinins, and brassinoster oids; the target of a protein produced by the gene is the TCH4 gene, which regulates the cell wall extension through xyloglucan endotransglycosylase [8]. In the A. thaliana genome, the ectopic expression of the ARGOS and the OSR1 genes, which are homologous to the ARL, promotes the enlargement of aerial organ sizes; in the first case, the effect occurs due to an increase in
the cell quantity and, in the second case, it is a result of the stimulation of both cell division and expansion [9, 10]. It is proposed that proteins produced by the ARGOS, ARL, and OSR1 genes belongs to the common system of phytohormone signal transduction, since the alignment of the amino acid sequences of the pro teins revealed a common conservative area that which forms the proposed part of the transmembrane desig nated as the QSR domain; there are data that show that the proteins are located on the endoplasmic retic ulum [10]. It was shown that genes that have the OSR domain can be used to elaborate transgenic plants with enlarged organ sizes; however the phenotypic mani festations of the ectopic expression of the group of genes were only investigated for A. thaliana plants [8– 10]. To study the effect of the ectopic expression of the group of genes on the size of the organ under hetero logical conditions, we elaborated earlier transgenic tobacco plants that express the ARGOS gene of A. thaliana [11]. The leaves and stems of the transgenic plants were larger than in control tobacco plants; the transgene affected both the cell division and the cell expansion. In this study, the transformation of tobacco plants with the construction of the ARL gene of A. thaliana controlled by the 35S promoter was per formed. Morphological analysis of the obtained trans genic in the ARL gene plants revealed enlargement in the dimensions of individual cells, which results in an increase in the final organ sizes; however, an equili brating decrease in the number of cells per organ was observed for the studied plants.
503
504
KULUEV et al.
MATERIALS AND METHODS Bacterial Cells, Cultures, Plasmids, and GeneEngineering Manipulations E. coli bacterial from the XL1Blue culture and A. tumefaciens of the AGL culture were used. To create geneengineering constructions, we used Tvector pKRX and the binary vectors pCambia 1301 and pCambia 1305.1 with the gene for resistance to hygro mycin (Hyg) and the GUS as reporter gene (CAMBIA, Australia). The MuLV reverse transcriptase was used to reverse the transcription of polymerase chain reac tion (RTPCR) (Fermentas, Lithuania). Plasmid DNA was isolated by the alkaline lysis of bacterial col onies using sets made by Cytokin (Russia). The ARL gene was isolated from A. thaliana genomic DNA by the ARLF primer CTTCTTTAAATGATTCGTGAG and the ARLR primer TTATTACATAAAAGTG GAAG. For RT PCR of the ARL gene, the primers GGAGATCATAACCGGAAAAACACGAGT and AGAAGAAGGCATGAAAGCAAGAACCA were used. In the search for the target clones for ligation in the pCambia 1301 vector, the 35SCambF primer AGAGGACCTAACAGAACTCG was used, along with the 1301R primer TGCTCTAGCATTCGC CATTC. To analyze the levels of the NtEXPA5 expansin expression, the EXP1F primer AATACTG CAGCTTTAAGCACAGC and EXP1R primer GCAATGTGTTGGAAGACACAGGCTG were applied. For RTPCR of mRNA of the gene coding αtubuline of tobacco plants, the tubAF primer CAAGGTGCAAAGGGCTGTATGTATGA and tubAR primer GCACCAACTTCCTCGTAATC CTTTTC were used. Sequencing was performed using an ABI PRISM 310 Genetic Analyzer automatic ana lyzer of nucleic acids (Applied Biosystems, United States). A search for homologous genes was performed using the MegAlign program from the Lasergene pack (DNASTAR, United States) and MegaBlast, which is available through at the site http://www.ncbi.nlm. nih.gov. Obtaining Transgenic Tobacco Plants, Morphological Description, and Conditions of Plant Growth Transgenic tobacco (Nicotiana tabacum L. var. Petit Havana SR1) plants were obtained by the method of agrobacterial transformation of leaf disks cut from leaves of 3monthold plants. Initial trans genic Т0 shoots were selected on selective medium that consisted of the Murashige and Scoog (MS) medium salts and supplemented with 1 mg/L 6BAP, 0.1 mg/L NAA, and 25 mg/L Hyg. A qualitative estimation of the activity of the reporter GUS gene in leaves of Т0 shoots was performed histochemically using XGluc substratum. The obtained Т0 GUS+ shoots of each variants were implanted in the presence of 25 mg/L Hyg, transported in a soil mixture, droved to flower
ing, after which seeds of the Т1 generation were col lected. To check the transgene inheritance and detect the quantity of insertions, some of the Т1 seeds from each of the obtained lines were surfacedisinfected by immersion in 70% ethanol followed by treatment with 5% solution of sodium hypochloride, washed with sterile distilled water, and couched in MS medium supplemented with Hyg in a Binder climate chamber (Germany). After three weeks, the calculation of the seedlings resistant and nonresistant to the selective agent was performed and splitting was detected in the inheritance of the selective marker gene. The results were calculated by the χ2 method using the standard procedure; lines with one integrated transgene copy were selected for further study. The integration of the proper target gene into plant genomes was detected using PCR analysis. The plants of transgenic lines and control plants were cultivated in 450mL vegetation pots, filled with universal mix (Gera, Russia) on an open photoplate at 26°С, 280 mmoles/m2 /s photon flux density, and photoperiod 16–8 h of light and dark. The plants of the Т1 generation were under observation from the stage of the acclimatization to the soil condition to seed harvesting that took 4–6 months. The untrans genic tobacco plants var. SR1 grown in MS medium without of antibiotics and acclimatized to the soil con ditions, as well transgenic plants that contain TDNA of the binary pCambia 1301 vector without the target gene, were used as a control. The leaves were measured 30 and 45 days after the plant transplantation in the soil and at the time of flowering; three measurments were made as a result. Five plants were selected from each of the transgenic plant lines, the length of which was measured for the three lower leaves along the cen tral rib from the beginning to the end of the leaf plate; the area of these leaves was also determined. Then, the mean values of length and square of the leaves were calculated for each plant. The stem length was only measured in flowering; the time when flowering began was noted; and the length of three flowers was mea sured from the pedicle to the border of the corona flute and mean value was calculated. The area and the num ber of the leaf epidermal cells per one leaf and per one mm2 of the leaf surface were determined by an Axio Imager M1 universal fluorescent microscope (Carl Zeiss, Germany) using original software. In the table and bar graphs, the mean values of the morpho logical plant characteristics and the confidence inter val at a 0.5 significance level are presented. RESULTS Search for Homologs of ARL Gene of A. thaliana and Analysis of Protein Molecule Coded by the Gene To select primers and the ARL gene of A. thaliana amplification, the gene sequence registered in Gen
RUSSIAN JOURNAL OF GENETICS
Vol. 49
No. 5
2013
EFFECT OF CONSTITUTIVE EXPRESSION
505
Morphological parameters of control plants without target gene and experimental plants of T1 generation that express ARL gene of A. thaliana Lines of transgenic plants that express ARL gene
Lines of the control plants Parameters
N. tabacum SR1
pCambia 1301
pCambia 1305.1 ARL 2
pCambia 1 1305.1 ARL 3
pCambia 1301 ARL 5
30 days
5.2 ± 0.6
4.6 ± 0.4
5.9 ± 0.5
4.8 ± 0.1
4.6 ± 0.1
45 days
11.7 ± 0.4
11.3 ± 0.8
10.6 ± 0.2
9.1 ± 0.3
11.1 ± 0.4
Length of flower, cm
4.50 ± 0.04
4.49 ± 0.01
4.75 ± 0.11
4.73 ± 0.07
4.72 ± 0.03
Number of epidermal leaf cells per 1 mm2
63.4 ± 4.5
66.2 ± 3.6
41.1 ± 1.8
42.9 ± 1.8
45.6 ± 2.7
100.2 ± 3.5
107.8 ± 2.4
110.5 ± 1.2
117.7 ± 4.2
103.0 ± 1.8
Length of leaves, cm
Time of flowering, days
Bank NCBI under the number NM_180078.3 was used. The search for homological genes by BLAST program showed a high level of the ARL gene similarity to nucleotide sequences of Arabidopsis lyrata (XM_002880036.1) and Boechera divaricarpa (DQ226826.1). The ARGOS gene also possesses a rather high level of identity to the ARL gene, the nucleotide sequences of which are determined in A. thaliana (NM_115853.4), Brassica rapa (FJ171724.1), Vitis vinifera (AM475052.1), Ricinus communis (XM_002533293.1), Solanum lyucopersi cum (NM_001247750.1), Populus trichocarpa (XM_002310336.1; XM_002331606.1), Picea sitchen sis (EF678316.1), Oryza sativa (DQ641272.1), Zea mays (AEQ59626.1), Hordeum vulgare (AK369743.1), and others, which indicates the universality of the gene group for all higher plants. We aligned some of these nucleotide sequences and, based on the results, a phy logenetic tree was formulated (Fig. 1a). The nucle otide sequence of the Boechera divaricarpa (DQ226826.1) gene was the most similar to that of the ARL gene; the next in the level of similarity are the ARGOS genes of A. thaliana, Brassica rapa, etc. (Fig. 1a). It should be noted that the presence of two closely located ATG codones in the studied group of genes can indicate the presence of a short signal pep tide at the Nterminal of the protein molecule, which consisted of 24 amino acids for both ARL and ARGOS. The results of the alignment of amino acid sequences of the ARL protein with the additional pep tide and the ARGOS protein molecules without the peptide are presented in Fig. 1b. The search for amino acid sequences homologous to the short section by BLAST revealed the absence of those in the base of GenBank NCBI. Using the DAS program (http://www. sbc.su.se/~miclos/DAS), a search was performed for a possible transmembrane domain in RUSSIAN JOURNAL OF GENETICS
Vol. 49
No. 5
the studied protein; two domains of this type were found in the ARL gene, i.e., from the 72nd to 92nd amino acids and from 100th to 120th amino acids (Fig. 1c). An analysis of the ARL protein was carried out using the ITASSER server, based on which the proposed struc ture and functions of protein molecules can be deter mined [12]. It was shown that the Nterminal of the ARL protein consists mainly of soluble or hydrophilic amino acids, and the Cterminal of the protein can be described as hydrophobic, which also confirms the trans membrane location of this domain. The proposed second structure of the ARL protein obtained by the ITASSER server consisted of both the βchains, and the αhelixes is presented in Fig. 1d. Despite that the over expression of the ARL gene promotes an increase in the level of expression of several genes [8], the protein product of the gene cannot be related to transcription factors, since the known DNAbinding parts are not found in the protein. The search for similar proteins among enzymes using the COFACTOR method revealed only a slight similarity to the Esherichia coli formate dehydrogenase [12]. Amplification of ARL Gene of A. thaliana and Creation of GeneEngineering Constructions of Target Gene in pCambia 1301 and pCambia 1305.1 Vectors The part of A. thaliana DNA that contains the ARL gene was amplified from genomic DNA and its size was less than 500 nucleotide pairs, which coincides with the theoretically expected size of 420 nucleotide pairs (Fig. 2a). The amplicon was cloned in phagemid T vector of pKRX, and then sequenced. An analysis of the nucleotide sequences showed that we isolated a copy of the target gene that completely coincided with theoretically expected copy and did not contain any 2013
506
KULUEV et al. (a)
(b) AtARGOS BrARGOS AtARL BdARL RcARGOS VvARGOS PtARGOS OsARGOS SbARGOS
48.2
45 40 35 30 25 20 15 10 5 0 Number of nucleotide substitutions (×100) (c) DAS evaluation profile 7
AtARGOS BrARGOS AtARL BdARL PtARGOS RcARGOS VvARGOS OsARGOS AtARGOS BrARGOS AtARL BdARL PtARGOS RcARGOS VvARGOS OsARGOS
(d)
6 5 4 3 2 1
0
20 40 60 80 100 120 140 The amino acid sequence of the protein ARL
Fig. 1. Results of analysis of nucleotide sequences and amino acids of ARL gene; (a) phylogenetic tree of similarity between ARL gene of A. thaliana and homological genes of other plants; (b) results of alignment of amino acid sequences of ARL and the ARGOS genes. Assumed transmembrane OSR domain is marked in gray; (c) results of search for assumed transmembrane domains in studied ARL protein using DAS program. Two peaks on diagram indicate the presence of two parts in the studied protein, which are most likely transmembrane segments; (d) assumed secondary structure of ARL protein revealed using ITASSER server.
nucleotide substitutions. The 35S cassette consisted of the 35S promoter and polyadenylation site was cloned into pCambia 1301 vector at the SmaI site. The BsePI fragment of a pKRX vector that contains the ARL gene sequence was treated with T4DNA polymerase to complete the sticky ends and was cloned into the pCambia 1301 vector preliminarily hydrolyzed with the SmaI restriction enzyme. The search for clones with the sense orientation of the target genes was made by combining 35SCambF, 1301R, ARLF, and ARLR primers. The target geneengineering constructions only yielded specific amplicons with PCR in the case of combination with the following primer pairs: 35SCambF–ARLR, ARLF–1301R, 35SCambF– 1301R; the combination of 35SCambF–ARLF and ARLR–1301R only resulted in amplification in the case of the antisense orientation of the ARL gene. Sim ilarly, the ARL gene was cloned in the pCambia 1305.1 vector. The agrobacterial clones that contain the pCambia 1301 and pCambia 1305.1 vectors with the
target gene in the sense orientation were used to trans form tobacco leaf disks and develop transgenic plants. Comparative Morphologic Description of Tobacco Transgenic Plants That Express the ARL Gene of A. thaliana Using the pCambia 1301/ARL vector, 14 trans genic shoots were obtained, five of which were rooted and acclimatized to the soil conditions. Based on the transformation of tobacco plants with the pCambia1305.1/ARL vector, ten transgenic shoots were obtained, six of which were implanted and trans planted into the soil. Thus, we obtained five lines of plants with the pCambia 1301 vector and six lines of plants with the pCambia 1305.1 vector. As a whole, it was only possible to prove a high level of target gene expression for five lines of transgenic plants (Fig. 2b), the second generation of which was used in the future study on their morphological parameters.
RUSSIAN JOURNAL OF GENETICS
Vol. 49
No. 5
2013
EFFECT OF CONSTITUTIVE EXPRESSION (a) 1
2
3
4
bp
1
2
3
(b) 4
507
5
6
bp
750
750
500
500
250 250 Fig. 2. Results of PCR and RTPCR of ARL gene; (a) amplification of genomic copy of ARL gene of A. thaliana with 420 bp in size; 1, molecular weight marker (Sibenzyme, Russia); 2–4, amplicons of the ARL gene of A. thaliana; (b) 2–6, results of RT PCR of the ARL gene, 1, molecular weight marker (Sibenzyme, Russia).
The seeds of the five lines of the second generation of the transgenic plant were sown into selective medium; the classic 3 : 1 ratio between surviving and lost lines was observed for the studied plants, which supposed indicates the presence of a single copy of the inserted transgene. For subsequent study of the mor phological parameters, the fifth plants of the selected lines were acclimatized to the soil conditions. The var. SR1 of nontransgenic tobacco plants and the 1301 line of transgenic plants that contained the TDNA of binary vector without the target gene were used as a control. After 30 and 45 days of acclimatization, the length of leaves of the experimental plants was almost the same as that of the control plants (table). At the same time, with visual evaluation, the transgenic plants of all five lines had larger organs. For example, the transgenic plant leaves of the lines 1305.1/ARL no. 2 and 1305.1/ARL no. 3 were 20 and 23% longer than the control leaves, correspondingly, and those of the 1301/ARL no. 5 line were 13% longer than leaves of the control plants (Fig. 3a). The leaf area of the transgenic plants was 18–23% greater, than that of the line 1301 (Fig. 3b). The stems of 1305.1/ARL no. 2, 1305.1/ARL no. 3, and 1305.1/ARL no. 5 lines of the transgenic plants were 25, 27, and 10% higher than the stems of the control plants (Fig. 3c). The differences in the lengths of flowers between the experimental and control plants were not too big and, overall, were no more than 5% (table). The shape of leaves, stems, and flowers of the experimental plants was the same as in the control plants. Inside each line of both the trans genic and the control plants, the differences in leaf and stem sizes between different variants of sampling never exceeded 10%; no differences were observed in flower sizes. At the same times, the insertion of the TDNA binary vector did not influenced markedly the mor RUSSIAN JOURNAL OF GENETICS
Vol. 49
No. 5
phological parameters of studied plants (Fig. 3). This means that the increase in the sizes of the transgenic plant organs was most likely determined by the ectopic expression of the ARL gene. To elucidate the reason for the increased organ sizes, we study the cells of leaf epidermis by the micro scope. The sizes of the transgenic plant organs could be increased by both enlarging individual cells and stimulating cell division [1]. The leaves of the trans genic in the ARL gene plants possessed increased epi dermal cell sizes, compared to those of the control plants (Figs. 3d, 4). Epidermal cells of the lines 1305.1/ARL no. 2, 1305.1/ARL no. 3, and 1301/ARL no. 5 from the leaves of transgenic plants were 58, 52, and 42% bigger compared to the control (Fig. 3d). The results shows that the dimensions of the transgenic plant cells were increased much more than the dimen sions of individual organs. The differences observed in the dimensions of flower epidermal cells also remained; however, they were only increased by 10– 15%. In other words, the overexpression of the ARL gene influenced mainly the sizes of leaf cells, while the dimensions of flower epidermal cells were changed to a much lesser degree. It is known that expansins take part in the regula tion of cell elongation [2]. At present, in tobacco plants, only six genes of αexpansins have been identi fied, known as NtEXPA, with serial numbers of 1–6; nucleotide sequences of the genes are available in GenBank (AF049350–AF049355) [13]. We selected oligonucleotide primers to perform RTPCR of the mRNA of the NtEXPA5 gene. It was shown that, in transgenic lines, in ARL gene tobacco plants, an increased level of corresponding expansin expression was observed compared to control (Fig. 5). 2013
508
KULUEV et al. (a) Length of leaves in flowering, cm
(b) Square of leaves in flowering, cm2
20
200
15
150
10
100
5
50
0 Stem height, cm
0
(c)
(d) Square of lower epidermal cells of leaves, μm2
100
24000
80
20000
60
16000 12000
40 8000 20
4000 0
0 SR1
1301
1305.1 1305.1 1301 ARL 2 ARL 3 ARL 5 Lines of control and experimental plants
SR1
1301
1305.1 1305.1 1301 ARL 2 ARL 3 ARL 5 Lines of control and experimental plants
Fig. 3. Morphological parameters of the transgenic and the control plants; (a) length of leaves in flowering; (b) square of leaves in flowering; (c) stem height; (d) the square of lower epidermal cells of leaves; SR1 is wildtype tobacco plants; 1301 is transgenic tobacco plants that contain the insertion of TDNA of pCambia 1301 binary vector without of the target gene (control); 1305.1/ARL 2, 3 is transgenic tobacco plants that contain insertion of TDNA of pCambia 1305.1 binary vector with ARL target gene; 1301/ARL 5 is transgenic tobacco plants that contain the insertion of TDNA of the pCambia 1301 binary vector with ARL target gene.
(a)
(b)
(c)
Fig. 4. Comparison of lower epidermal cells of leaves of control and experimental plants that express ARL gene; (a) leaf epidermal cells of the control tobacco plants, 200× power magnification; (b, c) leaf epidermal cells of tobacco plants transgenic in ARL gene, 200× power magnification. Scale is 50 µm.
DISCUSSION The ARL gene is related to a small family of genes that contain a conservative part that codes the trans membrane domain OSR [10]. The results of a mor phological analysis of the transgenic plants confirmed
the data on the participation of the ARL protein in the regulation of cell expansion. However, the question of differences in the structure and function between the proteins of the OSR family remains open. Among pro teins with the described structure and known func
RUSSIAN JOURNAL OF GENETICS
Vol. 49
No. 5
2013
EFFECT OF CONSTITUTIVE EXPRESSION
tions, we did not detect either ARL orthologs or those similar to polypeptides. In this connection, the func tional role of the ARL protein in plant must be studied in future. At present, it can be supposed only that the ARL protein is one of many receptor molecules trans ducing some signals from various phytohormones to transcriptional factors, which participate in the regu lation of plant development. It is possible that the sig nals are transmitted from the ARL protein to the GRF transcription factors, which takes part in the regula tion of cell expansion; however, there are no data of this kind [14, 15]. The results of our study shows that the ARL gene of A. thaliana can be used to obtain transgenic plants with increased organ dimensions; this is true not only for A. thaliana, but also for plants not related to the A. thaliana species. For example, this gene can be used to increase in the length of the stem and magnitude of the leaf, which can be of practical importance for agri culture and forestry biotechnology. We have previously elaborated transgenic tobacco plants that express the ARGOS gene of A. thaliana under the control of the promoter of the dahlia mosaic virus [11]. The trans genic plants possessed a more considerable increase in the dimensions of the organ than the transgenic line in the ARL gene of tobacco plants developed in this study. For example, the leaf and stem dimensions of tobacco plants transgenic in the ARGOS gene were 30–40% larger than the control, whereas those of transgenic plants in the ARL gene only exceeded the control mag nitudes by 10–27%. It is most likely that this differ ence is a result of the higher activity of the dahlia mosaic virus promoter compared to that of the 35S promoter, since transgenic A. thaliana plants that over express the ARGOS and ARL genes under the control of the 35S promoter differed only slightly form one another in organ sizes [10, 11]. It should be noted that, in transgenic lines, the ARGOS and ARL genes of A. thaliana plants demonstrated a greater increase in plant dimensions than the studied tobacco plants [10]. For example, the leaves of transgenic in the ARGOS gene of A. thaliana plants were at least 50% larger than the control plants [10]. As expected, the elaborated transgenic tobacco plants with the ARL gene demonstrated increased sizes of the leaf epidermal cells. For instance, the dimen sions of the leaf epidermal cells were 42–58% larger, than the control plants, whereas the area of the leaf plate of the studied plant was only increased by 18– 23%. These results indicate the equilibrating decrease in the cell quantity of leaves of transgenic plants pro moted to keep the organ sizes close to those in the control plants. It cannot be excluded that the overex pression of the ARL gene negatively affects the level of expression of several transcription factors that stimu late cell division, e.g., the AP2 factor of AINTEGU MENTA; furthermore, various phytohormones and the protein with the OSR domain can serve as signal molecules [1, 10]. RUSSIAN JOURNAL OF GENETICS
Vol. 49
No. 5
1
509 2
3
4
5
NtEXPA5
αtubuline
Fig. 5. Effect of ectopic expression of ARL gene on level of expression of NtEXPA5 gene; 1, 2, transgenic in ARL gene tobacco plants; 3–5, control plants.
ACKNOWLEDGMENTS The study was granted by the Russian Ministry of Education and Science, project no. 16.518.11.7047. REFERENCES 1. Mizukami, Y. and Fischer, R.L., Plant Organ Size Con trol: AINTEGUMENTA Regulates Growth and Cell Numbers during Organogenesis, Proc. Natl. Acad. Sci. U.S.A., 2000, vol. 97, pp. 942–947. 2. Sharova, E.I., Expansins—Proteins Involved in Cell Wall Softening during Plant Growth and Morphogene sis, Fiziol. Rast., 2007, vol. 54, no. 6, pp. 805–819. 3. Azeez, A., Sane, A.P., Tripathi, S.K., et al., The Gladi olus GgEXPA1 Is a GAResponsive AlphaExpansin Gene Expressed Ubiquitously during Expansion of All Floral Tissues and Leaves but Repressed during Organ Senescence, Postharvest Biol. Technol., 2010, vol. 58, pp. 48–56. 4. Park, C.H., Kim, T.W., Son, S.H., et al., Brassinoster oids Control AtEXPA5 Gene Expression in Arabidopsis thaliana, Phytochemistry, 2010, vol. 71, pp. 380–387. 5. Lee, Y., Choi, D., and Kende, H., Expansins: Over Expanding Numbers and Functions, Curr. Opin. Plant. Biol., 2001, vol. 4, pp. 527–532. 6. Chen, F., Nonogaki, H., and Bradford, K.J., A Gibber ellinRegulated Xyloglucan Endotransglycosylase Gene Is Expressed in the Endosperm Cap during Tomato Seed Germination, J. Exp. Bot., 2002, vol. 53, pp. 215–223. 7. Fry, S.C., Smith, R.C., Renwick, K.F., et al., Xyloglu can Endotransglycosylase, a New WallLoosening Enzyme Activity from Plants, Biochem. J., 1992, vol. 282, pp. 821–828. 8. Hu, Y., Poh, H., and Chua, N., The Arabidopsis ARGOSLIKE Gene Regulates Cell Expansion during Organ Growth, Plant J., 2006, vol. 47, pp. 1–9. 9. Hu, Y., Xie, Q., and Chua, N., The Arabidopsis Auxin Inducible Gene ARGOS Controls Lateral Organ Size, Plant Cell, 2003, vol. 15, pp. 1951–1961. 2013
510
KULUEV et al.
10. Feng, G., Qin, Z., Yan, J., et al., Arabidopsis ORGAN SIZE RELATED1 Regulates Organ Growth and Final Organ Size in Orchestration with ARGOS and ARL, New Phytol., 2011, vol. 191, pp. 635–646. 11. Kuluev, B.R., Knyazev, A.V., Il’yasova, A.A., and Chemeris, A.V., Constitutive Expression of the ARGOS Gene in the Tobacco Plants Driven by Dahlia Mosaic Virus Promoter, Fiziol. Rast., 2011, vol. 58, no. 3, pp. 443–452. 12. Roy, A., Kucukural, A., and Zhang, Y., ITASSER: A Unified Platform for Automated Protein Structure and Function Prediction, Nat. Protoc., 2010, vol. 5, pp. 725–738.
13. Link, B.M. and Cosgrove, D.J., AcidGrowth Response and αExpansins in Suspension Cultures of Bright Yellow 2 Tobacco, Plant Physiol., 1998, vol. 118, pp. 907–916. 14. Kim, J.H., Choi, D., and Kende, H., The AtGRF Family of Putative Transcription Factors Is Involved in Leaf and Cotyledon Growth in Arabidopsis, Plant J., 2003, vol. 36, pp. 94–104. 15. Horiguchi, G., Kim, G.T., and Tsukaya, H., The Tran scription Factor AtGRF5 and the Transcription Coac tivator AN3 Regulate Cell Proliferation in Leaf Pri mordia of Arabidopsis thaliana, Plant J., 2005, vol. 43, pp. 68–78.
Translated by E. Ladyzhenskaya
RUSSIAN JOURNAL OF GENETICS
Vol. 49
No. 5
2013
