JOURNAL OF VIROLOGY, Feb. 2010, p. 1977–1988 0022-538X/10/$12.00 doi:10.1128/JVI.02022-09 Copyright © 2010, American Society for Microbiology. All Rights Reserved.
Vol. 84, No. 4
Effect of Dimerizing Domains and Basic Residues on In Vitro and In Vivo Assembly of Mason-Pfizer Monkey Virus and Human Immunodeficiency Virus䌤 ˇtokrova´,1 Roman Tu Karolína Bohmova´,1,3 Romana Hadravova´,1 Jitka S ˚ma,2 Toma´ˇs Ruml,3 1 1 Iva Pichova´, and Michaela Rumlova´ * Institute of Organic Chemistry and Biochemistry IOCB Research Centre & Gilead Sciences, Academy of Sciences of the Czech Republic, Flemingovo na ´m. 2, 166 10, Prague, Czech Republic1; Astbury Centre for Structural Molecular Biology, Institute of Molecular and Cellular Biology, University of Leeds, Leeds LS2 9JT, United Kingdom2; and Department of Biochemistry and Microbiology and Center of Applied Genomics, Institute of Chemical Technology, Prague, Technicka ´ 3, 166 28, Prague, Czech Republic3 Received 25 September 2009/Accepted 30 November 2009
Assembly of immature retroviral particles is a complex process involving interactions of several specific domains of the Gag polyprotein localized mainly within capsid protein (CA), spacer peptide (SP), and nucleocapsid protein (NC). In the present work we focus on the contribution of NC to the oligomerization of CA leading to assembly of Mason-Pfizer monkey virus (M-PMV) and HIV-1. Analyzing in vitro assembly of substitution and deletion mutants of ⌬ProCANC, we identified a “spacer-like” sequence (NC15) at the M-PMV NC N terminus. This NC15 domain is indispensable for the assembly and cannot be replaced with oligomerization domains of GCN4 or CREB proteins. Although the M-PMV NC15 occupies a position analogous to that of the HIV-1 spacer peptide, it could not be replaced by the latter one. To induce the assembly, both M-PMV NC15 and HIV-1 SP1 must be followed by a short peptide that is rich in basic residues. This region either can be specific, i.e., derived from the downstream NC sequence, or can be a nonspecific positively charged peptide. However, it cannot be replaced by heterologous interaction domains either from GCN4 or from CREB. In summary, we report here a novel M-PMV spacer-like domain that is functionally similar to other retroviral spacer peptides and contributes to the assembly of immature-virus-like particles. noninfectious particles lacking a properly formed core (25, 30, 43, 59, 63). The structure reconstruction, obtained by electron cryotomography of immature particles, revealed patches of single continuous hexagonal Gag arrays composed of ordered CA and SP1 domains that are closed by the incorporation of irregular defects (7, 60). The detailed structure of CA lattice in the mature core was studied by cryo-electron microscopy, tomography, and electron crystallography (6, 8, 15, 31). The mature lattices are formed by hexamers of the CA NTD linked by CA CTD dimers. Though the CA NTD is not essential for immature particle assembly, it is believed that the N-terminal -hairpin, which is formed only upon proteolytic maturation, can shift the assembly from the immature, spherical particles to the mature, tubular cores (17, 46, 57, 58). All structures of CA NTD known to date show that the N-terminal -hairpin is stabilized by formation of a salt bridge between two highly conserved residues, the N-terminal proline and aspartate in helix 3 (13, 16, 27, 36, 39). Unlike the mature-particle-like lattices which can be effectively held together by CA-CA interactions alone, the assembly of immature particles relies on NC to tether Gag molecules together. The NC-NC interactions are most likely augmented by association with nucleic acid. With the exception of spumaviruses, retroviral NCs contain one or two CCHC zinc finger motifs responsible for the specific recognition and incorporation of retroviral genomic RNA into the immature particle. However, they are dispensable for immature virus-like particle
Assembly of immature retroviral particles is mediated by mutual interactions of Gag polyproteins. The Gag polyprotein of all retroviruses invariably contains a matrix (MA), a capsid (CA), and a nucleocapsid (NC) protein region. Additional, genus-specific domains may be present. Following assembly, the immature, spherical particle is surrounded by lipid bilayer and released from the host cell by budding through the plasma membrane. During the budding process the virus-encoded protease is activated and cleaves Gag polyprotein, releasing MA, CA, and NC proteins. MA remains associated with the membrane while CA condenses to form a core shell enclosing NC-RNA complex. The immature particle is stabilized by interactions between various regions throughout the Gag polyprotein. The major protein-protein interaction regions are within the CA that consists of two independently folded domains, an N-terminal domain (NTD) and a C-terminal domain (CTD) linked by a short, flexible linker. In HIV it was shown that whereas the CA NTD is not absolutely required for the assembly, the CA CTD together with a downstream spacer peptide sequence (SP) and NC are essential for the immature particle assembly (2, 4, 29, 37, 58). Preventing the cleavage between CA and SP or its inhibition, e.g., by betulinic acid (PA-457), results in
* Corresponding author. Mailing address: IOCB, Flemingovo na´m. 2, 166 10, Prague, Czech Republic. Phone: 420220183538. Fax: 420220183556. E-mail:
[email protected]. 䌤 Published ahead of print on 9 December 2009. 1977
1978
´ ET AL. BOHMOVA
(VLP) assembly (for a review, see reference 3). An even more conserved feature of retroviral NC sequences is a discrete patch of numerous basic amino acids, also described as an interaction (I) domain. Mutagenesis of these basic residues revealed their importance for initial Gag-Gag multimerization (5, 12, 50–52, 61, 62). The first seven amino acids of the Nterminal subdomain within HIV-1 NC (MQRGNFR) were shown to be sufficient for VLP reconstitution (50). These results led to a hypothesis that nonspecific RNA binding by the basic residues is required for augmenting Gag-Gag interactions and for providing the driving force during virion assembly (5, 12, 50, 52). A broad spectrum of different nucleic acids from singlestranded DNA to RNA oligonucleotide was successfully used in in vitro assays, and the results led to an assembly model in which the nucleic acid acts as a scaffold and brings the assembling proteins together in early stages (10, 11, 34, 40, 55). The minimal size of DNA oligonucleotide required for Rous sarcoma virus (RSV) Gag assembly was determined as 16 nucleotides (nt). This sequence is long enough to accommodate just two Gag molecules, suggesting a role of nucleic acid in promoting Gag dimerization (34, 35, 55). Additional support for this dimerization model was provided by replacing the NC with dimerizing leucine (DLZ) or trimerizing isoleucine (TIZ) zipper motifs (2, 14, 24, 62). Zhang et al. successfully replaced the HIV-1 NC in the Gag polyprotein with DLZ domain of human cyclic AMP response element binding protein (CREB) (62). This chimeric protein efficiently formed VLPs in mammalian cells that were released into the media. Similar results were obtained for the RSV Gag in which the replacement of NC with CREB DLZ restored budding of spherical particles morphologically similar to the wild-type VLPs (24). Accola et al. showed that leucine zipper dimerizing and also trimerizing domains from the yeast transcription factor GCN4 could substitute for NC-SP2 domain in assembly of minimal HIV-1 Gag construct (2). Most recently, Crist et al. replaced NC in HIV-1 Gag polyprotein with GCN4 DLZ and TIZ and studied their effect on assembly in 293T cells (14). The same authors also performed the first analysis of in vitro assembly of recombinant Gag-zipper chimeras (14). Their results demonstrated that while Gag zipper chimeras formed VLPs in mammalian cells, the NC replacement with DLZ and TIZ was not sufficient to support assembly in vitro unless cofactors such as nucleic acids or inositol phosphates were added (14). Here we probe the role of NC protein in Mason-Pfizer monkey virus (M-PMV) assembly and oligomerization of CA using chimeric protein constructs. We employ a rapid screen for assembly of expressed proteins in Escherichia coli and a previously established in vitro assembly assay. For selected constructs we complement these results by following assembly and budding of viral particles in infected cells. Our results identify a specific “spacer-like” sequence at the NC N terminus consisting of 15 amino acids that together with a nonspecific stretch rich in basic residues (e.g., residues NC16–23 or the first 10 residues from CREB) is essential for M-PMV immature particle assembly. The basic stretch cannot be substituted for a generic dimerization or trimerization domain (e.g., GCN4), indicating that it mediated interactions with RNA rather than protein-protein association. On the other hand the “spacer-
J. VIROL.
like” sequence (NC15) is specific for the virus and cannot be replaced by the HIV-1 spacer sequence. These findings are then compared with new results obtained for the assembly of HIV-1 ⌬ProCASP1NC. MATERIALS AND METHODS DNA constructs. Plasmids were created by using standard subcloning techniques and were propagated in E. coli DH5␣. For in vitro studies, all bacterial vectors were based on the parental M-PMV ⌬ProCANCpET22b and HIV-1 ⌬ProCANCpET22b, described earlier (46, 55). Chimeric constructs were created by ligation of amplified PCR fragments encoding a leucine zipper sequence or HIV-1 SP1 with expression vectors. As a template DNA for amplification of dimerization and trimerization leucine zipper domains, vectors encoding appropriate DLZ or TIZ sequence of yeast transcription factor GCN4 (21), kindly provided by Z. Knejzlík (ICT), were used, respectively. Dimerization domain of the human transcription factor CREB was obtained by reverse transcriptionPCR (RT-PCR) of total mRNA isolated from 293T cells, using primers 5⬘ GCGGCCGCCCGAGAGTGTCGTAGAAAGAAG and 3⬘ AAGCTTTTAAT CTGATTTGTGGCAGTAAAGGTC. As a template DNA for amplification of HIV-1 SP1 region, the vector pSAX2, kindly provided by J. Luban, was used. Oligonucleotide-directed mutagenesis using Pfu polymerase and appropriate primers were used for introduction of the stop codon (UAA) or insertion of the NotI restriction site (GCGGCCGC). For preparation of proviral vectors for in vivo studies, helper vectors, carrying M-PMV SacI-Eco72I fragments (nt 1165 to 3275) and HIV-1 SphI-SbfI fragments (nt 2433 to 3828) inserted into pUC19, were prepared. Each chimeric construct was first inserted into a helper vector, and following sequence verification, the SacI-Eco72I fragment was inserted into M-PMV proviral construct pSARM4 and the SphI-SbfI fragment was inserted into HIV-1 proviral construct pSAX2. Further details of the cloning strategy and full sequences of all PCR primers can be obtained from us upon request. Bacterial expression and protein purification. Recombinant proteins were expressed in Escherichia coli BL21, and the purification of M-PMV and HIV CANC related proteins was carried out as described in references 36 and 55 with some modifications. The heparin Sepharose chromatography column (GE HealthCare) was used as the final purification step for ⌬ProCANC, ⌬ProCADLZ, and ⌬ProCATIZ while the proteins ⌬ProCANC23DLZ, ⌬ProCANC23TIZ, ⌬ProCANC23, ⌬ProCANC15DLZ, ⌬ProCANC15TIZ, ⌬ProCASP1DLZ, ⌬ProCASP1TIZ, ⌬ProCASP1, ⌬ProCANC15CREB, ⌬ProCANC15CREB10, and ⌬ProCANC15⌬10CREB were purified using Sephadex G-100. Analysis of assembly intermediates by DLS. A combined dynamic light scattering (DLS) and 90-degree laser light scattering (LS) flow cell (PDI2020/DLS; Precision Detectors) was coupled to a high-pressure liquid chromatograph (HPLC; Waters 600 HPLC) and a size-exclusion column (Superdex 75, Superdex 200, or TSK 6000) and used for the determination of molecular weights of the produced proteins or assembled products. The column was equilibrated with the assembly buffer (50 mM Tris-HCl, 100 mM NaCl, 1 M ZnCl2, pH 8; flow, 0.5 ml/min). Purified proteins were centrifuged in a Beckman Airfuge (rotor A-95; 120,000 ⫻ g, 15 min), and aliquots of the purified proteins were dialyzed against the assembly buffer with or without RNA. The mixtures were then centrifuged at 120,000 ⫻ g for 15 min, and supernatant was loaded on an HPLC column. LS data were evaluated using Precision Analyze software (Precision Detectors) and absorption at 280 nm for concentration measurements. The LS detector was calibrated by standards with known molecular weights (bacteriophage P2 polymerase, bovine serum albumin [BSA], and lysozyme). In vitro assembly. An aliquot of 60 g in the total volume of 100 l of purified protein was dialyzed against the assembly buffer (50 mM Tris-HCl, 100 mM NaCl, 1 M ZnCl2, pH 8) overnight at 4°C using 1-kDa Spectrapor dialysis tubing. Nucleic acid (6 g, DNA oligonucleotides, 67 or 73 nt long [Generi Biotech], or bacteriophage MS2 RNA [Roche Molecular Biochemicals]) was optionally added to the protein prior to dialysis. Assembly products were negatively stained with 2% sodium phosphotungstate (pH 7.3) on carbon-Parlodioncoated grids and studied by electron microscopy (EM) (see details below). Tissue culture cell growth and virus production. 293T cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Sigma) supplemented with 10% fetal bovine serum (Gibco) and 1% L-glutamine (PAA Laboratories, Linz, Austria). 293T cells were transfected with the wild-type or mutant proviral DNA using Fugene HD transfection reagent (Roche Molecular Biochemicals). At 24 or 48 h posttransfection, culture media were filtered through a 0.45-m filter and virions were centrifuged through a 20% sucrose cushion at 210,000 ⫻ g for 1 h in a Beckman SW41 Ti rotor. Pellets were resuspended in the protein loading
VOL. 84, 2010
HIV AND M-PMV ASSEMBLY INTERACTIONS
buffer, analyzed by SDS-PAGE, and detected by a rabbit anti-M-PMV CA or a rabbit anti-HIV-1 CA polyclonal antibody on a Western blot. Electron microscopy analysis. Bacterial cell pellets (4 h postinduction) or 293T cells expressing the wild-type and chimeric proviral constructs grown on 100-mm plastic dishes were washed with phosphate-buffered saline (PBS) and transferred into a microcentrifuge tube. The cells were fixed with freshly prepared 2.5% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.5), postfixed in 1% osmium tetroxide, dehydrated by applying an ethanol series (30, 50, 70, 80, 90, and 100%), and embedded in fresh Agar100 epoxy resin. Ultrathin sections (70 nm) were cut on an RMC MT 7000 Ultramicrotome and placed onto 200-mesh copper grids. The sections were contrasted with saturated uranyl acetate and lead citrate and studied by transmission electron microscopy (JEOL JEM-1200EX) with a microscope operated at 60 kV.
RESULTS Replacement of M-PMV NC by DLZ and TIZ in ⌬ProCANC. Several studies have shown that retroviral CANC assembles into tubular, mature-virus-like structures (11, 18, 46, 55). However, by preventing the formation of a -hairpin at the N terminus of the CA (e.g., by deleting the N-terminal proline or by extending the N terminus), the assembly can be steered from yielding the mature lattices in favor of the immature spherical products (17, 44, 46, 55, 57). M-PMV ⌬ProCANC, the truncated domain of Gag, has been previously shown to be sufficient for assembly of immature, spherical VLPs in bacterial cells and in vitro (41, 46, 55). This construct was used as the starting point to delineate the contribution of NC interactions to the assembly of immature particles. This approach eliminated any interference from other Gag domains that may be potentially involved in the assembly process. The constructs used in this study are schematically shown in Fig. 1. Chimeric proteins in which the entire NC region was replaced by either DLZ or TIZ (both derived from the yeast GCN4 [21, 22, 33]) were cloned and designated ⌬ProCADLZ and ⌬ProCATIZ, respectively. The constructs were expressed in E. coli BL21 (DE3) and purified to homogeneity (Fig. 2). Their ability to form the expected oligomers, i.e., dimers and trimers, respectively, was assayed using analytical gel filtration coupled to a light-scattering flow cell. Peaks containing proteins with molecular weights corresponding to a dimer of ⌬ProCADLZ and a trimer-tetramer of ⌬ProCATIZ (Fig. 3A and B) were detected. The ability of the purified proteins to assemble into regular structures such as VLPs in vitro was subsequently investigated using an established in vitro assembly assay (55). No assembled particles were observed by transmission electron microscopy for either ⌬ProCADLZ or ⌬ProCATIZ (data not shown). The role of N-terminal subdomain of M-PMV NC. The inability of ⌬ProCADLZ and ⌬ProCATIZ proteins to assemble into regular structures could be caused by placing the zipper domain directly after the C terminus of M-PMV CA protein. Johnson et al. (24) showed that the RSV Gag polyprotein, in which the NC was replaced by the CREB dimerizing domain, assembled into spherical particles when expressed in insect Sf9 cells. The insertion of the 5-amino-acid flexible linker GSGSG between CA-SP and the dimerizing domain resulted in the formation of tubular particles (24). These data suggested that the spacing between CA and the multimerization domain may be critical. However, a more recent work by Keller et al. clearly demonstrated that in RSV the SP and the closely adjoining sequences (at least 8 residues of CA, all 12 residues of SP, and
1979
the first 4 residues of NC) play a critical role in the formation of immature particles (26). Since M-PMV has no similar spacer peptide connecting the CA and NC, we first determined whether the explanation for the failure of the ⌬ProCADLZ/ TIZ proteins to assemble may be due to the absence of a certain specific sequence which corresponds to a structural motif originally residing in the deleted M-PMV NC region. To analyze these possibilities, construct ⌬ProCANC23, which included the first 23 amino acids of M-PMV NC, was generated. The dimerizing and trimerizing domains were subsequently fused to ⌬ProCANC23, and the corresponding proteins (⌬ProCANC23, ⌬ProCANC23DLZ, and ⌬ProCANC23TIZ) were expressed in E. coli cells, purified, and assembled in vitro. All three proteins assembled into spherical particles (Fig. 4), revealing that both zinc fingers are dispensable for the assembly and that the 23 N-terminal amino acids of NC are sufficient to promote the multimerization of M-PMV CA molecules in the presence of nucleic acid. Moreover, DLZ and TIZ domains had no effect on assembly and the shape and size of the resulting particles (Fig. 4C and D). Light-scattering analysis of these proteins (⌬ProCANC23, ⌬ProCANC23DLZ, and ⌬ProCANC23TIZ) showed polydisperse mixtures of highmolecular-weight oligomers (data not shown). Next we attempted to design an “SP-like” linker joining M-PMV CA and the dimerizing or trimerizing domains in order to investigate whether these fusions could functionally substitute for NC23. First we determined the longest N-terminal sequence of NC that does not support the assembly of CA and used it in lieu of the spacer. As the contribution of basic residues within NC to the assembly of immature particles is well known (5, 12, 50–52), we focused on the lysine residues within the first 23 N-terminal amino acids, i.e., Lys10, Lys16, Lys18, and Lys20 (Fig. 5). To investigate their contribution to assembly, four constructs, i.e., ⌬ProCANC19, ⌬ProCANC17, ⌬ProCANC15, and ⌬ProCANC9, containing 3, 2, 1, and 0 lysine residues in the linker, respectively, were prepared. To check whether these shortened NC sequences still promoted CA assembly, we examined thin sections of E. coli cells expressing the corresponding fusion proteins. This analysis showed that the construct with a stop codon introduced in the place of Lys16 (⌬ProCANC15) failed to assemble spherical particles, and only tubular structures or protein layers were observed (Fig. 6). Our earlier in vitro studies identified an internal cleavage site of the M-PMV protease exactly within the NC sequence FLNN15*16 KNKE (45). Hence, we decided to use the first 15 N-terminal NC amino acids as a natural linker between CA and the leucine zipper domains (⌬ProCANC15). To analyze whether the extension of ⌬ProCANC15 by DLZ or TIZ could rescue the ability of this construct to assemble, constructs ⌬ProCANC15DLZ and ⌬ProCANC15TIZ were prepared. The EM analysis of these two proteins both in E. coli and in suspensions of in vitro-assembled proteins revealed that none of these domains could restore assembly, and only amorphous aggregates were observed (data not shown). As the leucine zipper replacements of NC fused to CA-SP in both RSV ⌬PR Gag (24) and HIV-1 Gag (2, 14, 62) were shown to be sufficient for assembly of immature particles, we analyzed the difference between the N-terminal 15-aminoacid-long putative spacer peptide of M-PMV and the spacer originating from HIV-1. The HIV-1 spacer peptide se-
1980
´ ET AL. BOHMOVA
FIG. 1. Schematic representation of M-PMV (A and C) and HIV-1 (B and C) constructs prepared in this study.
J. VIROL.
VOL. 84, 2010
FIG. 2. Coomassie blue-stained SDS-PAGE gel of purified M-PMV chimeric proteins expressed in E. coli.
quence was inserted between M-PMV CA and DLZ (⌬ProCASP1DLZ) or TIZ (⌬ProCASP1TIZ) (Fig. 1A). However, no assembly of organized structures was observed either in E. coli or in vitro. From this and the data shown above, it is obvious that at least the first 23 N-terminal amino acids of NC are absolutely necessary for the assembly of M-PMV and that this domain cannot be functionally replaced by DLZ, TIZ, or the HIV-1 spacer sequence SP. In order to see whether the above results were specific for M-PMV, we analyzed the effect of DLZ and TIZ on the assembly of HIV-1 ⌬ProCASP1NC. (Note that previously the effects of the leucine zipper domains on HIV-1 [2, 14, 62] and RSV [24] assembly were studied in the context of the whole Gag.) The HIV-1 chimeric proteins in which the NC was replaced by dimerizing or trimerizing GCN4 leucine zipper domains, resulting in ⌬ProCASP1DLZ and ⌬ProCASP1TIZ, respectively, were prepared (Fig. 1B). Although ⌬ProCASP1NC and ⌬ProCASP1 formed tubes both within E. coli (Fig. 7A and B, respectively) and the in vitro system (55), the replacement of NC by leucine zipper domains completely abolished this ability, and only amorphous material was observed for both proteins (Fig. 7F and G). Thus, the addition of oligomerization domains had an effect similar to that observed for M-PMV. However, as shown in previous studies the context of fulllength Gag is important for the assembly of immature particles and can completely change the outcome of the above substitutions (2, 14, 24, 62). Effect of CREB leucine zipper and basic residues on assembly. Previously, two different leucine zipper domains (CREB and GCN4) were used to replace NC domains within Gag of
HIV AND M-PMV ASSEMBLY INTERACTIONS
1981
HIV-1 (2, 14, 62) and RSV (24). Comparison of their amino acid sequences (Fig. 5) revealed a stretch of basic residues (RECRRKKKEY) at the N terminus of the CREB dimerization domain which does not occur in GCN4. To distinguish which part of CREB leucine zipper contributes to the assembly, three CREB-derived domains were fused to M-PMV ⌬ProCA, ⌬ProCANC15, and HIV-1 ⌬ProCASP1 proteins: (i) the whole CREB leucine zipper domain (CREB), (ii) a sequence containing only the N-terminal basic residues (CREB10), and (iii) CREB leucine zipper domain alone, i.e., lacking the sequence encompassing the N-terminal basic residues (⌬10CREB) (Fig. 1). All these proteins were then expressed in E. coli BL21(DE3), purified, and assayed for assembly by EM. M-PMV ⌬ProCACREB, ⌬ProCACREB10, and ⌬ProCA⌬ 10CREB did not reveal formation of any spherical particles either in thin sections of bacterial cells expressing these proteins or in negatively stained samples of in vitro assembly reactions (data not shown). Ultrastructural analysis of bacterial cells expressing the M-PMV ⌬ProCANC15CREB10 revealed formation of mainly spherical particles with a few tubular structures, i.e., a phenotype characteristic of ⌬ProCANC. Spherical particles and spiral structures formed in E. coli were observed for both ⌬ProCANC15CREB and ⌬ProCANC15⌬10CREB (data not shown). In vitro, only chimeric proteins containing either the complete CREB leucine zipper domain or CREB10 downstream of the NC15 linker (i.e., ⌬ProCANC15CREB and ⌬ProCANC15CREB10) formed spherical particles (Fig. 8A and B) similar to those of ⌬ProCANC (Fig. 4A). Chimeric protein ⌬ProCANC15⌬10CR⌭〉 lacking the stretch of basic residues formed mainly aggregates (Fig. 8C). To evaluate whether the sequence of the NC15 linker is essential for CREB-driven assembly, this region was replaced with that of HIV-1 SP1 in the three constructs ⌬ProCASP1CR⌭〉, ⌬ProCASP1CR⌭〉10, and ⌬ProCASP1⌬10CR⌭〉 (Fig. 1A). No particles were observed either in the cells expressing these constructs or in vitro (data not shown). In summary these data suggest that the 15 N-terminal amino acids of M-PMV NC followed by a short sequence containing basic residues originating either from the M-PMV NC (K16NK18EK20) or from the CREB-derived sequence (RECRRKKKEY) are required
FIG. 3. Oligomeric status of proteins. Purified proteins were separated on a size-exclusion column (Superdex 200) and detected by monitoring absorption at 280 nm. A peak labeled CA NTD corresponds to a monomer, a peak of ⌬ProCADLZ corresponds to a dimer, and a peak labeled ⌬ProCATIZ corresponds to molecular weight between trimer and tetramer (A). Distribution of molecular masses of CA1–140, ⌬ProCADLZ, and ⌬ProCATIZ was calculated from calibrated light-scattering intensity and absorbance traces (B).
1982
´ ET AL. BOHMOVA
J. VIROL.
FIG. 4. Transmission EM images of negatively stained M-PMV particles assembled in vitro from purified ⌬ProCANC (A), ⌬ProCANC23 (B), ⌬ProCANC23DLZ (C), and ⌬ProCANC23TIZ (D).
for M-PMV assembly. The NC15 cannot be functionally replaced by HIV-1 SP1 sequence. In order to determine whether portions of HIV-1 NC could be replaced with CREB, various fusions of ⌬ProCASP1 with CREB domains were examined. EM analysis of bacterial cells expressing HIV-1 ⌬ProCASP1 with fusion to CREB10 basic residues showed assembled tube-like structures (Fig. 7D) with appearance similar to those of HIV-1 ⌬ProCASP1NC (Fig. 7A). The ⌬ProCASP1CREB formed predominantly tubular and irregular structures (Fig. 7C). Deletion of the N-terminal basic residues from CREB (⌬ProCASP1⌬ 10CREB) completely abolished assembly as only inclusions containing nonstructured dense material were observed in bacterial cells (Fig. 7E). The same phenotype was observed for HIV-1 CASP1GCN4 chimeras, i.e., ⌬ProCASP1DLZ (Fig. 7F) and ⌬ProCASP1TIZ (Fig. 7G). Whereas purified
FIG. 5. Sequence of N-terminal 23 amino acids of M-PMV NC and comparison of amino acid sequences of leucine zippers of GCN4 and CREB. Residues in italics and boldface are basic residues (arginine and lysine), and those in boldface are involved in the zipper domain within GCN4 and CREB.
⌬ProCASP1NC assembles in vitro mostly into tubular structures, CREB-containing chimeric proteins were very difficult to purify as the proteins tended to precipitate and underwent degradation (data not shown). This was most likely the result of perturbed folding and precluded preparation of a homogeneous population of in vitro-assembled particles using CREBHIV chimeric proteins. Thus, while the basic residues within CREB can drive assembly of ⌬ProCASP1 into tubular structures, this sequence is not sufficient to promote formation of immature particles. Clearly, other regions provided by the Gag context are needed. The effect of NC replacement by CREB on the assembly of Gag polyprotein in cells. Recently published results from several laboratories have demonstrated that NC replacement by DLZ/TIZ within the whole Gag of RSV and HIV-1 is sufficient for assembly of immature particles at the plasma membrane (2, 14, 24, 62). Since the immature particles of M-PMV assemble within the cytoplasm, we analyzed a series of M-PMV Gag chimeric polyproteins, in which the NC was replaced by the three CREB-derived domains described above. For this purpose, CREB, CREB10, and ⌬10CREB sequences were inserted either between MA-PP-p12-CA-NC15 and p4 of MPMV Gag or between MA-CA-SP1 and SP2-p6 of HIV-1 Gag (Fig. 1C). The chimeric Gag proteins were expressed in 293T cells. Similarly to data published for HIV MA-CA-SP1 (14), M-PMV Gag lacking the NC domain did not assemble into spherical particles within the infected cells (data not shown) while all chimeric constructs were released from cells with efficiency similar to that of the wild-type control (Fig.
VOL. 84, 2010
HIV AND M-PMV ASSEMBLY INTERACTIONS
1983
FIG. 6. Electron micrographs of thin sections of E. coli cells expressing M-PMV ⌬ProCANC23 (A), ⌬ProCANC19 (B), ⌬ProCANC17 (C), and ⌬ProCANC15 (D).
9), indicating assembly. Although the deletion of the NC region abolished the frameshift sequence and only Gag polyprotein precursor was synthesized, some internal cleavage of both M-PMV and HIV-1 Gag was observed (Fig. 9). The same cleavage pattern was observed in viral constructs lacking the pro region, suggesting that the observed cleavage of chimeric Gag polyprotein is caused by cellular proteases (data not shown). The morphology of the particles was analyzed by EM (Fig. 10). The numbers and types of resulting structures were scored using 15 to 20 micrographs, and each experiment was performed in triplicate to eliminate possible artifacts due to differences in the transfection efficiency. Fully and partially assembled particles were observed in approximately equal amounts for M-PMV GagCREB (Fig. 10B) and GagCREB10 (Fig. 10C). Although about 10% of the particles revealed the C-type morphology and were assembled at the plasma membrane, the majority of these particles was preassembled within the cytoplasm. In the cells producing M-PMV Gag⌬10CREB only about 30% of particles were complete whereas 70% of all particles were only partially assembled (Fig. 10D). The assembly of this chimera probably occurs at the membrane since only partially assembled particles were occasionally observed within the cytoplasm. HIV-1 chimeric Gag proteins in which the NC domain was replaced either by the complete leucine zipper domain con-
taining the N-terminal basic residues (GagCREB) or by the leucine zipper domain lacking the N-terminal basic sequence (Gag⌬10CREB) formed a population of immature particles consisting of regularly shaped spherical VLPs and of larger, irregular VLPs (Fig. 10F and H). Surprisingly, the chimeric HIV-1 Gag in which NC was replaced only by the N-terminal basic part of CREB (GagCREB10) failed to assemble. Layers of accumulated proteins that tended to detach from the plasma membrane and form large vesicles (of more than 500-nm diameter) were observed for this chimeric protein (Fig. 10G). DISCUSSION This study investigated the contribution of NC to the oligomerization of CA and assembly of Gag into immature particles. As dimerization and trimerization have been implicated in Gag assembly (2, 14, 24, 62), we addressed primarily the question whether the dimerization or trimerization motifs could drive the assembly of CA alone as well as within the context of complete Gag. We have created a series of chimeric proteins derived from M-PMV and HIV-1 ⌬ProCANC and Gag in which NC was replaced by the leucine zipper domains from GCN4 and CREB proteins. The effect of these substitutions was examined by monitoring assembly in vitro and in vivo. In vitro assembly. The results provide solid evidence that the very N-terminal part of NC is essential for the assembly of
1984
´ ET AL. BOHMOVA
J. VIROL.
FIG. 7. Electron micrographs of thin sections of E. coli cells expressing HIV-1 ⌬ProCASP1NC (A), ⌬ProCASP1 (B), ⌬ProCASP1CREB (C), ⌬ProCASP1CREB10 (D), ⌬ProCASP1⌬10CREB (E), ⌬ProCASP1DLZ (F), and ⌬ProCASP1TIZ (G).
M-PMV immature particles. Similarly to the other retroviruses, both zinc fingers were found dispensable while a minimal domain encompassing the first 23 amino acids of NC (NC23) proved to be sufficient for immature particle assembly both in bacteria and in vitro. The first 17 amino acids (⌬ProCANC17) were found essential for assembly into spherical immature particles in bacteria but failed to assemble in vitro. However, the ⌬ProCANC15 and ⌬ProCANC9 failed to form spheres and assembled only into tubes resembling those of RSV SP mutants (26). These authors identified an extended SP assembly domain encompassing the last 8 CA residues, the
whole SP, and the first 4 residues of NC. This assembly domain was shown to be required for the formation of RSV immature particles since further insertion mutations led to the assembly of tubular lattices (26). Similarly, mutations within SP and in its vicinity have been shown to interfere with HIV-1 and bovine immunodeficiency virus (BIV) particle assembly (1, 19, 20, 29, 32, 38). Although M-PMV lacks a clear SP sequence between CA and NC (45), we suggest that the N terminus of NC (NC15), comprising the first 15 amino acids of NC and likely protruding into the CA, might act as a similar “assembly domain.” Similarly to RSV (26) and BIV (19), this M-PMV-
VOL. 84, 2010
HIV AND M-PMV ASSEMBLY INTERACTIONS
1985
FIG. 8. Transmission EM images of negatively stained M-PMV particles assembled in vitro from purified ⌬ProCANC15CR⌭〉 (〈), ⌬ProCANC15CR⌭〉10 (〉), and ⌬ProCANC15⌬10CR⌭〉 (C).
specific sequence cannot be functionally replaced with HIV SP. Neither dimerization, trimerization, a stretch of basic residues alone, nor their combination can substitute for this region. These data suggest a specific role of the N terminus of NC during immature particle assembly. The reason why the hypothetical “SP-like” sequence is not cleaved off and stays as a part of NC (and presumably also CA) after maturation remains to be elucidated. Although the recombinant M-PMV proteinase produces small amounts of Nterminally truncated forms of NC in vitro (cleavage in positions NC7, NC11, and NC15) detected by mass spectroscopy (45), no other proteolytic cleavage site apart from the one between CA and NC has been detected in the mature virion (23). This suggests that the putative spacer is cleaved during maturation into two moieties which remain attached to C and N termini of CA and NC, respectively. This would lead to its “inactivation” with the effect similar to the removal of HIV-1 or RSV SP during maturation. The reason for such a different mechanism (and the absence of M-PMV spacer peptide in the mature virion) might be related to the different core structures of these retroviruses. The M-PMV core is tubular, in contrast to the conical one of HIV or the angular appearance of RSV core (9). As mentioned previously, the basic residues downstream of CA are the key players in the assembly similar to those present in the CREB DLZ (RECRRKKKEY) and enabled both MPMV ⌬ProCANC15 and HIV ⌬ProCASP1 to assemble. In contrast the extension of ⌬ProCANC15 with DLZ/TIZ did not rescue the assembly of M-PMV. The same fusion had an in-
FIG. 9. Western blot analysis of released chimeric M-PMV (A) and HIV-1 (B) VLPs from 293T HEK cells, transfected with M-PMV pSARM4 (wt M-PMV), M-PMV GagCREB, M-PMV GagCREB10, and M-PMV Gag⌬10CREB (A) and HIV-1 pSAX2 (HIV-1 wt), HIV GagCREB, HIV GagCREB10, and HIV Gag⌬10CREB (B). VLPs were harvested 48 h posttransfection and pelleted through a 20% sucrose cushion. Viral proteins were detected using rabbit antibodies against M-PMV CA (A) and HIV-1 CA (B).
hibitory effect on the assembly of the otherwise assemblycompetent HIV-1 ⌬ProCASP. The extension of M-PMV ⌬ProCANC15 by additional NC sequence of 5 amino acids comprising the three lysine residues K16, K18, and K20 was also sufficient for the immature particle assembly. These data are in agreement with the work published by Sandefur et al. (50) in which they showed that the first seven amino acids of the HIV-1 NC (MQRGNFR), containing two arginine residues, are sufficient for VLP reconstitution. The only study focusing on the assembly of Gag-dimerizing chimeras in vitro (14) showed that the presence of DLZ was not sufficient for the assembly of recombinant purified HIV-1 MACASP1-DLZ unless a cofactor, such as nucleic acid, was added. This observation is in agreement with our data as we also show the necessity of basic residues for the assembly. These results suggest that a nucleic acid binding domain, i.e., a stretch of basic residues (originating from either M-PMV NC or CREB) or the positively charged face of MA, is necessary for in vitro assembly of CANC and Gag, respectively. This is in accord with the other studies (5, 12, 50–52, 61, 62) demonstrating the requirement for basic residues for immature particle assembly in the presence of nucleic acids. In previously published studies the NC substitutions by DLZ or TIZ domains have been made in the context of the whole Gag polyprotein where the leucine zipper domains were positioned directly after the spacer peptides, i.e., SP1 in HIV-1 and SP in RSV (2, 14, 24, 62). In the light of the recent evidence for RSV (26), it is unlikely that the optimal placement of the dimerization domain controls the shape of Gag particles, as believed previously (24). The question of whether the immature particle assembly can be driven by dimeric or trimeric interactions, however, remains open. Given that the M-PMV ⌬ProCANC15 assembles in vitro when extended with basic residues while the same protein does not assemble when extended with oligomerization domains, it seems unlikely that strict stoichiometric interactions (e.g., dimerization or trimerization) are required. Instead we prefer a model in which initiation of immature particle assembly is driven by interactions between NC and RNA, in agreement with previously published data (5, 11, 12, 40, 50). These interactions with the nucleic acid bring CA molecules together and may trigger an allosteric effect through the SP-like sequence in the C terminus of CA, making it competent for immature assembly. Alternatively, NC-RNA interactions compensate for the entropic penalty associated with assembly and prevent the adoption of mature-assemblylike configuration of CA CTD by a simple steric restriction.
1986
´ ET AL. BOHMOVA
J. VIROL.
FIG. 10. Electron micrographs of 293T HEK cells expressing M-PMV wt (A), M-PMV GagCREB (B), M-PMV GagCREB10 (C), M-PMV Gag⌬10CREB (D), HIV-1 wt (E), HIV GagCREB (F), HIV GagCREB10 (G), and HIVGag ⌬10CREB (H).
In vivo assembly. Similarly to the results published for RSV and HIV-1, we found that NC replacement with DLZ in HIV-1 and M-PMV Gag polyproteins did not interfere with assembly. This is in contrast with the in vitro results reported here and
elsewhere for CA assembly. Clearly, additional domains within Gag, binding of Gag to the plasma membrane, or other cellular factors were able to augment assembly inside cells. However, a more detailed analysis of VLP morphology and
VOL. 84, 2010
HIV AND M-PMV ASSEMBLY INTERACTIONS
the assembly locus within the cell revealed remarkable differences, depending on the type of chimera and the virus used (summarized in Fig. 1C). A striking difference was found between CREB chimeras of M-PMV Gag. Chimeric M-PMV Gag with CREB and GagCREB10, both including the 10 basic upstream residues, formed spherical immature particles within the cytoplasm, i.e., followed the typical D pathway. On the other hand, M-PMV GagCREB chimeras lacking the basic N-terminal region resulted in a mix of regular and partially assembled particles, formed mainly at the plasma membrane. Although these proteins contain the signal for transport to the pericentriolar site (residing in the MA domain of Gag) (53, 56), the lack of interaction with nucleic acids disrupted cytoplasmic assembly and the unassembled protein eventually ended underneath the plasma membrane, where matrix interactions with the leaflet might partially compensate for the defect. Assembly of HIV-1 Gag chimeras revealed the necessity for a dimerization domain (additional to that found in CA) since the stretch of basic residues alone failed to assemble. This is rather surprising in the light of data demonstrating the importance of NC basic residues for HIV Gag multimerization despite their dispensability for Gag membrane binding (42). In the HIV case protein-protein interactions clearly dominate over nucleic acid binding, which is essential for M-PMV assembly. The difference may be due to the protein makeup of M-PMV and HIV-1 Gag polyproteins. M-PMV Gag contains the p12 protein that has been shown to be important for cytoplasmic assembly (28, 47–49, 54). Its internal scaffold domain (ISD) was capable of inducing intracytoplasmic assembly of HIV-1 when fused to Gag, which normally assembles at the plasma membrane (47). Our results show different requirements for assembly of M-PMV and HIV-1 ⌬ProCANC in vitro compared to the in vivo assembly of Gag. We propose that multimerization mediated by interactions of basic residues with nucleic acids brings CA molecules to sufficient proximity, perhaps to evoke some structural changes required for the initiation of assembly or simply to overcome the entropic penalty. This is consistent with the data demonstrating the requirement of oligonucleotides spanning at least two monomers of RSV CANC (35). In the case of whole Gag, the situation is more complex. In addition to CA and NC other domains of Gag are involved in the process. It is reasonable to hypothesize that M-PMV and HIV-1, i.e., retroviruses with different morphogenetic pathways, evolved different interacting domains to direct and drive either intracytoplasmic or membrane assembly, respectively. In M-PMV Gag, additional interacting motif p12, as an internal scaffolding domain, eliminates the requirement of membrane for Gag assembly as suggested by Sakalian et al. (47–49). In contrast to M-PMV, the MA-membrane interaction provides additional driving force and allows the assembly at the membrane which is the predominant pathway for retroviruses including HIV-1. Such complexity of Gag prevents any further dissection of individual interacting regions by using the chimeric Gag constructs. Our in vitro approach is one way to circumvent this limitation and address the role and evolution of self-assembling domains in retroviruses. ACKNOWLEDGMENTS We thank Jeremy Luban from University of Geneva for providing us with HIV-1 vector pSAX2. We are also grateful to Zdeneˇk Knejzlík
1987
from ICT, Prague, for GCN4 expression plasmid. We thank Romana ˇípova´ for critCubínkova´ for excellent technical assistance and Jana S ical reading of the manuscript. The work was supported by the Grant Agency of the Czech Republic, grant 204/09/1388 to M.R.; by the research project 1M0508 and Z40550506 from the Czech Ministry of Education to I.P.; MSM 6046137305, ME 904, National Institutes of Health, United States, grant CA 27834; and EUROCORES Programme EuroSCOPE of the European Science Foundation, European Commission contract no. ERAS-CT-2003-980409. REFERENCES 1. Accola, M. A., S. Hoglund, and H. G. Gottlinger. 1998. A putative alphahelical structure which overlaps the capsid-p2 boundary in the human immunodeficiency virus type 1 Gag precursor is crucial for viral particle assembly. J. Virol. 72:2072–2078. 2. Accola, M. A., B. Strack, and H. G. Gottlinger. 2000. Efficient particle production by minimal Gag constructs which retain the carboxy-terminal domain of human immunodeficiency virus type 1 capsid-p2 and a late assembly domain. J. Virol. 74:5395–5402. 3. Berkowitz, R., J. Fisher, and S. P. Goff. 1996. RNA packaging. Curr. Top. Microbiol. Immunol. 214:177–218. 4. Borsetti, A., A. Ohagen, and H. G. Gottlinger. 1998. The C-terminal half of the human immunodeficiency virus type 1 Gag precursor is sufficient for efficient particle assembly. J. Virol. 72:9313–9317. 5. Bowzard, J. B., R. P. Bennett, N. K. Krishna, S. M. Ernst, A. Rein, and J. W. Wills. 1998. Importance of basic residues in the nucleocapsid sequence for retrovirus Gag assembly and complementation rescue. J. Virol. 72:9034– 9044. 6. Briggs, J. A., K. Grunewald, B. Glass, F. Forster, H. G. Krausslich, and S. D. Fuller. 2006. The mechanism of HIV-1 core assembly: insights from threedimensional reconstructions of authentic virions. Structure 14:15–20. 7. Briggs, J. A., J. D. Riches, B. Glass, V. Bartonova, G. Zanetti, and H. G. Krausslich. 2009. Structure and assembly of immature HIV. Proc. Natl. Acad. Sci. U. S. A. 106:11090–11095. 8. Briggs, J. A., T. Wilk, R. Welker, H. G. Krausslich, and S. D. Fuller. 2003. Structural organization of authentic, mature HIV-1 virions and cores. EMBO J. 22:1707–1715. 9. Butan, C., D. C. Winkler, J. B. Heymann, R. C. Craven, and A. C. Steven. 2008. RSV capsid polymorphism correlates with polymerization efficiency and envelope glycoprotein content: implications that nucleation controls morphogenesis. J. Mol. Biol. 376:1168–1181. 10. Campbell, S., and A. Rein. 1999. In vitro assembly properties of human immunodeficiency virus type 1 Gag protein lacking the p6 domain. J. Virol. 73:2270–2279. 11. Campbell, S., and V. M. Vogt. 1995. Self-assembly in vitro of purified CA-NC proteins from Rous sarcoma virus and human immunodeficiency virus type 1. J. Virol. 69:6487–6497. 12. Cimarelli, A., S. Sandin, S. Hoglund, and J. Luban. 2000. Basic residues in human immunodeficiency virus type 1 nucleocapsid promote virion assembly via interaction with RNA. J. Virol. 74:3046–3057. 13. Cornilescu, C. C., F. Bouamr, X. Yao, C. Carter, and N. Tjandra. 2001. Structural analysis of the N-terminal domain of the human T-cell leukemia virus capsid protein. J. Mol. Biol. 306:783–797. 14. Crist, R. M., S. A. K. Datta, A. G. Stephen, F. Soheilian, J. Mirro, R. J. Fisher, K. Nagashima, and A. Rein. 2009. Assembly properties of human immunodeficiency virus type 1 Gag-leucine zipper chimeras: implications for retrovirus assembly. J. Virol. 83:2216–2225. 15. Ganser-Pornillos, B. K., A. Cheng, and M. Yeager. 2007. Structure of fulllength HIV-1 CA: a model for the mature capsid lattice. Cell 131:70–79. 16. Gitti, R. K., B. M. Lee, J. Walker, M. F. Summers, S. Yoo, and W. I. Sundquist. 1996. Structure of the amino-terminal core domain of the HIV-1 capsid protein. Science 273:231–235. 17. Gross, I., H. Hohenberg, C. Huckhagel, and H. G. Krausslich. 1998. Nterminal extension of human immunodeficiency virus capsid protein converts the in vitro assembly phenotype from tubular to spherical particles. J. Virol. 72:4798–4810. 18. Gross, I., H. Hohenberg, and H. G. Krausslich. 1997. In vitro assembly properties of purified bacterially expressed capsid proteins of human immunodeficiency virus. Eur. J. Biochem. 249:592–600. 19. Guo, X. F., J. Hu, J. B. Whitney, R. S. Russell, and C. Liang. 2004. Important role for the CA-NC spacer region in the assembly of bovine immunodeficiency virus Gag protein. J. Virol. 78:551–560. 20. Guo, X., A. Roldan, J. Hu, M. A. Wainberg, and C. Liang. 2005. Mutation of the SP1 sequence impairs both multimerization and membrane-binding activities of human immunodeficiency virus type 1 Gag. J. Virol. 79:1803–1812. 21. Harbury, P. B., T. Zhang, P. S. Kim, and T. Alber. 1993. A switch between two-, three-, and four-stranded coiled coils in GCN4 leucine zipper mutants. Science 262:1401–1407. 22. Harbury, P. B., P. S. Kim, and T. Alber. 1994. Crystal structure of an isoleucine-zipper trimer. Nature 371:80–83.
1988
´ ET AL. BOHMOVA
23. Henderson, L. E., R. Sowder, G. Smythers, R. E. Benveniste, and S. Oroszlan. 1985. Purification and N-terminal amino acid sequence comparisons of structural proteins from retrovirus-D/Washington and Mason-Pfizer monkey virus. J. Virol. 55:778–787. 24. Johnson, M. C., H. M. Scobie, Y. M. Ma, and V. M. Vogt. 2002. Nucleic acid-independent retrovirus assembly can be driven by dimerization. J. Virol. 76:11177–11185. 25. Kanamoto, T., Y. Kashiwada, K. Kanbara, K. Gotoh, M. Yoshimori, T. Goto, K. Sano, and H. Nakashima. 2001. Anti-human immunodeficiency virus activity of YK-FH312 (a betulinic acid derivative), a novel compound blocking viral maturation. Antimicrob. Agents Chemother. 45:1225–1230. 26. Keller, P. W., M. C. Johnson, and V. M. Vogt. 2008. Mutations in the spacer peptide and adjoining sequences in Rous sarcoma virus Gag lead to tubular budding. J. Virol. 82:6788–6797. 27. Kingston, R. L., T. Fitzon-Ostendorp, E. Z. Eisenmesser, G. W. Schatz, V. M. Vogt, C. B. Post, and M. G. Rossmann. 2000. Structure and selfassociation of the Rous sarcoma virus capsid protein. Structure 8:617–628. 28. Knejzlík, Z., Z. Sme´kalova ´, T. Ruml, and M. Sakalian. 2007. Multimerization of the p12 domain is necessary for Mason-Pfizer monkey virus Gag assembly in vitro. Virology 365:260–270. 29. Krausslich, H. G., M. Facke, A. M. Heuser, J. Konvalinka, and H. Zentgraf. 1995. The spacer peptide between human immunodeficiency virus capsid and nucleocapsid proteins is essential for ordered assembly and viral infectivity. J. Virol. 69:3407–3419. 30. Li, F., R. Goila-Gaur, K. Salzwedel, N. R. Kilgore, M. Reddick, C. Matallana, A. Castillo, D. Zoumplis, D. E. Martin, J. M. Orenstein, G. P. Allaway, E. O. Freed, and C. T. Wild. 2003. PA-457: a potent HIV inhibitor that disrupts core condensation by targeting a late step in Gag processing. Proc. Natl. Acad. Sci. U. S. A. 100:13555–13560. 31. Li, S., C. P. Hill, W. I. Sundquist, and J. T. Finch. 2000. Image reconstructions of helical assemblies of the HIV-1CA protein. Nature 407:409–413. 32. Liang, C., J. Hu, J. B. Whitney, L. Kleiman, and M. A. Wainberg. 2003. A structurally disordered region at the C terminus of capsid plays essential roles in multimerization and membrane binding of the Gag protein of human immunodeficiency virus type 1. J. Virol. 77:1772–1783. 33. Lupas, A. 1996. Coiled coils: new structures and new functions. Trends Biochem. Sci. 21:375–382. 34. Ma, Y. M., and V. M. Vogt. 2002. Rous sarcoma virus Gag protein-oligonucleotide interaction suggests a critical role for protein dimer formation in assembly. J. Virol. 76:5452–5462. 35. Ma, Y. M., and V. M. Vogt. 2004. Nucleic acid binding-induced Gag dimerization in the assembly of Rous sarcoma virus particles in vitro. J. Virol. 78:52–60. 36. Macek, P., J. Chmelik, I. Krizova, P. Kaderavek, P. Padrta, L. Zidek, M. Wildova, R. Hadravova, R. Chaloupkova, I. Pichova, T. Ruml, M. Rumlova, and V. Sklenar. 2009. NMR structure of the N-terminal domain of capsid protein from the Mason-Pfizer monkey virus. J. Mol. Biol. 392:100–114. 37. Mammano, F., A. Ohagen, S. Hoglund, and H. G. Gottlinger. 1994. Role of the major homology region of human immunodeficiency virus type 1 in virion morphogenesis. J. Virol. 68:4927–4936. 38. Melamed, D., M. Mark-Danieli, M. Kenan-Eichler, O. Kraus, A. Castiel, N. Laham, T. Pupko, F. Glaser, N. Ben-Tal, and E. Bacharach. 2004. The conserved carboxy terminus of the capsid domain of human immunodeficiency virus type 1 Gag protein is important for virion assembly and release. J. Virol. 78:9675–9688. 39. Mortuza, G. B., L. F. Haire, A. Stevens, S. J. Smerdon, J. P. Stoye, and I. A. Taylor. 2004. High-resolution structure of a retroviral capsid hexameric amino-terminal domain. Nature 431:481–485. 40. Muriaux, D., J. Mirro, D. Harvin, and A. Rein. 2001. RNA is a structural element in retrovirus particles. Proc. Natl. Acad. Sci. U. S. A. 98:5246–5251. 41. Nermut, M. V., P. Bron, D. Thomas, M. Rumlova, T. Ruml, and E. Hunter. 2002. Molecular organization of Mason-Pfizer monkey virus capsids assembled from Gag polyprotein in Escherichia coli. J. Virol. 76:4321–4330. 42. Ono, A., A. A. Waheed, A. Joshi, and E. O. Freed. 2005. Association of human immunodeficiency virus type 1 Gag with membrane does not require highly basic sequences in the nucleocapsid: use of a novel Gag multimerization assay. J. Virol. 79:14131–14140. 43. Pepinsky, R. B., I. A. Papayannopoulos, E. P. Chow, N. K. Krishna, R. C. Craven, and V. M. Vogt. 1995. Differential proteolytic processing leads to
J. VIROL.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
multiple forms of the CA protein in avian sarcoma and leukemia viruses. J. Virol. 69:6430–6438. Phillips, J. M., P. S. Murray, D. Murray, and V. M. Vogt. 2008. A molecular switch required for retrovirus assembly participates in the hexagonal immature lattice. EMBO J. 27:1411–1420. Rumlova, M., T. Ruml, J. Pohl, and I. Pichova. 2003. Specific in vitro cleavage of Mason-Pfizer monkey virus capsid protein: evidence for a potential role of retroviral protease in early stages of infection. Virology 310: 310–318. Rumlova-Klikova, M., E. Hunter, M. V. Nermut, I. Pichova, and T. Ruml. 2000. Analysis of Mason-Pfizer monkey virus gag domains required for capsid assembly in bacteria: role of the N-terminal proline residue of CA in directing particle shape. J. Virol. 74:8452–8459. Sakalian, M., S. S. Dittmer, A. D. Gandy, N. D. Rapp, A. Zabransky, and E. Hunter. 2002. The Mason-Pfizer monkey virus internal scaffold domain enables in vitro assembly of human immunodeficiency virus type 1 Gag. J. Virol. 76:10811–10820. Sakalian, M., and E. Hunter. 1999. Separate assembly and transport domains within the Gag precursor of Mason-Pfizer monkey virus. J. Virol. 73:8073–8082. Sakalian, M., and N. D. Rapp. 2006. Rescue of internal scaffold-deleted Mason-Pfizer monkey virus particle production by plasma membrane targeting. Virology 345:317–327. Sandefur, S., R. M. Smith, V. Varthakavi, and P. Spearman. 2000. Mapping and characterization of the N-terminal I domain of human immunodeficiency virus type 1 Pr55(Gag). J. Virol. 74:7238–7249. Sandefur, S., V. Varthakavi, and P. Spearman. 1998. The I domain is required for efficient plasma membrane binding of human immunodeficiency virus type 1 Pr55(Gag). J. Virol. 72:2723–2732. Schmalzbauer, E., B. Strack, J. Dannull, S. Guehmann, and K. Moelling. 1996. Mutations of basic amino acids of NCp7 of human immunodeficiency virus type 1 affect RNA binding in vitro. J. Virol. 70:771–777. Sfakianos, J. N., R. A. LaCasse, and E. Hunter. 2003. The M-PMV cytoplasmic targeting-retention signal directs nascent Gag polypeptides to a pericentriolar region of the cell. Traffic 4:660–670. Sommerfelt, M. A., S. S. Rhee, and E. Hunter. 1992. Importance of p12 protein in Mason-Pfizer monkey virus assembly and infectivity. J. Virol. 66:7005–7011. Ulbrich, P., S. Haubova, M. V. Nermut, E. Hunter, M. Rumlova, and T. Ruml. 2006. Distinct roles for nucleic acid in in vitro assembly of purified Mason-Pfizer monkey virus CANC proteins. J. Virol. 80:7089–7099. Vlach, J., J. Lipov, M. Rumlova, V. Veverka, J. Lang, P. Srb, Z. Knejzlik, I. Pichova, E. Hunter, R. Hrabal, and T. Ruml. 2008. D-retrovirus morphogenetic switch driven by the targeting signal accessibility to Tctex-1 of dynein. Proc. Natl. Acad. Sci. U. S. A. 105:10565–10570. von Schwedler, U. K., T. L. Stemmler, V. Y. Klishko, S. Li, K. H. Albertine, D. R. Davis, and W. I. Sundquist. 1998. Proteolytic refolding of the HIV-1 capsid protein amino-terminus facilitates viral core assembly. EMBO J. 19:2391. von Schwedler, U. K., K. M. Stray, J. E. Garrus, and W. I. Sundquist. 2003. Functional surfaces of the human immunodeficiency virus type 1 capsid protein. J. Virol. 77:5439–5450. Wiegers, K., G. Rutter, H. Kottler, U. Tessmer, H. Hohenberg, and H. G. Krausslich. 1998. Sequential steps in human immunodeficiency virus particle maturation revealed by alterations of individual Gag polyprotein cleavage sites. J. Virol. 72:2846–2854. Wright, E. R., J. B. Schooler, H. J. Ding, C. Kieffer, C. Fillmore, W. I. Sundquist, and G. J. Jensen. 2007. Electron cryotomography of immature HIV-1 virions reveals the structure of the CA and SP1 Gag shells. EMBO J. 26:2218–2226. Yu, F., S. M. Joshi, Y. M. Ma, R. L. Kingston, M. N. Simon, and V. M. Vogt. 2001. Characterization of Rous sarcoma virus Gag particles assembled in vitro. J. Virol. 75:2753–2764. Zhang, Y., H. Qian, Z. Love, and E. Barklis. 1998. Analysis of the assembly function of the human immunodeficiency virus type 1 Gag protein nucleocapsid domain. J. Virol. 72:1782–1789. Zhou, J., C. H. Chen, and C. Aiken. 2004. The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to the small molecule maturation inhibitor 3-O-{3⬘,3⬘-dimethylsuccinyl}-betulinic acid. Retrovirology 1:15.
