Effect of Epigenetic Modifications of Donor Somatic Cells on the ...

BIOLOGY OF REPRODUCTION 78, 832–840 (2008) Published online before print 16 January 2008. DOI 10.1095/biolreprod.107.066662

Effect of Epigenetic Modifications of Donor Somatic Cells on the Subsequent Chromatin Remodeling of Cloned Bovine Embryos1 Angelica M. Giraldo,3,5 Darin A. Hylan,3 Casey B. Ballard,3 Megan N. Purpera,3 Todd D. Vaught,5 John W. Lynn,4 Robert A. Godke,3 and Kenneth R. Bondioli2,3 School of Animal Sciences,3 Louisiana State University Agricultural Center, Baton Rouge, Louisiana 70803 Department of Biological Sciences,4 Louisiana State University, Baton Rouge, Louisiana 70803 Revivicor, Inc.,5 Blacksburg, Virginia 24060 cloning is manifested by elevated abortion rates, perinatal death, and a high incidence of postnatal abnormalities [1]. Aborted and deceased newborn cloned animals have been characterized by aberrant expression of imprinted genes [2, 3]. These observations indicate that incomplete epigenetic reprogramming may be responsible for the developmental failure and abnormal phenotypes noted in cloned animals [4]. In normally fertilized embryos, methylation patterns of the maternal and paternal genome are erased before implantation. Active demethylation of the paternal genome before the onset of the first DNA replication is catalyzed by DNA demethyltransferases, whereas the maternal genome is progressively demethylated with each cleavage division [5–7]. In bovine embryos, shortly after the demethylation process occurs, a wave of global de novo methylation is observed from the 8-cell to the 16-cell stage, establishing a new embryonic methylation pattern [8–10]. This de novo methylation is catalyzed by the DNA methyltransferases (DNMTs) DNMT3A and 3B, which can have overlapping functions during early embryogenesis [11]. Patterns imposed on the genome by the de novo DNMTs at defined developmental time points are maintained by DNMT1 and lead to predetermined programs of gene expression during embryo development [12]. In comparison, it has been proposed that failure of the DNA to demethylate and remethylate causes incomplete nuclear reprogramming in cloned embryos [6]. The highly methylated pattern characteristic of the somatic donor cells could play a significant role in the epigenetic anomalies observed in cloned animals [13]. Moreover, the common procedure of NT by cell fusion potentially introduces the somatic form of DNMT1, which is not normally present in preimplantation embryos. This maintenance DNMT could be operating to perpetuate the somatic-like methylation patterns in early cloned embryos [6]. The nuclei of cloned embryos appear to be considerably demethylated after the first division. However, the mechanism responsible for this initial reduction in DNA methylation is unclear. After the 2-cell stage, bovine cloned embryos do not appear to undergo further demethylation, unlike normally fertilized embryos. Interestingly, premature, but incomplete, de novo methylation was noted by the 4-cell or 8-cell stage in NT-derived bovine embryos [9]. The persistence of a somatic cell methylation pattern after fusion, at a time when parental genomes normally undergo a drastic demethylation process, may have deleterious effects on the developmental potential of cloned embryos [14]. Several studies have evaluated DNA methylation and DNMT mRNA levels of in vivo and cloned bovine embryos from the pronuclear to the blastocyst stage [6, 8, 9, 13]. However, investigation of the reprogramming events that occur at later preimplantation stages is currently limited to the mouse [11]. Temporal and spatial differences in the DNA methylation pattern of embryos have been reported between mammalian

ABSTRACT Evidence indicates that failure of nuclear transfer (NT) embryos to develop normally can be attributed, at least partially, to the use of differentiated cells as the donor karyoplast. Blastocyst production and development to term of cloned embryos has been hypothesized to differ between population doublings of the same cell line as a consequence of changes in the levels of DNA methyltransferase 1 (DNMT1) and methylated DNA during in vitro culture. The objective of this study was to determine embryo production, developmental potential, and gene expression patterns of prehatched and posthatched embryos generated using donor cells with different levels of DNMT1 transcript. Day 7 embryos generated using donor cells with high and low levels of DNMT1 mRNA were transferred to recipient cows. Embryos recovered on Day 13 were morphologically characterized or used for gene expression analysis of DNMT, INFT, and MHC1. A higher proportion of 8- to 16-cell embryos developed to the blastocyst stage when cells with low levels of DNMT1 mRNA were used as donor nuclei. Day 13 NT embryos generated using donor cells with decreased levels of DNMT1 mRNA and capable of developing beyond the 8- to 16cell stage produced a larger number of apparently developing embryos, larger conceptuses, and a higher expression of DNMT3A transcript than NT embryos reconstructed using cells with high levels of DNMT1 mRNA. However, abnormal gene expression of DNMT, INFT, and MHC1 was noted in the majority of cloned embryos, indicating inefficient nuclear reprogramming and retarded embryo development. Furthermore, aberrant DNMT1 expression may partially contribute to the inefficient nuclear reprogramming observed in cloned embryos. chromatin remodeling proteins, cloning, early development, gene regulation, methyltransferases, preimplantation embryos

INTRODUCTION Although mammalian cloning by somatic cell nuclear transfer (SCNT) has been achieved in numerous species, the overall efficiency is still relatively low (only 2%–10% of reconstructed embryos develop to term). The inefficiency of 1 Supported by grants from the Louisiana State University Board of Regents through the Board of Regents Support Fund (contract LEQSF 2005-07-RD-A-01). Approved for publication by the Director of the Louisiana Agricultural Experimental Station as manuscript 07-18-0266. 2 Correspondence: Kenneth R. Bondioli, Louisiana State University, 105 Francioni Hall, Baton Rouge, LA 70803. FAX: 225 578 3279; e-mail: kbondioli@agcenter.lsu.edu

Received: 20 November 2007. First decision: 11 December 2007. Accepted: 2 January 2008. Ó 2008 by the Society for the Study of Reproduction, Inc. ISSN: 0006-3363. http://www.biolreprod.org

832

EPIGENETIC MODIFICATIONS OF CLONED BOVINE EMBRYOS

species [14], suggesting that the reprogramming process may differ from that in mouse embryos. Although in vivo and cloned embryos undergo drastic changes in the chromatin configuration during the first cleavages, data indicate that a highly significant number of specific genes, including interferon tau (INFT) [15] and pregnancy-associated glycoproteins [16], become up-regulated during the period from blastogenesis through implantation. In contrast, other genes, such as the major histocompatibility complex class 1 (MHC1) [17], are downregulated during this stage. A vast number of genes change their expression levels during this period to support the complex mechanisms of embryogenesis and implantation [15, 18]. Blelloch et al. [19] showed that knockout of DNMT1 mRNA in mouse cells has a positive effect on the efficiency of cloned embryos and/or generation of stem cells from these embryos. These results indicate that the use of donor cells with low levels of DNMT1 transcript may facilitate nuclear reprogramming due to the reestablishment of the conditions that permit the removal of heritable features affecting gene expression from differentiated cells during NT. Previous studies have demonstrated that epigenetic marks can be modified by culturing somatic cells for an extended period of time. Enright et al. [20] and Wilson and Jones [21] reported increased levels of acetylated histones and decreased levels of methylated DNA, respectively, in cells cultured for extended periods. Additionally, a significant decline in mRNA coding for DNMT1 was observed in cells at late population doublings (PDs) when compared with cultured fibroblasts at early PDs [22, 23]. Consequently, replating cells, a standard culture technique, can be used to generate cells containing low concentrations of DNMT1 mRNA. Since time in culture may reduce the gene expression of DNMT1 in somatic cells, this study examined the development potential of cloned bovine embryos reconstructed using somatic cells at early and late PD. Additionally, we investigated the expression of DNMT1, DNMT3A, DNMT3B, INFT, and MHC1 transcripts in cloned and in vivo embryos in prehatching and posthatching stages. To our knowledge, this is the first analysis of the effect of using donor cells with low levels of DNMT1 mRNA on the subsequent chromatin remodeling of cloned embryos beyond the blastocyst stage. MATERIALS AND METHODS Establishment of the Cell Line The primary fibroblast culture was established from a 50-day-old bovine fetus recovered from a local abattoir. Skin from the decapitated and eviscerated fetus was cut into 1-mm2 pieces and washed three times in Dulbecco PBS (dPBS, Gibco) containing 100 U/ml of penicillin and 100 lg/ml of streptomycin. The cell line was established by enzymatic dissociation. Briefly, the tissue pieces were placed in a conical tube with Dulbecco modified Eagle medium with high glucose (DMEM, Gibco) containing 0.5% of collagenase type I in 5% CO2 at 398C for 3 h. DMEM with 10% calf serum (CS) was added to inactivate the collagenase, and the cell suspension was centrifuged at 350 3 g for 5 min. Cells were resuspended in DMEM supplemented with 10% CS, penicillin, and streptomycin and cultured in 25-cm2 flasks under 5% CO2 and 90% humidity at 398C.

Maintenance and Cryopreservation of the Cell Line Cells were passaged upon reaching 90% confluence by enzymatic dissociation, counted using a hemacytometer, and reseeded at an initial concentration of 1 3 105 cells per 25-cm2 flask. PDs were calculated [24] at every passage using the following equation: log (final concentration/initial concentration) 3 3.33. Fibroblast cells were frozen and thawed at approximately PDs 2 and 32. For cell freezing, the fibroblasts were resuspendend in DMEM supplemented with 10% CS and 10% dimethyl sulfoxide and cooled at 1.08C/min until reaching 808C and then were stored in liquid nitrogen. Approximately

833

5 3 105 cells were frozen in 0.5 ml of freezing medium per cryovial. Cells were thawed by holding the cryovial for 10 sec at room temperature followed by submersion in a 388C water bath. Thawed cells were washed once in culture medium before being replated. Cells were cultured and synchronized in G0/G1 phase by contact inhibition for 7 days prior to being used as donor karyoplasts for NT or RNA isolation.

Karyotypic Analysis The chromosome number of fibroblasts was analyzed at early and late PDs. Twenty-four hours prior to the karyotypic analysis, cultured cells were trypsinized and passaged, with an initial concentration of 500 000 cells per flask. Actively dividing cells were synchronized with colcemid (0.05 lg/ml) for 20 min. The cell monolayer was then trypsinized, incubated with a hypotonic solution (sodium citrate) for 5 min at 388C, and fixed with acetic acid:methanol (1:3) for 24 h at 208C. Cells were washed in cold, fresh fixative, and three drops containing fixed cells were placed on precleaned slides held at room temperature. Chromosomes were stained with Giemsa (0.4%) for 15 min. Spreads were carefully selected to avoid miscounting of chromosomes. Overlapped and overspread metaphases were not included in the analysis. A digital picture of selected metaphases was taken. Images of chromosomal spreads were taken using bright field microscopy with a 3100 objective. Chromosomes were counted in each image using Adobe Photoshop 6.0. Sixty spread images were analyzed for each PD.

Production of Cloned Embryos Cumulus-oocyte complexes were obtained from a commercial supplier (Concho Valley Genetics, TX). Oocytes were denuded in a hyaluronidase solution (2 mg/ml) 19 h postmaturation (hpm). Prior to enucleation, oocytes with a visible polar body were incubated for 10 min in holding medium (130 mM NaCl, 3.1 mM KCl, 5.0 mM NaHCO3, 10 mM HEPES, 0.4 mM Na Pyruvate, essential amino acids [basal medium Eagle], nonessential amino acids [minimum essential medium], 3 mg/ml BSA, 100 U/ml penicillin, 100 lg/ ml streptomycin, and 10 lg/ml phenol red) supplemented with 3.5 lg/ml of Hoechst 33342. After incubation, mature oocytes were enucleated in holding medium containing 7.5 lg/ml of cytochalasin B. Removal of the metaphase plate was confirmed by exposure of the aspirated cytoplasm to UV light. A single bovine fibroblast cell in presumptive G0/G1 phase at PD 5 or 35 was introduced into the perivitelline space of each enucleated oocyte. At 24 hpm, couplets were placed in a fusion medium containing 260 mM of mannitol, 0.2 mM of MgSO4, 0.5 mM of Hepes, and 0.1% of polyvinyl alcohol (PVA). Fusion was induced with two DC pulses of 1.12 kV/cm for 15 lsec each, delivered by a BTX Electro Cell Manipulator 200 (Biotechnologies and Experimental Research, Inc., San Diego, CA). After fusion, reconstructed embryos were cultured for 2–3 h in CR1aa medium [25] containing 2.5 lg/ml of cytochalasin B. Couplets were activated 26–27 hpm with 5 lM ionomycin for 4 min followed by 4 h of culture in CR1aa plus 2 mM dimethylaminopurine and 7.5 lg/ml cytochalasin B. Reconstructed embryos were cultured in CR1aa medium supplemented with 0.52 mM glycine and 0.5 mM alanine at 398C in 5% CO2, 5% O2, and 90% N2. On Day 3, embryos were transferred to fresh medium containing 5% CS. Embryos that reached the blastocyst stage were used for gene expression analysis, cell counting, or embryo transfer. Six replicates per treatment (NT embryos generated using donor cells at PD 5 or 35) were performed.

Differential Staining Day 8 blastocysts were incubated in dPBS containing 10 lg/ml of Hoechst 33342 for 30 min. Following permeabilization with 0.04% Triton X-100 for 3 min, embryos were counterstained using 25 lg/ml of propidium iodide (PI) for 5 min. Stained embryos were mounted onto a glass microscope slide in a drop of 25% glycerol, gently flattened with a coverslip, and visualized for cell counting. The number of trophectoderm (TE; nucleus stained with PI) and inner cell mass cells (ICM; nucleus stained with Hoechst) was determined using an epifluorescent microscope equipped with a UV filter cube.

Transfer and Collection of Cloned Embryos Cloned blastocysts reconstructed with cells at PD 5 (NT-5) or 35 (NT-35) were transferred into naturally synchronized crossbred cows. Four embryo transfers per treatment were performed. Cloned embryos were collected on Day 13 postestrus. The recovered embryos were morphologically evaluated and used for gene expression analysis.

834

GIRALDO ET AL.

TABLE 1. Primers used for Q-PCR analysis. Gene DNMT1

NM_182651

DNMT3A

XM_86764

DNMT3B

AY244711

INFT

M31558

MHC1

X92870

PAP

X63436

a

Primersa

GenBank accession no. F: R: F: R: F: R: F: R: F: R: F: R:

Amplicon length (bp)

CCGACACCTAAACACAAAGC TTAGTTCTCTGTATGTAGTTCTGC GGACAAGAATGCCACCAAAG AACCACATGACCCAACGAG GGGAAGGAGTTTGGAATAGGAG CGGAGAACTTGCCATCACC GGCATCCATGTCTACCTGAAAG AGTAATTGAATCGGTGGCTGAAG GGGAGGACCAGACGCAGGAC CCAGTGACCACGAGGAGAACC AAGCAACTCCATCAACTACTG ACGGACTGGTCTTCATAGC

244 183 160 244 229 169

F, Forward; R, reverse.

Collection of In Vivo Embryos Superovulation was induced in 35 crossbred cows using a standard protocol. Donors exhibiting estrus behavior were artificially inseminated at 12 and 24 h postestrus. A nonsurgical embryo recovery was performed on Day 7, 10, 12, or 13 following the onset of standing estrus. A portion of the in vivo embryos collected on Day 7 postestrus were transferred into three naturally synchronized cows and again recovered on Day 13 as an embryo transfer (ET) control (in vivo-ET). Embryos were held in a commercial embryo holding medium (Holding Plus; BIONICHE, Pullman, WA) for a period of 1 to 2 h at 378C until storage for further gene expression analysis.

RNA Isolation and RT-PCR Pools of 1000 donor cells at PDs 5 and 35 (in presumptive G0/G1 phase of the cell cycle), pools of two embryos (Days 7, 10, and 12), or single embryos (Day 13) were stored at 808C in a volume of 3–5 ll of washing medium (PBS and 1% PVA) in siliconized tubes. Poly(A)þ RNA was isolated from somatic cells, in vivo and cloned embryos using Dynabeads (Dynal Biotech, Lake Success, NY) as previously described [26] and immediately used for reverse transcription (RT). Reverse transcription was carried out in a total volume of 20 ll using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc., Hercules, CA) according to the manufacturer’s instructions. The iScript RT Reaction Mix contained 4 ll of iScript reaction mix, 1 ll of reverse transcriptase, 4 ll of nuclease-free water, and 11 ll of mRNA. A reaction mix was formulated for the sample and for a no-reverse-transcriptase control reaction.

Real-Time PCR PCR primers for the amplification of DNMT1, DNMT3A, DNMT3B, INFT, MHC1, and poly(A) polymerase (PAP) transcripts were designed from bovine gene sequences using the Beacon Designer 4.0 (PREMIER Biosoft International; Table 1). Complementary DNA was amplified using iQ SYBR Green Supermix in the MyiQ Reverse Transcription PCR Detection System (Bio-Rad Laboratories, Inc.). The real-time PCR mix (25 ll) consisted of 5 ll of cDNA, 12.5 ll of SYBR green master mix, 5.5 ll of nuclease-free water, and 1 ll each of forward and reverse primers (10 qmol) for each gene. A reaction mix was formulated for the sample and for a no-reverse-transcriptase control reaction. The program used for the amplification of all genes consisted of a denaturing cycle of 3 min at 958C; 40 cycles of PCR (958C for 10 sec, 558C for 45 sec, and 958C for 1 min); a melting curve analysis consisting of 958C for 1 min followed by 558C for 1 min; a step cycle starting at 558C for 10 sec with a 0.58C/sec transition rate; and cooling at 48C. Final quantification was performed using a comparative CT method [27] and was reported as relative transcription or the n-fold difference relative to a calibrator. A mixture of RNA from Day 7 and Day 13 embryos and somatic cells was used as calibrator for all the target genes. PAP was used as an endogenous control gene. Briefly, the signal of the reference gene PAP was used to normalize the target gene signals of each sample. The amount of target transcripts relative to the calibrator was calculated by 2DDCT. Therefore, all target gene transcription was expressed as an n-fold difference relative to the calibrator. Ten replicates per gene, treatment, and developmental stage were performed.

PCR Validation A mixture of RNA from somatic cells and Day 7 and Day 13 embryos was used to validate and optimize the PCR procedures used in this study.

Briefly, cDNA was amplified with primers specific for DNMT1, DNMT3A, DNMT3B, INFT, MHC1, and PAP transcripts. PCR products were electrophoresed on an agarose gel and sequenced to confirm the amplification of the proper product. To demonstrate that the primers amplified only cDNA and not genomic DNA, 1 ng of genomic DNA was used as a template for the amplification of the target genes. No products were recovered after RT-PCR. In order to determine if the primers amplified a single product in a quantitative manner, efficiency levels, correlation coefficients, and melting curves of cDNA at five different dilutions were analyzed by quantitative-PCR. All the target genes led to efficiencies between 90%–97% and correlation coefficients of 0.98–1.00.

Immunolabeling of Methylated DNA Total methylated DNA was detected by immunolabeling with anti-5methylcytidine antibodies. Briefly, cells at 100% confluence were trypsinized, pelleted by centrifugation, and washed in dPBS (Caþ2 and Mgþ2 free). Cells were permeabilized by incubation in a dPBS solution supplemented with 1% BSA and 0.1% Tween 20 (PBST-BSA). Cells were fixed with 0.25% paraformaldehyde in dPBS for 10 min at 378C followed by the addition of 88% methanol previously refrigerated at 208C. After two washes with PBST-BSA at room temperature, cells were treated with 2N HCl at 378C for 30 min, followed by incubation in 0.1 M borate buffer (pH 8.5) for 5 min. Nonspecific binding sites were blocked with 1% BSA in PBS. Fibroblasts were incubated with a mouse anti-5-methylcytidine antibody (1 ng/ml; Serotec, Raleight, NC) for 30 min at room temperature, followed by labeling with a goat anti-mouse IgG conjugated with Alexa Fluor 488 (40 lg/ml; Molecular Probes, Eugene, OR). After labeling with the second antibody, cells were counter stained in a solution containing 10 lg/ml of PI and RNase (10 lg/ml) for 30 min at room temperature. Cells were then washed and resuspended in PBS for flow cytometric analysis. Specificity of the primary antibodies for nuclear epitopes was determined with epifluorescence microscopy.

Flow Cytometric Analysis of Methylated DNA Determination of the relative levels of methylated DNA was performed in a FACSAria (Becton Dickinson Immunocytometry Systems, San Jose, CA). Labeled cells were excited at 488 nm with a 13-mW laser. A 610-nm dichroic mirror (beam splitter) and a 610/20 nm band pass filter were used to detect PI levels. Difference in DNA content was used to gate cells in G0/G1 phase. Relative levels of methylated DNA of cells in G0/G1 phase were detected with a band pass filter of 530/30 nm. A minimum of 10 000 cells at PDs 5 and 35 were analyzed. Relative levels of fluorescence were reported as arbitrary fluorescence units (AFU). Six replicates per PD were performed.

Statistical Analysis Data were analyzed using SigmaStat Statistical Software Version 3.5 (Systat Software, Richmond, CA). Differences in the level of aneuploidies between PDs, cleavage rates, and blastocyst development between NT-5 and NT-35 were analyzed using chi-square. This test was also used to detect differences in the recovery rate of embryos at Day 13 between in vivo and cloned embryos generated using cells at different PDs. Cell number, ICM:TE ratio, embryo size, and gene expression levels of donor cells and embryos were tested for normality and equal variance using Kolmogorov-Smirnov and Levene tests, respectively. ANOVA, followed by Tukey test, was used to detect differences in gene expression levels of donor cells and in vivo embryos at Days 7, 12, and 13. The same test was used to detect differences in methylation

835

EPIGENETIC MODIFICATIONS OF CLONED BOVINE EMBRYOS TABLE 2. Embryonic development of cloned embryos generated using cells at different population doublings. Blastocystz Treatment

No. of oocytes

NT-5 NT-35

Fused couplets (%) a

499 457

Cleaved* (%) a

357 (71.5) 385 (84.2)b

8–16 Cell* (%) a

287 (80.4) 212 (55.1)b

205 (57.4) 107 (27.8)b

From fused (%) a

141 (39.5) 86 (22.3)b

From 8–16 cell (%) 141 (68.8)a 86 (80.4)b

* From the percentage of fused couplets. Seventy-two hours postfusion. z Total blastocysts at Day 8. a,b Different letters within columns indicate significant difference between treatments.

levels of fibroblasts at PDs 5 and 35, cell number and cell ratio of NT-5 and NT-35 embryos, and the size of in vivo and cloned embryos. The 95% confidence intervals for the gene expression levels of in vivo embryos were calculated. If transcription levels of individual cloned embryos did not fall within the confidence interval for the in vivo embryos they were considered abnormal.

RESULTS Transcript Levels for DNMT in Donor Cells The transcript levels of DNMTs changed during the in vitro culture period of bovine fibroblasts. A 35% reduction in the expression of DNMT1 was observed in cells at PD 35 when compared with cells at PD 5. Similarly, levels of DNMT3A transcript were higher in cells at PD 5 (0.5-fold increase) than in cells at late PDs. However, DNMT3B mRNA remained constant (Fig. 1). Transcript levels for DNMT1 and DNMT3A were more abundant than DNMT3B transcripts at both PDs analyzed. Level of Methylated DNA in Donor Cells Levels of methylated DNA decreased with time in culture in the cell line analyzed. Level of methylated DNA of cells in G0/G1 phase was significantly lower in fibroblasts at PD 35 than in cells at PD 5 (2698 6 860 vs. 5969 6 1269 AFU, respectively; P , 0.001). An approximately 0.55-fold decrease in the level of DNA methylation of cells at late vs. early PD indicates that time in culture may induce reduction in the level of DNMT1 and subsequent DNA hypomethylation of the cells.

were higher when cells at PD 35 were used as donor karyoplast (71.5% vs. 84.2%). Of the fused couplets, embryos reconstructed with cells at early PDs generated a significantly higher proportion of cleaved and 8- to 16-cell embryos than those reconstructed with cells at PD 35 (80.4% and 57.4% vs. 55.1% and 27.8%, respectively). The percentage of blastocysts, calculated from the total number of fused couplets, was higher when donor cells at PD 5 were used (39.5% vs. 22.3%). However, a higher proportion of embryos that reached the premorula stage (8–16 cells) developed to blastocysts when fibroblasts at PD 35 were used compared with fibroblasts at PD 5 (80.4% vs. 68.8%; Table 2). The mean total cell number in blastocysts reconstructed with cells at PD 5 (102 6 13.2) was similar to that of blastocysts generated using fibroblasts at PD 35 (81 6 4.8). Additionally, there was no statistical difference in the number of ICM or TE cells between treatment groups. However, the ICM:TE ratio differed between NT-5 and NT-35 embryos (1:2.7 vs. 1:1.9; Table 3). The number of ICM and TE cells as well as the total cell number and ICM:TE ratio of cloned embryos were not statistically different compared with the in vivo control group. Embryo Collection and Growth Only hatched and apparently normally developing embryos (past the blastocyst stage) were included in this analysis. The percentage of embryos recovered on Day 13 differed significantly between treatments. Lower embryo recovery rates

Chromosomal Stability of Somatic Cells Aneuploidies of cells at PD 5 were significantly lower than cells after their 35th division (23.3% vs. 50.0%, respectively). Of the cells with an abnormal chromosome number, 98.4% were hypoploid (loss of one or more chromosomes, 60 – X) and 1.6% were hyperploid (gain of chromosomes, 60 þ X). Embryo Development and Cell Number A total of 357 and 385 bovine enucleated cytoplasts were reconstructed with cells at PD 5 or 35, respectively. Fusion rates TABLE 3. Cell number of cloned embryos 8 days after reconstruction with donor cells at population doubling 5 and 35.* No. of Treatment embryos NT-5 NT-35 In vivo

20 20 10

ICM

TE

ICM:TE

Total cells a

102 6 13.2 29 6 4.1 73 6 9.5 1:2.7 6 0.2 81 6 4.8 29 6 2.2 53 6 3.2 1:1.9 6 0.1b 31 6 3.3 69 6 8.6 2.1 6 0.1ab 100 6 11.8

* Data presented as mean 6 SEM. a,b Different letters within columns indicate significant difference between treatments.

FIG. 1. Histogram indicating average relative transcript levels of DNMT1, DNMT3A, and DNMT3B in somatic cells at PDs 5 and 35. Final semiquantification is reported as the n-fold difference relative to a calibrator. Bars indicate standard error of the mean and different letters within columns indicate significant difference between PDs (P , 0.05).

836

GIRALDO ET AL.

FIG. 2. Bovine embryos collected on Day 13 postestrus. Elongating in vivo embryos (A) with an identifiable embryonic disc (B). Spherical and ovoid cloned embryos reconstructed using cells with high and low levels of DNMT1 mRNA, respectively (C,D). Arrows indicate the presence of an embryonic disc in in vivo embryos.

were observed in NT-5 embryos compared with NT-35 on Day 13 (28.6% vs. 70.4%). However, the recovery rate of embryos on Day 13 was not statistically different between in vivo-ET (65.0%) and NT-35 embryos (Table 4). In vivo and in vivo-ET embryos collected on Day 13 were elongated and had an identifiable embryonic disc, whereas cloned embryos (NT-5 and NT-35) displayed a spherical or ovoid shape with an absent or poorly delineated embryonic disc (Fig. 2). Lengths of elongated or the greatest diameters of spherical and ovoid embryos were used to determine differences in size between treatments. Day 13 in vivo and in vivo-ET embryos (controls) had a similar mean length of 1350 6 143 and 1269 6 74 lm, respectively. NT-5 and NT-35 embryos (293 6 28 and 531 6 42, respectively) were significantly smaller than the controls. However, NT-35 embryos were significantly larger than NT-5 embryos on Day 13 (Fig. 3).

Transcript Levels of DNMT, INFT, and MHC1 in Preimplantation In Vivo Embryos Expression of DNMTs of in vivo embryos underwent significant changes during the preimplantation stage. Changes in expression of DNMT1 and DNMT3B were observed, while the level of DNMT3A mRNA remained constant during the embryonic stages analyzed. DNMT3B was highly expressed in Day 10 embryos compared with Day 7, 12, and 13 embryos (3.6-fold difference). Levels of DNMT1 transcript were undetectable in in vivo embryos on Days 7, 10, and 12, but increased significantly on Day 13 (Fig. 4). In contrast to the somatic cells, DNMT3B, followed by DNMT3A mRNA, appeared to be the most abundant DNMT mRNA present in preimplantation in vivo bovine embryos. INFT and MHC1 transcripts were not detected in Day 7, 10, or 12 in vivo embryos, but were detected on Day 13. The gene expression pattern of DNMT3A and DNMT3B was the same in in vivo-ET embryos as in vivo embryos. However, DNMT1, INFT, and MHC1 transcripts were below detectable levels in Day 13 in vivo-ET embryos. Expression Levels of DNMT, INFT, and MHC1 in Preimplantation Cloned Embryos A high proportion of cloned embryos reconstructed with cells at PD 5 and 35 showed abnormal levels of DNMT TABLE 4. Embryo transfer and embryo collection of in vivo and cloned embryos.

FIG. 3. Embryo size of in vivo, in vivo-ET, NT-5, and NT-35 embryos collected on Day 13. Bars indicate standard error of the mean and different letters indicate significant difference between treatments (P , 0.05).

Treatment

No. of recipients

No. of embryos transferred

No. of embryos collected (%)

In vivo-ET NT-5 NT-35

3 4 4

40 98 44

26 (65.0)a 28 (28.6)b 31 (70.4)a

a,b Different letters within columns indicate significant difference in the percentage of embryos collected between treatments.

837


TABLE 5. Number of cloned embryos that fall within or outside the confidence interval of in vivo embryos. NT-5 Expression level DNMT3A High Normal Low DNMT3B High Normal Low

FIG. 4. Histogram indicating average relative transcript levels of DNMT1, DNMT3A, and DNMT3B of in vivo embryos. Final semiquantification is reported as the n-fold difference relative to a calibrator. Bars indicate standard error of the mean and different letters within DNMTs indicate significant difference between developmental stages (P , 0.05).

NT-35

Day 7

Day 13

Day 7

Day 13

0 4 6

1 9 0

0 7 2

6 4 0

1 3 6

0 2 8

0 2 8

0 6 4

transcripts on Days 7 and 13. Only 40% of NT-5 embryos had normal expression levels of DNMT3A, whereas 88.8% of NT-35 had normal transcript levels on Day 7. On Day 13, 90% and 40% of the NT-5 and NT-35 embryos fell within the confidence intervals for in vivo embryos, respectively. Interestingly, high levels of DNMT3A transcript were a common finding in NT-35 embryos at Day 13 (Fig. 5, A and B, and Table 5). Low levels of DNMT3B mRNA were characteristic of NT-5 and NT-35 embryos compared with the in vivo controls. Of the NT-5 embryos analyzed on Day 7, 30% expressed normal levels of DNMT3B, while 60% had a reduced amount of this

FIG. 5. Scatter plots indicating average relative transcript levels of DNMT3A and DNMT3B of individual NT-5 and NT-35 embryos at Days 7 and 13. Final semiquantification is reported as the n-fold difference relative to a calibrator. Relative differences of DNMT3A in embryos on Day 7 (A) and Day 13 (B) and DNMT3B mRNA at Day 7 (C) and Day 13 (D). Dashed lines represent the 95% confidence intervals of in vivo embryos.

838

GIRALDO ET AL.

transcript. The remaining embryos had higher expression levels of DNMT3B than the control. DNMT3B mRNA was within normal levels in only 20% of the NT-35 embryos, whereas the remaining 80% had levels below those of controls. Twenty percent and sixty percent of NT-5 and NT-35 embryos on Day 13, respectively, had DNMT3B mRNA levels that fell within the normal range. The remaining embryos had lower expression of this transcript (Fig. 5, C and D, and Table 5). DNMT1 mRNA was not detected in either NT-5 or NT-35 embryos on Days 7 and 13. A high proportion of cloned embryos had abnormal levels of the de novo methyltransferases. Nevertheless, dysregulation of DNMT3B mRNA was more commonly detected than aberrant expression of DNMT3A (67.5% vs. 38.5%). Moreover, 88.8% and 25.0% of cloned embryos with abnormal levels of DNMT3A also expressed abnormal levels of DNMT3B transcripts on Day 7 and Day 13, respectively. Similarly, 53.3% and 16% of embryos displaying abnormal concentrations of DNMT3B expressed aberrant levels of DNMT3A on Days 7 and 13, respectively. Similar to in vivo-ET embryos, neither the INFT nor MHC1 transcripts were detected in NT-5 or NT-35 embryos on Day 7. Likewise, these transcripts were not detected on Day 13, in contrast to in vivo embryos and similar to in vivo-ET embryos. DISCUSSION Cloned embryos produced by SCNT display substantial differences in chromatin configuration and gene expression compared with normally fertilized embryos, suggesting incomplete nuclear reprogramming [28]. Cloning requires that epigenetic information of the donor nucleus be reprogrammed to an embryonic state [13]. However, DNMT1 introduced in the recipient ooplasm at the time of fusion may perpetuate the DNA methylation pattern of the somatic cell [14, 29]. It has been hypothesized that using donor cells with low levels of this maintenance DNMT may enable the reprogramming process of the reconstructed embryo. Embryonic stem (ES) cells have lower levels of DNMT1 than somatic cells [30]. However, bovine ES cells have not been successfully isolated and cultured in vitro. Likewise, isolation of stem cells from adult tissues is an emerging technique, and levels of DNMT1 in these cells have not been examined completely. Data presented in this study and recently published by Giraldo et al. [22] and Moore et al. [23] demonstrate that cells cultured in vitro for an extended period of time have a significantly reduced level of DNMT1 transcript compared with young cells. Cells at late PDs were also characterized by a hypomethyled DNA pattern possibly as a consequence of the low level of DNMT1 mRNA present in the fibroblasts. The use of cells with low levels of DNMT1 transcript and hypomethylated DNA during SCNT may facilitate the waves of demethylation and remethylation characteristic during normal bovine preimplantation development, but aberrant in a high proportion of cloned embryos. These observations indicate that in vitro culture may impact the mechanisms responsible for the expression of these remodeling proteins, levels of methylated DNA, and the resulting gene expression of cultured cells [31]. Such changes have been hypothesized to occur as a consequence of cellular adjustments to the in vitro culture conditions. However, the specific mechanisms remain unknown. Cloned animals have been produced using cells at early and late PDs [32, 33]. Additionally, viable offspring have been produced from senescent somatic cells [34], indicating that although in vitro cell culture could lead to rearrangements in the chromatin

structure, somatic cells are able to efficiently reprogram and support embryo development. The embryonic development of cloned embryos using cells with low levels of DNMT1 differed from those generated using fibroblasts with higher levels of this transcript. A significantly lower percentage of embryos reconstructed with cells at late PDs compared with early PDs developed to the 8–16 stage (72 h postfusion). A higher proportion of 8- to 16-cell embryos developed to the blastocyst stage when cells at late PDs were used as donor cells compared with cells at early PDs. The early development pattern of NT-35 embryos may indicate that a selection process occurs during the first divisions. These NT-35 embryos reaching the 8- to 16-cell stage are more competent than NT-5 embryos to support further development. The accumulation of chromosomal abnormalities in somatic cells cultured for extended periods and the poor development of cloned embryos derived from them support the hypothesis that the use of cells at late PDs as donor karyoplast during NT may impair embryo development because of the abnormal chromosome complement of the cloned embryos [35, 36]. Chromosomal abnormalities and decreased levels of DNMT1 expression may be coincidental events in individual cells, in which case these cells may not be ideal donor karyoplasts for cloning. Embryos with an abnormal chromosome number are not like to survive past early embryonic divisions [37]. However, a selection of a population of cells at late PDs characterized by a normal chromosome number, low levels of DNMT1 transcripts, and DNA hypomethylation may facilitate the demethylation process during the first embryonic divisions, resulting in higher development rates in embryos surviving past the 8- to 16-cell stage. In vivo development beyond the blastocyst stage was also higher in NT-35 embryos compared with NT-5 embryos. A higher percentage and larger embryos were collected on Day 13 when donor karyoplast with low levels of DNMT1 mRNA was utilized. All cloned embryos (NT-5 and NT-35) showed a significant delay in growth compared with in vivo embryos. Since in vivo and in vivo-ET embryos were similar in size, it is unlikely that the embryo transfer procedure was responsible for the considerable size difference observed between normally fertilized and cloned embryos. For this study, a single technician performed all the embryo transfers and collections, and the recovery rate for in vivo-ET was similar to that for NT-35 embryos. The difference in recovery of Day 13 embryos between NT-5 and NT-35 most likely reflects a difference in developmental competence and not just variability between animals. Similar to previous reports, the in vivo bovine embryos analyzed in this study changed from a spherical to an ovoid shape marking the onset of elongation between Days 12 and 13. On approximately Day 12, the ICM, or epiblast, displaces the overlying trophoblast lining and establishes the embryonic disc [38–40]. Post-hatched cloned embryos did not undergo this elongation process. Cloned embryos at Day 13 were ovoid shaped, characteristic of normal embryos on Days 10 to 12. Furthermore, the embryonic disc was not recognizable at Day 13 in cloned embryos. These observations support the hypothesis that cloned embryos are developmentally slower compared with normally fertilized embryos. Numerous reports have investigated the DNA methylation and DNMT mRNA levels in cloned embryos, from the 1-cell embryo to the blastocyst stage [9, 14, 28, 41, 42]. However, little is known about this remodeling process in either in vivo or cloned bovine embryos after hatching. Similar to mouse embryos, DNMT3B is the most abundant DNMT found from gastrulation to initiation of the elongation


process in bovine embryos. Moreover, a significant increase in the levels of DNMT3B mRNA was observed at Day 10 and during the egg cylinder shape in bovine and mouse embryos, respectively. In mouse embryos this DNMT mRNA peak occurs coincidentally with a genome-wide DNA methylation pattern [43]. Bovine embryos may also undergo a process of hypermethylation as a result of the elevated level of this de novo DNMT transcript. The amount of DNMT3A mRNA remained constant from gastrulation through elongation in bovine embryos. However, DNMT3A mRNA was not detected in significant amounts in mouse embryos from the free blastocyst to the early streak stage [11]. Low levels of DNMT1 transcript were detected in bovine embryos on Day 13, but not before, indicating that this maintenance DNMT is only expressed after the new embryonic methylation pattern has been established by DNMT3A and DNMT3B. Numerous reports have demonstrated that DNMT transcripts in prehatched, cloned embryos are expressed at abnormal levels and/or at inappropriate developmental stages, resulting in impaired nuclear reprogramming [9, 14, 28, 44]. The expression patterns of DNMTs in posthatched, cloned bovine embryos have not been extensively analyzed. This study demonstrates that the gene expression level of DNMT3B is low in the majority of cloned embryos on Days 7 and 13, independent of the cell used as donor karyoplast. However, a considerable portion of Day 13 embryos reconstructed with cells at late PDs (NT-35) showed higher levels of DNMT3A mRNA than in NT-5 and in vivo embryos. Although several reports suggest that DNMT3A and DNMT3B possess distinct functions [45, 46], Okano et al. [29] demonstrated that a deficiency of DNMT3B results in increased gene expression levels of DNMT3A to partially compensate for the lack of the other transcript. The high levels of DNMT3A transcript in NT35 embryos may indicate the activation of a rescue mechanism to compensate for the deficiency of DNMT3B mRNA. However, there is no evidence to support the hypothesis that the low levels of DNMT1 mRNA in PD-35 cells at the time of fusion are directly responsible for the up-regulation of DNMT3A. In general, abnormal regulation of the de novo DNMT transcripts was observed in all cloned embryos. Vast numbers of genes become down- or up-regulated in the trophoblast cells of bovine embryos between Days 7 and 14 in order to support embryogenesis and implantation [15]. Previous research indicates that bovine trophoblast cells grow and express high levels of INFT throughout the elongation process [47]. The low number of trophoblast cells and the apparent delay in elongation of cloned embryos may contribute to the low level of INFT mRNA detected in this study. Trophoblast cells of NT-generated embryos have been reported to express aberrant levels of MHC1 protein, which normally is suppressed in first-trimester cattle embryos [17, 48]. However, in this study, levels of MHC1 transcript were detected in in vivo but not in in vivo-ET or cloned embryos at Day 13. Absence of this transcript in the treatment groups may be a consequence of the delayed growth observed in these embryos. Alternatively, it is possible that the regulatory mechanism that suppresses the expression of this transcript is not active at early stages [15]. Additionally, the low number of trophoblast cells characteristic of Day 13 cloned embryos may lead to the production of reduced or undetectable levels of this mRNA. Difference in size, formation of the embryonic disc, and developmental competence between in vivo and cloned embryos on Day 13 can be attributed to the NT procedure, rather than to the embryo transfer and collection procedures. However, embryo transfer could affect gene expression of DNMT1, INFT, and MHC1.

839

In conclusion, NT embryos generated using donor cells with low levels of DNMT1 mRNA and hypomethylated DNA that were able to reach the maternal-zygote transition produced a greater number of apparently normally developing embryos, larger-sized conceptuses, and higher expression of DNMT3A on Day 13 than NT embryos reconstructed using cells with higher levels of DNMT1 mRNA. Abnormal gene expression of DNMTs, INFT, and MHC1 transcripts was noted in the majority of cloned embryos, indicating inefficient or delayed nuclear reprogramming and embryo growth. ACKNOWLEDGMENTS The authors are grateful to Dr. Pat Bollich and the staff of Reproduction Biology Center, Louisiana State University Agricultural Center, for their support during this study. The authors are thankful to Dr. Kenneth Eilertsen for his help in the analysis of data.

REFERENCES 1. Young LE. Scientific hazards of human reproductive ‘cloning’. Hum Fertil 2003; 6:59–63. 2. Cezar GG, Bartolomei MS, Forsberg EJ, First NL, Bishop MD, Eilertsen KJ. Genome-wide epigenetic alterations in cloned bovine fetuses. Biol Reprod 2003; 68:1009–1014. 3. Yang L, Chavatte-Palmer P, Kubota C, O’Neill M, Hoagland T, Renard JP, Taneja M, Yang X, Tian XC. Expression of imprinted genes is aberrant in deceased newborn cloned calves and relatively normal in surviving adult clones. Mol Reprod Dev 2005; 71:431–438. 4. Cezar GG. Epigenetic reprogramming of cloned animals. Cloning Stem Cells 2003; 5:165–180. 5. Oswald J, Engemann S, Lane N, Mayer W, Olek A, Fundele R, Dean W, Reik W, Walter J. Active demethylation of the paternal genome in the mouse zygote. Curr Biol 2000; 10:475–478. 6. Bourc’his D, Le Bourhis D, Patin D, Niveleau A, Comizzoli P, Renard JP, Viegas-Pequignot E. Delayed and incomplete reprogramming of chromosome methylation patterns in bovine cloned embryos. Curr Biol 2001; 11: 1542–1546. 7. Santos F, Hendrich B, Reik W, Dean W. Dynamic reprogramming of DNA methylation in the early mouse embryo. Dev Biol 2002; 241:172–182. 8. Kang YK, Koo DB, Park JS, Choi YH, Chung AS, Lee KK, Han YM. Aberrant methylation of donor genome in cloned bovine embryos. Nat Genet 2001; 28:173–177. 9. Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E, Reik W. Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc Natl Acad Sci U S A 2001; 98:13734–13738. 10. Rideout WM III, Eggan K, Jaenisch R. Nuclear cloning and epigenetic reprogramming of the genome. Science 2001; 293:1093–1098. 11. Watanabe D, Suetake I, Tada T, Tajima S. Stage- and cell-specific expression of Dnmt3a and Dnmt3b during embryogenesis. Mech Dev 2002; 118:187–190. 12. Reik W, Dean W, Walter J. Epigenetic reprogramming in mammalian development. Science 2001; 293:1089–1093. 13. Mann MR, Chung YG, Nolen LD, Verona RI, Latham KE, Bartolomei MS. Disruption of imprinted gene methylation and expression in cloned preimplantation stage mouse embryos. Biol Reprod 2003; 69:902–914. 14. Beaujean N, Taylor J, Gardner J, Wilmut I, Meehan R, Young L. Effect of limited DNA methylation reprogramming in the normal sheep embryo on somatic cell nuclear transfer. Biol Reprod 2004; 71:185–193. 15. Ushizawa K, Herath CB, Kaneyama K, Shiojima S, Hirasawa A, Takahashi T, Imai K, Ochiai K, Tokunaga T, Tsunoda Y, Tsujimoto G, Hashizume K. cDNA microarray analysis of bovine embryo gene expression profiles during the pre-implantation period. Reprod Biol Endocrinol 2004; 2:77–92. 16. Hashizume K, Ishiwata H, Kizaki K, Yamada O, Takahashi T, Imai K, Patel OV, Akagi S, Shimizu M, Takahashi S, Katsuma S, Shiojima S, et al. Implantation and placental development in somatic cell clone recipient cows. Cloning Stem Cells 2002; 4:197–209. 17. Hill JR, Schlafer DH, Fisher PJ, Davies CJ. Abnormal expression of trophoblast major histocompatibility complex class I antigens in cloned bovine pregnancies is associated with a pronounced endometrial lymphocytic response. Biol Reprod 2002; 67:55–63. 18. Ushizawa K, Takahashi T, Kaneyama K, Tokunaga T, Tsunoda Y, Hashizume K. Gene expression profiles of bovine trophoblastic cell line

840

19.

20. 21. 22. 23. 24.

25. 26. 27. 28. 29. 30. 31. 32. 33. 34.

GIRALDO ET AL. (BT-1) analyzed by a custom cDNA microarray. J Reprod Dev 2005; 51: 211–220. Blelloch R, Wang Z, Meissner A, Pollard S, Smith A, Jaenish R. Reprogramming efficiency following somatic cell nuclear transfer is influenced by the differentiation and methylation state of the donor nucleus. Stem Cells 2006; 24:2007–2013. Enright BP, Jeong BS, Yang X, Tian XC. Epigenetic characteristics of bovine donor cells for nuclear transfer: levels of histone acetylation. Biol Reprod 2003; 69:1525–1530. Wilson VL, Jones PA. DNA methylation decreases in aging but not in immortal cells. Science 1983; 220:1055–1057. Giraldo A, Lynn JW, Purpera MN, Godke RA, Bondioli K. Epigenetic modification of cultured bovine fibroblasts for nuclear transfer [abstract]. Reprod Fertil Dev 2007; 19:136–137. Moore K, Wroclawska E, Kramer JM, Goica SL. Cell type and culture over time effect DNA methyltransferase 1 expression in bovine donor fibroblast cells [abstract]. Reprod Fertil Dev 2007; 19:151. Arat S, Gibbons J, Rzucidlo SJ, Respess DS, Tumlin M, Stice SL. In vitro development of bovine nuclear transfer embryos from transgenic clonal lines of adult and fetal fibroblast cells of the same genotype. Biol Reprod 2002; 66:1768–1774. Rosenkrans CF Jr, First NL. Effect of free amino acids and vitamins on cleavage and developmental rate of bovine zygotes in vitro. J Anim Sci 1994; 72:434–437. Wrenzycki C, Wells D, Herrmann D, Miller A, Oliver J, Tervit R, Niemann H. Nuclear transfer protocol affects messenger RNA expression patterns in cloned bovine blastocysts. Biol Reprod 2001; 65:309–317. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001; 25:402–408. Chung YG, Ratnam S, Chaillet JR, Latham KE. Abnormal regulation of DNA methyltransferase expression in cloned mouse embryos. Biol Reprod 2003; 69:146–153. Okano M, Bell DW, Haber DA, Li E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 1999; 99:247–257. Lei H, Oh S, Okano M, Ju¨ttermann R, Goss K, Jaenisch R, Li E. De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells. Development 1996; 122:3195–3205. Malayer JR, Woods VM. Expression of estrogen receptor and maintenance of hormone-responsive phenotype in bovine fetal uterine cells. Domest Anim Endocrinol 1998; 15:141–154. Wilmut I, Schnieke AE, McWhir J, Kind AJ, Campbell KHS. Viable offspring derived from fetal and adult mammalian cells. Nature 1997; 385: 810–813. Kubota C, Yamakuchi H, Todoroli J, Mizoshita K, Tabara N, Barber M, Yang X. Six cloned claves produced from adult fibroblast cells alter long-term culture. Proc Natl Acad Sci U S A 2000; 97:990–995. Lanza RP, Cibelli JB, Blackwell C, Cristofalo VJ, Francis MK, Baerlocher GM, Mak J, Schertzer M, Chavez EA, Sawyer N, Lansdorp P, West MD.

35. 36. 37. 38. 39. 40.

41. 42. 43. 44.

45.

46.

47.

48.

Extension of cell life-span and telomere length in animals cloned from senescent somatic cells. Science 2000; 288:665–669. Bureau W, Bordignon V, Leveillee C, Smith L, King A. Sex-chromosomal complement of donor cells and reconstructed embryos derived from them [abstract]. Theriogenology 2003; 59:239. Giraldo A, Lynn JW, Godke RA, Bondioli K. Proliferative characteristics and chromosomal stability of bovine donor cells for nuclear transfer. Mol Reprod Dev 2006; 73:1230–1238. Magli MC, Gianaroli L, Ferraretti AP, Lappi M, Rubrti A, Fartali V. Embryo morphology and development are dependent on the chromosomal complement. Fertil Steril 2007; 87:534–541. Betteridge KJ, Eaglesome MD, Randall GC, Mitchell D. Collection, description and transfer of embryos from cattle 10–16 days after oestrus. J Reprod Fertil 1980; 59:205–216. Betteridge KJ. The anatomy and physiology of pre-attachment bovine embryos. Theriogenology 1988; 29:155–187. Maddox-Hyttel P, Alexopoulos NI, Vajta G, Lewis I, Rogers P, Cann L, Callesen H, Tveden-Nyborg P, Trounson A. Immunohistochemical and ultrastructural characterization of the initial post-hatching development of bovine embryos. Reproduction 2003; 125:607–623. Shi W, Zakhartchenko V, Wolf E. Epigenetic reprogramming in mammalian nuclear transfer. Differentiation 2003; 71:91–113. Wrenzycki C, Niemann H. Epigenetic reprogramming in early embryonic development: effects of in-vitro production and somatic nuclear transfer. Reprod Biomed Online 2003; 7:649–656. Monk M. Changes in DNA methylation during mouse embryonic development in relation to X-chromosome activity and imprinting. Philos Trans R Soc Lond B Biol Sci 1990; 326:299–312. Suteevun T, Smith SL, Muenthaisong S, Yang X, Parnpai R, Tian XC. Anomalous mRNA levels of chromatin remodeling genes in swamp buffalo (Bubalus bubalis) cloned embryos. Theriogenology 2006; 65: 1704–1715. Miniou P, Jeanpierre M, Bourc’his D, Coutinho Barbosa AC, Blanquet V, Viegas-Pequignot E. Alpha-satellite DNA methylation in normal individuals and in ICF patients: heterogeneous methylation of constitutive heterochromatin in adult and fetal tissues. Hum Genet 1997; 99:738–745. Xu GL, Bestor TH, Bourc’his D, Hsieh CL, Tommerup N, Bugge M, Hulten M, Qu X, Russo JJ, Viegas-Pequignot E. Chromosome instability and immunodeficiency syndrome caused by mutations in a DNA methyltransferase gene. Nature 1999; 402:187–191. Degrelle SA, Campion E, Cabau C, Piumi F, Reinaud P, Richard C, Renard JP, Hue I. Molecular evidence for a critical period in mural trophoblast development in bovine blastocysts. Dev Biol 2005; 288: 448–460. Pfister-Genskow M, Myers C, Childs LA, Lacson JC, Patterson T, Betthauser JM, Goueleke PJ, Koppang RW, Lange G, Fisher P, Watt SR, Forsberg EJ, et al. Identification of differentially expressed genes in individual bovine preimplantation embryos produced by nuclear transfer: improper reprogramming of genes required for development. Biol Reprod 2005; 72:546–555.