Effect of Ionizing Radiation on the Transcription ... - Radiation Research

RADIATION RESEARCH

176, 38–48 (2011)

0033-7587/11 $15.00 g 2011 by Radiation Research Society. All rights of reproduction in any form reserved. DOI: 10.1667/RR2525.1

Effect of Ionizing Radiation on the Transcription Levels of Cell Stress Marker Genes in the Pacific Oyster Crassostrea gigas Emilie Farcy,a,1 Claire Voiseux,a Ismae¨l Robbes,b Jean-Marc Lebelc and Bruno Fieveta,2 a

Laboratoire de Radioećologie de Cherbourg-Octeville, Institut de Radioprotection et de Suˆrete´ Nucleáire/DEI/SECRE, Cherbourg-Octeville, France; b Laboratoire de Dosime´trie des Rayonnements Ionisants, Institut de Radioprotection et de Suˆrete´ Nucleáire/DRPH/SDE, Fontenay-aux-Roses, France; and c Laboratoire de Biologie et Biotechnologies Marines, Universite´ de Caen Basse-Normandie, UMR 100 Ifremer, Caen, France

INTRODUCTION Farcy, E., Voiseux, C., Robbes, I., Lebel, J-M. and Fievet, B. Effect of Ionizing Radiation on the Transcription Levels of Cell Stress Marker Genes in the Pacific Oyster Crassostrea gigas. Radiat. Res. 176, 38–48 (2011).

The Cotentin Peninsula (Normandy, France) hosts several nuclear facilities that are responsible for controlled releases of liquid radioactive waste into the marine environment. These releases result in measurable amounts of a few artificial radionuclides in the vicinity of the input source, but the resulting increase in radioactivity is small compared to natural radioactivity. The objective of radiation protection is to ensure safe conditions for humans. In the 1970s, protecting humans to the current desirable degree was considered to guarantee that other species were not put at risk (1). In recent decades, growing concern over environmental protection and sustainable development has prompted the scientific community and radioprotection authorities to reconsider this approach (2, 3). The environment is no longer envisioned as a mere transfer route between the input sources and humans but rather is seen as an ecosystem where biodiversity must be preserved (4, 5). Though radionuclide input into the marine environment by the nuclear industry is small, it is constant, and our knowledge of the possible effects of chronic exposure to low doses of radioactivity is limited. Therefore, investigating the effects of chronic exposure of marine species to ionizing radiation is necessary to document the dose– response relationship and provide a robust scientific basis for environmental risk assessment and environmental protection regulations. Normandy is one of the main areas for oyster farming in France. The possible impact of radioactive releases on the oyster Crassostrea gigas in the English Channel was recently studied in the field (6). The transcriptional levels of several cell stress genes were quantified in relation to seasonal changes and distance from the input source. A clear seasonal pattern was observed, with higher mRNA levels in winter compared to summer, but no significant change in the exposure status of oysters relative to radioactive liquid releases in the Cotentin area could be demonstrated.

In the North-Cotentin (Normandy, France), the marine environment is chronically exposed to liquid releases from the La Hague nuclear fuel recycling plant (Areva NC), resulting in a small increase in radioactivity compared to natural background. The transcriptional expression levels of stress genes were investigated in oysters exposed to ionizing radiation. Adult oysters were kept for 6 weeks in 60Co-labeled seawater (400 Bq liter21), resulting in a total dose of 6.2 mGy. Transcriptional expression of target genes was monitored by reverse-transcription quantitative polymerase chain reaction. Nine genes were selected for their sensitivity to ionizing radiation based on the literature and available DNA sequences. They included genes encoding chaperone proteins and genes involved in oxidative stress regulation, cell detoxification and cell cycle regulation. Of the nine genes of interest, metallothionein (MT) and multi-drug resistance (MDR) displayed significant overexpression in response to chronic exposure to an internal low dose. For comparison, oysters were acutely exposed to an external high dose for 100 min, resulting in 20 Gy, and the same target gene expression analysis was carried out. As in the case of chronic exposure to the low dose, MT and MDR displayed significant increases. The results suggest that the transcriptional expression levels of cell stress genes may be used as a biosensor of exposure of oysters to ionizing radiation, with a particular focus on the MT and MDR genes. However, the upregulation of these potential players in the cellular response to radiation-induced stress was not correlated with mortality or apparent morbidity. The possible role of these stress genes in the resistance of oysters to ionizing radiation is discussed. g 2011 by Radiation Research Society

1 Present address: INRS-IAF, 531 boulevard des prairies, Laval, Que´bec, H7V 1B7, Canada. 2 Address for correspondence: Institut de Radioprotection et de Suˆrete´ Nucleáire, DEI/SECRE/LRC, Rue Max Pol Fouchet, BP10, 50130 Cherbourg-Octeville, France; e-mail: [email protected].

38

EXPOSURE OF OYSTERS TO GAMMA RADIATION

To complement this field study, oysters were artificially exposed to ionizing radiation in laboratory conditions to provide evidence for the responsiveness of these cell stress markers. The cell stress marker genes were selected for their sensitivity to ionizing radiation on the basis of the radiobiology literature. They included genes encoding chaperone proteins [Hsp70, Hsc72, Hsp90 (7–12)], genes involved in regulation of oxidative stress [superoxide dismutase (SOD) (13–15) and metallothionein (MT) (16–20)], and genes involved in cell detoxification [glutathione S-transferase (GST), cytochrome P450 and multidrug resistance (MDR) (21–26)] and cell cycle regulation [p53 (27–32)]. The mRNA levels of the selected genes were quantified by reverse transcription real-time polymerase chain reaction (RTqPCR). Oysters were exposed chronically to low-dose internal ionizing radiation by adding 60Co to seawater and acutely to high-dose external c radiation for comparison. Doses were estimated using thermoluminescence dosimeters to derive dose rates. METHODS Animals Oysters were obtained from a local oyster farm in St-Vaast and screened carefully to ensure that all of the oysters were diploid, were 3– 4 years old, and had spent their entire lives on the farm. Seawater supplied to the laboratory was pumped in the natural environment and filtered on sand. Prior to exposure experiments, the oysters were acclimated to laboratory conditions for 1 week in fully aerated seawater tanks (72 oysters per 120-liter tank) at the same temperature as the water in the natural environment. The temperature was 14uC for the experiments involving chronic internal exposure to 60Co and 10uC for the experiments involving acute external irradiation. Water was partially changed (60 liters) every day during this acclimation phase. To check that keeping oysters in the laboratory did not induce any additional stress, we compared the expression levels of stress genes in oysters in laboratory control conditions and in oysters from the ‘‘natural’’ environment (oyster farm). Twenty oysters sampled monthly for 22 months were previously used to study the seasonal expression pattern of stress genes (6). Expression level data measured in the same seasonal periods as in the present laboratory experiments were extracted from the whole time series for comparison purposes. Chronic Internal Exposure to 60Co For chronic 60Co internal exposure experiments, oysters were transferred into six 20-liter tanks (12 oysters per tank); seawater was changed every day during the first week and every 4 days during the following 5 weeks. Temperature was maintained at 14uC throughout the experiment. Three batches of two tanks (24 oysters) each were tested in parallel: (1) control oysters in seawater, (2) oysters in seawater with 60Co (CoCl2) at a concentration of 400 Bq liter21, (3) oysters in seawater with 59Co at the same cobalt concentration (0.57 nM added) as in batch 2, to check potential cobalt chemical toxicity. In 60Co-labeled tanks, the 60Co concentration in seawater was monitored daily by c-ray spectrometry and maintained at 400 Bq liter21. Oyster exposure lasted 6 weeks and samples were taken at time zero (control batch only) and after 1, 3 and 6 weeks of exposure. At each sampling time, oysters were analyzed for 60Co labeling by c-ray spectrometry on the soft part and separately on the shell. After 6 weeks of exposure, the last six oysters were analyzed

39

more precisely for 60Co organ distribution between labial palps, edge of mantle, gills, adductor muscle, digestive gland and the remaining parts. Results were expressed in Bq kg21 fresh weight. To estimate c-radiation dose rates, small LiF thermoluminescence dosimeters (3 3 20-mm cylinder) were kept in the following places: remote from the experiment (background); immersed in 60Co-labeled seawater; after oyster sampling, inside both nonexposed and 60Coexposed empty oyster shells and in contact with crushed tissues in counting vials. Replicate dosimeters (2–4) for each condition made it possible to estimate the doses resulting from 60Co (1) in seawater, (2) adsorbed on shell and (3) incorporated into the soft parts in 60Colabeled oysters. Dosimeters were analyzed by the LDRI (IRSN/ DRPH/SDE) with an LTM reader to determine the doses (Gy), and dose rates were calculated by dividing by exposure time. The reported data are means ± SD from six individual oysters. At each sampling time, oysters exposed to 60Co and 59Co were compared with control oysters using a Student’s t test. The significance of the difference was given as P # 0.05. Statistical analysis was carried out on log-transformed data. Normal data distribution and homogeneity of variances were verified with the Shapiro-Wilk test and the F test, respectively. Linear regression analysis was performed on 60Co concentration and dose-rate estimates in oyster soft parts and shell. All statistical analysis was performed with the R Environment for Windows (33). Acute External Exposure to c Radiation Because of limitations on the amount of radionuclides used for labeling in the laboratory, higher-dose exposure was carried out in a specific facility in IRSN/DRPH/SDE (Fontenay-aux-Roses, France) where oysters could be exposed to an external source of 60Co. For acute external exposure experiments, oysters were transferred into 20-liter tanks (12 oysters per tank). Prior to irradiation, preliminary dosimetry was carried out to adjust the irradiation collimation (horizontal shooting) accurately, taking into account oyster positioning and absorption by the tank wall, seawater and oyster shell. A final measured dose rate of 0.2 Gy min21 was adopted and exposure was carried out for 100 min, resulting in an external c-ray dose of 20 Gy to each oyster. After irradiation, oysters were returned to the 120-liter acclimation tank where seawater was changed every day. Temperature was maintained at 10uC throughout the experiment. The transcriptional expression level of target stress genes was measured at 4, 17, 48 and 96 h after the exposure to the high external dose. Control oysters kept in the acclimation tank were analyzed at 4, 72 and 96 h. Statistical analysis was carried out on log-transformed data since gene expression levels corresponded to ratio values. At each sampling time, irradiated oysters were compared with control oysters using a Student’s t test (n 5 6), and the significance of the difference was given as P # 0.05, assuming normal distribution and homogeneity of variances. Oyster Treatment and mRNA Quantification At each sampling time, six oysters were shucked and the soft parts were instantaneously frozen in liquid nitrogen. Frozen parts were then crushed in a ball crusher (Verder MM301) in buckets cooled by liquid nitrogen. Aliquots (50 mg) were used for gene expression while the remaining parts from 60Co-labeled oysters were saved for c-ray spectrometry and dosimeter exposure. The 50-mg aliquot withdrawn for gene expression was considered as negligible for the dose evaluation. Total RNA was extracted using TRI Reagent (Sigma Aldrich), quantified (260 nm and 280 nm absorbance measured in a UV spectrophotometer), treated with DNase I (Sigma-Aldrich) to remove genomic DNA, and reverse-transcribed (Promega reagents) as described previously (6). Real-time PCR was performed in a MiQ Cycler (BioRad) and the sequences of the primers used (Table 1) were designed based on cDNA sequences available in GenBank and with

40

FARCY ET AL.

TABLE 1 GenBank Accession Numbers of cDNA Sequences from C. gigas Used to Design the Primers. Primer Sequences and Lengths of Expected Amplicons Gene Actina GAPDH 18S rRNA Hsp70 Hsp72 Hsp90 Cu-Zn SOD MTb GST sigma CYP2E1 MDR1 p53

GenBank accession no. AF026063 AJ544886 AB064942 AJ305315 AF144646 AJ431681 AJ496219 AJ243263 AJ242657 AJ557140 AF075692 AJ422120 AM236465

Forward primer

Reverse primer

Length of the amplicon

59 59 59 59 59 59 59 59

GCCCTGGACTTCGAACAA 39 TTGTCTTGCCCCTCTTGC 39 CGGGGAGGTAGTGACGAA 39 AGCAAGCCAGCACAGCA 39 GAGGATCGCAGCCAAGAA 39 GGAGAGCAAAACCCTCACC 39 AACCCCTTCAACAAAGAGCA 39 GGACCGGAAAACTGCAAA 39

59 59 59 59 59 59 59 59

CGTTGCCAATGGTGATGA 39 CGCCAATCCTTGTTGCTT 39 ACCAGACTTGCCCTCCAA 39 GCGATGATTTCCACCTTC 39 TATCGCCCTCGCTGATCT 39 TGGCAATGGTTCCAAGGT 39 TTTGGCGACACCGTCTTC 39 CCAGTGCATCCTTTACCACA 39

100 110 126 92 98 83 96 98

bp bp bp bp bp bp bp bp

59 59 59 59

AACGCCACCATTCACGAC 39 CCCTGGGAGTTCAAACCTG 39 CCGAGAACATCCGCTACG 39 ACCCAGCTCCGACTCATTT 39

59 59 59 59

AAGACCCCACCCAATGCT 39 CGACGCCAAATCCAATAAA 39 GCCCTGTGGGAGTTCCTT 39 TCATGGGGGATGATGACAC 39

118 94 104 97

bp bp bp bp

a

Used to normalize other mRNA. This pair of primers did not discriminate between two identified members of oyster MTs: MT1 (accession no. AJ243263) and MT2 (accession no. AJ242657). b

the aid of Primer3 software (http://frodo.wi.mit.edu/primer3/). The primers were 18 to 20 bp in length and had a Tm between 59uC and 61uC and GC% from 40% to 60%. The efficiency of each pair of primers was tested as described (6). Amplification was carried out in 96-well plates in a total volume of 15 ml containing 7.5 ml of 23 iQ SYBRH Green supermix (BioRad), each primer (500 nM final) and cDNA samples obtained from reverse transcription of 5 ng of total RNA. Amplification conditions were 40 cycles of 15 s at 95uC and 45 s at 60uC, followed by the melting curve protocol: 80 cycles of 10 s with an increase of 0.5uC between each cycle from 55uC to 95uC. The specificity of the reaction was confirmed by observing a single peak at the expected Tm on the melting curve and by sequencing the PCR product once. All determinations were carried out in duplicate. Controls without template cDNA were included on the PCR plates. Gene-specific mRNA quantification was performed by normalizing data to the amount of mRNA encoding for actin, a cytoskeletal protein used as a housekeeping gene. Two alternative reference RNAs, GAPDH mRNA and ribosomal 18S rRNA, were also analyzed, but the results were similar to those with actin. For each specific DNA analyzed, real-time PCR provides a cycle threshold (Ct) value where the fluorescence signal is detectable above the background. The actin Ct values in the range of 18.5–20.1 confirmed that the starting amount of cDNA was similar in all samples analyzed. Quantification of specific stress gene mRNA was performed using the delta cycle threshold (Ct) method: gene of interest normalized mRNA ½Ctreference {Ctgene of interest . Thus mRNA data correspond to the ratio level 52 (unitless) between the number of mRNA encoding for the gene of interest and the number of reference RNA (Actin, GAPDH mRNA or 18S rRNA).

presented in Fig. 1B and shows that the gills and the digestive gland incorporated about two times more 60Co than the labial palps, the edge of the mantle and the adductor muscle. The dose rate due to natural radionuclides in control oysters (nonlabeled seawater) was estimated at

RESULTS

Chronic Internal Exposure Experiments 1. 60Co labeling and dose estimation Figure 1A shows that the amount of 60Co incorporated in the soft parts and shells of oysters increased during the 6 weeks of exposure and that a steady state was not reached. Oyster shell labeling was about 20-fold higher than soft part labeling. The relative distribution of 60Co between organs after 6 weeks of exposure is

FIG. 1. Panel A: 60Co labeling in oyster shell (filled symbols) and soft parts (unfilled symbols) during 6 weeks of exposure in seawater containing 400 Bq liter21 of 60Co. Panel B: Organ distribution after 6 weeks of exposure. Values are means and SD (n 5 6).

41


TABLE 2 Estimated Dose-Rate Contributions by the Shell, Soft Parts and Seawater in Oyster 60 Co-Labeling Experiments Dose rate (mGy h21)

Time of exposure (week)

Shell

Soft parts

Seawater

Total

0 1 3 6

0.02 2.4 3.9 5.4

0.02 0.08 0.07 0.10

0.6 0.6 0.6

3.1 4.6 6.1

0.02 mGy h21 in both soft parts (n 5 2) and shell (n 5 1). Table 2 summarizes the different estimated contributions of the shell, soft tissue and seawater to the dose rate during the 6 weeks of exposure compared to natural background values (time zero). The dose rate increased with the exposure time. This increase was mainly due to the shell, which is in agreement with 60Co labeling (Fig. 1A). Linear regression analysis between 60Co concentration and dose rate gave correlation coefficients (r2 values) of 0.97 and 0.66 in the shell and soft parts, respectively. After 6 weeks of exposure to 60Co, the total dose rate to oysters was about 6 mGy h21 and the integrated received dose was about 6.2 mGy. mRNA Levels of Studied Stress Genes The relative expression levels of the genes were calculated as the ratio of mRNA amount to actin mRNA amount (actin used as a reference gene). Of nine genes studied that were potentially involved in the response to ionizing radiation, only two displayed statistically significant changes (MDR1 and MT) while the other seven were not significantly affected (not shown). In addition, no change was observed in response to 59Co exposure, indicating that adding 0.57 nM to seawater did not induce any detectable chemical toxicity. Figure 2 shows the results for the transcriptional expression of MDR1 and MT in oyster tissue. Alternative Reference RNAs The choice of the reference RNA used to quantify the mRNA levels of the genes of interest is crucial since it is assumed to be expressed constantly over the experiment. To support this assumption, two other alternative reference RNAs (GAPDH mRNA and 18S rRNA) were used to determine whether they challenged the conclusions drawn from data normalized to actin. Figure 3 illustrates the results for the transcriptional expression of MDR1 and MT in oyster tissue.

(not shown). Figure 4 shows the results for the transcriptional expression of MDR1 and MT in oyster tissue after exposure to 20 Gy (0.2 Gy/min 3 100 min). Because of technical constraints in the high-dose-rate irradiation facility, control oysters could not be analyzed at 17 h and 48 h but were sampled at 72 h. Since control oysters were not exposed to stress, mRNA encoding for stress genes were expected to be stable over the time of the experiment, here a few days, while seasonal changes occur on a longer-term basis (6). Attention was focused on the end of the experiment because it was essential to ensure that keeping control oysters in the facility (shielded from radiation) for several days did not induce any stress. On the basis of data obtained at 4, 72 and 96 h, it was assumed that mRNA levels were likely to be stable between 4 h and 72 h. The MT 72-h control displayed a higher standard deviation compared to all other control data points, and MT value for 48 h was not significantly different from that of the 72-h control. Similarly, because of a higher standard deviation, the MDR1 value of the 17-h irradiation point was not significantly higher than that of the 4-h control. Comparison between Natural Environment Data and Laboratory Data The expression levels of the MT and MDR1 genes measured in oysters from the natural environment (oyster farm) in the same seasonal periods and temperatures as in the present laboratory experiments were extracted from a previous field study (6). This made it possible to determine whether handling and maintaining the oysters in laboratory conditions induced any additional stress that could interfere with c-radiation exposure. The ranges of MDR1 and MT gene expression levels are summarized in Fig. 5. For MDR1 and MT mRNA, environmental and laboratory control data are displayed as box plots at temperatures corresponding to the chronic internal low-dose (14uC) and the acute external high-dose (10uC) exposure experiments. We also assessed the magnitude of the response of oysters to c-ray exposure relative to the natural variability of stress gene expression levels. The maximum peak values resulting from acute external exposure (at 14uC) for both MDR1 and MT genes (0.0495 and 1.19, respectively) came out above the ranges of both environmental and laboratory control data. In the case of chronic internal exposure to the low dose (at 10uC), the maximum peak values for both MDR1 and MT genes (0.0107 and 0.82, respectively) were above the ranges of laboratory control values but were still within the ranges of environmental values.

Acute External Irradiation Experiments In response to acute external irradiation, the same two genes (MDR1 and MT) displayed statistically significant changes while the other seven appeared to be unaffected

DISCUSSION

The aim of this study was to investigate whether the expression levels of stress genes can be used as early

42

FARCY ET AL.

FIG. 2. Transcriptional expression of MDR1 (panel A) and MT (panel B) in oysters exposed for 6 weeks in seawater (unfilled bars), seawater containing 400 Bq liter21 of 60Co (filled bars), and seawater with stable 59Co (hatched bars). Values are means and SD (n 5 6); *P , 0.05, significant difference relative to the control (seawater).

sensors of potential effects of ionizing radiation exposure in oysters. A limited number of genes were selected from the DNA sequence database information available on oysters, based on the literature about cellular functions expected to be involved in radiation response. This included genes encoding for chaperone proteins and genes involved in regulation of oxidative stress, cell detoxification and cell cycle regulation.

Estimation of doses in oysters kept in 60Co-labeled seawater for 6 weeks was carried out using thermoluminescence dosimeters. Because 60Co, a high-energy cray emitter, was chosen for internal contamination, relatively homogeneous tissue irradiation could be assumed. The number of dosimeter replicates was limited, but incorporation of 60Co during the 6-week experiments was monitored together with dose estima-


43

FIG. 3. Influence of reference RNA used for quantification of gene transcriptional expression. Expression of MDR1 (panels A and B) and MT (panels C and D) in oysters exposed for 6 weeks in seawater (unfilled bars), seawater containing 400 Bq liter21 of 60Co (filled bars), and seawater with stable 59Co (hatched bars) was normalized either to GAPDH mRNA (panels A and C) or to 18S rRNA (panels B and D). Values are means and SD (n 5 6); *P , 0.05, significant difference relative to the control.

tion, and good correlation was observed between the two parameters. In the external irradiation experiment, the facility operators were able to perform accurate dose quantification prior to the experiments. Because of the Areva NC3 nuclear fuel recycling plant at La Hague, oysters from St-Vaast are very slightly labeled by 60Co and the range of 60Co concentrations in soft parts is 0.12–0.23 Bq kg21 dry weight (6). In the same oysters, the range of 60Co concentrations in homogenized shell material was 0.10–0.30 Bq kg21 dry weight (unpublished). After 6 weeks of immersion in 60 Co-spiked seawater, the 60Co concentration was about 7.5 Bq g21 in tissue (wet weight). After conversion to dry weight, assuming a wet/dry ratio of 6, this is about 250,000-fold higher than in the natural environment. This comparison is for soft parts only; in the laboratory, 60 Co concentrated on the shell much more than in the soft parts and labeling increased linearly in both compartments during the 6 weeks. In the environment, oysters and seawater are in a steady state since seawater 60 Co is quite stable in St-Vaast (100 km from the input source) and the distribution between oyster soft parts 3

Formerly known as Cogema.

and shell is different. The total dose received by oysters after 6 weeks of 60Co labeling in the laboratory was about 6.2 mGy, which can be considered as a low dose. The estimated dose rate after 6 weeks of exposure was about 6.1 mGy h21. This was 15- to 50-fold higher than the natural environment dose rate for Cape La Hague, which has been estimated in the range of 0.1–0.4 mGy h21 (34). This dose rate is low compared to the UNSCEAR (35) reference value of 400 mGy h21 (1 mGy day21). However, it is closer to the range in recent studies on mussels (Mytilus edulis) exposed to tritium (36, 37). These studies suggested that dose rates in the range of 1– 10 mGy h21 could result in cytotoxic and genotoxic effects, especially in the early stages of development. A benchmark value of 10 mGy h21 was reported recently by the ERICA European Union programme (38). The mRNA levels of the target genes were compared with mRNA encoding for actin, a cytoskeletal protein. The choice of the reference gene is crucial in mRNA quantification by real-time PCR. In a previous study, two other reference RNAs were tested (GAPDH mRNA and 18S rRNA); actin proved to be reliable and was ultimately selected (6, 39). In the present study, both alternative reference RNAs were also tested. This did

44

FARCY ET AL.

FIG. 4. Transcriptional expression of MDR1 (panel A) and MT (panel B) in control oysters (unfilled symbols) and oysters exposed to 0.2 Gy min21 for 100 min (filled symbols). Values are means and SD (n 5 6); *P , 0.05, significant difference relative to the control. The dashed lines show the paired values used for statistical tests when the time for irradiation and control data point did not match.

not affect the results obtained with actin. This was illustrated for the MDR1 and MT genes in oysters chronically exposed to the internal low dose (Fig. 3), but to avoid redundancy we have not reported all the results with GAPDH mRNA and 18S rRNA. We observed variability among replicates, as is usually encountered when quantifying mRNA levels in in vivo experiments. In the acute external high-dose exposure experiment, since we lacked data points at 17 h and 48 h, we cannot rule out that mRNA level may have changed in control oysters at 17 h, and this would challenge the conclusion that MT mRNA was significantly increased at 17 h. But since control oysters were not exposed to stress, it can reasonably be assumed that mRNA control levels were stable over the experiment, on the basis of data obtained at 4, 72 and 96 h. Significant changes were observed in the expression levels of some of the genes studied in oysters exposed to radiation. A preliminary study (6) addressed the variability of the same stress gene expression levels in the natural environment. The results revealed not only data scattering but also a very clear seasonal pattern. Therefore, it was necessary to check whether handling the oysters in the laboratory disturbed the expression levels of stress genes. We compared the mRNA levels of oyster genes in the laboratory with data from oysters collected in the field at the same temperature. The expression level ranges in control laboratory conditions were found to be below or similar to the ranges in oysters from the natural environment. This result was observed for all genes studied. Only data for MT and MDR genes are shown in Fig. 5, since the other genes did not display any significant changes after irradiation in the present experiments. Though statistical analysis was precluded because field oyster samples were pooled

FIG. 5. Comparison of control MDR1 (panel A) and MT (panel B) gene expression levels in oysters from environmental and laboratory studies at the same temperatures (10uC and 14uC) as for laboratory experiments. The outer vertical box spans between the first and third quartiles; the inner horizontal box is centered on the median, while the symbol z displays the mean and the open circles indicate the minimum and maximum values. Numbers of observations for data sets are 12 pools of 5 oysters for environmental data and 18 individual oysters for laboratory control data.


while laboratory oyster replicates were individuals, our findings strongly suggested that handling oysters in the laboratory did not interfere with the stress gene response to c radiation. It could thus be asserted that the increased expression levels of MT and MDR in response to chronic exposure to low-dose-rate radiation was significant and that the signal was relevant despite its high natural variability. Peak values from irradiated oysters were above the ranges of control oysters from the laboratory. However, if they were above the range of observed environmental values in the case of acute external high-dose exposure, they were still within this range in the case of chronic internal low-dose exposure. Nevertheless, to reinforce the relevance of this target gene expression approach, we exposed oysters to higher dose rates. Because the amount of 60Co that can be handled is limited, we used an acute external exposure. This was an opportunity to compare the effect of a higher dose rate and another type of exposure: acute or chronic. Exposing oysters to the high acute dose rate stimulated the transcription of the same stress genes as in the case of the chronic low dose rate. The magnitude of the response was a little higher but was similar. Comparing chronic low dose and acute high dose should not be used to assert any dose dependence not only because those exposure conditions may trigger different biological responses but also because the two experiments were not performed at the same temperature. Nevertheless, the results clearly suggest that the dose– response relationship should be investigated further. Radiolysis of water molecules generates free oxygen radicals, resulting in significant damage to cellular components. Though MTs are well known for their role in metal metabolism, they are also known to be involved in the regulation of oxidative stress in response to radiation exposure (39, 20). Ionization of organic molecules also generates toxic compounds that the cell detoxification machinery must process. MDR genes are involved in excretion of organic compounds and have been shown to be involved in the cellular response to ionizing radiation (23, 25, 26, 40). The comparison between the experiments with the chronic low dose and the acute high dose revealed significantly increased expression after 6 weeks of exposure to the low dose (6 3 1023 Gy) or within hours after exposure to the high dose (20 Gy). Additional intermediate dose rates should be tested to clarify the relationship between ionizing radiation and MT and MDR gene responses in oysters. Of the nine genes tested only MT and MDR1 displayed statistically significant changes in the present study. Thus the question arises why only these two genes were affected. The possible role of the other selected stress genes in response to ionizing radiation exposure is supported in the literature (see the Introduction). A technical problem resulting in a more sensitive and accurate detection of changes in MT and MDR1

45

compared to other genes studied is unlikely because all genes were monitored in parallel on the same sample extracts and with the same quantification technique. As a positive control in a separate study, we exposed oysters from the same location to acute thermal stress, another physical stress, and investigated the response of the same set of stress genes (41). We observed increases in other genes among those studied, including HSP as expected. This showed that this approach allows the detection of different gene regulation patterns, depending on the nature of stress. Nevertheless, data scattering resulting from variability and repeatability is certainly a problem that may impair our ability to detect small changes in gene expression levels that would not appear to be statistically significant. Another possible reason would be the existence of different isoforms of stress genes (identified or not) that may be selectively triggered and not included in our selection. Another likely reason is that cell stress response does not necessarily induce all stress gene transcriptional overexpression; it might also involve regulation at the translational and/or posttranslation levels or at the protein enzymatic activity level or some other cellular mechanism. It should be emphasized that no oyster farm is closer to the nuclear recycling plant. However, on the basis of our knowledge on radionuclide hydrodynamic dispersion in the Channel Sea (42), the radionuclide concentrations in the immediate vicinity of the source of input are expected to be only twice the concentrations in the location of St-Vaast oyster farm, where no significant impact was found (6). Thus radionuclide concentrations resulting from liquid radioactive discharges in the North-Cotentin are unlikely to change gene expression in adult oysters. There are few studies on the effects of ionizing radiation on mollusks in the literature. Many of them date back several decades (43–52). Except for the most recent studies, they mainly investigated lethal doses and concluded that like many invertebrates, mollusks are very radioresistant and can withstand exposure to doses in the 101–103 Gy range (35). However, recent investigations on mussels (Mytilus edulis) provided evidence that low-dose exposure to tritium, from 10 mGy h21 during 3 days, induced genotoxic effects in adults (36, 53). Damage to embryo-larvae was also observed in a similar dose range for different biological end points from genotoxicity to mortality (37). Data for other aquatic invertebrates include recent multigenerational experiments on the effects of ionizing radiation in Daphnia magna (54–56). These authors also showed that the larval and juvenile stages were the most affected by chronic external c irradiation (56) or internal aparticle irradiation (241Am) (54, 55). These studies suggest that early stages of oyster development should be studied first since they may be more sensitive to ionizing radiation.

46

FARCY ET AL.

Comparing these experiments remains a sensitive issue. It is well known that the relative biological effectiveness (RBE) of high-LET4 (a particles) and low-LET radiation (c rays, b particles) is very different. This makes it difficult to compare the various radioemitters. Additionally, experimental data in a number of biological models have shown that low-LET radiation (X rays, c rays and electrons) of different energies has different effectiveness. Indeed, the RBE of high-energy low-LET radiation (c rays, electrons) is less than that of low-energy low-LET radiation (X rays, b particles), so there is a factor of about 3 to 4 for tritium b particles relative to 60Co c radiation [reviewed in (57)]. In our experiments, we exposed oysters to a low-LET c-ray emitter, 60Co. In spite of the relatively low expected biological effectiveness of the chronic low-dose-rate irradiation, MT and MDR transcriptional expression was significantly modified. This suggests that MT and MDR transcripts are promising molecular sensors to investigate the response of oysters to radionuclide exposure in a large range of intensities. It is not currently possible to conclude whether the observed mRNA increases are indicative of detrimental effects on the oysters. The fact that most of the genes we investigated were not significantly affected in this study could lead to two contradictory interpretations: (1) the exposure conditions were not stressful enough and there was no need for cells to trigger the stress response; (2) the transcription machinery was inhibited or the stress signals were not effective. Further investigation is needed to assess the potential damage to adult oysters exposed to these low dose rates. It is important to emphasize, however, that in the present study the upregulation of the two genes potentially involved in cellular response to radiation-induced stress (MT and MDR) was not correlated with any mortality or apparent morbidity. According to the literature, the effects of low-dose c radiation can be somewhat surprising. Mitchel and colleagues highlighted that there is now a large body of evidence indicating that, at low doses, the ‘‘Linear NoThreshold’’ hypothesis, used in all radiation protection practices, is incorrect. The LNT hypothesis assumes that all doses, no matter how low, increase the risk of cancer, birth defects and heritable mutations. However, in vitro cell-based experiments show adaptive processes in response to low doses and dose rates of low-LET radiation and do not support the LNT hypothesis (58–60). On the contrary, they show that low doses of low-LET radiation induce protective effects, known as the adaptive response. For example, a single low dose of ionizing radiation can reduce detrimental genotoxic effects (chromosomal aberration, micronucleus frequency) of a subsequent irradiation and increase the cells’ ability to repair DNA damage 4

Linear energy transfer.

(58). The same radioadaptive effect was observed after heat stress (61), suggesting that low-dose radiation and hyperthermia may share common mechanisms of cellular stress regulation. The underlying mechanisms for radioresistance in oysters are still unclear. Our study showed that early induction of detoxification processes and oxyradical scavenging may be involved, at least in part, but they may not be sufficient to explain the radioresistance. Recently, Daly et al. (62, 63) highlighted in Deinococcus radiodurans that their particular resistance to ionizing radiation may be due to Mn complexes, which may prevent oxidative protein damage and preserve the activity of enzymes and thereby increase the efficiency of DNA repair. According to these authors, the genotoxic end point may not accurately represent the radiosensitivity of the organism. They hypothesized that, in irradiated bacteria, death may occur mainly because of the susceptibility of repair proteins to oxidative inactivation that could render even minor DNA damage lethal. The role of antioxidant molecules that may be naturally present in oyster tissue should be considered in future studies. Taken together, these results suggest that the transcriptional expression levels of cell stress genes may be used as a biosensor of exposure of oysters to ionizing radiation. The present results draw attention to two particular stress genes, MT and MDR, and suggest that further investigations are needed on the relationship between the dose and the overexpression levels of these genes. If the relevance of those stress gene expression levels as biomarkers to assess the impact of ionizing radiation in the Pacific oyster is confirmed, it should be used together with other health markers at the integrated (growth, development, etc.) and cellular (stress regulation and repair enzymes, genotoxicity, etc.) biological levels. Moreover, additional studies may also be carried out on the early life stages of oysters since they may be more sensitive to ionizing radiation at these times. The underlying mechanisms for the radioresistance of oysters remain to be clarified. ACKNOWLEDGMENTS Emilie Farcy was supported in part by the Institute for Radioprotection and Nuclear Safety (IRSN) and by a fellowship from ‘‘Re´gion Basse-Normandie’’. The authors wish to thank Luc Solier (Laboratoire de Radioećologie de Cherbourg-Octeville, IRSN) for c-ray spectrometry analysis of 60Co-labeled oysters. Received: December 7, 2010; accepted: March 10, 2011; published online: May 16, 2011

REFERENCES 1. ICRP. Recommendations of the International Commission on Radiological Protection. Publication 26. Oxford: Pergamon Press; 1977.


2. ICRP. Recommendations of the International Commission on Radiological Protection. 1991; Publication 60. Ann ICRP 21(1– 3) Oxford: Pergamon Press; 1991. 3. Pentreath RJ. Radiological protection criteria for the natural environment. Radiat Prot Dosimetry 1998; 75:175–9. 4. Whicker FW, Bedford JS. Environmental impact of radioactive releases. In: Proceedings of an international symposium on environmental impact of radioactive releases. Vienna: International Atomic Energy Agency; 1995. p. 561–7. 5. Hinton TG, Bedford JS, Congdon JD, Whicker FW. Effects of radiation on the environment: A need to question old paradigms and enhance collaboration among radiation biologists and radiation ecologists. Radiat Res 2004; 162:332–8. 6. Farcy E, Voiseux C, Lebel J-M, Fievet B. Seasonal changes in mRNA encoding for cell stress markers in the oyster Crassostrea gigas exposed to radioactive discharges in their natural environment. Sci Total Environ 2007; 374:328–41. 7. Sierra-Rivera E, Voorhees GJ, Freeman ML. Gamma irradiation increases hsp-70 in Chinese hamster ovary cells. Radiat Res 1993; 135:40–5. 8. Matsumoto H, Wang X, Ohnishi T. Binding between wild-type p53 and hsp72 accumulated after UV and c-ray irradiation. Cancer Lett 1995; 92:127–33. 9. Park SH, Lee SJ, Chung HY, Kim TH, Cho CK, Yoo SY, et al. Inducible heat-shock protein 70 is involved in the radioadaptive response. Radiat Res 2000; 153:318–26. 10. Lee SJ, Choi SA, Lee KH, Chung HY, Kim TH, Cho CK, et al. Role of inducible heat shock protein 70 in radiation-induced cell death. Cell Stress Chaperones 2001; 6:273–81. 11. Kang CM, Park KP, Cho CK, Seo JS, Park WY, Lee SJ, et al. Hspa4 (HSP70) is involved in the radioadaptive response: results from mouse splenocytes. Radiat Res 2002; 157: 650–5. 12. Calini V, Urani C, Camatini M. Overexpression of HSP70 is induced by ionizing radiation in C3H 10T1/2 cells and protects from DNA damage. Toxicol In Vitro 2003; 17:561–6. 13. Yamaoka K, Sato EF, Utsumi K. Induction of two species of superoxide dismutase in some organs of rats by low dose Xirradiation. Physiol Chem Phys Med NMR 1994; 26:205–14. 14. Otero G, Avila MA, Emfietzoglou D, Clerch LB, Massaro D, Notario V. Increased manganese superoxide dismutase activity, protein, and mRNA levels and concurrent induction of tumor necrosis factor alpha in radiation-initiated Syrian hamster cells. Mol Carcinog 1996; 17:175–80. 15. Guo G, Yan-Sanders Y, Lyn-Cook BD, Wang T, Tamae D, Ogi J, et al. Manganese superoxide dismutase-mediated gene expression in radiation-induced adaptive responses. Mol Cell Biol 2003; 23:2362–78. 16. Bravard A, Luccioni C, Moustacchi E, Rigaud O. Contribution of antioxidant enzymes to the adaptive response to ionizing radiation of human lymphoblasts. Int J Radiat Biol 1999; 75:639–45. 17. Cai L, Satohc M, Tohyamac C, Cherian MG. Metallothionein in radiation exposure: its induction and protective role. Toxicol Lett 1999; 132:85–98. 18. Agrawal A, Chandra D, Kale RK. Radiation induced oxidative stress: II. Studies in liver as a distant organ of tumor bearing mice. Mol Cell Biochem 2001; 224:9–17. 19. Agrawal A, Choudhary D, Upreti M, Rath PC, Kale RK. Radiation induced oxidative stress: I. Studies in Ehrlich solid tumor in mice. Mol Cell Biochem 2001; 223:71–80. 20. Cai L, Cherian MG. Zinc-metallothionein protects from DNA damage induced by radiation better than glutathione and copperor cadmium-metallothioneins. Toxicol Lett 2003; 136:193–8. 21. Chung HC, Kim SH, Lee MG, Cho CK, Kim TH, Lee DH, et al. Mitochondrial dysfunction by c-irradiation accompanies the induction of cytochrome P450 2E1 (CYP2E1) in rat liver. Toxicology 2001; 161:79–91.

47

22. Inano H, Ishii-Ohba H, Suzuki K, Ikeda K. Reasons for reduced activities of 17 alpha-hydroxylase and C17–C20 lyase in spite of increased contents of cytochrome P-450 in mature rat testis fetally irradiated with 60Co. J Steroid Biochem 1990; 35:711–4. 23. Stammler G, Pommerenke EW, Mattern J, Volm M. Effects of single doses of irradiation on the expression of resistance-related proteins in murine NIH 3T3 and human lung carcinoma cells. Carcinogenesis 1995; 16:2051–5. 24. Chandra D, Kale RK. Influence of gamma-rays on the mouse liver cytochrome P450 system and its modulation by phenothiazine drugs. Int J Radiat Biol 1999; 75:335–49. 25. Osmak M, Miljanic S, Kapitanovic S. Low doses of gamma-rays can induce the expression of mdr gene. Mutat Res 1994; 324:35– 41. 26. Ruth AC, Roninson IB. Effects of the multidrug transporter Pglycoprotein on cellular responses to ionizing radiation. Cancer Res 2000; 60:2576–8. 27. Lu X, Lane DP. Differential induction of transcriptionally active p53 following UV or ionizing radiation: defects in chromosome instability syndromes? Cell 1993; 75:765–78. 28. Maki CG, Howley PM. Ubiquitination of p53 and p21 is differentially affected by ionizing and UV radiation. Mol Cell Biol 1997; 17:355–63. 29. Zeng M, Narayanan L, Xu XS, Prolla TA, Liskay RM, Glazer PM. Ionizing radiation-induced apoptosis via separate Pms2- and p53-dependent pathways. Cancer Res 2000; 60:4889–93. 30. Concin N, Stimpfl M, Zeillinger C, Wolff U, Hefler L, Sedlak J, et al. Role of p53 in G2/M cell cycle arrest and apoptosis in response to gamma-irradiation in ovarian carcinoma cell lines. Int J Oncol 2003; 22:51–7. 31. Corbet SW, Clarke AR, Gledhill S, Wyllie AH. P53-dependent and -independent links between DNA-damage, apoptosis and mutation frequency in ES cells. Oncogene 1999; 18:1537–44. 32. Ponten F, Lindman H, Bostrom A, Berne B, Bergh J. Induction of p53 expression in skin by radiotherapy and UV radiation: a randomized study. J Natl Cancer Inst 2001; 93:128–33. 33. R Development Core Team. R: A language and environment for statistical computing. Vienna: R Foundation for Statistical Computing; 2009. Available from: http://www.R-project.org. 34. Assessment of marine biota doses arising from the radioactive sea discharges of the COGEMA La Hague Facility, Final Report 2003, Vol. I: Executive summary and consensus appraisal of the study. Ontario (Canada): SENES Consultants Ltd; 2003. 35. United Nations Scientific Committee on the Effects of Atomic Radiation, Sources and effects of ionizing radiation. UNSCEAR 1996 Report to the General Assembly, with scientific annex. New York: United Nations; 1996. 647 p. 36. Jha AN, Dogra Y, Turner A, Millward GE. Impact of low doses of tritium on the marine mussel, Mytilus edulis: Genotoxic effects and tissue-specific bioconcentration. Mutat Res Genet Toxicol Environ Mutagen 2005; 586:47–57. 37. Hagger JA, Atienzar FA, Jha AN. Genotoxic, cytotoxic, developmental and survival effects of tritiated water in the early life stages of the marine mollusc, Mytilus edulis. Aquatic Toxicol 2005; 74:205–17. 38. Derivation of predicted-no-effect-dose-rate values for ecosystems (and their sub-organisational levels) exposed to radioactive substances. Deliverable 5. ERICA, European Commission, Sixth Framework, Contract FI6R-CT-2004-508847; 2006. 88 p. Available from: http://www.ceh.ac.uk/protect/ERICAdeliverables. html. 39. Cai L, Satohc M, Tohyamac C, Cherian MG. Metallothionein in radiation exposure: its induction and protective role. Toxicol Lett 1999; 132:85–98. 40. Sukhai M, Piquette-Miller M. Regulation of the multidrug resistance genes by stress signals. J Pharm Pharmaceut Sci 2000; 3:268–80.

48

FARCY ET AL.

41. Farcy E, Voiseux C, Lebel J-M, Fievet B. Transcriptional expression levels of cell stress marker genes in the Pacific oyster Crassostrea gigas exposed to acute thermal stress. Cell Stress Chaperones 2009; 14:371–80. 42. Bailly du Bois P, Dumas F. Fast hydrodynamic model for mediumand long-term dispersion in seawater in the English Channel and southern North Sea, qualitative and quantitative validation by radionuclide tracers. Ocean Modelling 2005; 9:169–210. 43. Longwell AC, Stiles SS. The genetic system and breeding potential of the commercial American oyster. Endeavour 1970; 29:94–9. 44. Mix MC, Sparks AK. Studies on the histhological effects of ionizing radiations on the oyster Crassostrea gigas. I. The degenerative phase involving digestive diverticulae, stomach, and gut. J Invertebr Pathol 1970; 16:14–37. 45. Mix MC, Sparks AK. Repair of digestive tubule tissue of the pacific oyster, Crassostrea gigas, damaged by ionizing radiation. J Invertebr Pathol 1971; 17:172–7. 46. Mix MC. Chronic tissue degeneration in the pacific oyster, Crassostrea gigas, following acute gamma-irradiation. Radiat Res 1972; 49:176–89. 47. Cooley JL. Effects of chronic environmental radiation on a natural population of the aquatic snail Physa heterostropha. Radiat Res 1973; 54:130–40. 48. Engel DW, Davis EM. An atypical response to radiation by the mud snail, Nassarius obsoletus. Int J Radiat Biol 1973; 24:199– 201. 49. Nelson VA. Effects of ionizing radiation and temperature on the larvae of the Pacific oyster, Crassostrea gigas. In: Radionuclides in ecosystems. Proceedings of the 3rd National Symposium on Radioecology, Vol 1. CONF-10501-P2, Washington (DC): U.S. AEC; 1973. p. 591–8. 50. Baptist JP, Wolfe DA, Colby DR. Effects of chronic gamma radiation on the growth and survival of juvenile clams (Mercenaria mercenaria) and scallops (Argopecten irradians). Health Phys 1976; 30:79–83. 51. Greenberger JS, Pechenik J, Lord A, Gould L, Naparstek E, Kase K, Fitzgerald TJ. X-irradiation effects on growth and metamorphosis of gastropod larvae (Crepidula fornicata): A

52.

53.

54.

55.

56.

57.

58. 59. 60.

61.

62. 63.

model for environmental radiation teratogenesis. Arch Environ Contam Toxicol 1986; 15:227–34. Karpenko AA, Ivanovsky YA. Effect of very low doses of gamma radiation on motility of gill ciliated epithelia of Mytilus edulis. Radiat Res 1993; 133:108–10. Jha AN, Dogra Y, Turner A, Millward GE. Are low doses of tritium genotoxic to Mytilus edulis? Marine Environ Res 2006; 62:S297–300. Alonzo F, Gilbin R, Bourrachot S, Floriani M, Morello M, Garnier-Laplace J. Effects of chronic internal alpha irradiation on physiology, growth and reproductive success of Daphnia magna. Aquatic Toxicol 2006; 80:228–36. Alonzo F, Gilbin R, Zeman FA, Garnier-Laplace J. Increased effects of internal alpha irradiation in Daphnia magna after chronic exposure over three successive generations. Aquatic Toxicol 2008; 87:146–56. Gilbin R, Alonzo F, Garnier-Laplace J. Effects of chronic external gamma irradiation on growth and reproductive success of Daphnia magna. J Environ Radioact 2008; 99:134–45. Hunter N, Muirhead CR. Review of relative biological effectiveness dependence on linear energy transfer for low-LET radiations. J Radiol Prot 2009; 29:5–21. Mitchel REJ. Low doses of radiation are protective in vitro and in vivo: Evolutionary origins. Dose-Response 2006; 4:75–90. Mitchel REJ. Low doses of radiation reduce risk in vivo. DoseResponse 2007; 5:1–10. Mitchel REJ. Cancer and low dose responses in vivo: Implications for radiation protection. Dose-Response 2007; 5:285–91. Cai L, Jiang J. Mild hyperthermia can induce adaptation to cytogenetic damage caused by subsequent X irradiation. Radiat Res 1995; 143:26–33. Daly MJ. A new perspective on radiation resistance based on Deinococcus radiodurans. Nat Rev Microbiol 2009; 7:237–45. Daly MJ, Gaidamakova EK, Matrosova VY, Kiang JG, Fukumoto R, Lee DY, et al. Small-molecule antioxidant proteome-shields in Deinococcus radiodurans. PLoS ONE 2010; 5:1–15.