Effective inhibition of human cytomegalovirus gene expression by ...

Acta Biochim Biophys Sin (2009): 389 – 398 | ª The Author 2009. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. DOI: 10.1093/abbs/gmp024. Advance Access Publication 31 March 2009

Effective inhibition of human cytomegalovirus gene expression by DNA-based external guide sequences Zhifeng Zeng, Hongjian Li, Yueqing Li, Yanwei Cui, Qi Zhou, Yi Zou, Guang Yang, and Tianhong Zhou* Key Laboratory for Regenerative Medicine of Ministry of Education, Jinan University, Guangzhou 510632, China *Corresponding address. Tel: þ86-20-85-22-3087; Fax: þ86-20-85-22-3087; E-mail: [email protected]

To investigate whether a 12 nucleotide DNA-based miniEGSs can silence the expression of human cytomegalovirus (HCMV) UL49 gene efficiently, A HeLa cell line stably expressing UL49 gene was constructed and the putative miniEGSs (UL49-miniEGSs) were assayed in the stable cell line. Quantitative RT – PCR and western blot results showed a reduction of 67% in UL49 expression level in HeLa cells that were transfected with UL49-miniEGSs. It was significantly different from that of mock and control miniEGSs (TK-miniEGSs) which were 1 and 7%, respectively. To further confirm the gene silence directed by UL49-miniEGSs with human RNase P, a mutant of UL49-miniEGSs was constructed and a modified 50 RACE was carried out. Data showed that the inhibition of UL49 gene expression directed by UL49-miniEGSs was RNase P-dependent and the cleavage of UL49 mRNA by RNase P was site specific. As a result, the length of DNA-based miniEGSs that could silence gene expression efficiently was only 12 nt. That is significantly less than any other oligonucleotide-based method of gene inactivation known so far. MiniEGSs may represent novel gene-targeting agents for the inhibition of viral genes and other human disease related gene expression.

Keywords DNA-based miniEGSs; RNase P; gene silence; human cytomegalovirus; antivirus Received: December 1, 2008

Accepted: January 15, 2009

Introduction Nucleic acid-based gene interference strategies such as antisense oligonucleotides, ribozymes or DNAzymes, and RNA interference (RNAi) represent powerful

research tools and promising therapeutic agents for human diseases [1–6]. The gene-targeting agents used can be a conventional antisense oligonucleotide, an antisense catalytic molecule (ribozyme or DNA enzyme) or an antisense molecule with an additional (guide) sequence that targets the mRNA for degradation by endogenous RNases such as RNase L and the RNA-induced silencing complexes [3–8]. Each of these approaches has its own advantages and limitations in terms of targeting efficacy, sequence specificity, toxicity, and delivery efficiency in vivo. The improvement in these current technologies and the development of new nucleic acid-based strategies will provide exciting tools and reagents for basic research and clinical applications including therapeutic interventions. The endonuclease ribonuclease P (RNase P) processes tRNA by cleaving the 50 leader sequence of the precursor, generating mature tRNA. Studies with chemically modified substrates have shown that the contact sites between pre-tRNA and some bacterial and Schizosaccharomyces pombe RNase P enzymes are located primarily in the aminoacyl acceptor stem, the T stem, and the T loop [9–13]. Hardt et al. [14] found that D stem deletions reduced cleavage by human and Thermus thermophilus RNase P, whereas these deletions affected the Escherichia coli enzyme to a lesser extent. Other studies demonstrated that RNase P cleavage of a small model substrate consisting only of the acceptor stem with a 50 leader and the T stem and loop; all other domains of tRNA were replaced by a bulge. The most efficient cleavage was achieved with a bulge size of nine nucleotides. In tRNA, the acceptor stem and T stem form a consecutive helix that is the binding site for RNase P [15,16]. It was also demonstrated that RNase P recognizes bimolecular RNA structures that resemble tRNA precursors and subsequently cleave one

Acta Biochim Biophys Sin (2009) | Volume 41 | Issue 5 | Page 389

Inhibition of HCMV UL49 expression by miniEGS

of the strands at a specific position [17,18]. The RNA strand cleaved was defined as the target strand, whereas the other strand was termed the external guide sequence (EGS). This discovery led to the idea of utilizing EGSs as oligonucleotide-based therapeutics [17–25]. Werner et al. [26] showed that the sequence UUCR adjacent to a 5- or 6-bp helix, which in turn is connected through a bulge with a second short helix (seven to eight nucleotides), is sufficient for the recognition and cleavage with human RNase P. This finding has a very important implication that we were able to design EGSs of a length of only 12 or 13 nt, which was named miniEGSs. RNA-based EGSs have been expressed endogenously as transgene in both bacteria and mammalian cells [18,27], and were effective in inhibiting gene expressions of herpes simplex and influenza virus and in abolishing replication of influenza virus in human cells [28,29]. In vitro studies in human cells have shown that DNA-based EGSs, as well as EGS molecules with modified nucleotides, can direct M1 RNA and human RNase P to cleave an mRNA sequence, although their targeting efficiencies are lower than those of unmodified RNAbased EGSs. Previous studies showed that exogenous administration of chemically synthesized DNA-based EGSs is highly effective in treating human cytomegalovirus (HCMV)-infected cells and abolishing HCMV replication [17,30–32]. It is also unclear whether DNA-based miniEGSs can be exogenously administered into human cells for inhibiting gene expression. HCMV, a human herpes virus, causes serious clinical manifestations in newborns and immunocompromised populations such as AIDS patients [33]. For example, this virus is the leading cause of congenital infections associated with mental retardation in newborns [34–38]. The development of effective antiviral compounds and approaches is central for the treatment and prevention of infections by HCMV as well as other herpes viruses. The UL49-deletion TowneBAC was significantly defective in growth in HFF. Thus, UL49 may serve as a target for novel drug development to combat HCMV infection [39]. In this study, we showed that a DNA-based miniEGS-induced RNase P to specifically cleave the UL49 mRNA in cell culture. Our study provided evidences that the RNase P-based approach is effective in inhibiting HCMV gene expression by targeting the UL49 mRNA. These results also demonstrated the feasibility of the active miniEGSs as a novel class of antiviral agents for treatment of human viral diseases. Acta Biochim Biophys Sin (2009) | Volume 41 | Issue 5 | Page 390

Materials and Methods Construction of plasmids The DNA sequence that encodes HCMV UL49 was constructed by PCR using AD169 genomic DNA as a template and oligonucleotides UL49F: 50 -AGGCGAATTCGCCAC CATGGCCAGTCGTCGTCTCCGA-30 and UL49R: 50 -C GGCTCGAGGACATGGGGCAGGCCGTG-30 as 50 and 30 primers, respectively. The reactions were performed for 30 s at 958C, 1 min at 558C, and 45 s at 728C for 35 cycles. The PCR fragments were digested with BamHI and XhoI, and then cloned into pcDNA3.1/myc plasmid vector (Invitrogen, Karlsruhe, Germany). The restriction endonucleases BamHI and XhoI, LA Taq polymerase, and T4 DNA ligase were purchased from Takara (Dalian, China). All oligonucleotides used as PCR primers were purchased from Genewindows (Guangzhou, China). Construction of UL49-expressing cells The protocol for the construction of HeLa cells expressing HCMV UL49 was modified based on the manual of pcDNA3.1/myc plasmid. In brief, HeLa cells (ATCC) were transfected with pcDNA3.1-UL49-myc vector DNA with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocols. The ratio of Lipofectamine 2000 to plasmid was 1 ml/mg. At 48–72 h after infection, cells were incubated in DMEM (Sigma-Aldrich, St. Louis, USA) containing 800 mg/ml neomycin. Cells were subsequently selected in the presence of neomycin for 3 week, and neomycin-resistant cells were cloned. Reverse-transcription PCR and western blotting were performed for UL49 expression analysis. Design of DNA-based miniEGSs The anti-UL49 DNA-based miniEGSs (UL49-miniEGSs) was designed as described by Werner et al. [26]. A search was conducted to find the pattern TTCR in the sequence of the HCMV cDNA (NC_001347). For the design of UL49-miniEGSs, the region between 71331 and 73043 bp was chosen. The putative EGSs were designed to hybridize as EGSs to different regions of the UL49 mRNA with an expected cleavage site 50 to the double-stranded region. Each was designed for stem 1 to hybridize immediately adjacent to a TTCR sequence; the length of stem 1 was five or six nucleotides. Stem 2 for each EGS was designed so that a G residue was 30 to the putative cleavage site; the helix length was seven or eight nucleotides. Consequently, the sizes of the bulges varied between 5 and 14 nucleotides, depending on the


positions of the G residues at the 50 end and the TTCR residues at the 30 end of the targeted region. Two additional DNA-based miniEGSs were designed. One was anti-TK DNA-based miniEGSs (TK-miniEGSs) that targeted the mRNA for thymidine kinase (TK) of herpes simplex virus (HSV-1) (NC_001806) and the other was 30 end mismatch mutant of anti-UL49 DNA-based miniEGSs (mut-miniEGSs). The two EGSs were used as controls to determine whether EGSs with an incorrect guide sequence could target UL49 mRNA in cell culture.

DNA-based miniEGSs treatments of cells Stable UL49-expressing HeLa cells were maintained at 378C in a humidified atmosphere with 5% CO2 in DMEM (Invitrogen), supplemented with 10% fetal calf serum (FCS; Sijiqin, Hangzhou, China), penicillin (100 mg/ml), streptomycin (100 mg/ml), and neomycin (200 mg/ml) (Invitrogen). Cells were grown on collagentreated plates and transfected with DNA-based miniEGSs using the Lipofectamine 2000 (Invitrogen). For the knockdown of HCMV UL49 expression, UL49-miniEGSs, mut-miniEGSs, and TK-miniEGSs were used. The corresponding amounts of EGS molecules were mixed with 25 ml of MEM (Invitrogen). In a separate tube, 2.5 ml of Lipofectamine 2000 per reaction were added to 50 ml of MEM and incubated for 5 min at room temperature. Both solutions were mixed and incubated for an additional 20 min at room temperature to allow complex formation. The solutions were then added to the cells in the 6-well plates to a final volume of 600 ml. Cells were incubated at 378C in the presence of the mixed solution for 6 h. Flow cytometry To assay the transfection efficiency of these DNA-based miniEGS, some of miniEGSs were 50 end fluorescein isothiocyanate (FITC) labeled. FITC-conjugated miniEGSs were transfected into cells at 40 nM. Twenty-four hours post-transfection, cells were washed twice in PBS and finally resuspended in PBS containing 1% (v/v) of FCS. Samples were analyzed using an XL flow cytometer (Coultronics, Margency, France) equipped with an argon laser set at 488 nm. Untransfected cells were used as negative control. Green fluorescence was processed with a 520–530 nm band pass filter. Fluorescence was displayed on a monoparametric histogram (256 channels logarithmic scale) and was expressed as the mean intensity of fluorescence (MIF): MIF ¼ e[(ln 1000:256)x], where ‘x’ is the mean peak

channel on the logarithmic scale. A total of 10 000 cells were analyzed for each assay. Viable cells were selected using the biparametric histogram FLS 90LS (size granulometry).

50 RACE The cleavage of HCMV UL49 mRNA was measured by 50 RACE. Stable UL49-expressing HeLa cells were transfected with 40 nM of UL49-miniEGSs, 40 nM of mut-miniEGSs, 40 nM of TK-miniEGSs, and mock transfected. Total RNA was harvested 24 h after transfection using the TRIzol (Invitrogen) and DNase treated with RNA Free DNAse I (Takara, Tokyo, Japan). Four micrograms of RNA were ligated to a synthetic DNA oligonucleotide adaptor (GCTGATGGCGATGAATGAA CACTGCGTTTGCTGGCTTTGATGAAA) by treatment with T4 RNA ligase (2 units; New England Biolabs (Beijing) Ltd, Beijing, China) for 1 h at 378C. After the ligation reaction, RNA was phenol/chloroform extracted and precipitated with ethanol. Ligation products were reverse-transcribed using oligo(dT) primer and MMLV RT (Toyobo, Tokyo, Japan) according to the manufacturer’s guidelines. The resulting cDNAs were amplified by PCR using primer1 (50 -CACTGCGTTTGCTGG CTTTGATG-30 ) and primer3 (50 -CCTTACCCAGGTTG AGGCAGTGT-30 ), and primer2 (50 -GACCTTCGGCT GCCCGTGCTTCA-30 ), and primer3. As internal standard, a fragment of human endogenous b-actin was amplified simultaneously in each PCR. b-Actin sense primer: 50 -CAGCTTCACCACCACAGTCA-30 , antisense primer: 50 -CAGGTAAGTCCTGGCTGCAT-30 . RT– PCR products were examined by 1.5% agarose gel electrophoresis. The identity of specific cleavage products was confirmed by cloning of the PCR product and sequencing of individual clones. Quantitative RT– PCR Quantitative RT–PCR was performed using standard protocols on an Applied Biosystem’s 7300 Sequence Detection System. Briefly, total RNA was extracted using TRIzol, then 5 ml of a 1/100 dilution of cDNA in water was added into 12.5 ml of the 2 SYBR green PCR master mix (Takara), with 800 nM of each primer in a total volume of 25 ml. All reactions were run in triplicate using Applied Biosystem’s 7300 Sequence Detection System. UL49 gene sense primer: 50 -CGTTCTTGCGT CCTTCATCT-30 ; anti-sense primer: 50 -CACAAAGTAG GGCTTGGTCAT-30 . As internal standard, a fragment of human endogenous b-actin was amplified simultaneously in each PCR. b-Actin sense primer: 50 -TCGTCCACCGC Acta Biochim Biophys Sin (2009) | Volume 41 | Issue 5 | Page 391


AAATGCTTCTAG-30 , anti-sense primer: 50 -ACTGCTG TCACCTTCACCGTTCC-30 . Quantitative RT –PCR conditions: 958C for 10 s 1 cycle, followed by 958C for 5 s, 608C for 20 s, 40 cycles for amplifying UL49 and b-actin.

Western blot analysis For western blot analysis, cells were treated DNA-based miniEGSs with the same protocol in 6-well plates. After washing and lyses steps, proteins were separated using a 15% polyacrylamide gel (Bio-Rad, Munich, Germany). Electrophoresis was performed at 80 V for 30 min and 150 V for 1 h. Then, gels were transferred to a PVDF membrane (Amersham, Freiburg, Germany); Demi-electroblotting was carried out for 30 min at 27 V. Ponceau S solution was used for protein labeling. Blocking was performed for 8 h at 48C with PBST/ de-fatted milk 0.5%, and then primary antibody (1:1000 anti-myc antibody; Invitrogen) was added. After incubation for 2 h at 378C and washing with PBST, incubation with the secondary antibody (1:5000 anti-rabbit IgG-HRP, Amersham Pharmacia) was performed for 45 min. After wash and removal of EDTA with PBS, the blots were incubated for 2 min with the luminescence solution ECL (Pierce, Rockford, USA) and exposed on a film in a darkroom. b-Actin (1:200) was used as positive control using 1:5000 anti-rabbit IgG-HRP (Amersham) as secondary antibody.

Results Efficient expression of the UL49 in HeLa cells The pcDNA3.1-UL49-myc recombinant plasmids were assayed by PCR, digestion of BamHI and XhoI, and sequencing (data not shown). Results showed that DNA fragment coding HCMV UL49 was cloned into pcDNA3.1/ myc vector [Fig. 1(A)] and placed under the control of HCMV immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells. Only the plasmid that was successfully constructed could be used to establish UL49 stable expression HeLa cell lines. The pcDNA3.1-UL49-myc plasmids were transfected into HeLa cells. Complete stable cell lines selection took up to 3 weeks of growth in neomycin-selective media. Neomycin-resistant cells were cloned. Reversetranscription PCR and western blot were carried out to analyze selected cells. The data showed that UL49 stable expression cell lines was constructed successfully [Fig. 1(B,C)]. The cell lines expressing HCMV UL49 can be used for further studies in EGS assay experiment. Acta Biochim Biophys Sin (2009) | Volume 41 | Issue 5 | Page 392

Fig. 1 Efficient expression of the UL49 in HeLa cells (A) The pcDNA3.1-UL49-myc recombinant plasmids were assayed by PCR and digestion of BamHI and XhoI. M, DL5000 DNA marker; lane 1, PCR product using pCDNA3.1-UL49-myc as template; lane2, digestion of pCDNA3.1-UL49-myc by BamHI and XhoI. (B) Neomycin-resistant HeLa cells were assayed by reverse transcription PCR. M, DL500 DNA marker; lane 1, PCR product using cDNA from HeLa cells as template and UL49 sense primer, UL49 anti sense primer; lane 2, PCR product using cDNA from neomycin-resistant HeLa cells as template and UL49 sense primer, UL49 anti-sense primer; lane 3, PCR product using cDNA from neomycin-resistant HeLa cells as template and b-actin sense primer; lane 4, PCR product using cDNA from HeLa cells as template and b-actin sense primer. (C) Neomycin-resistant HeLa cells were assayed by western blotting. Lane1: protein from neomycin-resistant HeLa cells; lane 2, protein from HeLa cells alone.

Design of DNA-based miniEGSs On the basis of the principles of designing miniEGSs described above, one of the putative cleavage sites with the different EGSs was at position 603 of the 1713-bp UL49 mRNA [Fig. 2(A)]. The sequence UUCA adjacent to a 5 bp helix of UL49-miniEGSs GCACGGGTCCAC [Fig. 2(B)], which in turn is connected through a bulge with a second short helix (nine nucleotides) that is sufficient for recognition by human RNase P and induced targeted mRNA cleavage with human RNase P [Fig. 2(C)].


of these DNA-based miniEGSs was assayed by flow cytometry. The transfection efficiency of UL49-miniEGSs, TK-miniEGSs, and mut-miniEGSs was 97.9 and 97.7, and 97.7%, respectively (Fig. 3). The results showed that these miniEGSs were transfected into cells successfully. That would make the data analyses in further study performed in the same background. To assay the silencing efficiency of UL49 expression by UL49-miniEGSs, quantitative RT–PCR and western blot analyses were performed. A reduction of 67% in the levels of UL49 expression was observed in cells that transfected with 40 nM UL49-miniEGSs. It was significantly higher than those of mock and 40 nM TK-miniEGSs, which was 1 and 4%, respectively [Fig. 4(A,B)]. As a result, an efficient inhibition of HCMV UL49 gene expression was induced by UL49-miniEGSs.

Fig. 2 Design of DNA-based miniEGSs (A) UUCA motif and RNase P putative cleavage site: the underlined is stem 1 and stem 2; the bold is UUCA motif; the arrowhead is RNase P putative cleavage site which is 603 bp of UL49 sequence. (B) Anti-UL49 DNA-based miniEGSs (UL49-miniEGSs) sequences. (C) Secondary structure formed by UL49 mRNA and miniEGSs recognition and cleavage with human RNase P. The left is UL49 mRNA sequences; the right is DNA-based miniEGS sequences; the arrowhead is RNase P putative cleavage site. (D) Secondary structure formed by UL49 mRNA and miniEGSs2 unavailability with human RNase P. The left is UL49 mRNA sequences; the right is 30 mutant of DNA-based miniEGS sequences; the arrowhead is RNase P failed cleavage site. (E) Anti-UL49 DNA-based mutant miniEGSs (mut-miniEGSs) sequences. (F) Anti-TK1 DNA-based miniEGSs (TK-miniEGSs) sequences.

The mut-miniEGSs were the sequence of 30 end mutation of UL49-miniEGSs CAC to GTG [Fig. 2(D)] that is insufficient for recognition and cleavage with human RNase P [Fig. 2(E)]. The TK-miniEGSs 50 -CCTGCGGAGAGC-30 [Fig. 2(F)] was designed to determine whether EGSs with an incorrect guide sequence could target UL49 mRNA in cultured cell.

UL49-miniEGSs directed inhibition of UL49 expression To determine whether the UL49-miniEGSs directed human RNase P to cleave UL49 mRNA sequence efficiently, UL49-miniEGSs and TK-miniEGSs were transfected into stable UL49-expressing HeLa cells with mock transfection performed. The transfection efficiency

Inhibition directed by DNA-based miniEGSs is dose-dependent To determine whether the inhibition of UL49 expression directed by miniEGSs is depended on the dose of UL49-miniEGSs or not, the UL49-miniEGSs were transfected into stable cell lines at different concentrations (2.5, 5, 10, 20, 40, 60, and 80 nM). We consistently achieve an optimal transfection efficiency of about 97% (data not shown). To assay the silencing efficiency in different concentration, quantitative RT –PCR and western blot analyses were performed. The quantitative RT–PCR and western blot analysis [Fig. 5(A,B)] showed that when the concentration of UL49-miniEGSs was 2.5 nM, the inhibition efficiency was 17%; and then 5 nM was 20%, 10 nM was 33%, 20 nM was 56%, 40 nM was 70%, 60 nM was 87%, and 80 nM was 88%. As a result, the inhibition efficiency of UL49-miniEGSs was depended on concentration of UL49-miniEGSs. In another word, inhibition of HCMV UL49 expression directed by UL49-miniEGSs is dose dependent. Inhibition directed by DNA-based miniEGS is RNase P-dependent To determine whether the inhibition of UL49 expression directed by miniEGSs is depended on the sequence specificity of UL49-miniEGSs and RNase P-specific cleavage, the 40 nM mut-miniEGSs, which was mutant in RNase P cleavage site of the 30 end of miniEGSs, were transfected into the stable cell line. The transfection efficiency of mut-miniEGSs was 97.7% assayed by flow cytometry [Fig. 3(C)]. To assay the silence efficiency of mut-miniEGS, quantitative RT –PCR, and western blot Acta Biochim Biophys Sin (2009) | Volume 41 | Issue 5 | Page 393


Fig. 3 Transfection efficiency of different miniEGSs (A) The transfection efficiency of UL49-miniEGSs at 40 nM is 97.9%. (B) The transfection efficiency of TK-miniEGSs at 40 nM is 97.7%. (C) The transfection efficiency of mut-miniEGSs at 40 nM is 97.7%.

quantitative RT–PCR and western blot analysis [Fig. 7(A,B)] showed that when the concentration of mut-miniEGSs was 20, 40, 60, and 80 nM, the inhibition efficiency of UL49 expression was 1, 2, 8, and 0%, respectively. There were significant differences compared with those of UL49-miniEGS. It showed that when the cleavage site of RNase P was mutational, the mutant of UL49-miniEGSs could not induce RNase P to cleave the targeted mRNA. The 30 end sequence of EGSs is important for the cleavage of RNase P, and it means that the inhibition directed by miniEGSs is depended on mRNA cleavage induced by RNase P. In another word, inhibition of HCMV UL49 expression directed by UL49-miniEGSs is RNase P dependent.

Fig. 4 UL49-miniEGSs directed inhibition of UL49 expression Quantitative RT–PCR (A) and western blot analysis (B) showed that the inhibition of UL49-miniEGSs was 67% in 40 nM. Mock group was treated with a 12 bp random DNA fragment. HeLa group was HeLa cells treated with a 12 bp random DNA fragment.

analyses were performed. The data showed that the inhibition efficiency of UL49 expression were 7% [Fig. 6(A,B)]. To further determine whether the inhibition of the mut-miniEGS is dose dependent, the mut-miniEGSs were transfected into stable cell lines at different concentrations (20, 40, 60, and 80 nM). The Acta Biochim Biophys Sin (2009) | Volume 41 | Issue 5 | Page 394

Cleavage directed by DNA-based miniEGS is site specific To make sure that the human RNase P-mediated cleavage of UL49 mRNA directed by UL49-miniEGSs is highly site specific, the modified 50 RACE was carried out. A DNA adaptor was ligated to the 50 end of cleavage site. When the UL49 transcripts were cleaved by RNase P in putative cleavage site, there are fragments by reversetranscribed PCR using whatever paired primer1 and primer3 or paired primer2 and primer3. If the PCR fragments can be obtained only using primer2 and primer3, it means that transcripts were not cleaved [Fig. 8(A)]. The 50 RACE results showed that using cDNA from the cells of mock, mut-miniEGSs and TK-miniEGSs transfected as templates, only primer2 and primer3 could get


Fig. 5 Inhibition directed by DNA-based miniEGSs is dosedependent Quantitative RT– PCR (A) and western blot analysis (B) showed that when the concentration of UL49-miniEGSs was 2.5 nM, the inhibition efficiency was 17% and then 5 nM was 20%, 10 nM was 33%, 20 nM was 56%, 40 nM was 70%, 60 nM was 87%, and 80 nM was 88%. Mock group was treated with a 12 bp random DNA fragment.

the PCR fragments [lanes 1–3 and 7–9 in Fig. 8(B) and lanes 1–9 in Fig. 8(C)]. On the other hand, using cDNA from UL49-miniEGSs transfected cells as a template could get PCR fragments using both primer1 and primer3, and primer2 and primer3 [lanes 4–6 in Fig. 8(B)]. Identity of specific cleavage products was confirmed by cloning of the PCR product and sequencing of individual clones (data not shown). It means that cleavage of UL49 mRNA was highly specific directed by UL49-miniEGSs not by other irrelevant miniEGSs.

Discussion The EGS-based technology represents an attractive approach for gene inactivation since it utilizes endogenous RNase P to generate highly efficient and specific cleavage of the target RNA [40,41]. In particular, RNase P is among the most ubiquitous and essential enzymes

Fig. 6 Inhibition efficiency of 40 nM mut-miniEGS Quantitative RT – PCR (A) and western blot analysis (B) showed that the inhibition of UL49-miniEGSs was 67% in 40 nM. Mock group was treated with a 12 bp random DNA fragment. HeLa group was HeLa cells treated with a 12 bp random DNA fragment.

found in nature, as it is responsible for processing all tRNA molecules. Moreover, RNase P-mediated cleavage directed by EGSs is highly specific and does not generate ‘irrelevant cleavage’ that is usually associated with RNase H-mediated cleavage induced by conventional DNA-based oligonucleotides [40,42]. Thus, EGS molecules represent promising general gene-targeting agents that can be used in both basic research and clinical applications. Several criteria must be satisfied if successful targeting with the EGS technology is to be achieved. Among these are efficient delivery of the reagents, high efficiency of cleavage, and sequence specificity of the EGS. Delivery of the EGS into the nuclear compartment is essential to the success of the EGS technology because RNase P is exclusively localized in nuclei [40]. To determine whether the EGSs were efficiently internalized into the cells, EGS molecules conjugated with a Cy3 label were included in the transfection mixture and were visualized by confocal microscopy. The majority of the EGS colocalized with those stained with DAPI ( primarily staining genomic DNA in the nuclei; data not Acta Biochim Biophys Sin (2009) | Volume 41 | Issue 5 | Page 395


Fig. 7 Inhibition efficiency of mut-miniEGS at different concentration Quantitative RT – PCR (A) and western blot analysis (B) showed that when the concentration of mut-miniEGSs was 20, 40, 60, and 80 nM, the inhibition efficiency of UL49 expression were 1, 2, 8, and 0%. Mock group was treated with a 12 bp random DNA fragment. HeLa group was HeLa cells treated with a 12 bp random DNA fragment.

shown). It means that exogenous DNA-based EGSs can be delivered predominantly into the nuclei. The efficient delivery and proper localization of the EGS may be mediated by cellular tRNA-binding proteins, which may interact with the tRNA-like domains of the EGS and target the EGS to the nuclear compartment. Further exploitation of these interactions will facilitate the development of EGSs as novel gene-targeting agents for both basic research and clinical therapeutic applications. The EGSs did not exhibit significant cytotoxicity, as cells treated with EGSs are indistinguishable from the cells treated with lipid complexes alone in the absence of the EGSs, in terms of cell growth and viability for 10 days (data not shown). The UL49-miniEGSs directed human RNase P to cleave UL49 mRNA sequence efficiently. In contrast, a reduction of ,8% in the levels of UL49 expression was observed in cells that transfected control mut-miniEGSs. Mut-miniEGSs could bind efficiently to the UL49 mRNA sequence but contained point mutations that disrupted RNase P cleavage. A reduction of ,5% in the levels of UL49 expression was observed in cells transfected with TK-miniEGSs that Acta Biochim Biophys Sin (2009) | Volume 41 | Issue 5 | Page 396

Fig. 8 Cleavage directed by DNA-based miniEGS is sitespecific (A) Model of modified 50 RACE, Transcript, UL49 mRNA; adapter, DNA adapter; 1, primer 1; 2, primer 2; 3, primer3. (B) RNase P was able to cleave the targeted mRNA induced by UL49-miniEGSs (lanes 4– 5). (C) RNase P was unable to cleave the targeted mRNA induced by mut-miniEGSs (lanes 4 –5). Mock group was treated with a 12 bp random DNA fragment. M, DL2000 DNA marker; Pr, primer; 2RT, RNA without reverse transcription as PCR template.

targeted TK1 mRNA. These results suggest that the overall observed inhibition with UL49 was primarily due to targeted cleavage by RNase P induced by UL49-miniEGSs, which is in contrast to the antisense effect or other non-specific effects of other EGSs. The length of DNA-based miniEGSs was only 12 nucleotides. This is significantly shorter than others used in oligonucleotide-based method of gene inactivation known so far [43]. This new design of EGSs opens promising new perspectives for developing oligonucleotide-based antiviral or anti-human disease therapeutics, because shorter oligonucleotides are easier to synthesize. HCMV is a member of the human herpes virus family, which includes seven other different viruses such as human syncytial virus (HSV) and Epstein–Barr virus [33]. HCMV infects 70 –100% of adults in populations worldwide. Although the virus establishes life-long latency and persists after a primary infection, 60–90% of transplant recipients and AIDS patients may develop CMV infections due either to reactivation of latent virus


or to a new infection [44]. In such patients, CMV infection not only causes problems during the acute phase but also appears to increase the risk of long-term complications. These include transplant vascular sclerosis and other vascular complications in organ transplant recipients and autoimmune phenomena, such as chronic graft versus host disease in bone marrow transplant recipients and skin-related symptoms in AIDS patients. Thus, to find effective anti-HCMV drugs is important for these patients. The drug-resistant HCMV was found and choosing a new target for anti-virus therapy is essential. The UL49 is highly conserved among all herpes viruses and is considered as an ideal target for anti-HCMV therapy because the mutant HCMV with UL49 knockout is lethal in cultured cell [39] and our group found that silenced UL49 gene expression will inhibit virus growth (data not showed). Thus, UL49 may serve as a target for novel drug development to combat HCMV infection. Further research of testing the efficiency of EGS-based gene inactivation in live pathogens should be the ultimate test for feasibility of using EGS in biomedical applications. Such further research to improve the nuclease resistance and binding affinity of the short EGSs by introducing further chemical modifications is currently ongoing. Further understanding of how the functional groups in the nucleotides of an EGS interact with human RNase P and the mRNA substrate will lead to the construction of highly active and stable EGSs with either different bases or modifications at these nucleotide positions. Moreover, engineering different designs of EGSs for increasing their targeting activity, as well as developing new means for improving their delivery, are needed to increase the efficacy of the EGSs in vivo. These studies will further facilitate the development of the EGS-based technology for gene-targeting applications in both basic research and clinical therapy, including the studies and treatment of HCMV infections.

Funding This work was supported by grants fro m the National Natural Science Foundation of China (No. 90608024 and 303707762), a Key Science & Technology Project of Guangzhou (No. 2006J1-C0111), the Planned Science and Technology Project of Guangdong Province (No. 2006B35502002), the Key Program of Natural Science Foundation of Guangdong Province (No. 36703), the China Postdoctoral Science Foundation Funded Project (No. 20080430845). This work was also supported by 211 grant of MOE.

References 1 Sun Y, Chen X and Xiao D. Tetracycline-inducible expression systems: new strategies and practices in the transgenic mouse modeling. Acta Biochim Biophys Sin 2007, 39: 235 – 246. 2 Sun L, Cai L, Yu Y, Meng Q, Cheng X, Zhao Y and Sui G et al. Knockdown of S-phase kinase-associated protein-2 expression in MCF-7 inhibits cell growth and enhances the cytotoxic effects of epirubicin. Acta Biochim Biophys Sin 2007, 39: 999 –1007. 3 Stein CA and Cheng YC. Antisense oligonucleotides as therapeutic agents—is the bullet really magical. Science 1993, 261: 1004 – 1012. 4 Santoro SW and Joyce GF. A general purpose RNA-cleaving DNA enzyme. Proc Natl Acad Sci USA 1997, 94: 4262 – 4266. 5 Wong-Staal F, Poeschla EM and Looney DJ. A controlled, Phase 1 clinical trial to evaluate the safety and effects in HIV-1 infected humans of autologous lymphocytes transuded with a ribozyme that cleaves HIV-1 RNA. Hum Gene Ther 1998, 9: 2407– 2425. 6 Scherer LJ and Rossi JJ. Approaches for the sequence-specific knockdown of mRNA. Nat Biotechnol 2003, 21: 1457– 1465. 7 Maran A, Maitra RK, Kumar A, Dong B, Xiao W, Li G and Williams BR et al. Blockage of NF-kappa B signaling by selective ablation of an mRNA target by 2-5A antisense chimeras. Science 1994, 265: 789–792. 8 Yuan Y and Altman S. Selection of guide sequences that direct efficient cleavage of mRNA by human ribonuclease P. Science 1994, 263: 1269– 1273. 9 Kahle D, Wehmeyer U and Krupp G. Substrate recognition by RNase P and by the catalytic M1 RNA: identification of possible contact points in pre-tRNAs. EMBO J 1990, 9: 1929– 1937. 10 Thurlow DL, Shilowski D and Marsh TL. Nucleotides in precursor tRNA that are required intact for catalysis by RNase P RNAs. Nucleic Acids Res 1991, 19: 885 – 890. 11 Conrad F, Hanne A, Gaur RK and Krupp G. Enzymatic synthesis of 20 modified nucleic acids: identification of important phosphates and ribose moieties in RNase P substrates. Nucleic Acids Res 1995, 23: 1845– 1853. 12 Pan T, Loria A and Zhong K. Probing of tertiary interactions in RNA: 20 -hydroxyl-base contacts between the RNase P RNA and pre-tRNA. Proc Natl Acad Sci USA 1995, 92: 12510– 12514. 13 Loria A and Pan T. Recognition of the T stem-loop of a pre-tRNA substrate by the ribozyme from Bacillus subtilis ribonuclease P. Biochemistry 1997, 6317– 6325. 14 Hardt WD, Schlegl J, Erdmann VA and Hartmann RK. Role of the D arm and anticodon arm in tRNA recognition by eubacterial and eukaryotic RNase P enzyme. Biochemistry 1993, 32: 13046– 13053. 15 Yuan Y and Altman S. Substrate recognition by human RNase P: identification of small model substrates for the enzyme. EMBO J 1995, 14: 159 –168. 16 Carrara G, Calandra P, Fruscolini P and Tocchini-Valentini GP. Two helices plus a linker: small model substrate for eukaryotic RNase P. Proc Natl Acad Sci USA 1995, 92: 2627– 2631. 17 Forster AC and Altman S. External guide sequences for an RNA enzyme. Science 1990, 249: 783– 786. 18 Yuan Y, Hwang ES and Altman S. Targeted cleavage of mRNA by human RNase P. Proc Natl Acad Sci USA 1992, 89: 8006 – 8010. 19 Zhu J, Trang P, Kim K, Zhou T, Deng H and Liu F. Effective inhibition of Rta expression and lytic replication of Kaposi’s sarcoma-associated herpes virus by human RNase P. Proc Natl Acad Sci USA 2004, 101: 9073– 9078.


Inhibition of HCMV UL49 expression by miniEGS 20 Li H, Trang P, Kim K, Zhou T, Umamoto S and Liu F. Effective inhibition of human cytomegalovirus gene expression and growth by intracellular expression of external guide sequence RNA. RNA 2006, 12: 63–72. 21 Zhang WJ, Li HJ, Li YQ, He HK, Tang DS, Zhang X and Zhou TH. Construction of an effective M1GS ribozyme targeting HCMV UL97 mRNA segment in vitro. Yi Chuan Xue Bao 2005, 32: 1205– 1212. 22 Su YZ, Li HJ, Li YQ, Chen HJ, Tang DS, Zhang X and Jiang H et al. In vitro construction of effective M1GS ribozymes targeting HCMV UL54 RNA segments. Acta Biochim Biophys Sin 2005, 37: 210 –214. 23 Altman S. RNase P in research and therapy. Biotechnology (NY) 1995, 13: 327 –329. 24 Krupp G. Antisense oligoribonucleotides and RNase P. A great potential. Biochimie 1993, 75: 135– 138. 25 Hartmann RK, Krupp G and Hardt WD. Towards a new concept of gene inactivation: specific RNA cleavage by endogenous ribonuclease P. In: El-Gewely MR ed. Biotechnology Annual Review, vol 1. Amsterdam: Elsevier, 1995, 215 – 265. 26 Werner M, Rosa E, Nordstrom JL, Goldberg AR and George ST. Short oligonucleotides as external guide sequences for site-specific cleavage of RNA molecules with human RNase P. RNA 1998, 4: 847 – 855. 27 Guerrier-Takada C, Li Y and Altman S. Artificial regulation of gene expression in Escherichia coli by RNase P. Proc Natl Acad Sci USA 1995, 92: 11115– 11119. 28 Kawa D, Wang J, Yuan Y and Liu F. Inhibition of viral gene expression by human ribonuclease P. RNA 1998, 4: 1397– 1406. 29 Plehn-Dujowich D and Altman S. Effective inhibition of influenza virus production in cultured cells by external guide sequences and ribonuclease P. Proc Natl Acad Sci USA 1998, 95: 7327 –7332. 30 Ma M, Benimetskaya L, Lebedeva I, Dignam J, Takle G and Stein CA. Intracellular mRNA cleavage induced through activation of RNase P by nuclease-resistant external guide sequences. Nat Biotechnol 2000, 18: 58– 61. 31 Ma MY, Jacob-Samuel B, Diagram JC, Pace U, Goldberg AR and George ST. Nuclease-resistant external guide sequence-induced cleavage of target RNA by human ribonuclease P. Antisense Nucleic Acid Drug Dev 1998, 8: 415– 426. 32 Perreault JP and Altman S. Important 20 -hydroxyl groups in model substrates for M1 RNA, the catalytic RNA subunit of RNase P from Escherichia coli. J Mol Biol 1992, 226: 399– 409.


33 Mocarski ES and Courcelle CT. Cytomegalovirus and their replication. In: Knipe DM and Howley PM eds. Fields Virology. Philadelphia, PA: Lippincott-William & Wilkins, 2001, 2629– 2673. 34 He R, Ruan Q, Qi Y, Ma YP, Huang YJ, Sun ZR and Ji YH. Sequence variability of human cytomegalovirus UL143 in low-passage clinical isolates. Chin Med J (Engl) 2006, 119: 397– 402. 35 Zhang C, Shen K, Jiang Z and He X. Early diagnosis and monitoring of active HCMV infection in children with systemic lupus erythematosus. Chin Med J (Engl) 2001, 114: 1309– 1312. 36 Jiang H, Wen L and Ling X. Diagnostic value of human cytomegalovirus late mRNA detection in active intrauterine infection. Chin Med J (Engl) 2002, 115: 1507 – 1509. 37 Zhou XM, Lin LS, Shi Y, Tian DA, Huang HJ, Zhou HJ and Jin YX. Establishment of a screening system for selection of siRNA target sites directed against hepatitis B virus surface gene. Acta Biochim Biophys Sin 2005, 37: 310– 316. 38 Pass RF. Cytomegalovirus. In: Knipe DM and Howley PM eds. Fields Virology. Philadelphia, PA: Lippincott-William & Wilkins, 2001, 2675– 2706. 39 Dunn W, Chou C, Li H, Hai R, Patterson D, Stolc V and Zhu H et al. Functional profiling of a human cytomegalovirus genome. Proc Natl Acad Sci USA 2003, 100: 14223 –14228. 40 Altman S and Kirsebom LA. Ribonuclease in the RNA world. In: Gesteland RF et al. eds. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1999, 351– 380. 41 Raj SM and Liu F. Engineering of RNase P ribozyme for gene targeting applications. Gene 2003, 313: 59– 69. 42 Ma M, Benimetskaya L, Lebedeva I, Dignam J, Takle G and Stein CA. Intracellular mRNA cleavage induced through activation of RNase P by nuclease-resistant external guide sequences. Nat Biotechnol 2000, 18: 58– 61. 43 Rudnick SI, Swaminathan J, Sumaroka M, Liebhaber S and Gewirtz AM. Effects of local mRNA structure on posttranscriptional gene silencing. Proc Natl Acad Sci USA 2008, 105: 13787– 13792. 44 Reeves MB, MacAry PA, Lehner PJ, Sissons JGP and Sinclair JH. Latency, chromatin remodeling, and reactivation of human cytomegalovirus in the dendritic cells of healthy carriers. Proc Natl Acad Sci USA 2005, 102: 4140– 4145.