Effects of dietary fructooligosaccharide levels and ...

Fish & Shellfish Immunology 41 (2014) 560e569

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Effects of dietary fructooligosaccharide levels and feeding modes on growth, immune responses, antioxidant capability and disease resistance of blunt snout bream (Megalobrama amblycephala) Chun-Nuan Zhang, Xiang-Fei Li, Guang-Zhen Jiang, Ding-Dong Zhang, Hong-Yan Tian, Jun-Yi Li, Wen-Bin Liu* Key Laboratory of Aquatic Nutrition and Feed Science of Jiangsu Province, College of Animal Science and Technology, Nanjing Agricultural University, No. 1 Weigang Road, Nanjing 210095, People's Republic of China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 20 June 2014 Received in revised form 3 October 2014 Accepted 3 October 2014 Available online 16 October 2014

This study aimed to determine the effects of fructooligosaccharide (FOS) levels and its feeding modes on growth, immune response, antioxidant capability and disease resistance of blunt snout bream (Megalobrama amblycephala). Fish (12.5 ± 0.5 g) were subjected to three FOS levels (0, 0.4% and 0.8%) and two feeding modes (supplementing FOS continuously and supplementing FOS two days interval 5 days) according to a 3 2 factorial design. At the end of 8-week feeding trial, fish were challenged by Aeromonas hydrophila with concentration of 1 105 CFU mL1 and mortality was recorded for the next 96 h. Fish fed 0.4% FOS continuously (D2) and fish fed the basal diet for 5 days followed by 0.8% FOS for 2 days (D5) showed admirable growth performance. The highest plasma lysozyme, acid phosphatase and myeloperoxidase activities as well as complement component 3, total protein and immunoglobulin M (IgM) levels were all observed in fish fed D5. They were significantly higher (P < 0.05) than those of the control group and/or fish fed 0.8% FOS continuously, but exhibited no statistical difference (P > 0.05) with that of fish fed D2. A similar trend was also observed in antioxidant capability as well as the expression of Leap-I and Leap-Ⅱ. Mortality showed an opposite trend with the immune response with the lowest rate observed in fish fed D5. The results indicated that diet supplementing FOS in appropriate levels and feeding modes could improve the growth, immune response and antioxidant capability of fish, as might consequently lead to enhanced disease resistance. It can be speculated that the basal diet for 5 days followed by 0.8% FOS for 2 days was most suitable for blunt snout bream. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Megalobrama amblycephala Fructooligosaccharide Feeding modes Immunity Disease resistance

1. Introduction Blunt snout bream (Megalobrama amblycephala) is one of the most important species cultured in China. This fish is suitable for intensive aquaculture because of its fast growth, ease of reproduction, good taste and high market value [1]. However, the rapid expansion of the production has resulted in the emergence of several resistant pathogens, which is highly infectious and lethal to this species. Thus, improving and protecting fish health in commercial production practices is a major factor in the aquaculture

* Corresponding author. Laboratory of Aquatic Nutrition and Ecology, College of Animal Science and Technology, Nanjing Agricultural University, No. 1 Weigang Road, Nanjing 210095, Jiangsu Province, People's Republic of China. Tel./fax: þ86 025 84395382. E-mail addresses: [email protected] (C.-N. Zhang), [email protected]. cn (W.-B. Liu). http://dx.doi.org/10.1016/j.fsi.2014.10.005 1050-4648/© 2014 Elsevier Ltd. All rights reserved.

industry. One of the most common ways to enhance fish immunity is to administer antibiotics. However, the adverse effects are notorious, which includes the development of antibiotic resistance of aquatic microorganisms and the accumulation of antimicrobial residues in products [2]. Therefore, alternative strategies such as the application of vaccine, probiotics, prebiotics, and immunostimulants may help to reduce the susceptibility of fish to diseases. According to published literatures, the prebiotics such as mannanoligosaccharides (MOS), fructooligosaccharides (FOS), inulin and vitamin C has shown promise as preventive and environmentally friendly alternatives to antibiotics in aquaculture, especially for fishes [3e7].In fact, during the last decade the application of prebiotics has been increasing in aquaculture. Among prebiotics, fructooligosaccharides (FOS) is nondigestible carbohydrates, which selectively stimulate the growth and metabolism of health-promoting bacteria present in the host gut. It is reported that FOS could overcome the limitations and side effects of

C.-N. Zhang et al. / Fish & Shellfish Immunology 41 (2014) 560e569

antibiotics and other drugs, leading to high production through enhanced growth, stimulated immune response and increased resistance to pathogens of fish [3,5,8e11]. Our previous studies also demonstrated the efficacy of FOS to increase the growth performance and the non-specific immunity of fish [8,11]. In previous studies, FOS was supplemented continuously. However, some researchers have proved that continuous administration of high levels of immunostimulants has no beneficial effects on growth or/ and immunity [12,13]. Others also suggested that discontinuous administration of immunostimulants may solve those problems [12]. Unfortunately, up to date, there is no report concerning the feeding modes of FOS on growth, immunity and disease resistant in fish. Being the important components of innate immunity systems antimicrobial peptides (AMPs) are now widely acknowledged as key marker molecules for the assessment of the efficacy of immunostimulants [14]. Since the aquatic environment provides considerable exposure to various pathogens, fish possess a very large number of AMPs against a broad spectrum of pathogens [15]. Among these, liver expressed antimicrobial peptides (Leap) have drawn considerable attention due to its important role in innate immune defense [16]. So far, two categories of Leap (namely Leap-1 and Leap-2) have been identified [17]. However, there is little information concerning the Leap expression following immunostimulants treatment. The correlation between Leap expression and fish immunity still remains poorly understood. Bearing these in mind, this study was conducted to assess the effect of dietary FOS and its feeding modes on growth, innate immune responses and disease resistance to Aeromonas hydrophila in blunt snout bream The data obtained here may give some instructions for the application of prebiotics in herbivorous freshwater fish. 2. Materials and methods 2.1. FOS and experimental diets The FOS used in this study was produced by Meiji Holdings Co., Ltd, Japan. The minimum level of sucrose combined with 1e3 fructoses in the product was 95% and the level of other components was no more than 5%, mainly including glucose, fructose and sucroser. The composition of the basal diet is shown in Table 1. Fish meal, soybean meal, cottonseed meal and rapeseed meal served as

Table 1 Ingredients and proximate composition of the basal diet. Ingredients (g kg1) Fish meal Soybean meal Cottonseed meal Rapeseed meal Soybean oil Fish oil Wheat bran Wheat flour Ca(H2PO4)2 Premixa Salt

Proximate composition (g kg1air-dry basis) 80 300 150 150 22 22 50 196 18 10 2

Moisture Crude protein Crude lipid Energy (MJ kg1)

114.4 327.1 68.8 15.1

a Premix supplied the following minerals (g kg1) and vitamins (IU or mg kg1): CuSO4$5H2O, 2.0 g; FeSO4$7H2O, 25 g; ZnSO4$7H2O, 22 g; MnSO4$4H2O, 7 g; Na2SeO3, 0.04 g; KI, 0.026 g; CoCl2$6H2O, 0.1 g; Vitamin A, 900,000 IU; Vitamin D, 200,000 IU; Vitamin E, 4500 mg; Vitamin K3, 220 mg; Vitamin B1, 320 mg; Vitamin B2, 1090 mg; Vitamin B5, 2000 mg; Vitamin B6, 500 mg; Vitamin B12, 1.6 mg; Vitamin C, 5000 mg; Pantothenate, 1000 mg; Folic acid, 165 mg; Choline, 60,000 mg.

561

protein sources. Both fish oil and soybean oil (1:1) were used as lipid sources. Wheat flour was adopted as carbohydrate sources. Graded doses of FOS (0, 0.4% and 0.8%) were added into the basal diet followed by mixing manually. Dietary ingredients were ground into fine powder then thoroughly mixed, and then blended with an additional 100 mL of water per kg of diet to form a soft dough which was pelleted (without injected steam) using a Pillet Mill with a 2 mm diameter die. The experiment feed was dried at air temperature at 33 C overnight and stored in sealed plastic bags at 4 C until use. The proximate composition of the experimental diets was determined according to the standard AOAC methodology [18]. 2.2. Fish and experimental design Blunt snout bream were obtained from a local fish hatchery (Nanjing, China). Prior to the feeding trial, fish were acclimated to experimental conditions for 4 weeks. During the acclimation period, fish were fed a control diet three times a day. And then, 600 healthy fish with an initial mean body weight of 12.5 ± 0.5 g were randomly distributed into 20 cages which were anchored in an outdoor pond. Each treatment has four replicates and each cage (1 1 1 m, L:W:H) holds 30 fish. A total of five treatments were adopted. Control group was fed with the basal diet (Diet 1, D1). The second group was fed with the basal diet supplemented with 0.4% FOS (Diet 2, D2) continuously. The third was fed with the basal diet supplemented with 0.8% FOS (Diet 3, D3) continuously. The fourth was fed with the basal diet for 5 days followed by 0.4% FOS for 2 days (Diet 4, D4), and the fifth was fed with the basal diet for 5 days followed by 0.8% FOS for 2 days (Diet 5, D5). Fish were fed three times daily at 7:00, 12:00 and 17:00 h, respectively, for 8 weeks. Fish were hand-fed to apparent satiation with utmost care to minimize feed waste. Fish were held under natural photoperiod throughout the feeding trail. Water temperature, pH and dissolved oxygen were monitored using a YSI 556 MPS multi-probe field meter (Geotech, USA). Water temperature ranged from 23 to 28 C, pH fluctuated between 6.5 and 7.6 and dissolved oxygen was maintained approximately at 5.0 mg L1 during the feeding trial. 2.3. Sampling and analysis 2.3.1. Sampling At the end of the feeding trial, fish were starved for 24 h before sampling. And then all individuals were quickly removed from each cage and anesthetized in diluted MS-222 (tricaine methanesulfonate, Sigma, USA) at the concentration of 100 mg L1. Total number and weight of fish in each cage were determined to calculate the growth performance. Six fish were randomly removed from each cage and blood sample was collected by caudal vein puncture using heparinized syringes coated with lithium heparin as anticoagulant. After centrifugation (3000 g for 10 min at 4 C), plasma was stored at 80 C for subsequent analysis. In addition, individual liver and intestinal were dissected over an ice bed and washed thoroughly with chilled saline (0.89 g NaCl L1), dried quickly over a piece of filter paper and stored at 80 C. Three livers and intestines were used for enzymatic analysis and another three livers were used for Real-time PCR. 2.3.2. Growth performance The fish were weighed individually before (initial body weight) and after (final body weight) the 56-day feeding experiment. For each treatment, all fish were used to quantify the percent of weight gain (WG), specific growth rate (SGR) and feed conversion ratio (FCR). These parameters were calculated as follows: Weight gain (WG) ¼ 100 (Wf Wi)/Wi

562


Specific growth rate (SGR, %/d) ¼ 100 (Ln Wf Ln Wi)/t

[32]. The MDA concentration was expressed as nmol mg1 protein in the supernatant.

Feed conversion ratio (FCR) ¼ Feed consumed (g)/(Wf Wi) where Wf is final body weight (g), Wi is initial body weight (g), t is experimental duration in days. 2.3.3. Intestine enzymes assays The whole intestine was carefully weighed and homogenized in an ice bath with ten volumes (v/w) of chilled saline in a tissue homogenizer. The extract was later centrifuged at 3000 rpm at 4 C for 10 min. The supernatant was then stored at 70 C for subsequent analysis. Protein concentration in the supernatant was measured using bovine serum albumin (Sigma, USA) as standard to enable the calculation of enzyme-specific activities. Protease activity was measured using Folin phenol reagent following the procedures detailed by Lowry et al. [19]. Lipase activity was determined according to a modified method given by Gjellesvik et al. [20]. Amylase activity was quantified using a solution to reveal non-hydrolyzed starch [21]. 2.3.4. Histology analysis The intestine samples of three fish in each cage were used for transmission electron microscopy (TEM) following the method described by Merrifield et al. [22]. Briefly, intestine samples were fixed in 2.5% glutaraldehyde for 24 h, then post-fixed in 1% osmium tetroxide (OsO4) for 1 h and stored at 4 C for 24 h. Sections were embedded in epoxy resin Epon812 and cut by an RMC PowerTome XL microtome at 70 nm thickness. The sections were post-stained with 0.2% lead citrate and examined using Image J software version 1.45 (National Institutes of Health, USA). Firstly, the midvillus regions were identified under low magnification. Then, micrographs of the microvillus border were taken at 4000-villus region. TEM (4000) images were analyzed to measure the microvillar length as detailed by Hu et al. [23]. 2.3.5. Immune parameters Lysozyme activity was measured using the turbidimetric method given by Stolen with a little modification [24]. Plasma acid phosphatase (ACP) activity was carried out based on a disodium phenyl phosphate method [25]. Plasma myeloperoxidase (MPO) activity was determined following the procedures detailed by Alcorn et al. [26]. Complement component 3 (C3) and 4 (C4) levels were determined according to the method described by Tang et al. [27]. Plasma nitric oxide (NO) levels were determined by the nitrate reductase assay using a commercial kit (ref. no. A012) produced by Jiancheng Bioengineering Institute (Nanjing, China). Plasma total protein content was estimated by the Biuret method [28]. Total plasma immunoglobulin M (IgM) levels were assayed by the method of enzyme-linked immunosorbent assay (ELISA) [29]. 2.3.6. Analysis of antioxidant status The liver was homogenized in ten volumes (v/w) of chilled physiological saline in tissue homogenizer and centrifuged at 3000 g at 4 C for 10 min. The supernatant was used as enzyme source for measuring enzymatic activities. All enzyme preparations were carried out on ice. Dilution of the sample was done as and when required. Total superoxide dismutase (t-SOD) activity was measured at 550 nm using an SOD detection kit (Nanjing Jiancheng Bioengineering Institute, China) described by Wang and Chen [30]. Catalase (CAT), glutathione peroxidase (GPx) activities and reduced glutathione (GSH) concentration were all determined following the methods described by Lygren et al. [31]. The Malonaldehyde (MDA) concentration was examined by the thiobarbituric acid technique

2.3.7. Real-time PCR analysis Total RNA was extracted from liver using RNAiso Reagent (TaKaRa, Japan) according to the manufacturer's instructions. Then it was resuspended in DEPC-treated water. Agarose gel electrophoresis at 1% and spectrophotometric analysis (A260: 280 nm ratio) were used to assess RNA quality and quantity. The purified RNA generally had OD260/OD280 ratio of 1.8e2.0. The cDNA was synthesized using RT-PCR Kit (Takara, Japan) according to the instructions of SYBR®PrimeScript™. The reaction conditions were as follows: 42 C for 40 min, 90 C for 2 min, and 4 C thereafter. In order to adjust the variation in quantity of input cDNA, the housekeeping gene b-actin was used as an internal control [33]. Primers for RT-PCR were designed with reference to the known sequences of blunt snout bream (Table 2). All primers were synthesized in Shanghai Generay Biotech Co., Ltd. RT-PCR was performed as follows: denaturizing at 95 C for 30 s; 40 cycles of denaturizing at 95 C for 5 s, annealing at 62 C for 60 s. We calculated the relative quantification of the target gene transcript Leap-I and Leap-Ⅱ using the 2DDCT method. 2.4. Challenge test A. hydrophila (A. hydrophila, BSK-10) was provided by Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences (Wuxi, Jiangsu Province, China) and was activated following the methods described by Alexander et al. [34]. A 96 h LD50 (Ah, BSK-10 does that killed 50% of the test fish) was determined before challenge test and the result showed that the LD50 was 105 CFU mL1. After the initial sampling, the fish were kept in prepared tanks for three days and then all remaining 24 fish from each treatment were injected intraperitoneally with the A. hydrophila using the method detailed by Zhang et al. [8]. Fish were carefully monitored and mortality was recorded twice daily for the next 96 h. Cumulative mortality rate was determined using the following formula. Cumulative mortality rate (%) ¼ (N0 Nt) 100/N0 where Nt and N0 were the final and initial number of fish. 2.5. Statistical analysis Statistical analysis was performed using the SPSS General Linear Models (GLM) procedure (SPSS 7.5, Michigan Avenue, Chicago, IL, USA) for significant differences among treatment means based on FOS levels, feeding modes and the interaction of FOS levels and feeding modes [8]. All difference were considered significant at P < 0.05. If significant (P < 0.05) differences were found in factors, Tukey's multiple range test (One-way ANOVA) was used to rank the means [35]. Results were presented as means ± S.E.M (standard error of the mean) of four replications.

Table 2 Nucleotide sequences of the primers used to assay gene expression by real-time PCR. Target Accession Forward (50 e30 ) gene number

Reverse (50 e30 )

Leap-1 JQ308841 CAGACCGCAGCCGTTCCCTT AGCAGTATCCACAGCCTTTG Leap-2 JQ344324 GTGCCTACTGCCAGAACCAT GAACATTACCTATTGCCTCC b-actin AY170122 TCGTCCACCGCAAATGCTTCTA CCGTCACCTTCACCGTTCCAGT


563

Table 3 Growth performance of blunt snout bream fed different levels of dietary FOS under different feeding modes. Diets

Initial weight (g)

D1 D2 D3 D4 D5 Two-way ANOVA FOS Feeding modes Interaction

12.9 12.8 12.8 12.9 13.0

± ± ± ± ±

Finial weight (g)

0.13 0.09 0.14 0.08 0.13

67.09 78.32 69.44 71.47 77.04

± ± ± ± ±

WG (%)

1.25a 1.96c 1.09ab 4.43abc 0.99bc

419.9 511.2 440.7 451.3 495.8

* ns *

± ± ± ± ±

SGR (%) 4.72a 10.80c 5.61a 28.7ab 7.04bc

** ns **

2.94 3.23 3.01 3.04 3.19

± ± ± ± ±

0.02a 0.03c 0.02a 0.09ab 0.02bc

** ns **

FCR 1.48 1.32 1.43 1.45 1.34

± ± ± ± ±

0.05c 0.02a 0.05abc 0.04bc 0.01ab

* ns *

Means in the same column with different superscripts are significantly different (P < 0.05).

3. Result 3.1. Growth performance As can be seen in Table 3, dietary FOS had a significant (P < 0.05) effect on the growth performance of blunt snout bream. The finial weight, WG and SGR of fish fed D2 and D5 were significantly higher (P < 0.05) than those of fish fed D1 and D3 (except for WG of fish fed D3), but exhibited no statistical difference (P > 0.05) with those of the other groups. FCR of fish fed D2 and D5 was both significantly (P < 0.05) lower than that of the control, but showed no differences with that of fish fed D3. In addition, a significant interaction (P < 0.05) between FOS levels and feeding modes was observed in growth performance with the highest values all observed in fish fed D2. 3.2. Digestive enzymes and microvillus length

fed both D2 and D5 were all significantly higher (P < 0.05) than those of the control group. However, no significant difference (P > 0.05) was observed among fish fed D3, D4 and the control diet (Fig. 2). The highest plasma C4 level was observed in fish fed D2 and it was significantly (P < 0.05) higher than that of the control group, but exhibited no significant difference (P > 0.05) with that of the other groups. In addition, plasma lysozyme, ACP, MPO activities and C3 level all were significantly (P < 0.05) affected by the interaction between FOS levels and feeding modes with the highest values all obtained in fish fed D5. No significant difference (P > 0.05) was observed in plasma NO concentration. As can be seen from Fig. 3, the highest values of plasma total protein and IgM contents were both observed in fish fed D5. They were significantly (P < 0.05) higher than that of fish fed D1, but exhibited no statistical difference (P > 0.05) with those of fish fed D2. In addition, the IgM content was significantly (P < 0.05) affected by the interaction between FOS levels and feeding modes with the highest obtained in fish fed D5.

As can be seen from Table 4 and Fig. 1, intestinal amylase activity showed little difference (P > 0.05) among all the treatments. However, protease and lipase activities as well as microvillus length were significantly affected (P < 0.05, P < 0.05, P < 0.01) by dietary FOS levels with the highest values all observed in fish fed D2. They were significantly higher than those of the control group, but exhibited no significant difference (P > 0.05) with those of fish fed D5. In addition, protease and microvillus length were both significantly (P < 0.05, P < 0.01) affected by the interaction between FOS levels and feeding modes with the highest values obtained in fish fed D2.

As can be seen from Fig. 4, liver Leap-I and Leap-II expressions of fish fed D2 and D5 were significantly higher (P < 0.05) than that of the control group. Moreover, the Leap-II expression of fish fed D5 was significantly (P < 0.05) higher than that of fish fed D4, but showed little difference (P > 0.05) compared to that of fish fed D3. In addition, a significant interaction (P < 0.05) between FOS levels and feeding modes was observed in the expressions of Leap-I and Leap-II with the highest values both observed in fish fed D5.

3.3. Immune parameters

3.5. Antioxidant parameters

Immune parameters of blunt snout bream are shown in Fig. 2. Plasma lysozyme, ACP and MPO activities as well as C3 levels of fish

As can be seen from Table 5, no significant difference (P > 0.05) was observed in liver GSH content among all the treatments. However, liver SOD, CAT and GPX activities of fish fed D5 were all significantly (P < 0.05) higher than those of fish fed D1, D3 and D4 except for the GPX activity, but showed no significant difference (P > 0.05) with those of fish fed D2. The lowest MDA content was observed in fish fed D2 and it was significantly (P < 0.05) lower than that of fish fed D1 and D4, but exhibited no statistical difference (P > 0.05) with that of the other groups. In addition, a significant interaction (P < 0.05) between FOS levels and feeding modes was observed in SOD, CAT and GPX activities as well as MDA content.

Table 4 Digestive enzyme activities and microvilli length in the intestine of blunt snout bream fed different levels of dietary FOS under different feeding modes. Diets

Protease (U/mg prot)

D1 D2 D3 D4 D5 Two-way ANOVA FOS Feeding modes Interaction

70.4 91.6 77.3 79.1 90.5 * ns *

± ± ± ± ±

4.6a 2.5b 4.7ab 4.5ab 5.1b

Lipase (U/g prot) 60.9 69.5 65.7 65.9 67.1 * ns ns

± ± ± ± ±

1.9a 4.7b 1.4ab 0.6ab 1.0ab

Amylase (U/mg prot) 1.40 1.53 1.50 1.42 1.57 ns ns ns

± ± ± ± ±

0.05 0.06 0.09 006 0.07

Microvilli length (mm) 1.36 1.58 1.42 1.46 1.58

± ± ± ± ±

0.01a 0.01c 0.01ab 0.06b 0.02c

** ns **


3.4. Leap-I and Leap-II expression

3.6. Mortality after A. hydrophila challenge As can be seen from Fig. 5, the lowest mortality rate was observed in fish fed D5. It was significantly (P < 0.05) lower than that of fish fed D1 and D3, but exhibited no statistical difference (P > 0.05) with that of the other groups.

564


Fig. 1. Comparative TEM micrographs of the intestine of blunt snout bream. D1-Fish fed control diet. D2-Fish fed permanently 0.4% FOS diet. D3-Fish fed permanently 0.8% FOS diet. D4-Fish fed 5 days control diet -2 days 0.4% FOS experimental diet. D5-5 days control diet -2 days 0.8% FOS experimental diet.

4. Discussion 4.1. Growth performance In the present study, fish fed diets supplemented with FOS obtained higher WG and SGR as well as lower FCR compared to control group, suggesting that FOS could improve the growth and feed utilization of blunt snout bream. This improved growth performance might be ascribed to the enhanced intestinal function.

This was supported by the fact that significant improvements in digestive enzymes activities and microvilli height were both observed in fish fed FOS. Previous studies indicated that the growth performance of fish is positively correlated with intestinal enzyme activities as well as the length and quantity of intestinal villus, as might facilitate intestinal digestion and absorption processes [36]. In addition, the beneficial effects of intestinal bacterial communities could not be neglected. In fact, as a kind of prebiotics, FOS is involved in the digestion, absorption and metabolism of various


565

Fig. 2. Effects of FOS on immune parameters (lysozyme (A), ACP (B), MPO (C), C3 (D), C4 (E), NO (F)) of blunt snout bream under different feeding modes. Each data represents the mean of four replicates. Bars assigned with different superscripts are significantly different (P < 0.05).

nutrients in aquatic animals [9,37] and can significantly modulate the colonic microbiota by increasing the number of specific bacteria as consequently changes the microbiota composition [38,39]. In addition, it should be noted here that the growth performance of fish administrated 0.8% FOS discontinuously was better than that of the control group and fish fed 0.8% FOS continuously. This indicated that oral administration of high level of FOS continuously could reduce its efficacy. The negative effect may be due to the inability of intestinal microbiota to ferment excessive levels of prebiotics and subsequent accumulation in the intestine, which may be deleterious to the enterocytes [39,40]. However, further studies are needed to elucidate this. Furthermore, significant improvements in digestive enzymes activities and microvilli height were both

observed in fish fed D2 and D5 in our present study. This finding agrees with a previous observation by Bai et al. who reported that shrimps fed with dietary b-glucan 2 days followed by the basal diet for 5 days showed the highest specific growth rate [12]. Due to the fact that relevant literature is quite limited, the mechanism underlying this process is still unknown, as warrants further investigations. 4.2. Immune response It is well-known that fish treated with oligosaccharides show enhanced immunity [6]. The present study also demonstrated that the application of dietary FOS had beneficial effects on the

566


levels are usually thought to be associated with a enhanced innate immune response in fish [48], suggesting again that FOS had beneficial effects on the immunity of this species. According to previous reports, FOS could beneficially affect host health by selectively stimulating the growth and/or activity of a number of bacteria such as lactic acid bacteria and Bacillus spp [49]. These beneficial bacteria possess cell wall components such as lipopolysaccharides which have immunostimulatory properties [50]. Besides, these oligosaccharides can be selectively used by bifidobacterium to reproduce probiotic bacteria and restrain the adherence and colonization of pathogenic microorganism [51]. Furthermore, the fermentation of FOS including acetate, propionate and butyrate, as well as lactic acid, carbon dioxide and hydrogen also plays a crucial role in health as a bifidogenic agent, modulating the immune system [52,53]. To evaluate whether FOS influenced the expression of immunerelated genes, the expressions of Leap-I and Leap-II were examined using real-time PCR. In this present study, dietary FOS in appropriate levels and feeding modes up-regulated Leap-I and Leap-II expression in blunt snout bream, as was in accordance to the

Fig. 3. Effects of FOS on total protein (A) and IgM (B) contents of blunt snout bream under different feeding modes. Each data represents the mean of four replicates. Bars assigned with different superscripts are significantly different (P < 0.05).

nonspecific immune functions of blunt snout bream evidenced by the significant higher immune parameters (including plasma lysozyme, ACP and MPO activities and C3 and C4 levels as well as total protein and IgM contents) observed in fish fed FOS compared to that of fish fed the control diet. However, fish fed 0.8% FOS continuously showed no significant improvement in immune responses. The similar phenomenon was also observed by Matsuo who reported that long-term oral administration of peptideglucans decreased the immune response of rainbow trout challenged by Vibrio anguillarum [41] as well as in catfish (Clarias gariepinus) [42]. The higher lysozyme and MPO activities might be ascribed to the relatively high leukocyte numbers observed in these two groups due to the fact that fish plasma lysozyme is believed to be leukocyte origin [43,44]. In fact, according to previous studies, fish lysozyme was identified histochemically both in monocytes and neutrophils [43], whereas MPO activity is a peculiar and specific hemeprotein released by neutrophils [45]. As a typical lysosomal enzyme, ACP activity expectedly has the similar trend with that of lysozyme [46]. A similar trend was also observed in plasma contents of C3 and C4 as are all crucial components of fish innate immune system and involved in the defense against microbial pathogens [47]. The increases in plasma protein especially IgM

Fig. 4. Effects of FOS on expression levels of Leap-I (A) and Leap-II (B) mRNA of blunt snout bream under different feeding modes. Each data represents the mean of four replicates. Bars assigned with different superscripts are significantly different (P < 0.05).

C.-N. Zhang et al. / Fish & Shellfish Immunology 41 (2014) 560e569 Table 5 Liver antioxidant status of blunt snout bream fed different levels of dietary FOS under different feeding modes. Diets

GSH (U/mg SOD prot) (U/mg prot)

D1 58.1 ± D2 60.2 ± D3 59.8 ± D4 64.0 ± D5 60.3 ± Two-way ANOVA FOS ns Feeding ns modes Interaction ns

3.3 3.0 3.3 4.4 4.4

132.2 150.1 138.4 142.2 161.5

± ± ± ± ±

4.6a 6.1ab 3.4a 6.7a 7.6b

CAT (U/mg GPX (U/mg MDA (nmol/mg prot) prot) prot) 26.1 29.7 27.7 26.9 31.7

± ± ± ± ±

1.0a 1.0b 1.4a 1.3a 0.8b

37.1 45.9 44.7 42.8 47.6

± ± ± ± ±

3.4a 2.3ab 0.8ab 3.4ab 4.4b

8.94 6.45 8.13 8.56 6.96

* ns

* ns

* ns

* ns

*

*

ns

*

± ± ± ± ±

0.53c 0.60a 0.45abc 0.59bc 0.53ab


results of plasma immune parameters. Augmented expressions of AMPs might be related to the changes of the leukocyte types present in liver post FOS-administration, or to changes in their activation state. According to previous reports, both macrophages and granulocytes are highly relevant in this regard [54], since fish macrophages can express cathelicidins [55]. It is also possible that following an initial activation of resident leucocytes by FOS, a number of other signals are released, such as cytokines, complement factors and even the AMPs themselves, which regulate the activity of cells in the immediate environment, resulting in the increased expression of Leap-I and Leap-II. 4.3. Antioxidant capability The present results showed that liver SOD, CAT and GPX activities are all improved by the application of FOS which was consistent with the immune response. This indicated that FOS might enhance the antioxidant capability of juvenile blunt snout bream, as was supported by the fact that antioxidant enzymes are capable of scavenging reactive oxygen species and products of lipid peroxidation, thereby protecting cells and tissues from oxidative damage [56]. In fact, as the immune response increases, animal cells produce reactive oxygen species (ROS) which are highly

567

microbicidal [57]. In order to keep an ongoing balance between antioxidants and ROS, the major antioxidant enzymes, including SOD, CAT and GPX representing the first line of defense against oxidative stress were generated [58]. In addition, it should be mentioned here that the administration of FOS significantly reduced liver MDA content, indicating again that FOS could inhibit the process of lipid peroxide. This was supported by the fact that MDA level is a direct evidence of the toxic processes caused by free radicals [59]. One probable explanation could be that dietary FOS could improve feed utilization [10], which may contribute to dietary antioxidants assimilated. And, previous studies proved that interval feed immunostimulants such as probiotics and Vc can increase the antioxidant status of fish [60]. Consistent with those results, in the present study, fish fed 0.8% FOS two days per week showed higher antioxidant ability compared to that of the control group and that of fish fed 0.8% FOS continuously. This suggested that an optimal feeding mode (D5) of FOS can contribute to the health of blunt snout bream. 4.4. Challenge test The cumulative mortality is a valuable indicator for monitoring fish health and determining the efficacy of the immunostimulants. In this study after challenge with A. hydrophila, the mortality rate of fish fed FOS was significantly lower than that of the control group. This suggested that dietary FOS can enhance the immunity and disease resistance of the blunt snout bream. According to previous studies, this enhanced disease resistance may be ascribed to the increase of the antibodies secreted by plasma cells, especially by leukocyte which can represent a prelude of multifaceted inflammatory-like immune response [61]. Another possible explanation may be that FOS stimulated immune system by enhancing IgM production and cytokine modulation as well as improving host defenses [62], or that FOS serves as a substrate for proliferation of lactic acid bacteria and bifidobacteria, and inhibit the growth of putrefactive or pathogenic bacteria present in the colon through the production of short chain fatty acids [63]. In addition, continuous application of high dose of FOS resulted in higher cumulative mortality, while interval feeding mode showed better results. This again confirmed that proper feeding schedule and optimal administration doses of prebiotics are both important in improving the immunity and resistance of fish to microbial infection. In conclusion, results of this study indicated that FOS has an enhancing effect on growth, immunity and antioxidant capability of blunt snout bream as well as increasing its resistance to A. hydrophila. However, the continuous application of high dose of FOS has no admirable effects in this species. Feeding basal diet five days following 0.8% FOS diet two days was most suitable for blunt snout bream. Acknowledgments The present study was funded by the National Technology System for Conventional Freshwater Fish Industries of China (CARS46-20) in collaboration with Natural Science Fund of Jiangsu Province (China, BK20130687). References

Fig. 5. Effects of FOS on cumulative mortality of blunt snout bream under different feeding modes. Each data represents the mean of four replicates. Bars assigned with different superscripts are significantly different (P < 0.05).

[1] Zhou Z, Ren Z, Zeng H, Yao B. Apparent digestibility of various feedstuffs for bluntnose black bream Megalobrama amblycephala Yih. Aquacult Nutr 2008;14:153e65. [2] FAO, Joint World Health Organization. Joint FAO/OIE/WHO expert workshop on non-human antimicrobial usage and antimicrobial resistance: scientific assessment: Geneva, December 1e5 2003, vol. 7; 2004. p. 38.

568


[3] Akrami R, Iri Y, Khoshbavar Rostami H, Razeghi Mansour M. Effect of dietary supplementation of fructooligosaccharide (FOS) on growth performance, survival, lactobacillus bacterial population and hemato-immunological parameters of stellate sturgeon (Acipenser stellatus) juvenile. Fish Shellfish Immunol 2013;35:1235e9. [4] Ibrahem MD, Fathi M, Mesalhy S, Abd El-Aty A. Effect of dietary supplementation of inulin and vitamin C on the growth, hematology, innate immunity, and resistance of Nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol 2010;29:241e6. rez-Jime nez A, Costas B, Oliva-Teles A. Effect of temperature [5] Guerreiro I, Pe and short chain fructooligosaccharides supplementation on the hepatic oxidative status and immune response of turbot (Scophthalmus maximus). Fish Shellfish Immunol 2014;40:570e6. [6] Song SK, Beck BR, Kim D, Park J, Kim J, Kim HD, et al. Prebiotics as immunostimulants in aquaculture: a review. Fish Shellfish Immunol 2014;40:40e8. [7] Pharmaceutiques UdL. Dietary modulation of the human colonie microbiota: introducing the concept of prebiotics. J Nutr 1995;125:1401e12. [8] Zhang CN, Li XF, Xu WN, Jiang GZ, Lu KL, Wang LN, et al. Combined effects of dietary fructooligosaccharide and Bacillus licheniformis on innate immunity, antioxidant capability and disease resistance of triangular bream Megalobrama terminalis. Fish Shellfish Immunol 2013;35:1380e6. [9] Soleimani N, Hoseinifar SH, Merrifield DL, Barati M, Abadi ZH. Dietary supplementation of fructooligosaccharide (FOS) improves the innate immune response, stress resistance, digestive enzyme activities and growth performance of Caspian roach (Rutilus rutilus) fry. Fish Shellfish Immunol 2012;32:316e21. [10] Zhang Q, Ma H, Mai K, Zhang W, Liufu Z, Xu W. Interaction of dietary Bacillus subtilis and fructooligosaccharide on the growth performance, non-specific immunity of sea cucumber, Apostichopus japonicus. Fish Shellfish Immunol 2010;29:204e11. [11] Wu Y, Liu WB, Li HY, Xu WN, He JX, Li XF, et al. Effects of dietary supplementation of fructooligosaccharide on growth performance, body composition, intestinal enzymes activities and histology of blunt snout bream (Megalobrama amblycephala) fingerlings. Aquacult Nutr 2013;19:886e94. [12] Bai N, Zhang W, Mai K, Wang X, Xu W, Ma H. Effects of discontinuous administration of b-glucan and glycyrrhizin on the growth and immunity of white shrimp Litopenaeus vannamei. Aquaculture 2010;306:218e24. [13] Chang CF, Chen HY, Su MS, Liao I. Immunomodulation by dietary b-1, 3-glucan in the brooders of the black tiger shrimp Penaeus monodon. Fish Shellfish Immunol 2000;10:505e14. n F, C [14] Alvarez CA, Guzma ardenas C, Marshall SH, Mercado L. antimicrobial activity of trout hepcidin. Fish Shellfish Immunol 2014;41:93e101. [15] Hirono I, Kondo H, Koyama T, Arma NR, Hwang JY, Nozaki R, et al. Characterization of Japanese flounder (Paralichthys olivaceus) NK-lysin, an antimicrobial peptide. Fish Shellfish Immunol 2007:567e75. [16] Liang T, Ji W, Zhang GR, Wei KJ, Feng K, Wang WM, et al. Molecular cloning and expression analysis of liver-expressed antimicrobial peptide 1 (LEAP-1) and LEAP-2 genes in the blunt snout bream (Megalobrama amblycephala). Fish Shellfish Immunol 2013;35:553e63. [17] Liu T, Gao Y, Wang R, Xu T. Characterization, evolution and functional analysis of the liver-expressed antimicrobial peptide 2 (LEAP-2) gene in miiuy croaker. Fish Shellfish Immunol 2014;41:191e9. [18] AOAC. In: Official methods of analysis. 15th ed. Arlington, VA: Association of Official Analytical Chemists Inc; 1990. [19] Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 1951;193:265e75. [20] Gjellesvik D, Lombardo D. Pancreatic bile salt dependent lipase from cod (Gadus morhua): purification and properties. BBA-Lipid Lipid Metab 1992;1124:123e34. [21] Bernfeld P. Amylases a and b. In: Colowick SP, Kaplan NO, editors. Methods in enzymology. New York, USA.: Academic Press; 1995. p. 149. [22] Merrifield D, Dimitroglou A, Bradley G, Baker R, Davies S. Soybean meal alters autochthonous microbial populations, microvilli morphology and compromises intestinal enterocyte integrity of rainbow trout, Oncorhynchus mykiss (Walbaum). J Fish Dis 2009;32:755e66. [23] Hu C, Xu Y, Xia M, Xiong L, Xu Z. Effects of Cu2þ-exchanged montmorillonite on growth performance, microbial ecology and intestinal morphology of Nile tilapia (Oreochromis niloticus). Aquaculture 2007;70:200e6. [24] Stolen JS, Fletcher TC, Anderson DP, Roberson BS, Van Muiswinkel WB. Techniques in fish immunology. Fair Haven, NJ: SOS Publications; 1990. p. 7. [25] El-Boshy ME, El-Ashram AM, AbdelHamid FM, Gadalla HA. Immunomodulatory effect of dietary Saccharomyces cerevisiae, b-glucan and laminaran in mercuric chloride treated Nile tilapia (Oreochromis niloticus) and experimentally infected with Aeromonas hydrophila. Fish Shellfish Immunol 2010;8:802e8. [26] Alcorn SW, Pascho RJ, Murray AL, Shearer KD. Effects of ration level on immune functions in chinook salmon (Oncorhynchus tshawytscha). Aquaculture 2003;17:529e45. [27] Tang Hg, Wu Tx, Zhao Zy, Pan Xd. Effects of fish protein hydrolysate on growth performance and humoral immune response in large yellow croaker (Pseudosciaena crocea R.). J Zhejiang Univ Sci B 2008;9:684e90 [In chinese]. [28] Reinhold J. Manual determination of total serum proteins, albumin and globulin fractions by Biuret method. In: M. Reiner, editor. Standard method of clinical chemistry. New York: Academic Press; 1953. p. 8. [29] Cuesta A, Meseguer J, Esteban M. Total serum immunoglobulin M levels are affected by immunomodulators in seabream (Sparus aurata L.). Vet Immunol Immunopathol 2004;101:203e10.

[30] Wang SH, Chen JC. The protective effect of chitin and chitosan against Vibrio alginolyticus in white shrimp Litopenaeus vannamei. Fish Shellfish Immunol 2005;19:191e204. [31] Lygren B, Hamre K, Waagbø R. Effects of dietary pro-and antioxidants on some protective mechanisms and health parameters in Atlantic salmon. J Aquat Anim Health 1999;11:211e21. [32] Kei S. Serum lipid peroxide in cerebrovascular disorders determined by a new colorimetric method. Clin Chim Acta 1978;90:37e43. [33] Ming J, Xie J, Xu P, Liu W, Ge X, Liu B, et al. Molecular cloning and expression of two HSP70 genes in the Wuchang bream (Megalobrama amblycephala Yih). Fish Shellfish Immunol 2010;28:407e18. [34] Alexander JB, Ingram GA. Noncellular nonspecific defence mechanisms of fish. Annu Rev Fish Dis 1992;2:249e79. [35] Gao J, Koshio S, Ishikawa M, Yokoyama S, Mamauag REP, Han Y. Effects of dietary oxidized fish oil with vitamin E supplementation on growth performance and reduction of lipid peroxidation in tissues and blood of red sea bream Pagrus major. Aquaculture 2012;356e357:73e9. [36] Dimitroglou A, Merrifield D, Moate R, Davies S, Spring P, Sweetman J, et al. Dietary mannan oligosaccharide supplementation modulates intestinal microbial ecology and improves gut morphology of rainbow trout, Oncorhynchus mykiss (Walbaum). J Anim Sci 2009;87:3226e34. [37] Ringø E, Olsen RE, Gifstad T, Dalmo R, Amlund H, Hemre GI, et al. Prebiotics in aquaculture: a review. Aquacult Nutr 2010;16:117e36. [38] Li P, Burr GS, Gatlin DM, Hume ME, Patnaik S, Castille FL, et al. Dietary supplementation of short-chain fructooligosaccharides influences gastrointestinal microbiota composition and immunity characteristics of Pacific white shrimp, Litopenaeus vannamei, cultured in a recirculating system. J Nutr 2007;37:2763e8. [39] Hoseinifar S, Mirvaghefi A, Mojazi Amiri B, Rostami HK, Merrifield D. The effects of oligofructose on growth performance, survival and autochthonous intestinal microbiota of beluga (Huso huso) juveniles. Aquacult Nutr 2011;17: 498e504. [40] Sakai M. Current research status of fish immunostimulants. Aquaculture 1999;172:63e92. [41] Matsuo K, Miyazono I. The influence of long-term administration of peptidoglycan on disease resistance and growth of juvenile rainbow trout. Nippon Suisan Gakkaishi 1993;59:1377e9. [42] Yoshida T, Kruger R, Inglis V. Augmentation of non-specific protection in African catfish, Clarias gariepinus (Burchell), by the long-term oral administration of immunostimulants. J Fish Dis 1995;18:195e8. [43] Ellis A. Immunity to bacteria in fish. Fish Shellfish Immunol 1999;9: 291e308. [44] Cecchini S, Terova G, Caricato G, Saroglia M. Lysosome activity in embryos and larvae of sea bass (Dicentrarchus labraxL.), spawned by broodstocks fed with vitamin C enriched diets. Bull Eur Assoc Fish Pathol 2000;20:120e4. [45] Basha KA, Raman RP, Prasad KP, Kumar K, Nilavan E, Kumar S. Effect of dietary supplemented andrographolide on growth, non-specific immune parameters and resistance against Aeromonas hydrophila in Labeo rohita (Hamilton). Fish Shellfish Immunol 2013;35:1433e41. [46] Cheng TC. Immunology deficiency disease in marine mollusks: measurements of some variables. J Aquat Anim Health 1989;1:209e16. [47] Magnadottir B. Immunological control of fish diseases. Mar Biotechnol 2010;12:361e79. [48] Israelson O, Petersson A, Bengten E, Wiersma E, Anderson J, Gezelius G, et al. Immunoglobulin concentration in Atlantic cod, Gadus morhua L., serum and cross reactivity between anticod antibodies and immunoglobulins from other species. J Fish Biol 1991;39:265e78. [49] Sang HM, Fotedar R, Filer K. Effects of dietary mannan oligosaccharide on the survival, growth, immunity and digestive enzyme activity of freshwater crayfish, Cherax destructor Clark. Aquacult Nutr 1936;2011(17):629e35. [50] Bricknell I, Dalmo RA. The use of immunostimulants in fish larval aquaculture. Fish Shellfish Immunol 2005;19:457e72. [51] Kaneko T, Yokoyama A, Suzuki M. Digestibility characteristics of isomaltooligosaccharides in comparison with several saccharides using the rat jejunum loop method. Biosci Biotechnol Biochem 1995;59:1190e4. [52] Passos LML, Park YK. Fructooligosaccharides: implications in human health being and use in foods. Cienc Rural 2003;33:385e90. [53] Thakur M, Dixit VK. Ameliorative effect of fructo-oligosaccharide rich extract of Orchis latifolia Linn. on sexual dysfunction in hyperglycemic male rats. Sex Disabil 2008;26:37e46. [54] Schlapbach CYN, Hunger RE. Human [beta]-defensin-2 and psoriasin are overexpressed in lesions of acne inversa. J Am Acad Dermatol 2009;1: 58e65. [55] Chang CI, Pleguezuelos O, Zhang YA, Zou J, Secombes CJ. Identification of a novel cathelicidin gene in the rainbow trout, Oncorhynchus mykiss. Infect Immun 2005;73:5053e64. [56] Li X, Ma Y, Liu X. Effect of the Lycium barbarum polysaccharides on age-related oxidative stress in aged mice. J Ethnopharmacol 2007;111:504e11. [57] Martinez-Alvarez RM, Morales AE, Sanz A. Antioxidant defenses in fish: biotic and abiotic factors. Rev Fish Biol Fish 2005;15:75e88. [58] Farombi E, Adelowo O, Ajimoko Y. Biomarkers of oxidative stress and heavy metal levels as indicators of environmental pollution in African cat fish (Clarias gariepinus) from Nigeria Ogun river. Int J Environ Res Publ Health 2007;4:158e65.

C.-N. Zhang et al. / Fish & Shellfish Immunology 41 (2014) 560e569 [59] Livingstone D. Oxidative stress in aquatic organisms in relation to pollution and aquaculture. Rev Med Vet 2003;154:427e30. [60] Sun YZ, Yang HL, Ma RL, Lin WY. Probiotic applications of two dominant gut Bacillus strains with antagonistic activity improved the growth performance and immune responses of grouper Epinephelus coioides. Fish shellfish Immunol 2010;29:803e9. [61] Bagni M, Romano N, Finoia MG, Abelli L, Scapigliati G, Tiscar PG, et al. Shortand long-term effects of a dietary yeast b-glucan (Macrogard) and alginic acid

569

(Ergosan) preparation on immune response in sea bass (Dicentrarchus labrax). Fish Shellfish Immunol 2005;18:311e25. [62] Lomax AR, Calder PC. Prebiotics, immune function, infection and inflammation: a review of the evidence. Br J Nutr 2009;101:633e58. [63] Saulnier D, Spinler JK, Gibson GR, Versalovic J. Mechanisms of probiosis and prebiosis: considerations for enhanced functional foods. Curr Opin Biotech 2009;20:135e41.