Photosynth Res DOI 10.1007/s11120-015-0199-5
ORIGINAL ARTICLE
Effects of ethylene on photosystem II and antioxidant enzyme activity in Bermuda grass under low temperature Zhengrong Hu1,2 • Jibiao Fan1,2 • Ke Chen1 • Erick Amombo1,2 Liang Chen1 • Jinmin Fu1
•
Received: 18 June 2015 / Accepted: 17 October 2015 Ó Springer Science+Business Media Dordrecht 2015
Abstract The phytohormone ethylene has been reported to mediate plant response to cold stress. However, it is still debated whether the effect of ethylene on plant response to cold stress is negative or positive. The objective of the present study was to explore the role of ethylene in the cold resistance of Bermuda grass (Cynodon dactylon (L).Pers.). Under control (warm) condition, there was no obvious effect of the ethylene precursor 1-aminocyclopropane-1carboxylic acid (ACC) or the antagonist Ag? of ethylene signaling on electrolyte leakage (EL) and malondialdehyde (MDA) content. Under cold stress conditions, ACC-treated plant leaves had a greater level of EL and MDA than the untreated leaves. However, the EL and MDA values were lower in the Ag? regime versus the untreated. In addition, after 3 days of cold treatment, ACC remarkably reduced the content of soluble protein and also altered antioxidant enzyme activity. Under control (warm) condition, there was no significant effect of ACC on the performance of photosystem II (PS II) as monitored by chlorophyll a fluorescence transients. However, under cold stress, ACC inhibited the performance of PS II. Under cold condition, ACC remarkably reduced the performance index for energy conservation from excitation to the reduction of
& Liang Chen
[email protected] & Jinmin Fu
[email protected] 1
Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, Hubei 430074, China
2
University of Chinese Academy of Sciences, 19 Yuquan Road, Beijing 100049, China
intersystem electron acceptors (PIABS), the maximum quantum yield of primary photochemistry (uP0), the quantum yield of electron transport flux from QA to QB (uE0), and the efficiency/probability of electron transport (WE0). Simultaneously, ACC increased the values of specific energy fluxes for absorption (ABS/RC) and dissipation (DI0/RC) after 3 days of cold treatment. Additionally, under cold condition, exogenous ACC altered the expressions of several related genes implicated in the induction of cold tolerance (LEA, SOD, POD-1 and CBF1, EIN3-1, and EIN3-2). The present study thus suggests that ethylene affects the cold tolerance of Bermuda grass by impacting the antioxidant system, photosystem II, as well as the CBF transcriptional regulatory cascade. Keywords Ethylene Photosystem II Antioxidant enzymes activities Bermuda grass Cold tolerance
Introduction Bermuda grass (Cynodon dactylon (L).Pers.), a typical warm-season turf grass, grows in warm climates all over the world, and is widely used in park, lawns, as well as sport fields (Shi et al. 2014a, b). The optimum temperature for Bermuda grass growth ranges from 26 to 35 °C (Fan et al. 2014). Low temperature is a key environmental factor that limits the growth, production, and utilization of Bermuda grass (Fan et al. 2014). Plants exposed to cold stress in their native habitat have evolved mechanisms to enhance their cold tolerance, such as by adjusting various physiological and biochemical processes (Guy 1990; Thomashow 1999; Zhu et al. 2004; Knight and Knight 2012). However, information concerning the cold resistance of Bermuda grass is limited, and the studies of Bermuda grass under
123
Photosynth Res
cold stress are being conducted to improve this species’ tolerance (Zhang et al. 2011a, b; Shi et al. 2014a, b). Photosynthesis is a vital photochemical and biochemical process that converts solar energy into chemical energy essential for biomass production on earth. Low temperature directly affects the performance and activity of the photosynthetic apparatus (Smillie and Hetherington 1984). Jeong et al. (2002) observed that leaf photosynthesis of cold-sensitive rice cultivars, ‘Milyang 23,’ declined faster than that of cold-resistant ‘Stejaree 45’ when leaves were exposed to low temperatures of 5, 10, 15, 20, and 25 °C for 6 h. Greer et al. (1986) reported that cold stress induced inhibition of whole chain electron transport and of photosystem II (PS II) photochemistry. Low temperature reduced the efficiency of photosynthetic electron transport and resulted in photoinhibition of photosynthesis (Krause 1994). When plants are subjected to photoinhibitory conditions, reactive oxygen species (ROS) are typically formed, which can result in an inactivation of PS II components (Osmond 1994). The extent of this inactivation depends on the balance between inactivation and re-synthesis of PS II components during the stress (Allakhverdiev et al. 2008; Chen et al. 2013). However, there has been little information about the effects of ethylene on photosystem and antioxidant system in plants under low temperature stress. Low temperature is one of the major abiotic stresses that limit plant growth, productivity, as well as plant geographical distribution. Plants have developed complex mechanisms for enhancing cold tolerance, such as the C-repeat-Binding Factor/DRE-Binding Factor (CBF/ DREB) pathway (Thomashow 1999). CBF, a crucial transcriptional activator activates a large subset of downstream cold-regulated (COR) genes to allow plants to tolerate cold stress (Thomashow 1999). Ethylene, one of classical plant hormones, is involved in the regulation of numerous physiological processes (Bleecker and Kende 2000; Lin et al. 2009). The synthesis of ethylene is from methionine through S-adenosyl-L-methionine and 1-aminocyclopropane-1-carboxylic acid (ACC), and this process is successively catalyzed by ACC synthase (ACS) and ACC oxidase (ACO) (Yang and Hoffman 1984; Kende 1993). Ethylene is perceived by a family of receptors that act as negative factors in ethylene signaling (Chang et al. 1993; Hua et al. 1995; Hua and Meyerowitz 1998; Sakai et al. 1998; Shi et al. 2012). CONSTITUTIVE TRIPLE RESPONSE1 (CTR1) is a Raflike serine/threonine protein kinase that functions as a negative regulator in ethylene signaling. In the absence of ethylene, these receptors interact with CTR1 and positively regulate its activity (Kieber et al. 1993; Gao et al. 2003). Then, EIN2, a crucial positive regulator in ethylene signaling, is inhibited by CRT1 (Alonso et al. 1999). The EIN3/EIN3-Like1 (EIL) family of transcription factors,
123
functioning downstream of EIN2, modulates the expressions of ethylene-response target genes, sequentially regulating the ethylene-related responses in plants (Chao et al. 1997; Solano et al. 1998; Chen et al. 2009; Boutrot et al. 2010; Zhang et al. 2011a). Concurrently, there is increasing evidence that ethylene plays a crucial role during plant response to biotic and abiotic stress (Bleecker and Kende 2000; Ederli et al. 2006; Wang et al. 2007; Li et al. 2009; Shi et al. 2012; Catala et al. 2014; Zhao et al. 2014). Shi et al. (2012) reported that, upon exposure to -4 °C, ACC-treated plants exhibited lower survival rates and higher electrolyte leakage (EL) than control plants. Conversely, plants treated with the ethylene biosynthesis inhibitor aminoethoxyvinyl glycine (AVG) showed higher survival rate and lower EL. Conversely, ethylene-insensitive mutants, such as etr1-1, ein4-1, ein2-5, ein3-1, and ein3 eil1, were more tolerant to cold stress than wild-type plants. In contrast, Catala´ (2014) reported that ethylene biosynthesis was involved in positively modulating constitutive cold tolerance in Arabidopsis. The latter authors assessed freezing tolerance of an Arabidopsis octuplet ACS mutant that contains extremely low levels of ethylene. The expression levels of many cold-inducible genes were severely compromised in the octuplet mutant grown under standard conditions or under exposure to low temperature. The octuplet plants exhibited a significantly lower freezing tolerance than the wild-type plants. In addition, exogenous ethylene significantly increased constitutive freezing tolerance of Arabidopsis. Therefore, it remains controversial whether ethylene affects cold tolerance regulation of plants negatively or positively. The bone of contention was the different conditions employed in growing the plants in these studies. In the present study, a physiological and molecular approach was used to evaluate the role of ethylene in cold stress response of plants. The objectives of this study were to investigate how ethylene affected the response of chlorophyll a fluorescence, antioxidant enzyme activity, and CBF transcriptional-regulatory cascade in Bermuda grass to low temperature in the hope to provide new information to turf grass researchers on low-temperaturetolerance mechanisms in Bermuda grass.
Materials and methods Plant material and growth conditions A wild-type Bermuda grass (Cynodon dactylon) ‘WBD128,’ collected from Xiaojiang City, Zhejiang Province, China (N27°34.258, E120°27.383) was used in this study. Uniform stolons were planted in plastic pots (7.5 cm in diameter and 9.0 cm deep) filled with matrix (brown coal soil). There were
Photosynth Res
several drainage holes at the bottom of each pot to discharge excessive water and enhance soil aeration. The pots were kept in the greenhouse for 2 months to establish growth conditions of 12-h-light (240 lmol m-2 s-1, 31 °C)/12-hdark (23 °C) and 40 % relative humidity following the method described by Fan et al. (2014). Treatments The established grasses were transferred into two growth chambers (LSC-339CF, Xingxing Group Co., Ltd, Zhejiang, China) under different growth conditions. The conditions of the control chamber were 12 h-light (240 lmol m-2 s-1, 30 °C)/12 h-dark (25 °C) and 60 % relative humidity. The cold treatment-chamber conditions were similar to those of the control chamber, except that a temperature of 4 °C (day/ night) was used. In the study, 50 lmol ACC and 20 lmol AgNO3 were used as an ethylene donor and an ethyleneproduction inhibitor according to the method by Shi et al. (2012) and Catala´ et al. (2014). Double-distilled water was used for the control. Plants in each growth chamber were sprayed and watered daily with 100 mL of deionized water, ACC, or AgNO3 for 3 days, respectively. Fully extended leaf samples were collected for RNA extraction at 0, 2, 4, 6, 12, 24, and 48 h and for physiological assays at 3 d after treatment. Leaf samples were subjected to various analyses after collection. In addition, the EL and chlorophyll a fluorescence of the plants above were recorded at 3 d and 6 d of cold treatment.
Electrolyte leakage To measure EL, about 0.1 g of treated leaves was washed with deionized water to remove surface-adhered electrolytes. Segments of 1-cm long were excised and put into a 50 mL centrifuge tube filled with 15 mL of deionized water, then placed in an incubator shaker to shake for 24 h at room temperature. Conductivity was measured by a conductivity meter (JENCO-3173, Jenco Instruments, Inc., San Diego, CA, USA). After determining initial conductivity (CA), tissues of leaves in the solution in test tubes were heated at 95 °C for 30 min to disrupt the tissues completely and release all the electrolytes. Conductivity (CB) was measured after the solution in test tubes was cooled down to room temperature. Relative electrolyte leakage (EL) was calculated by using the formula: ELð%Þ ¼ ðCA =CB Þ 100. Chlorophyll content
Measurements
Chlorophyll content was measured according to the method described by Hiscox and Israelstam (1979) with some modifications. About 0.1 g of leaves was cut into pieces and placed into 15 mL tubes filled with 10 mL dimethylsulfoxide. Tubes were placed in the dark for 48 h, and the absorption at 645 and 663 nm was measured by spectrophotometer (UV-2600, UNICO Instruments Co. Ltd., Shanghai, China). Total chlorophyll content was calculated by using the formula: Chl total mg L1 ¼ 20:2 OD645 þ 8:02 OD663.
Chlorophyll (Chl) a fluorescence transient
Crude enzyme extraction
Chlorophyll (Chl) a fluorescence transient was measured with pulse-amplitude modulation (PAM) fluorometer (PAM 2500, Heinz Walz GmbH) with high time resolution (10 ls). The third fully expanded leaves were collected at 3 and 6 days after cold stress exposure. After 30 min of dark adaptation, OJIP transients were triggered by red light of 3000 lmol photons m-2 s-1 to ensure closure of all reaction centers of PS II and obtain a true fluorescence intensity of FM (Chen et al. 2014).The strong light pulses induced Chl a fluorescence emission, which was measured subsequently and digitized between 10 us and 320 ms. Then, the OJIP transients were analyzed by using the JIP-test as described in Chen et al. (2013). The JIP-test, a multiparametric analysis of the OJIP transient, is based on the theory of energy fluxes in bio-membranes (To´th et al. 2007b), which translates original Chl a fluorescence data into biophysical parameters that quantified the energy flow through PS II (Tsimilli-Michael and Strasser 2008; To´th et al. 2007a).
To extract crude enzyme, about 0.2 g of leaves was homogenized using ice-cooled mortar and pestle in 4 mL of 150 mM sodium phosphate buffer (pH 7.0). The homogenate was transferred into 15 mL tubes and centrifuged for 25 min with 8000 rpm at 4 °C. The supernatant was collected for physiological assays, including the content of soluble proteins, MDA, and enzymes activities. MDA content The MDA content was determined by the method of Hu et al. (2012) with slight modifications. Briefly, 1 mL of supernatant was mixed with 2 mL of reaction solution containing 0.5 % (v/v) thiobarbituric acid (TBA) and 20 % (v/v) trichloroacetic acid (TCA). The mixture was heated at 95 °C for 30 min, then quickly cooled down to room temperature, treated to eliminate air bubbles, and centrifuged at 8000 rpm for 20 min. Then, absorbance of the supernatant was determined by a spectrophotometer at 532
123
Photosynth Res
and 600 nm. The MDA content was calculated using the formula: MDA ðnmol g1 FWÞ ¼ ½ðOD532 OD600Þ L =ð1 FWÞ of 155 mM
1
ð was the extinction coefficient cm :
Total soluble protein and antioxidant enzyme activity Total soluble protein content was estimated by the method described by Bradford (1976) with BSA (bovine serum albumin) as a standard. Briefly, 30 lL of enzyme extraction was mixed with 3 mL Bradford solution containing 0.01 % Coomassie Blue G250 (w/v), 4.7 % ethanol (v/v), and 8.5 % phosphoric acid (v/v). Then, absorbance at 595 nm was obtained using a spectrophotometer. Soluble protein content was calculated based on a BSA standard curve. Activities of SOD (superoxide dismutase) and POD (peroxidase) were determined according to methods described by Fan et al. (2014) with some modifications. As for SOD activity measurement, 100 lL of crude enzyme solution was added into 2.9 mL reaction solution composed of 50 mM sodium phosphate buffer (pH 7.8), 60 lM riboflavin, 195 mM methionine, 3 lM ethylene diamine tetraacetic acid (EDTA), and 1.125 mM nitro blue tetrazolium (NBT). 3 mL reaction solution was used as the control. Tubes were placed under 4000-lux fluorescent lamp for 30 min, and then transferred to darkness to stop the reaction followed by reading absorbance at 560 nm. The enzyme quantity that reduced NBT by 50 % in the dark was defined as a unit of SOD activity. The activity of POD was measured as follows: 50 lL of crude enzyme solution was mixed with a reaction solution containing 100 mM sodium acetate-acetic acid buffer (pH 5.0), 0.25 % guaiacol, and 0.75 % H2O2. Absorbance at 460 nm was measured at 1-min interval for 3 min. A unit of POD activity was defined as an increase by one unit per minute of the absorbance at 460 nm. Quantitative RT-PCR analysis To analyze quantitative RT-PCR, total RNA in leaves was isolated and purified by using Trizol reagent (Invitrogen, America). About 2.5 lg RNA was reversely transcribed using M-MLV reverse transcriptase (Promega) with an oligo (dT) primer according to the operation manual. The quality of cDNA was examined by gel electrophoresis, and then cDNA was diluted 4 times and kept at -80 °C for qRT-PCR analysis. Gene-specific primes of selected genes were synthesized based on the sequences reported previously and are listed in Table 1. The ACTIN was used as the
123
internal reference gene in the reaction, and qRT-PCR was performed by following method proposed by Chen et al. (2010) on the StepOnePlus Real-Time PCR Systems (Applied Biosystems, USA), using the fluorescent intercalating dye SYBR Green with a detection system (Opticon 2, MJ Research, Waltham, USA). Statistical analysis Values were given as mean ± SD of at least three replicates. Statistical analyses were performed using one-way ANOVA, and Duncan’s multiple range tests to separate means at a significant level of P \ 0.05, using the statistical package SPSS 16.0 and Excel 2010 for Windows.
Results Membrane integrity of cold-stressed Bermuda grass Percentage electrolyte leakage (EL) and malondialdehyde (MDA) content serve as indicators of damage to cell membrane integrity induced by cold stress (Lyons 1973); therefore, we measured changes in EL and MDA content of control plants versus plants treated with ACC or AgNO3. Cold treatment significantly increased the percentage of EL and MDA content of control plants not treated with agents that manipulate ethylene levels or ethylene signaling (Fig. 1a). The ACC-treated plants had higher EL and MDA content, whereas Ag?-treated plants had lower EL and MDA content compared to control plants under 4 °C low temperatures (Fig. 1). These results indicated that exogenous ACC aggravates the oxidative damage of cell membrane induced by cold stress. Soluble proteins and chlorophyll content of coldstressed Bermuda grass Proteins are vital cellular components that can be damaged by adverse environmental conditions (Prasad 1996). To explore the change of soluble protein accumulation, soluble protein’s content was measured. As shown in Fig. 2, low temperature increased soluble protein content in the control regime. In the absence of cold stress, there was no significant difference among the three regimes (control, ACCtreated, and Ag?-treated). However, under cold condition, soluble protein content in ACC-treated plants was lower than in control plants, while it was higher for the AgNO3treated regime (Fig. 2a). Cold stress lowered chlorophyll content in the control regime. ACC-treated plants had even lower chlorophyll content, whereas Ag?-treated plants had higher chlorophyll content than control plants in response to low temperatures (Fig. 2b).
Photosynth Res Table 1 Primers used for the expression of genes Gene name
Primer sequences (50 -30 )
POD-1 F
AGTTCGACAACGGCTACTACC
R
TGACCTCGCCACTGGTCCCC
POD-2 F
AGGCAGCGGGGCTGAAGAAGG
R
CCCTGACGAAGCAGTCGTGGAA
SOD F
TGGGAAACATTGTTGCCAACA
R
GCCAACAACACCACATGCCA
LEA F R
TCATCCCCAGCGTGTTCATCA GAGGCCGCCAAACAGAAGACA
Subsequently, H2O2 is removed by POD (ascorbate peroxidase) or catalase (CAT) (Foyer et al. 1997). The POD activity in the control regime was lower in cold-treated plants versus warm-grown plants (Fig. 3a). After cold treatment, POD activity in ACC-treated plants was significantly lower compared to that in control plants, while opposite results were observed in AgNO3-treated plants (Fig. 3a). In contrast, low temperature significantly increased SOD activity in the control regime, with significant further enhancement by ACC treatment, but inhibition by Ag? treatment (Fig. 3b). The OJIP transient curves of cold-stressed Bermuda grass
SOD scavenges superoxide radicals by converting superoxide anions to O2 and H2O2 (Alscher et al. 2002).
As shown in Fig. 4, cold stress affected the OJIP transient curve for the control regime (Fig. 4). After 3 days of cold treatment, the OJIP curve was dampened for both ACCand Ag?-treated plants compared to control plants, while the OJIP curve level for Ag?-treated plants was higher than ACC-treated plants. However, after 6 days of cold stress, Ag?-treated plants displayed a more pronounced OJIP curve than the control plants, while the reverse result was observed in ACC-treated plant (Fig. 4b). To further explore the behavior of the photosynthetic system in plants exposed to cold stress, various structural and functional parameters were assessed. As compared to normal condition (30 °C), low temperature decreased the values of uP0 (maximum quantum yield), uE0 (quantum yield of the electron transport flux from QA to QB), WE0 (efficiency/probability with which an electron trapped by PS II is transferred from QA to QB), and cRC (probability that a PS II Chl molecule functions as RC) in control regime (Fig. 5). In the absence of cold stress, neither ACC nor AgNO3 treatments had obvious effects on these
Fig. 1 Effects of the ethylene on cell membrane stability and lipid peroxidation of the Bermuda grass treated with ethylene precursor or inhibitor under low temperature. a Electrolyte leakage (EL). b Malondialdehyde (MDA) content. Bermuda grass plants were treated with cold stress (4 °C) for 3 days. ACC was used as ethylene donor, and AgNO3 was used as ethylene inhibitor. The CK was the
control that treated with deionized water, the ACC was plant treated with 50 lM ACC, and the AgNO3 was plant treated with 20 lM AgNO3. The FW was fresh weight. Mean values and SD were calculated from four independent experiments. Different letters indicated statistical difference significance at P \ 0.05 among the treatments by Duncan’s multiple range tests
CBF1 F
ACCAAGTTCCGCGAGACGC
R
CGAGTCGGCGAAGTTGAGGCA
EIN3-1 F
GCAGCACTGCGACCCGCCGCA
R
ACTTGGACTGCCGGACCAGGC
EIN3-2 F
GTGGTTGCGTCTTCAGTTGTT
R
GCACTTGAAGAGCTGACCATA
CTR1 F
AGAAAGCTGTTGCTGGTGACG
R
CTGCAGCAAGTGATAGATCAC
F and R represent forward and reverse, respectively
Antioxidant enzyme activity of cold-stressed Bermuda grass
123
Photosynth Res
Fig. 2 Effects of the ethylene on soluble protein and chlorophyll content of the Bermuda grass treated with ethylene precursor or inhibitor under low temperature. a Soluble protein content. b Chlorophyll content. Bermuda grass plants were treated with cold stress (4 °C) for 3 days. ACC was used as ethylene donor, and AgNO3 was used as ethylene inhibitor. The CK was the control that treated with
deionized water, the ACC was plant treated with 50 lM ACC, and the AgNO3 was plant treated with 20 lM AgNO3. The FW was fresh weight. Mean values and SD were calculated from four independent experiments. Different letters indicated statistical difference significance at P \ 0.05 among the treatments by Duncan’s multiple range tests
Fig. 3 Effects of the ethylene on antioxidant enzymes activities of the Bermuda grass treated with ethylene precursor or inhibitor under low temperature. a Activities of peroxidase (POD). b Superoxide dismutase (SOD). Bermuda grass plants were treated with cold stress (4 °C) for 3 days. ACC was used as ethylene donor, and AgNO3 was used as ethylene inhibitor. The CK was the control that treated with
deionized water, the ACC was plant treated with 50 lM ACC, and the AgNO3 was plant treated with 20 lM AgNO3. The FW was fresh weight. Mean values and SD were calculated from four independent experiments. Different letters indicated statistical difference significance at P \ 0.05 among the treatments by Duncan’s multiple range tests
fluorescence parameters. Under a low temperature of 4 °C, ACC-treated plants exhibited lower uP0, WE0, uE0, and cRC values, while Ag?-treated plants had higher uP0, WE0, and uE0 values than control plants. In addition, several specific energy-flux parameters and PIABS (performance index for energy conservation from photons absorbed by PS II antenna to the reduction of QB) were analyzed. Cold stress significantly increased the ABS/ RC (energy fluxes for absorption) and DI0/RC (energy fluxes for dissipation) values, while decreasing the ET0/RC (electron transport flux per RC) and PIABS values (potential for energy conservation from exciton to the reduction of intersystem electron) for the CK plants (Fig. 6). In the
absence of cold stress, there was no obvious effect of ACC or Ag? on these parameters for any of the regimes (control, ACC, and AgNO3 regimes). However, after cold treatment, ACC-treated plants had higher ABS/RC and DI0/RC values, while Ag?-treated plants had lower ABS/RC and DI0/ RC values than control plants (Fig. 6a, b). However, compared to control plants, neither ACC nor AgNO3 treatments had obvious effect on the ET0/RC value, while the value for ACC-treated plans was lower than that for Ag?-treated plants (Fig. 6c). Moreover, under low temperature, the PIABS value was remarkably reduced by exogenous ACC treatment compared to control plants (Fig. 6d).
123
Photosynth Res
Fig. 4 Effects of the ethylene on polyphasic chlorophyll fluorescence transients of the Bermuda grass treated with ethylene precursor and inhibitor under cold stress. a Chlorophyll fluorescence transients of plants at 3 days of cold treatment(4 °C). b Chlorophyll fluorescence transients of plants at 6 days of cold treatment (4 °C). Plant leaves were treated with deionized water, 50 lM ACC, and 20 lM AgNO3,
respectively. ACC was used as ethylene donor, and AgNO3 was used as ethylene inhibitor. The CK was the control that treated with deionized water, the ACC was plant treated with the ACC, the AgNO3 was plant treated with the AgNO3. The 30 means the culture temperature of 30 °C, and the 4 means the culture temperature of 4 °C
Fig. 5 Effects of the ethylene on quantum yields and efficiencies/ probabilities deduced by JIP-test analysis of fluorescence transients. Calculation of each parameter followed the method of Yusuf et al. (2010). a Alteration of maximum quantum yield for primary photochemistry (uP0). b Alteration of quantum yield of the electron transport flux from QA to QB (uE0). c Alteration of efficiency/ probability with that a PS II trapped electron is transferred from QA to QB (WE0). d Probability that a PS II Chl molecule functions as RC
(cRC). Bermuda grass plants were treated with cold stress (4 °C) for 3 days. ACC was used as ethylene donor, and AgNO3 was used as ethylene inhibitor. The CK was the control that treated with deionized water, the ACC was plant treated with 50 lM ACC, and the AgNO3 was plant treated with 20 lM AgNO3. Mean values and SD were calculated from seven independent experiments. Different letters indicated statistical difference significance at P \ 0.05 among the treatments by Duncan’s multiple range tests
123
Photosynth Res
Fig. 6 Effects of ethylene on energy fluxes per active PS II reaction center (RC) and performance index (PIABS) deduced by JIP-test analysis of fluorescence transients. Calculation of each parameter followed the method of Yusuf et al. (2010). a Absorbed photon flux per RC (ABS/RC). b Dissipated photon flux per RC (DI0/RC). c Electron transport flux per RC (ET0/RC). d Energy conservation from excitation to the reduction of intersystem electron (PIABS). Bermuda grass plants were treated with cold stress (4 °C) for 3 days.
ACC was used as ethylene donor, and AgNO3 was used as ethylene inhibitor. The CK was the control that treated with deionized water, the ACC was plant treated with 50 lM ACC, and the AgNO3 was plant treated with 20 lM AgNO3. Mean values and SD were calculated from seven independent experiments. Different letters indicated statistical difference significance at P \ 0.05 among the treatments by Duncan’s multiple range tests
Gene expression of cold-stressed Bermuda grass
Low temperature caused an up-regulation of POD-1 in control plants (Fig. 7c). From 6 h of cold treatment, the expression level of POD-1 substantially increased and reached the peak at 48 h. Cold-induced up-regulation of POD-1 was inhibited by exogenous ACC treatment, whereas it was enhanced by Ag? treatment (Fig. 7c). Expression of POD-2 in control regime was down-regulated at 2–4 h of cold treatment, then up-regulated at 6 h, and then reached its highest level at 12 h (Fig. 7d). After 24 h of cold treatment, gene expression decreased to a low level. Expression level of POD-2 in ACC-treated regime was significantly lower than in control regime at 4–48 h of cold treatment. On the contrary, the expression level in Ag? treated regime was considerably higher than in control regime at 4–24 h of cold treatment. It is well understood that the CBF transcription factors play essential roles in cold acclimation (Thomashow 1999). Cold stress activates the transcription of CBF and gives rise to the expression of a large subset of COLD-REGULATED (COR) genes (Stockinger et al. Gilmour et al. 1998; Liu et al. 1998). Overexpression of CBFs results in constitutively enhanced cold tolerance (Jaglo-Ottosen et al. 1998;
To further investigate how ethylene modulates gene expression pattern of plants in response to cold stress, expression patterns of three genes encoding antioxidant enzymes, three genes involved in ethylene signaling, a LEA gene as well as a CBF gene were analyzed. Late embryogenesis-abundant (LEA) protein has been reported play a critical role in abiotic stress tolerance, particularly dehydration and cold stress. As shown in Fig. 7a, after cold treatment, LEA expression in the control regime was generally up-regulated. When applying ethylene precursor ACC treatment, LEA expression was suppressed at 12–48 h of cold treatment. Conversely, the coldinduced up-regulation of LEA was enhanced by Ag? application (Fig. 7a). After 12 h of cold treatment, the transcript level of SOD increased and reached a peak, then gradually decreased to a basal level. The expression level of SOD in the ACCtreated plants was generally lower than in the control, while the opposite result was observed in Ag?-treated plants (Fig. 7b).
123
Photosynth Res Fig. 7 Effects of the ethylene on the gene transcription of the LEA and antioxidant enzymes of Bermuda grass with different treatments under cold stress (4 °C). a Relative expression of LEA. b Relative expression of SOD. c Relative expression of POD-1. d Relative expression of POD-2. Total RNA were isolated from leaves treated at 4 °C for 0, 2, 4, 6, 12, 24, and 48 h, respectively. Quantitative real-time PCR was repeated for three times. Duncan’s multiple range tests were used to determine the statistical differences. Bars show SD
Liu et al. 1998; Gilmour et al. 2000). As shown in Fig. 8a, expression of CBF1 in control regime increased and reached a peak at hour 2 of cold treatment, decreased at hour 4–12, and then increased again and was and maintained at a relatively higher level at 24–48 h. When exogenous ACC was applied, the expression level of CBF1 was generally lower than that in the control regime, while Ag?-treated plants exhibited a higher level of CBF1 expression at 6 and 12 h of cold treatment (Fig. 8a). We further examined the expression of CTR1, EIN3-1, and EIN3-2 that are involved in ethylene signaling in plants exposed to cold stress. After cold treatment, expression of CTR1 in the control regime was generally down-regulated, except for a temporary increase at 24 h, and decreased to a relatively low level afterward (Fig. 8b). The expression level in the ACC-treated plants was substantially lower than in the control plants at 4, 24 h of cold treatment, while it was higher at 6 and 12 h (Fig. 8b). When cold stress was applied, the expression of CTR1 in the Ag?-treated regime was significantly higher than in the control regime at 2–12 h of cold treatment. Under cold conditions, expression of EIN3-1 in control plants was down-regulated, and remained at a low level after 6–48 h of cold treatment (Fig. 8c). As for the ACCtreated regime, expression of EIN3-1 was up-regulated at 2 h of cold treatment, then declined substantially and remained at an extremely low level (Fig. 8c). The transcription level of EIN3-1 in the ACC-treated plants was
generally higher than that in control regime (Fig. 8c). Similarly, the expression of EIN3-2 in control regime was down-regulated under cold stress. After 2 h of cold treatment, gene expression decreased rapidly and substantially to a relatively low level (Fig. 8d). The transcription level of EIN3-2 in ACC-treated regime was generally higher than in control plants, while the expression level in Ag?-treated plants was unchanged compared to control plants (Fig. 8d).
Discussion It has been documented that ethylene signaling is crucial in regulating plant growth and stress response. The involvement of ethylene in plant response to cold stress has been implicated in several species (Ciardi et al. 1997; Yu et al. 2001; Zhang and Huang 2010; Wang et al. 2012). Shi et al. (2012) reported that application of the ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) decreased freezing tolerance in Arabidopsis thaliana, while addition of the ethylene biosynthesis inhibitor aminoethoxyvinyl glycine (AVG) or of the ethylene signaling antagonist Ag? increased cold tolerance. In contrast, Catala´ et al. (2014) reported that the low temperature rapidly increased the levels of ACC SYNTHASE (ACS) and ethylene, overcoming the control of RARE COLD-INDUCIBLE 1A (RCI1A), which restrains ethylene biosynthesis and is a negative regulator of constitutive freezing tolerance in
123
Photosynth Res
Fig. 8 Effects of the ethylene on the gene transcription of CBF1, CTR1, and EIN3 of Bermuda grass with different treatments under cold stress (4 °C). a Relative expression of CBF1. b Relative expression of CTR1. c Relative expression of EIN3-1. d Relative
expression of EIN3-2. Total RNA was isolated from leaves treated at 4 °C for 0, 2, 4, 6, 12, 24, and 48 h, respectively. Quantitative realtime PCR was repeated for three times. Duncan’s multiple range tests were used to determine statistical differences. Bars show SD
Arabidopsis. Consequently, this rise in ethylene would induce many cold-regulated genes in response to cold stress. However, prolonged cold stress increased RCI1A levels, which would restore the basal levels of ACS protein and ethylene. Low temperature causes cell damage and drastically impairs plant development and growth (Yang et al. 2006; Shi et al. 2012; Catala´ et al. 2014). Numerous changes can take place to allow plants to tolerate cold stress, such as alteration of membrane permeability, enzyme activity, related metabolism, as well as cell ultrastructure (Fan et al. 2014; Shi et al. 2014b). There are studies indicating that the cold tolerance of Bermuda grass was affected by changes in cell membrane stability, the content of proline, and soluble sugars as well as in antioxidant enzyme activity (Fan et al.2014; Shi et al. 2014a). Further studies showed that the accumulation of carbohydrates, LEA (Late Embryogenesis Abundant Proteins), and some phytohormones also affected cold tolerance of Bermuda grass (Zhang et al. 2011a, b). The best characterized transcriptional regulation of a response pathway to cold stress is the CBF/DREB transcriptional regulatory cascade (Thomashow 1999). CBF activates downstream cold-regulated (COR) genes (Stockinger et al. 1997; Liu et al. 1998).
In the present study, cold stress significantly increased MDA content and EL in control plants. Moreover, under cold condition, levels of the latter two parameters in ACCtreated regimes were significantly higher than in control plants, while they were lower for Ag?-treated plants, which indicated that ethylene aggravated lipid peroxidation and plasma-membrane permeability increases are induced by cold stress. These results are consistent with those of Zhang et al. (2006) that cold stress-induced damage of plasma membrane in Bermuda grass. Exogenous ethylene treatment aggravated cold-induced inhibition of PS II. Cold stress strongly decreased the PIABS value (as an indicator of maximal photon efficiency of PS II) in the control regime, and even more so in ACCtreated plants. In Arabidopsis thaliana and many other plant species, the chlorophyll fluorescence parameter Fv/ Fm can serve to assess cold tolerance (Artus et al. 1996; Ehlert and Hincha 2008; Rizza et al. 2001; Peguero-Pina et al. 2008; Baker and Rosenqvist 2004; Mishra et al. 2011). In the present study, after cold stress, the uP0 value in the ACC-treated regime was significantly lower than the control regime. Further analysis suggested that the uE0 and WE0 values were decreased in control plants after cold treatment, with further decreases in ACC-treated plants but
123
Photosynth Res
higher values in Ag?-treated plants. These results collectively suggested that cold stress decreased electron transport rate in Bermuda grass, and particularly so in ACCtreated plants. An effect of low temperature in decreasing the efficiency of photosynthetic electron transport in plants was previously shown in other species (Osmond 1981; Hodgson and Raison 1989). Light energy absorbed in a leaf can either be utilized in photosynthesis (photochemical quenching), be dissipated as heat (nonphotochemical quenching),or lead to formation of ROS and possible inactivation of PS II (Huner et al. 1998; Pospı´sˇil 2012; Chen et al. 2014). A potential energy imbalance between electron transport, photochemistry and metabolism is exacerbated under conditions of low temperature (Huner et al. 1998). Our study showed that low temperature increased the values of ABS/RC and DI0/RC but decreased the ET0/RC value in control plants of Bermuda grass (Fig. 6). Furthermore, after 3 days of cold treatment, ABS/RC and DI0/RC values in the ACC-treated regime were significantly higher than control plants and lower in Ag?-treated plants. These results suggest that exogenous ethylene enhances the level of imbalance between light absorption and utilization induced by low temperature, but almost maintained the level of energy used for electron transport per reaction center. Jeon et al. (2010) and Hu et al. (2013) reported that cold stress could decrease cell turgor and induce instability of plasma membrane, leading to cell damage and plant death by inducing an ROS burst and oxidative damage (Apel and Hirt 2004; Miller et al. 2010; Mittler et al. 2004, 2011). Antioxidant enzymes such as CAT, SOD, POD, and glutathione peroxidase (GPX) play a crucial role in coldtemperature tolerance in plants. In the present study, cold stress significantly decreased POD activity in control plants, with further decreases in POD activity and POD-2 expression levels in ACC-treated plants but not in Ag?treated plant (Figs. 3a, 7d). Furthermore, cold stress increased SOD activity, which was enhanced by ACC but inhibited by Ag? treatment (Fig. 3b). These results indicate that exogenous ethylene has complex effects on ROS detoxification by antioxidants in plants exposed to cold stress. These findings are consistent with the result that transcription of POD-2 in control regime was down-regulated under cold condition. By contrast, the transcript level of SOD increased and reached a peak at 12 h of cold treatment, then gradually declined to a basal level. The ACC-treated plants had lower expression level of SOD than the CK plants, while opposite result was observed in the Ag?-treated plants (Fig. 7b). These results indicate that, under low temperature, exogenous ethylene might impact gene expression of antioxidant enzyme (in different directions for different antioxidant enzymes) and enzymes activities in Bermuda grass.
Previous studies have suggested a role the late embryogenesis abundant (LEA) in abiotic stress tolerance, especially dehydration and cold stress (Tunnacliffe and Wise 2007; Thomashow 1999). The LEA protein can function as an antioxidant and a membrane stabilizer during water stress. In the present study, under cold condition, the LEA gene was generally up-regulated in control plants but not in ACC-treated plants, suggesting that exogenous ethylene might inhibit transcription of LEA and decrease accumulation of the LEA protein. It was controversial whether ethylene negatively or positively impacts cold tolerance in plants. Findings of the present study indicate that ethylene is negatively involved in plant response to cold stress. It has been reported that CBF genes play a vital role in cold acclimation (Thomashow 1999; see also Yamaguchi-Shinozaki and Shinozaki 2006; Chinnusamy et al. 2007). As expected, the findings of the present study show that CBF1 expression increased in response to cold treatment in control plants, similar to the study of Shi et al. (2014). In the present study, expression of CBF1 in ACC-treated plants was lower than in control plants, suggesting that exogenous ethylene suppresses CBF1 gene expression, thus presumably inhibiting COR genes transcription and negatively impacting cold tolerance of Bermuda grass. Ethylene is perceived by a family of receptors. The membrane protein ETHYLENE INSENSITIVE2 (EIN2) acts between the ethylene acceptor CTR1 and the EIN3/ EIL family of transcription factors (Alonso et al. 1999). EIN3/EIL1 specifically bind to the promoters of ethyleneresponse target genes to activate or repress their expression, in turn regulating ethylene-related responses in plants (Alonso et al. 2003; Zhong et al. 2009; Boutrot et al. 2010; Zhang et al. 2011a). CTR1 is a Ser/Thr kinase downstream receptor and also a negative regulator of ethylene signaling pathway (Kieber et al. 1993). Downstream of the CTR1 is EIN2, which further regulates the positive regulator EIN3 (Chao et al. 1997; Solano et al. 1998). In the present study, both EIN3-1 and EIN3-2 in control plants were downregulated in response to cold stress, with greater expression levels for ACC-treated plants, indicating that exogenous ethylene alters ethylene signaling in Bermuda grass under cold condition. It has been reported that the expression of the CBF gene was negatively correlated with the transcription level of the EIN3 protein in inducible EIN3-FLAG transgenic plants (Shi et al. 2012), which is consistent with the findings of the present paper. In the present study, the expression of EIN3-1 in ACC-treated plants rapidly increased and reached a peak at 2 h after cold treatment, followed by a substantial decrease in CBF1 expression in ACC-treated plants, again suggesting that an ethylene signaling-mediated cold response of Bermuda grass occurred at least
123
Photosynth Res
partially through the transcriptional repression of CBF1 genes by EIN3. In summary, the role of ethylene in cold tolerance is complex. A negative impact of ethylene on cold tolerance in Bermuda grass has been emphasized in the present study. Exogenous ethylene decreased cold tolerance of Bermuda grass by decreasing the stability of cell membranes, altering antioxidant activities, inhibiting photosynthetic activity, suppressing antioxidant enzyme genes, LEA, and CBF1 gene expressions, as well as altering the transcriptions of ethylene signaling genes. Acknowledgments This work was funded by the National Science Foundation of China (NSFC) (Grant Nos. 31272194 and 31401915), China-Africa Center for Research and Education (Grant No. SAJC201325), the Hubei Province National Science Foundation Sciences (Grant No. ZRY1326), and the outstanding young talent program of CAS Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture (Grant No. Y452341X01). We would like to thank Qian Liu for collecting the documents.
References Allakhverdiev SI, Kreslavski VD, Klimov VV, Los DA, Carpentier R, Mohanty P (2008) Heat stress: an overview of molecular responses in photosynthesis. Photosynth Res 98(1–3):541–550 Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR (1999) EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Science 284:2148–2152 Alonso JM, Stepanova AN, Solano R, Wisman E, Ferrari S, Ausubel FM, Ecker JR (2003) Five components of the ethylene-response pathway identified in a screen for weak ethyleneinsensitive mutants in Arabidopsis. Proc Natl Acad Sci USA 100: 2992–2997 Alscher RG, Erturk N, Heath LS (2002) Role of superoxide dismutases (SODs) in controlling oxidative stress inplants. J Exp Bot 53:1331–1341 Apel K, Hirt H (2004) Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu Rev Plant Biol 55:373–399 Artus NN, Uemura M, Steponkus PL, Gilmour SJ, Lin C, Thomashow MF (1996) Constitutive expression of the cold-regulated Arabidopsis thaliana COR15a gene affects both chloroplast and protoplast freezing tolerance. Proc Natl Acad Sci 93(23): 13404–13409 Baker NR, Rosenqvist E (2004) Applications of chlorophyll fluorescence can improve crop production strategies: an examination of future possibilities. J Exp Bot 55(403):1607–1621 Bleecker AB, Kende H (2000) Ethylene: a gaseous signal molecule in plants. Annu Rev Cell Dev Biol 16(1):1–18 Boutrot F, Segonzac C, Chang KN, Qiao H, Ecker JR, Zipfel C, Rathjen JP (2010) Direct transcriptional control of the Arabidopsis immune receptor FLS2 by the ethylene-dependent transcription factors EIN3 and EIL1. Proc Natl Acad Sci USA 107:14502–14507 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72(1):248–254 Catala R, Lopez-Cobollo R, Mar Castellano M, Angosto T, Alonso JM, Ecker JR, Salinas J (2014) The Arabidopsis 14-3-3 protein RARE COLD INDUCIBLE 1A links low-temperature response
123
and ethylene biosynthesis to regulate freezing tolerance and cold acclimation. Plant Cell 26(8):3326–3342. doi:10.1105/tpc.114. 127605 Chang C, Kwok SF, Bleecker AB, Meyerowitz EM (1993) Arabidopsis ethylene-response gene ETR1: similarity of product to two-component regulators. Science 262:539–544 Chao Q, Rothenberg M, Solano R, Roman G, Terzaghi W (1997) Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related proteins. Cell 89(7):1133–1144 Chen H, Xue L, Chintamanani S, Germain H, Lin H, Cui H, Cai R, Zuo J, Tang X, Li X (2009) ETHYLENE INSENSITIVE3 and ETHYLENE INSENSITIVE3-LIKE1 repress SALICYLIC ACID INDUCTION DEFICIENT2 expression to negatively regulate plant innate immunity in Arabidopsis. Plant Cell Online 21(8):2527–2540 Chen L, Ren F, Zhong H, Jiang W, Li X (2010) Identification and expression analysis of genes in response to high-salinity and drought stresses in Brassica napus. Acta Biochim Biophys Sin 42(2):154–164 Chen K, Chen L, Fan J, Fu J (2013) Alleviation of heat damage to photosystem II by nitric oxide in tall fescue. Photosynth Res 116(1):21–31. doi:10.1007/s11120-013-9883-5 Chen K, Sun X, Amombo E, Zhu Q, Zhao Z, Chen L, Xu Q, Fu J (2014) High correlation between thermotolerance and photosystem II activity in tall fescue. Photosynth Res 122(3):305–314. doi:10.1007/s11120-014-0035-3 Chinnusamy V, Zhu J, Zhu JK (2007) Cold stress regulation of gene expression in plants. Trends Plant Sci 12:444–451 Ciardi JA, Deikman J, Orzolek MD (1997) Increased ethylene synthesis enhances cold tolerance in tomato. Physiol Plant 101(2):333–340 Ederli L, Morettini R, Borgogni A, Wasternack C, Miersch O, Reale L, Ferranti F, Tosti N, Pasqualini S (2006) Interaction between nitric oxide and ethylene in the induction of alternative oxidase in ozone-treated tobacco plants. Plant Physiol 142(2):595–608 Ehlert B, Hincha DK (2008) Chlorophyll fluorescence imaging accurately quantifies freezing damage and cold acclimation responses in Arabidopsis leaves. Plant Methods 4(1):1–7 Fan J, Ren J, Zhu W, Amombo E, Fu J, Chen L (2014) Antioxidant responses and gene expression in s under cold stress. J Am Soc Hortic Sci 139(6):699–705 Foyer CH, Lopez-Delgado H, Dat JF, Scott IM (1997) Hydrogen peroxide-and glutathione-associated mechanisms of acclimatory stress tolerance and signalling. Physiol Plant 100(2):241–254 Gao Z, Chen Y, Randlett MD, Zhao XC, Findell JL, Kieber JJ, Schaller GE (2003) Localization of the Raf-like kinase CTR1 to the endoplasmic reticulum of Arabidopsis through participation in ethylene receptor signaling complexes. J Biol Chem 278: 34725–34732 Gilmour S, Zarka D, Stockinger E, Salazar M, Houghton J, Thomashow M (1998) Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional activators as an early step in cold-induced COR gene expression. Plant J 16:433–442 Gilmour SJ, Sebolt AM, Salazar MP, Everard JD, Thomashow MF (2000) Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiol 124:1854–1865 Greer D, Berry J, Bjo¨rkman O (1986) Photoinhibition of photosynthesis in intact bean leaves: role of light and temperature, and requirement for chloroplast-protein synthesis during recovery. Planta 168(2):253–260 Guy CL (1990) Cold accelimation and freezing stress tolerance: role of protein metabolism. Annu Rev Plant Biol 41(1): 187–223
Photosynth Res Hodgson RA, Raison JK (1989) Inhibition of photosynthesis by cold in moderate light: a comparison of plants sensitive and insensitive to cold. Planta 178(4):545–552 Hu L, Li H, Pang H, Fu J (2012) Responses of antioxidant gene, protein and enzymes to salinity stress in two genotypes of perennial ryegrass (Lolium perenne) differing in salt tolerance. J Plant Physiol 169:146–156 Hu Y, Jiang L, Wang F, Yu D (2013) Jasmonate Regulates the INDUCER OF CBF expression–c-repeat binding factor/dre binding factor1 cascade and freezing tolerance in Arabidopsis. Plant Cell Online 25(8):2907–2924 Hua J, Meyerowitz EM (1998) Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana. Cell 94:261–271 Hua J, Chang C, Sun Q, Meyerowitz EM (1995) Ethylene insensitivity conferred by Arabidopsis ERS gene. Science 269:1712–1714 ¨ quist G, Sarhan F (1998) Energy balance and acclimation Huner N, O to light and cold. Trends Plant Sci 3(6):224–230 Jaglo-Ottosen KR, Gilmour SJ, Zarka DG, Schabenberger O, Thomashow MF (1998) Arabidopsis CBF1 overexpression inducesCORgenes and enhances freezing tolerance. Science 280: 104–106 Jeon J, Kim NY, Kim S, Kang NY, Nova´k O, Ku S-J, Cho C, Lee DJ, Lee E-J, Strnad M (2010) A subset of cytokinin two-component signaling system plays a role in cold temperature stress response in Arabidopsis. J Biol Chem 285(30):23371–23386 Jeong SW, Choi SM, Lee DS, Ahn SN, Hur Y, Chow WS, Park Y-I (2002) Differential susceptibility of photosynthesis to light-cold stress in rice (Oryza sativa l.) depends on the capacity for photochemical dissipation of light. Mol Cells 13(3):419–428 Hiscox JT, Israelstam G (1979) A method for the extraction of chlorophyll from leaf tissue without maceration. Can J Bot 57(12):1332–1334 Kende H (1993) Ethylene biosynthesis. Annu Rev Plant Physiol Plant Mol Biol 44:283–307 Kieber JJ, Rothenberg M, Roman G, Feldmann KA, Ecker JR (1993) CTR1, a negative regulator of the ethylene response pathway in arabidopsis, encodes a member of the Raf family of protein kinases. Cell 72(3):427–441 Knight MR, Knight H (2012) Low-temperature perception leading to gene expression and cold tolerance in higher plants. New Phytol 195(4):737–751 Krause GH (1994) Photoinhibition induced by low temperatures. In: Baker NR, Bowyer JR (eds) Photoinhibition of Photosynthesis. Bios Scientific Publishers, Oxford, pp 331–342 Li Y-S, Mao X-T, Tian Q-Y, Li L-H, Zhang W-H (2009) Phosphorus deficiency-induced reduction in root hydraulic conductivity in \i[ Medicago falcata \/i[ is associated with ethylene production. Environ Exp Bot 67(1):172–177 Lin Z, Zhong S, Grierson D (2009) Recent advances in ethylene research. J Exp Bot 60(12):3311–3336 Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, YamaguchiShinozaki K, Shinozaki K (1998) Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and lowtemperatureresponsive gene expression, respectively, in Arabidopsis. Plant Cell 10:1391–1406 Lyons JM (1973) Chilling injury in plants. Annual Rev Plant Physiol 24:445–466 Miller G, Suzuki N, Ciftci-Yilmaz S, Mittler R (2010) Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ 33(4):453–467 Mishra A, Mishra KB, Ho¨ermiller II, Heyer AG, Nedbal L (2011) Chlorophyll fluorescence emission as a reporter on cold tolerance in Arabidopsis thaliana accessions. Plant Signal Behav 6(2):301
Mittler R, Vanderauwera S, Gollery M, Van Breusegem F (2004) Reactive oxygen gene network of plants. Trends Plant Sci 9(10):490–498 Mittler R, Vanderauwera S, Suzuki N, Miller G, Tognetti VB, Vandepoele K, Gollery M, Shulaev V, Van Breusegem F (2011) ROS signaling: the new wave? Trends Plant Sci 16(6):300–309 Osmond C (1981) Photorespiration and photoinhibition: some implications for the energetics of photosynthesis. Biochim Biophys Acta (BBA) Rev Bioenerg 639(2):77–98 Osmond C (1994) What is photoinhibition? Some insights from comparisons of shade and sun plants. In: Baker NR, Bowyer JR (eds) Photoinhibition of photosynthesis from molecular mechanisms to the field. Bio Scientific, Oxford, pp 1–24 Peguero-Pina JJ, Morales F, Gil-Pelegrı´n E (2008) Frost damage in Pinus sylvestris L. stems assessed by chlorophyll fluorescence in cortical bark chlorenchyma. Ann For Sci 65(8):1 Pospı´sˇil P (2012) Molecular mechanisms of production and scavenging of reactive oxygen species by photosystem II. Biochim Biophys Acta Bioenerg 1817(1):218–231 Prasad TK (1996) Mechanisms of cold-induced oxidative stress injury and tolerance in developing maize seedlings: changes in antioxidant system, oxidation of proteins and lipids, and protease activities. Plant J 10(6):1017–1026 Rizza F, Pagani D, Stanca A, Cattivelli L (2001) Use of chlorophyll fluorescence to evaluate the cold acclimation and freezing tolerance of winter and spring oats. Plant Breed 120(5):389–396 Sakai H, Hua J, Chen QG, Chang C, Medrano LJ, Bleecker AB, Meyerowitz EM (1998) ETR2 is an ETR1-like gene involved in ethylene signaling in Arabidopsis. Proc Natl Acad Sci USA 95(10):5812–5817 Shi Y, Tian S, Hou L, Huang X, Zhang X, Guo H, Yang S (2012) Ethylene signaling negatively regulates freezing tolerance by repressing expression of CBF and type-A ARR genes in Arabidopsis. Plant Cell 24(6):2578–2595. doi:10.1105/tpc.112. 098640 Shi H, Jiang C, Ye T, Tan D, Reiter RJ, Zhang H, Liu R, Chan Z (2014a) Comparative physiological, metabolomic, and transcriptomic analyses reveal mechanisms of improved abiotic stress resistance in bermudagrass [Cynodon dactylon (L). Pers.] by exogenous melatonin. J Exp Bot. doi:10.1093/jxb/eru373 Shi H, Ye T, Zhong B, Liu X, Chan Z (2014b) Comparative proteomic and metabolomic analyses reveal mechanisms of improved cold stress tolerance in bermudagrass (Cynodon dactylon (L.) Pers.) by exogenous calcium. J Integr Plant Biol 56(11):1064–1079. doi:10.1111/jipb.12167 Shi H, Ye T, Zhong B, Liu X, Jin R, Chan Z (2014c) AtHAP5A modulates freezing stress resistance in Arabidopsis through binding to CCAAT motif of AtXTH21. New Phytol 203: 554–567 Smillie RM, Hetherington SE (1984) A screening method for cold tolerance using chlorophyll fluorescence in vivo. In: Sybesma C (ed) Advances in photosynthesis research. Springer, Berlin, pp 471–474 Solano R, Stepanova A, Chao Q, Ecker JR (1998) Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSEFACTOR1. Genes Dev 12(23):3703–3714 Stockinger E, Gilmour S, Thomashow M (1997) Arabidopsis thaliana CBF1encodes an AP2 domain-containing transcriptional activator that binds to the C-repeat/DRE, a cis-acting DNA regulatory element that stimulates transcription in response to low temperature and water deficit. Proc Natl Acad Sci USA 94:1035–1040 Thomashow M (1999) Plant cold acclimation: freezing tolerance genes and regulatory mechanisms. Annu Rev Plant Biol 50(1):571–599 To´th SZ, Schansker G, Garab G, Strasser RJ (2007a) Photosynthetic electron transport activity in heat-treated barley leaves: the role
123
Photosynth Res of internal alternative electron donors to photosystem II. Biochim Biophys Acta (BBA) Bioenerg 1767(4):295–305 To´th SZ, Schansker G, Strasser RJ (2007b) A non-invasive assay of the plastoquinone pool redox state based on the OJIP-transient. Photosynth Res 93(1–3):193–203 Tsimilli-Michael M, Strasser RJ (2008) Experimental resolution and theoretical complexity determine the amount of information extractable from the chlorophyll fluorescence transient OJIP. In: Allen J, Gantt E, Golbeck JH, Osmond B (eds) Photosynthesis. Energy from the sun. Springer, Berlin, pp 697–701 Tunnacliffe A, Wise MJ (2007) The continuing conundrum of the LEA proteins. Naturwissenschaften 94(10):791–812 Wang Y, Liu C, Li K, Sun F, Hu H, Li X, Zhao Y, Han C, Zhang W, Duan Y (2007) Arabidopsis EIN2 modulates stress response through abscisic acid response pathway. Plant Mol Biol 64(6): 633–644 Wang H, Huang J, Liang X, Bi Y (2012) Involvement of hydrogen peroxide, calcium, and ethylene in the induction of the alternative pathway in cold-stressed Arabidopsis callus. Planta 235(1):53–67 Yamaguchi-Shinozaki K, Shinozaki K (2006) Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu Rev Plant Biol 57:781–803 Yang S, Hoffman N (1984) Ethylene biosynthesis and its regulation in higher plants. Annu Rev Plant Physiol 35:155–189 Yang P, Li X, Liang Y, Jing Y, Shen S, Kuang T (2006) Proteomic analysis of the response of Liangyoupeijiu (super high-yield hybrid rice) seedlings to cold stress. J Integr Plant Biol 48: 945–951 Yu X-M, Griffith M, Wiseman SB (2001) Ethylene induces antifreeze activity in winter rye leaves. Plant Physiol 126(3):1232–1240 Yusuf MA, Kumar D, Rajwanshi R, Strasser RJ, Tsimilli-Michael M, Govindjee Sarin NB (2010) Overexpression of gamma-
123
tocopherol methyl transferase gene in transgenic Brassica juncea plants alleviates abiotic stress: physiological and chlorophyll a fluorescence measurements. Biochim Biophys Acta 1797(8):1428–1438. doi:10.1016/j.bbabio.2010.02.002 Zhang Z, Huang R (2010) Enhanced tolerance to freezing in tobacco and tomato overexpressing transcription factor TERF2/LeERF2 is modulated by ethylene biosynthesis. Plant Mol Biol 73(3): 241–249 Zhang X, Ervin E, LaBranche A (2006) Metabolic defense responses of seeded bermudagrass during acclimation to freezing stress. Crop Sci 46(6):2598–2605 Zhang X, Ervin E, Waltz C, Murphy T (2011a) Metabolic changes during cold acclimation and deacclimation in five bermudagrass varieties: II. cytokinin and abscisic acid metabolism. Crop Sci 51(2):847–853 Zhang X, Wang K, Ervin E, Waltz C, Murphy T (2011b) Metabolic changes during cold acclimation and deacclimation in five bermudagrass varieties. I. Proline, total amino acid, protein, and dehydrin expression. Crop Sci 51(2):838–846 Zhao M, Liu W, Xia X, Wang T, Zhang WH (2014) Cold acclimation-induced freezing tolerance of Medicago truncatula seedlings is negatively regulated by ethylene. Physiol Plant 152(1):115–129. doi:10.1111/ppl.12161 Zhong S, Zhao M, Shi T, Shi H, An F, Zhao Q, Guo H (2009) EIN3/ EIL1 cooperate with PIF1 to prevent photo-oxidation and to promote greening of Arabidopsis seedlings. Proc Natl Acad Sci USA 106:21431–21436 Zhu J, Shi H, B-h Lee, Damsz B, Cheng S, Stirm V, Zhu J-K, Hasegawa PM, Bressan RA (2004) An Arabidopsis homeodomain transcription factor gene, HOS9, mediates cold tolerance through a CBF-independent pathway. Proc Natl Acad Sci USA 101(26):9873–9878
