Effects of fluorescent dyes, quenchers, and dangling

BBRC Biochemical and Biophysical Research Communications 327 (2005) 473–484 www.elsevier.com/locate/ybbrc

Effects of fluorescent dyes, quenchers, and dangling ends on DNA duplex stabilityq Bernardo G. Moreira, Yong You, Mark A. Behlke, Richard Owczarzy* Integrated DNA Technologies, 1710 Commercial Park, Coralville, IA 52241, USA Received 2 December 2004 Available online 15 December 2004

Abstract Single and dual-labeled fluorescent oligodeoxynucleotides are used in many molecular biology applications. We investigated the effects of commonly used fluorescent dyes and quenchers on the thermodynamic stability of a model probe–target DNA duplex. We demonstrate that those effects can be significant. Fluorescent dyes and quenchers were attached to the probe ends. In certain combinations, these groups stabilized the duplex up to 1.8 kcal/mol and increased Tm up to 4.3 °C. None of the groups tested significantly destabilized the duplex. Rank order of potency was, starting with the most stabilizing group: Iowa Black RQ Black Hole 2 > Cy5 Cy3 > Black Hole 1 > QSY7 Iowa Black FQ > Texas Red TAMRA > FAM HEX Dabcyl > TET. Longer linkers decreased stabilizing effects. Hybridizations to targets with various dangling ends were also studied and were found to have only minor effects on thermodynamic stability. Depending on the dye/quencher combination employed, it can be important to include thermodynamic contributions from fluorophore and quencher when designing oligonucleotide probe assays. Ó 2004 Elsevier Inc. All rights reserved. Keywords: DNA melting temperature; Fluorescent probes; DNA thermodynamics; Quencher; Dangling ends; Real-time PCR

Over the last decade, sensitive and rapid molecular biology applications have been developed that use oligodeoxynucleotide (ODN) probes labeled with covalently attached fluorescent dyes and quenchers [1–3]. When these probes anneal to complementary nucleic acid sequences, the resulting probe–target duplexes usually lead to a detectable change in fluorescent signal. Stability of the probe–target duplex determines the specificity of the detection event. Melting temperatures, Tm and melting profiles of those duplexes are usually preq FAM, HEX, TAMRA, and TET are trademarks of Applied Biosystems. Cy3 and Cy5 are trademarks of Amersham Biosciences. Texas Red-X NHS and QSY7 are trademarks of Molecular Probes. Black Hole Quencher, BHQ1 and BHQ2 are trademarks of Biosearch Technologies. Iowa Black RQ and Iowa Black FQ are trademarks of Integrated DNA Technologies. * Corresponding author. Fax: +1 319 626 9683. E-mail address: [email protected] (R. Owczarzy). URLs: http://www.idtdna.com, http://www.owczarzy.net.

0006-291X/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.12.035

dicted using a nearest-neighbor (NN) algorithm when probe assays are designed. Having an accurate estimate of probe Tm is crucial to good design, especially if differential hybridization is employed to distinguish between alleles or in genotyping. For example, a difference of at least 5 °C between melting temperatures of match and mismatched probe–target duplexes is needed for accurate multiplex genotyping using real-time PCR [3,4]. Current sophisticated approaches to probe and primer design employ the nearest-neighbor model and use the unified thermodynamic parameter set [5], which is the most accurate method available to predict melting temperatures of DNA duplex oligomers [6]. The nearest-neighbor calculation results in a Tm estimate for conditions of 1 M NaCl, which must be adjusted to the actual salt concentrations employed in an assay. Improved methods have recently been reported to scale Tm from the reference value at 1 M NaCl to lower salt

474

B.G. Moreira et al. / Biochemical and Biophysical Research Communications 327 (2005) 473–484

concentrations [7]. The effects of magnesium ions on Tm are equally important and must also be taken into account. The relationship between divalent cation concentration and Tm is less well characterized than for monovalent cations, but equations exist that can be used to scale Tm estimates using NN model [8]. Methods to adjust Tm for the presence of fluorescent dyes or quencher groups on probes have not been developed. Because an accurate predictive algorithm or nearestneighbor thermodynamic parameters have not been determined for energetics of fluorescent dyes and quenchers, their effects are neglected [9,10] and it is assumed that melting profiles of the unmodified duplex and the dye-modified duplex are similar. This assumption may not be valid. Studies of G-quadruplex [11] and i-motif DNA structures [12] showed that fluorophores covalently attached to DNA oligomers could significantly destabilize these structures (by 1–11 °C). Further, fluorescein destabilized G-quadruplex to a greater degree than tetramethylrhodamine, indicating that the thermodynamic effects can be dye-specific. Some studies reported that moderate duplex destabilization results when fluorescent dye groups are incorporated at internal positions within the hybridizing sequence [13,14]. It is more important, however, to consider the thermodynamic effects that dyes or quenchers may have when placed at the ends of oligonucleotides as this configuration is most commonly used for DNA probes. Studies of molecular beacons and complementary linear probes have shown that fluorescent dyes and quenchers can interact and increase duplex stability if the groups are in close proximity. Specifically, the study of Morrison and Stols [15] detected both fluorophore– fluorophore and fluorophore–DNA interactions, which significantly altered duplex stability. In this case, one strand was labeled with 5 0 -terminal fluorescein and the complement was labeled with 3 0 -terminal rhodamine, resulting in a duplex where dye and quencher were directly adjacent on opposite strands and in potential physical contact. Extending this work, Marras et al. [16] investigated the effects on duplex stability caused by a wide variety of fluorophores and quenchers conjugated as 5 0 - and 3 0 -terminal modifications on complementary 20 bp long ODNs. They observed that, in the configuration tested where fluorophores and quenchers can directly interact, the presence of dye/quencher groups increased Tm by 2–10 °C. The magnitude of this stabilizing effect was different for each dye/quencher pair tested. These results suggest that, when adjacent, dye/quencher groups have the potential to form complexes that can confer significant additional stability to the DNA duplex. For singly labeled ODNs, fluorophores and quenchers can directly interact in this way only when positioned at opposite ends of hybridized complementary sequences. For dual-labeled ODNs, a

5 0 -modification can directly interact with a 3 0 -modification in a unimolecular reaction if the sequence forms a hairpin or stem structure, as in molecular beacons. The thermodynamic contribution of dye/quencher interaction can confer significant stability to the stem of a molecular beacon [17]. The relative magnitude of the contribution of dye/quencher interactions in stabilizing molecular beacons is more pronounced with shorter stems; ideally, thermodynamic contributions of the dye and quencher interaction should be taken into account when designing hairpin probes. However, these studies do not address the potential for dye groups to interact with DNA during bimolecular duplex formation. In summary, the limited set of melting data available suggests that effects of fluorophores on DNA duplex stability vary with the base sequence, length of the duplex, and nature of the dye or quencher. While fluorescent properties of these DNAs have been studied in detail [10,16–18]; the effects on the duplex thermodynamics are largely unknown. It would therefore be useful to investigate which dyes and quenchers change the thermodynamic stability of DNA duplex formation. We conducted a series of UV melting experiments using oligonucleotides having the same base sequence which were terminally labeled with the following fluorescent dyes or quenchers: 6-carboxyfluorescein (FAM), hexachlorofluorescein (HEX), Cy3, Cy5, tetrachlorofluorescein (TET), carboxytetramethylrhodamine (TAMRA), Texas Red-X, Dabcyl-dC, Black Hole Quencher 1 (BHQ1), Black Hole Quencher 2 (BHQ2), QSY7, Iowa Black RQ (IBRQ, version 3.1). and Iowa Black FQ (IBFQ, version 1.0). To examine the effects of linkers, FAM and Cy3 dyes were attached to the oligomer using chemical moieties of various lengths and hydrophobicity. Specifically, amino C3 linker (L3), amino C6 linker (L6), hydroxy C3 spacer (C3), and triethylene glycol spacer (S9) were used (see supplementary material for chemical structures). Dual-labeled probes were also studied where a fluorescent dye was attached to 5 0 -end of the oligomer and a quencher was covalently bound to 3 0 -end. A 20 base long oligonucleotide probe was selected for testing, using as a model system the mouse p48 gene with an established real-time RT-PCR assay of known performance and characteristics [19]. In real-time PCR applications, fluorescence is typically measured at 60 °C. Therefore, free energies of probe–target hybridization are reported at this temperature. Most methods of nucleic acid detection employ fluorescent probes that are shorter than their DNA targets. For any two hybridized sequences of different lengths, stacking interactions between the base pairs at the ends of the shorter strand and unpaired bases (dangling ends) of the longer strand can affect stability of the duplex [20– 25]. Thermodynamic parameters for sequences with dangling ends were reported for both DNA [24] and


RNA [25]. It was found that, for select sequences, dangling ends could contribute to duplex stability as much as an additional Watson–Crick base pair. Attachment of fluorescent dyes or quenchers to ends of DNA probes can further alter the dangling end interactions. We therefore investigated the stabilizing or destabilizing effects that terminal dye groups may contribute in the context of dangling ends.

475

Materials and methods

Fig. 1. The 20 bp DNA probe–target duplexes were previously used to detect the mouse PTF1 p48 gene. The unmodified DNA probe is called ‘‘ODN.’’ Various fluorescent dyes (F) and quenchers (Q) are covalently attached at the probe ends. Modified probes are designated F-ODN-Q to indicate relative position and type of the label from 5 0 - to 3 0 -end. The terms ‘‘label’’ and ‘‘modification’’ apply to both fluorophores and quenchers.

Oligomers. An 80 bp target DNA oligomer (MP48 target, 5 0 CCTGCAAGAGGAGGGAGACCATAATCCGGGTCACTGGGG GAGGGTGAACGGGTGCCTCGATGGCAGATGATAACCTTC TG-3 0 ) was derived from the sequence of the mouse (Mus musculus) p48 gene (GenBank Accession No. AF298116) and is complementary to the gene cDNA. To examine the effects of dangling ends, we compared hybridizations of probe ODN 5 0 -ACCCGTTCACCCTCCCC CAG-3 0 to various shorter target sequences that resulted in blunt ends as well as overhangs of different lengths (Table 1). Modifications of the DNA probe (F-ODN-Q) containing various fluorescent dyes (F) and quenchers (Q) covalently attached at 5 0 and/or 3 0 -ends were prepared (Fig. 1). All oligomers were synthesized using phosphoramidite chemistry at Integrated DNA Technologies (Coralville, IA) and purified using 8 M urea denaturing polyacrylamide gel electrophoresis or using a Transgenomic Wave HPLC system. Ion pairing HPLC was performed using the Transgenomic OligoPrep HC column and a linear 0–50% acetonitrile elution gradient in 0.1 M triethylammonium acetate, pH 7. Ion-exchange HPLC was carried out using a Source 15Q column (Amersham Biosciences, Piscataway, NJ) and a linear elution gradient of 0–0.5 M LiCl in 0.1 M Tris–HCl buffer, pH 8.5. Oligomer quality was assessed by mass spectrometry and capillary electrophoresis as described [7]. Matrix-assisted laser desorption ionization timeof-flight mass spectrometry (MALDI-TOF) was carried out on Voyager DE Biospectrometry workstation for short ( Cy5 Cy3 > Black Hole 1 > QSY7 Iowa Black FQ > Texas Red TAMRA > FAM HEX Dabcyl-dC > TET. Thermodynamic effects of linker length

Fig. 5. Changes of probe–target duplex stabilities, DDG060 C , for probes with fluorophores attached at 5 0 terminus (A), quenchers attached at 3 0 terminus (B), and dual-labeled probes (C). Each probe was hybridized to three targets containing different numbers of dangling bases. See Table 1 for target description, T (black circle), T1D1 (open triangle), and MP48 (open square). Dashed lines denote the range of DDG060 C change (±0.4 kcal/mol), which is within the error of measurements.

If the target nucleic acid is longer than the probe, unpaired bases of the targets will be present at the ends of duplexes. Since fluorophores or quenchers attached at

Fluorescent dyes and quenchers could be conjugated to DNA with linkers of various lengths. The linkers may modify dye–DNA interactions and may also interact with DNA. To study thermodynamic effects of linkers, we synthesized probes with amino linkers containing three (L3) or six (L6) methylene groups. Results of their UV melting experiments are presented in Table 3. The number of atoms connecting the terminal amino group of a linker and the phosphate group of a DNA strand is shown in the second column of the table. Changes of melting temperatures are compared in Fig. 6. The L3 linker does not alter duplex stability. The longer L6 linker, which is used to attach majority of the studied

480


Table 2 Thermodynamic parameters for probe–target duplex DNAs DDH 0vh b (kcal/mol)

DDS 0vh b (cal/(mol K))

DDG060 C b (kcal/mol)

Probe ID

Tma (°C)

DTmb (°C)

ODN

70.4

—

185

—

511

—

15.3

—

5 labeled probes Phosphate-ODN TET-ODN FAM-ODN HEX-ODN Texas Red-ODN TAMRA-ODN Cy3-ODN Cy5-ODN

70.9 70.1 70.2 70.4 71.2 70.4 71.7 71.8

0.6 0.2 0.1 0.0 0.8 0.0 1.4 1.5

183 175 181 179 178 172 180 178

2 11 4 7 7 14 5 7

504 480 499 492 489 472 493 488

7 31 12 19 22 39 18 23

15.4 14.8 15.0 15.0 15.4 14.8 15.8 15.7

0.2 0.5 0.3 0.2 0.2 0.4 0.5 0.5

3 0 labeled probes ODN-phosphate ODN-TAMRA ODN-Dabcyl-dC ODN-IBFQ ODN-QSY7 ODN-BHQ1 ODN-BHQ2 ODN-IBRQ

70.2 70.0 70.5 70.9 71.1 71.7 72.2 71.7

0.2 0.3 0.2 0.6 0.8 1.4 1.9 1.3

180 160 187 171 171 189 196 180

5 26 2 14 14 4 10 6

496 437 516 469 468 519 538 492

15 74 5 42 43 9 27 19

15.0 14.3 15.4 15.0 15.1 16.0 16.6 15.7

0.3 1.0 0.1 0.2 0.1 0.8 1.3 0.4

Dual-labeled probes FAM-ODN-TAMRA FAM-ODN-Dabcyl-dC HEX-ODN-BHQ2 FAM-ODN-IBFQ Cy3-ODN-BHQ1 Cy3-ODN-QSY7 Cy5-ODN-IBRQ

70.2 70.7 71.9 71.2 71.8 72.3 72.7

0.2 0.3 1.6 0.8 1.4 1.9 2.3

177 187 201 171 180 179 181

9 2 16 15 6 7 4

487 516 554 467 492 489 495

24 5 43 44 19 22 16

14.9 15.5 16.5 15.2 15.7 15.9 16.3

0.4 0.2 1.3 0.1 0.5 0.7 1.0

DH 0vh (kcal/mol)

DS 0vh (cal/(mol K))

DG060 C (kcal/mol)

0

The various probes were hybridized to the 20 bp target T. a Experiments were carried out in a cacodylate buffer (10 mM sodium cacodylate, 50 mM KCl, and 3 mM MgCl2, pH 7.2), which mimics the typical real-time PCR buffer. Total single-strand concentration, Ct, was 1.9 ± 0.2 lM. b Changes due to the covalently attached label. The changes were calculated using non-rounded values of the thermodynamic parameters.

Table 3 Thermodynamic effects of various linkers, which were used to attach Cy3 or FAM dyes Probe ID

Linker lengtha

Tm (°C)

DTmb (°C)

DH 0vh (kcal/mol)

DDH 0vh b (kcal/mol)

DS 0vh (cal/(mol K))

DDS 0vh b (cal/(mol K))

DG060 C (kcal/mol)

DDG060 C b (kcal/mol)

ODN L3-ODN L6-ODN FAM-L3-ODN FAM-ODN Cy3-ODN Cy3-C3-ODN Cy3-S9-ODN

0 3 6 3 6 3 9 14

70.4 70.2 69.4 69.6 70.2 71.7 71.1 70.7

— 0.2 1.0 0.7 0.1 1.4 0.7 0.4

185 183 157 165 181 180 183 172

— 3 28 20 4 5 2 13

511 503 430 453 499 493 503 472

— 7 81 58 12 18 8 39

15.3 15.0 13.9 14.2 15.0 15.8 15.5 15.0

— 0.3 1.4 1.0 0.3 0.5 0.3 0.3

The probes were hybridized to the target T. a Number of connecting atoms between the amino group of a dye and the phosphate group at 5 0 -end of DNA backbone. b Changes due to the covalently attached label. The changes were calculated using non-rounded values of the thermodynamic parameters. See Table 2 for experimental details.

dyes, destabilizes probe–target duplex (average DTm = 0.9 °C, DDG = + 1.1 kcal/mol). Examination of energetics from Table 3 shows that this destabilization is a result of less favorable enthalpic change when the probe anneals to its complement ðDDH 0vh ¼ þ28 kcal=molÞ.

Further, a set of probes was examined where FAM and Cy3 dyes were attached with linkers of length that varied from 3 to 14 connecting atoms. Fig. 6 shows that the FAM dye did not change duplex stability regardless of linker length. On the other hand, the magnitude of duplex stabilization seen with Cy3 dye varied with linker


481

Fig. 6. Effects of linkers on duplex melting temperatures. Each probe was hybridized to three targets. See Table 1 for targets description, T (black circle), T1D1 (open triangle), and MP48 (open square). Dashed lines denote the range of Tm change (±0.6 °C), which is within the error of measurements. Chemical structures of the linkers are shown in the Supplementary Material.

length. As length of the linker increased, the stabilizing effect decreased. Nevertheless, a stabilizing effect of Cy3 was still detected even for the longest linker examined (Cy3-S9-ODN, DTm = +0.7 °C). Therefore, depending on the dye group employed, the precise linker used in dye attachment can influence the final thermodynamic contribution that the dye makes to probe–target duplex stability. Visible spectra of dyes and quenchers We investigated changes in spectral properties for dyes and quenchers that arise with hybridization of probes to targets. Spectra of single-stranded probes were compared with spectra of probe–target duplexes for thirteen dyes and quenchers. Typical spectral changes are shown in Fig. 7. DNA probes having only one modifying group were examined. None of these singly labeled probes exhibited any significant spectral changes when hybridized to complementary target T1D1, i.e., visible spectra of single-stranded probes and duplexes overlapped. Both wavelengths of peak maximum and extinction coefficients of dyes and quenchers did not change, within errors of the measurements ðkmax 2 nm; emax 5%Þ. The same results were observed for both stabilizing and destabilizing labels. We also investigated dual-labeled probes. In contrast, these probes showed significant changes in their visible spectra when hybridized to DNA targets. Specifically, spectra of FAM-ODN-TAMRA, FAM-ODN-IBFQ, Cy3-ODN-BHQ1, Cy3-ODN-QSY7, and Cy5-ODNIBRQ probes were altered. Fig. 7C shows an example of those changes. Absorbance peak maximum of the Cy3-ODN-BHQ1 probe at 549 nm is increased by 32%

Fig. 7. Visible spectrum of the probe (dotted line) and the probe– target duplex (solid line) for the Cy3-ODN probe linked with a Cy3 dye at 5 0 terminus (A), the ODN-BHQ1 probe with BHQ1 quencher attached at 3 0 -end (B), and the dual-labeled Cy3-ODN-BHQ1 probe (C). Target is 22 bp long T1D1 oligomer and each DNA strand has a concentration of 1 lM. Measurements were done at 25 °C.

upon hybridization to the complementary DNA. These spectral changes indicate an interaction between the fluorophores (FAM, Cy3, and Cy5) and the quenchers (BHQ1, TAMRA, QSY7, and IBRQ). In other words, the fluorophore and the quencher form an intramolecular complex that is disrupted by duplex formation. Johansson et al. [18] recently proposed the formation of dye heterodimers for dual-labeled probes and reported evidence of their existence for a Cy3.5-BHQ1 oligomer. We observed that intramolecular dye-quencher heterodimers are common for dual-labeled probes. Within the set of dual-labeled probes examined, only the FAM-ODN-Dabcyl-dC and HEX-ODN-BHQ2 probes did not show any appreciable spectral changes when hybridized to complementary targets.

482


Discussion Thermodynamic studies of synthetic oligomers with dangling ends have been conducted on both DNA and RNA duplexes ranging in length from 4 to 16 bp [20– 25]. Effects of single dangling residues were found to be sequence-specific [24]. Most of the dangling residues stabilize duplex DNAs up to 0.96 kcal/mol. This is comparable with the free energy contribution of a Watson–Crick A Æ T base pair. However, Riccelli et al. [34] examined the effects of dangling residues on longer duplexes, 16 bp stem DNA hairpins. He observed that dangling ends did not significantly enhance stability of these hairpins. Similarly, we find for a 20 bp DNA oligomer that dangling ends do not appreciably influence duplex stability. Further investigation is needed to define how the effects of dangling ends on duplex stability vary with duplex length. Ohmichi et al. [35] studied duplexes with dangling ends comprised of adenosines and observed significant stability difference between RNA and DNA. As the number of RNA dangling residues was increased, additional duplex stability enhancements were detected. In contrast, additional DNA dangling residues have little energetic effects. Maximal DNA duplex stabilization is usually achieved with a single base dangling end. Our experiments are consistent with these results; we do not observe any stability changes when dangling ends of DNA targets are extended to 2, 3, 27, and 33 residues. Thermodynamic parameters for DNA dangling ends were recently reported [24] that allow prediction of DNA duplex stability using the nearest-neighbor model and the unified nearest-neighbor parameter set. Unfortunately, the predicted melting temperatures are inaccurate (see Table 1). Further refinement of these parameters and/or better corrections for buffer salt content is needed. Improvements of Tm predictions for monovalent cations have recently been published [7]. We demonstrated that covalently attached fluorophores and quenchers can appreciably alter the melting temperatures of probe–target duplexes. Thermodynamic effects are results of dye–DNA and quenchers–DNA interactions. Linkers and additional phosphate groups, which are needed to connect the dye group to the DNA oligomer, do not themselves have significant thermodynamic effects but can influence the energetics of label-DNA interactions. The stability of any DNA duplex is a balance of stabilizing and destabilizing interactions. Stabilizing interactions include hydrogen bonding and base stacking, which consist of electrostatic and van der Waals interactions. Melting experiments have provided us with useful information on the stability of duplexes. However, little can be discerned about the physical structure and the mode of label-DNA interactions from thermodynamic experiments. All of the fluorescent dyes and quenchers tested contain aromatic

conjugated rings, which have similar structure to wellknown intercalators of nucleic acids. It is therefore reasonable to consider a possibility of dye intercalation between the adjacent bases. Intercalation has been described for certain cyanine class dyes [36]. The same kind of interactions may occur for Cy3 and Cy5, which have related structures; within the set of compounds tested, Cy3 and Cy5 were among the most stabilizing. However, an increase of Tm is by itself not evidence of intercalation. Significant stabilization of duplexes is also observed with other modes of DNA binding, such as that seen with minor groove binders [37]. Intercalation of dyes results in significant changes in their UV and visible spectra, typically exhibiting a red shift of 5–50 nm and substantial hypochromicity [38]. We have not detected this kind of spectral changes for any of the dyes and quenchers examined (for examples, see Figs. 7A and B). Our results are more consistent with the molecular binding to major/minor groove or exterior of the DNA duplex. Only dual-labeled probes showed any significant perturbation of visible spectra upon hybridization. However, we and others interpret these changes to indicate disruption of an intramolecular dye–quencher complex with duplex formation [16,18]. Intercalation events usually show a favorable negative enthalpy change, up to 8 kcal/mol for intercalation of singly charged cationic compound. Except for Black Hole quenchers, we observed unfavorable enthalpy changes (positive DDH 0vh ), which are overcome by favorably smaller entropic losses (positive DDS 0vh ). The thermodynamic properties we see with duplex formation for labeled probes are unlikely to result from label intercalation. We therefore conclude that the observed DNA duplex stabilization conferred by the dye/quencher groups most likely results from binding of the label to the exterior of the duplex and/or changes of ion and water binding caused by dyes and quenchers. Further studies of label–DNA interactions using NMR and linear electric dichroism techniques would be useful and would permit measurement of the dipole orientation of dyes and quenchers in relation to the DNA helical axis. If a dye is not aligned approximately perpendicular to the DNA axis, dye intercalation is unlikely. Figs. 4 and 5 show DTm and DDG060 C for each of the fluorophores and quenchers. These values are specific for the particular sequence studied and may change for sequences of different base composition and length. Enthalpic and entropic thermodynamic contributions of labels will have a greater impact on shorter duplexes. Thus, the effects of dyes and quenchers on duplex stability are expected to increase as duplex length decreases. We have not explored the base context dependence for each dye and quencher, which might also be significant. Since polarizability and charge distribution are different for G Æ C and A Æ T base pairs, interactions with labels may also be different.


We have characterized the contribution that a variety of commonly used fluorescent dyes and quenchers make on the stability of DNA probe hybridization, using a functional real-time PCR assay as the model system. We find that some of the labels significantly alter Tm and the contribution of these groups should be considered when fluorescent probes and assays are designed.

Acknowledgments We thank Brian Elliot for mass spectroscopy measurements and Jeff A. Manthey for software development.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/ j.bbrc.2004.12.035.

References [1] C.A. Heid, J. Stevens, K.J. Livak, P.M. Willimas, Real time quantitative PCR, PCR Methods Appl. 6 (1996) 986–994. [2] G. Bonnet, S. Tyagi, A. Libchaber, F.R. Kramer, Thermodynamic basis of the enhanced specificity of structured DNA probes, Proc. Natl. Acad. Sci. USA 96 (1999) 6171–6176. [3] C.T. Wittwer, M.G. Herrmann, C.N. Gundry, K.S.J. ElenitobaJohnson, Real-time multiplex PCR assays, Methods 25 (2001) 430–442. [4] N. von Ahsen, M. Oellerich, E. Schu¨tz, A method for homogeneous color-compensated genotyping of factor V (G1691A) and methylenetetrahydrofolate reductase (C677T) mutations using real-time multiplex fluorescence PCR, Clin. Biochem. 33 (2000) 535–539. [5] J. SantaLucia Jr., A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics, Proc. Natl. Acad. Sci. USA 95 (1998) 1460–1465. [6] R. Owczarzy, P.M. Vallone, F.J. Gallo, T.M. Paner, M.J. Lane, A.S. Benight, Predicting sequence-dependent melting stability of short duplex DNA oligomers, Biopolymers 44 (1997) 217–239. [7] R. Owczarzy, Y. You, B.G. Moreira, J.A. Manthey, L. Huang, M.A. Behlke, J.A. Walder, Effects of sodium ions on DNA duplex oligomers: improved predictions of melting temperatures, Biochemistry 43 (2004) 3537–3554. [8] N. Peyret, Prediction of nucleic acid hybridization: parameters and algorithms, PhD thesis, pp. 128, Wayne State University, Detroit, Michigan, 2000. [9] E. Schu¨tz, N. von Ahsen, M. Oellerich, Genotyping of eight thiopurine methyltransferase mutations: three-color multiplexing, ‘‘two-color/shared’’ anchor, and fluorescence-quenching hybridization probe assays based on thermodynamic nearest-neighbor probe design, Clin. Chem. 46 (2000) 1728–1737. [10] D. Proudnikov, V. Yuferov, Y. Zhou, K.S. LaForge, A. Ho, M.J. Kreek, Optimizing primer–probe design for fluorescent PCR, J. Neurosci. Methods 123 (2003) 31–45. [11] J.L. Mergny, J.C. Maurizot, Fluorescence resonance energy transfer as a probe for G-quartet formation by a telomeric repeat, Chembiochem 2 (2001) 124–132.

483

[12] J.L. Mergny, Fluorescence energy transfer as a probe for tetraplex formation: the i-motif, Biochemistry 38 (1999) 1573–1581. [13] G.-S. Jiao, K. Burgess, Oligonucleotides with strongly fluorescent groups p-conjugated to nucleobase: synthesis, melting temperatures, and conformation, Bioorg. Med. Chem. Lett. 13 (2003) 2785–2788. [14] J. Mineno, Y. Ishino, T. Ohminami, I. Kato, Fluorescent labeling of a DNA sequencing primer, DNA Seq. 4 (1993) 135–141. [15] L.E. Morrison, L.M. Stols, Sensitive fluorescence-based thermodynamic and kinetic measurements of DNA hybridization in solution, Biochemistry 32 (1993) 3095–3104. [16] S.A.E. Marras, F.R. Kramer, S. Tyagi, Efficiencies of fluorescence resonance energy transfer and contact-mediated quenching in oligonucleotide probes, Nucleic Acids Res. 30 (2002) e122. [17] A. Tsourkas, M.A. Behlke, S.D. Rose, G. Bao, Hybridization kinetics and thermodynamics of molecular beacons, Nucleic Acids Res. 31 (2003) 1319–1330. [18] M.K. Johansson, H. Fidder, D. Dick, R.M. Cook, Intramolecular dimers: a new strategy to fluorescence quenching in dual-labeled oligonucleotide probes, J. Am. Chem. Soc. 124 (2002) 6950–6956. [19] S.D. Rose, G.H. Swift, M.J. Peyton, R.E. Hammer, R.J. MacDonald, The role of PTF1-P48 in pancreatic acinar gene expression, J. Biol. Chem. 276 (2001) 44018–44026. [20] M. Petersheim, D.H. Turner, Base-stacking and base-pairing contributions to helix stability: thermodynamics of double-helix formation with CCGG, CCGGp CCGGAp, ACCGGp, CCGGUp, and ACCGGUp, Biochemistry 22 (1983) 256–263. [21] N. Sugimoto, K. Hasegawa, A. Matsumura, M. Sasaki, Effects of dangling ends on the double-helix melting of ribooligonucleotides at different Na+ concentrations, Chem. Lett. 20 (1991) 1291–1294. [22] M. Senior, R.A. Jones, K.J. Breslauer, Influence of dangling thymidine residues on the stability and structure of two DNA duplexes, Biochemistry 27 (1988) 3879–3885. [23] K.M. Guckian, B.A. Schweitzer, R.X.-F. Ren, C.J. Sheils, D.C. Tahmassebi, E.T. Kool, Factors contributing to aromatic stacking in water: evaluation in the context of DNA, J. Am. Chem. Soc. 122 (2000) 2213–2222. [24] S. Bommarito, N. Peyret, J. SantaLucia Jr., Thermodynamic parameters for DNA sequences with dangling ends, Nucleic Acids Res. 28 (2000) 1929–1934. [25] D.H. Turner, N. Sugimoto, S.M. Freier, RNA structure prediction, Annu. Rev. Biophys. Biophys. Chem. 17 (1988) 167–192. [26] H.A. Flaschka, EDTA Titrations: An Introduction to Theory and Practice, Pergamon Press, New York, NY, 1959. [27] R.B. Fischer, D.G. Peters, Basic Theory and Practice of Quantitative Chemical Analysis, W.B. Saunders, Philadelphia, Pennsylvania, 1968. [28] J. Mendham, R.C. Denney, J.D. Barnes, M. Thomas, Vogels Textbook of Quantitative Chemical Analysis, Pearson Education Limited, Harlow, England, 2000. [29] W.J. Blaedel, H.T. Knight, Purification and properties of disodium salt of ethylenediaminetetraacetic acid as a primary standard, Anal. Chem. 26 (1954) 741–746. [30] G.D. Fasman (Ed.), Handbook of Biochemistry and Molecular Biology, vol. 1, CRC Press, Cleveland, Ohio, 1975, p. 589. [31] R.M. Wartell, A.S. Benight, Thermal denaturation of DNA molecules: a comparison of theory with experiment, Phys. Rep. 126 (1985) 67–107. [32] J.F. Kaiser, W.A. Reed, Data smoothing using low-pass digital filters, Rev. Sci. Instrum. 48 (1977) 1447–1457. [33] L.A. Marky, K.J. Breslauer, Calculating thermodynamic data for transitions of any molecularity from equilibrium melting curves, Biopolymers 26 (1987) 1601–1620. [34] P.V. Riccelli, K.E. Mandell, A.S. Benight, Melting studies of dangling-ended DNA hairpins: effects of end length, loop sequence and biotinylation of loop bases, Nucleic Acids Res. 30 (2002) 4088–4093.

484


[35] T. Ohmichi, S. Nakano, D. Miyoshi, N. Sugimoto, Long RNA dangling end has large energetic contribution to duplex stability, J. Am. Chem. Soc. 124 (2002) 10367–10372. [36] S.M. Yarmoluk, S.S. Lukashov, T.YU. Ogulchansky, M.YU. Losytskyy, O.S. Kornyushyna, Interaction of cyanine dyes with nucleic acids. XXI. Arguments for half-intercalation model of interaction, Biopolymers 62 (2001) 219–227. [37] I.V. Kutyavin, I.A. Afonina, A. Mills, V.V. Gorn, E.A. Lukhtanov, E.S. Belousov, M.J. Singer, D.K. Walburger, S.G. Lokhov, A.A.

Gall, R. Dempcy, M.W. Reed, R.B. Meyer, J. Hedgpeth, 3 0 -Minor groove binder-DNA probes increase sequence specificity at PCR extension temperatures, Nucleic Acids Res. 28 (2000) 655–661. [38] G. Dougherty, J.R. Pilbrow, Physico-chemical probes of intercalation, Int. J. Biochem. 16 (1984) 1179–1192. [39] M. Bower, M.F. Summers, B. Kell, J. Hoskins, G. Zon, W.D. Wilson, Synthesis and characterization of oligodeoxyribonucleotides containing terminal phosphates, Nucleic Acid Res. 15 (1987) 3531–3547.