Effects of Nucleotide Sequence on the Specificity of me-dependent ...

Vol. 269,No. 14,Issue of April 8,pp. 10797-10803, 1994 Printed in U S A .

TXEJOURNAL OF BIOLOGICAL CHEMISTRY 0 1994 by The American Society for Biwhemiatry and Molecular Biology, Inc.

Effects of Nucleotide Sequence on the Specificity of me-dependent and RNase E-mediated Cleavagesof RNA I Encoded by thepBR322 Plasmid* (Received for publication, November 15, 1993,and in revised form, January 11, 1994)

Sue Lin-ChaoSI, Ten-TsaoWongSfl, Kenneth J. McDowallll, and Stanley N. CohenSII From the Unstitute of Molecular Biology, Academia Sinica, Nankang 11529, the Wnstitute ofBiochemistry, National Yang-Ming Medical College, nipei, Taiwan, Republic of China, and the IDepartment of Genetics, Stanford University School of Medicine, Stanford, California 94305

Sequence similarity a t RNase E cleavage sites of 9 S RNA RNase E, an endoribonuclease encoded by theEscherichia coli ~ j m j h ~locus, p l cleavesRNA I, an anti- and pBR322-encoded RNA I was first noted by ~ m c s a n y and i sense regulator of the replication of ColEl type plas- Apirion (3) who showed that RNase E removes 5 nucleotides mid~, in a single-stranded region near its 6’ end. Them- from a single-stranded region near the 5‘ end of RNA I. The 3071 mutationprolongsthe RNA I half-life in cells product of this cleavage, pRNA I-&,decays rapidly in vivo, recultured at an elevated temperature and imparts tem- leasing repression of plasmid DNA replication (4). Mutation of perature sensitivity on RNase E isolated from the mutant the sequence surrounding the site of RNase E cleavage alters strain. Here we report the effects of specific sequence both RNA I half-life i n vivo and plasmid copy number (4). Sechanges introduced by site-directed mutagenesis on the quences similar to those cleaved by RNase E in 9 S RNA and location of ribonucleolytic cleavage near the5’ end of pBR322 RNA I have been identified in other transcripts that pBR322 RNA I in m-3071 and congenic E. coli and on cleavage ofRNA I by RNase E in vitro. Primer exten- also show cleavage dependent on the me-3071 mutation, although the specific nucleotides vary from site to site (for review sion analyses showed that the occurrence and position of cleavagesin vivo and in vitro are altered highly spe- see Ref. 21). Aligning these sequences, Ehretsmann et at. (22) cifically by sequence changes but that the site of cleav- have proposed a consensus cleavage sequence for RNase E(where R = A or G and W = A or U). On age bears no simple relationship to a particular nucle-sensitive loci: the other hand, investigations of RNase E cleavages within otide order. Ourresults do not support eithernotion the that cleavage by RNase E is determined by a consensus rpsT mRNA and mutated 9 S RNA have led Mackie(12,231 and E is a virtu- Cormack and Mackie (16) to conclude that theenzyme has few sequence or the contrary view that RNase primary structural constraints otherthan a preference for sites allynonspecificsingle-strandedendonucleasewitha immediately 5’ to an AU dinucleotide located in a singlepreference for cutting 5’ to anAU dinucleotide. stranded region. As pBR322 RNA I is not translated, its cleavage by RNase E Ribonuclease E (RNase E), an Escherichia coli endoribo- and the subsequent steps of its degradation in vivo are not nuclease initially identified as the enzyme that processes 9 S subject to the possibly confounding effects of ribosomes (e.g. ribosomal RNA (11, subsequently has been implicated in the Ref. 24). Additionally, its small size (108 nucleotides) and excleavage of a variety of other substrates,including 10 Sa RNA tensively characterized secondary structure (for recent reviews (21, RNAI, a n antisense repressor of replication of pBR322 and see Refs. 25 and 26) make RNA I an attractive model system for other ColEl type plasmids (3, 41, mRNA encoded by bacterio- studying the parameters that affect RNA decay in E. coli (4,27, phage T4 and related phages (5-71, the genome of bacterio- 28). Using site-directed m u ~ ~ n e s iwe s , investigated the efphage fl(8), and certain chromosomallyencoded mRNA species fects of RNA I sequence changes on re-dependent cleavages in of E. coli (9-13). The r e gene, which encodes RNase E activity vivo and on the site of cutting by RNase E in vitro. We found (14-161, is now known to be identical to theams (altered mes- that theRNA I sequence in the vicinity of the RNase E cleavage senger stability)locus, which globallyaffects the chemical half- site strongly affects the position of cleavage; however, there is life of E. coli messages (17) and to h m p l , an E. coli gene iden- no simple relationship between sequence and the phosphoditified independently on the basis of its ability to encode a ester bondcleaved. Our results are not consistent with the product related to a yeast heavy chain myosin (18). Two tem- notion that a simple consensus sequence governs RNase E perature-sensitive mutations in the ams /rne Jhmpl gene, cleavages or with the view that RNase E i s a virtually nonspeams-1 (17) and r e - 3 0 7 1 (191, alter nucleotides 6 base pairs cific endoribonuclease with a preference for cutting singleapart in a segment of the gene that encodes a domain resem- stranded sites 5’ to an AU dinucleotide. McDowall et al. (29) bling an E. coli protein implicated in the maintenance of bac- have reached identical conclusions using a different approach, terial cell shape (20). random mutagenesis, to study the specificity of RNase E cleav* This work was supported by National Science CouncilTaiwan, Re- ages occurring in anotherColEl type plasmid, pACYCl84. the Institute of public of China, Grants NSC 80/81-0203-B~1-14 (to Molecular Biology) and NSC 8V82-0211-B-001-519/120(to S. N. C.), by MATERIALS AND METHODS National Institutes of Health Grant GM!27241 (to S. N. C.), and by Stmins, Plasmids, and Growth Conditions-Thebacterial strains Science & Engineering Research Council Postdoctoral Fellowship B/SV used for the RNA I studies were the E. coli K12 congenic strains N3433 RFW1197 (to K. J. M.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must ( r e ’ ) andN3431 (me-3071)(19), DH5a and DH5aF‘ (30) and were therefore be hereby marked “advertisement”in accordancewith 18 described previously(4,31). The phage DNA and plasmidused for RNA I mutant constructions and the riboprobe preparation were U.S.C. Section 1734 solely to indicate this fact. 4 To whom correspondence reprint requests should be addressed. Fax: M13mplSori and pUCT7l”r3-pBRori, respectively, and were described in Lin-Chao andCohen (4). Luria-Bertani broth (32) was used for plas886-2-782-6085. r

n

e

+

~~

10797

10798

Effects of Nucleotide Sequence on RNase E Cleavages

mid DNA preparation, and M9/glucose medium (4) was used to grow cultures for isolation of RNA. Constr~ctionof Mutant P Z a s m i d s ~ i t e - d i ~mutagenesis d was used to introduce specific sequence changes in the region encodingRNA I. M13mpl9ori viral DNA was used as the DNA template of oligonucleotide site-directed mutagenesis according the Amersham oligonucleotide-directed in uitm mutagenesis system. The oligonucleotides used

forthemutagenesiswere:5'GCTACACTAGAAGG(d3)GTAT"GGTATCTGCG(pCMLlO5); 5'GAAGGACAGTA""l'GAT"GGTATCTGCGCTCTGC(pCML113); 5'GCTACACTAGAAGGAT"GAT"GGTATCTGCGCTCTGC (pCME1); S'GCTACACTAGAAGGCAAATACTGTGTATCTGCGCTCTGC (pCME5); S'GCTACACTAGAAGGGCCCAATATTGTATCTGCGCTCTGC (pCME8);5'GCTACACTAGAAGGA'I"lA'I"MATTTGGTATCTGCGC ($ME$); and 5'ATTIY=GTATCTGCGCTCTG(d13)CCTTCGGAAAAAGAGWGG (pCML95);the DNA sequences inserted or deleted kg. d l 3 a 13-nucleotide deletion between the DNA sequences as indicated) are shown by a underline for each construct. pCMLlO3 was derived from pSLC-lOl(4) by polymerase chain reaction amplification as described below. The 20-mer 5'ACI'AGAAGGACA(AI T/C)TAT"GG was used to construct RNA I variants carrying a G to A or U or C substitution located at thefourth nucleotide from the 5' end of RNA I. The individual mutated phage DNA was subsequently amplified by polymerase chain reaction using B'GATGGATCCGGTAACTATCGTC (the underlined DNA sequences is recognized by EcoRI; the bold type A corresponds to the coordinate sequence of 2826 of pBR322 (36)) and 5'GCAGAATTCTGCTGC'ITGCAAAC (the underlined DNA sequence is recognized by BamHI; the bold type C corresponds to the sequence coordinate of 3096 of pBR322). The amplified DNA product was inserted into the EcoRI and BamHI sites of pCM128 (33), a high copy number mutant of pPM30 134).The corresponding plasmid canying mutant RNA I is indicated in parentheses for each oligonucleotide used for the mutagenesis and was confirmed by DNAsequence analysis. DNA and RNAEchniques-DNA,RNA, and probe preparations were described previously (4,311.Primer extension analysis was used to map the 5' termini of RNAI molecules and was described (31).A 29-mer (Su-29 mer), 5'-CTACCAGCGGTGGTD'G"GCCGGATCA, complementary to the 3' end of the RNA I transcript, was used for primer extension analysis. RNA Capping Assay and SI Protection-An RNA capping assay using guanylytransferase, [C~-~'P]GTP, and 30-50pgof total RNA was used to examine whether an RNA species isolated from E. coli was a primary transcript. The capping enzyme,guanylyltransferase, was purchased from Life Technologies, Inc. The reaction buffers and procedures used for the capping experiments were described by the vendor (10 x capping reaction buffer containing 250 m~ Tris-C1 (pH 7.51, 12.5 m~ MgCI,, and 60 m~ KCl). Single-stranded DNA complementaryto RNA I was used for protection of capped RNA species from S1 nuclease and was prepared by polymerase chain reaction a m p l i f i ~ ~ o(351 n using primers bracketing the ColEl replicon. The base pair coordinates of synthesized single-stranded DNA are from 2462 to 3074 of plasmid pBR322 (36). Hybridization of capped RNA with single-stranded DNA ( 150 ng used for each reaction) was carried out in 30 pl of water that had been treated with diethylpyrocarbonate as described for primer extension analysis (31). The reaction was incubated for 12 h at 37 "C after 5 min of preheating at 85 "C and was added to 300 pl of S1 nuclease reaction buffer (36) containing 75 units of S1 nuclease (Life Technologies, Inc.). The reaction was incubated for 1h at 20 "C and stopped by the addition of 80 pl of S1 stop mixture (4 M ammonium acetate, 50 m~ EDTA, and 50 p g / d tRNA), and extracted with phenollchloroform. Nucleic acid precipitation was carried out as described (4), and the 5' end G-capped [C~-~P]RNA was analyzed on an 8% polyacrylamide sequencing gel. In Etro Synthesis of RNA I and 9 S RNA for RNase E Digestion Anutysis-3 pg of supercoiled DNA of pCMLlO8or its derivatives was used as template for synthesis of the correspondingRNA I species by E. coEi RNApolymerase. The reaction conditions were modified' from those described previously (37). 50-p1 reaction mixtures contained 40 m~ Tris-C1(pH 8.0), 50 m~ ammonium acetate, 100 nm potassium acetate, 4 m~ magnesium acetate, 50 pCiof [a-32PlUTP,a 0.4 m~ concentration of each NTP, 5 m~ p-mercaptoethanol, 50 pg/ml acetylated bovine serum albumin, and 3 units of RNA polymerase (Boehringer Mannheim). Incubation was for 1 h at 37 "C. 9 S rRNA was synthesized from an HaeIII-linearized plasmid, pTH9O (38) (a gift from Dr. A. von Gabain), using T7RNA polymerase. DNA template was removed by DNase I digestion for 15 min a t 37 "C using RNase-free DNase I (Boehringer Mannheim), and the reaction was extracted with phenolkhloroform, M. Chamberlin, personal communication.

precipitated by the addition of isopropyl alcohol,and stored a t -20 "C until used. Partial ~ r ~ ~ a tand i o Assay n of E. coli RNase E-E. coli strain N3433 was grown logarithmically a t 37 "C in Terrific Broth (TB) in a high density cell fermenter (Lab-Line Instruments, Inc.) to OD,, = 7 under 8 p.s.i. of continuous flow of 0,. Cells (yield about 25 gfliter)were chilled rapidly in an ice-water bath and collected by centrifugation at 4 "C. Pellets were washed twicein 0.2 x volume of chilled bufferA (381, centrifuged, and frozen at -70 "C. 25-g aliquots of cells (frozen wet weight) were disrupted by grinding at 4 "C (where all subsequent steps were also carried out) with 50 g of prechilled alumina (Sigma) added slowly until a paste was formed. The paste was extracted by mixing with 60 ml of chilled bufferA added 10 ml a t a time, and the suspension was centrifuged for 20min a t 20,000 x g. The supernatant was cleared by spinning at 30,000 x g for 30 min and further purified by centrifugation, pellet extraction in 0.65 M KC], and ammonium sulfate precipitation as described by Sohlberg et al. (38). Dialyzed preparations were stored in either buffer A or buffer B at -70 "C. The enzyme was assayed in 20 pl of an RNase E digestion mixture that contained 10 nm Tris-HCl (pH 8.01.5 m~ MgCI,, 100 nm NH,C12, 5% glycerol, 1m~ dithiothreitoi, 15-20 pg ofprotein, and about 10 pg of total RNA that had been isolated from re-3071 carrying the indicated plasmid. The mixture was incubated at 30 "C for 30or 90 min, extracted twice with phenollchloroform, isopropyl alcoholprecipitated, and used for primer extension analyses to identify the site(s)of cleavage. RESULTS

Construction of W A I Variants-A series of specific sequence changes were introduced by site-directed mutagenesis into the 10-nucleotide single-stranded region at the 5' end ofFWA I encoded by the pBR322 plasmid (Fig. 1,A and B). Some of the mutations generated were designed to test directly the RNase E cleavage site preferences postulated previously by others (e.g. constructs pCMEl and pCME9);some mutations were intended to investigate whether extensive changes in primary sequence abolish cleavage oralter itslocation (e.g. pCME8 and pCME5), whereas stillanother addressed the question of whether the cleavage site is set a t a particular position relative to a stem-loop structure or the 5' terminus ofRNA I (i.e. pCML113). The pBR322-derivedplasmids we constructed were all viable replicons; however, the copy number varied greatly (data not shown), and therefore, the mutagenized DNA segments encoding RNA I were individually introduced into the pSC101-based plasmid, pCM128 (331, to ensure constant plasmid copy number and comparable rates of formation of the RNA I variants (Fig. 1C). RNA I Decay Intermediates wected by the re-3071 Mutation in Viuo-The 5' ends generated by cleavage of the wild type pBR322 RNA I sequence encoded by plasmid pCML108 were mapped by primer extension analysis. In these experiments, a band representing the 5' pppA terminus of full-length pBR322 or ColEl RNA I (39) identified nucleotide position 108; the positions of other 5'ends are described in relation to this band. A s shown in Fig. 2, me+ cells carrying pCML108 and grown a t either 33or 43 "C contained, in addition to full-length RNA I, a species 5 nucleotides shorter at the 5' end. This species, which migrates at the same position (nucleotide 103)as the mutationally truncated primary transcript encoded by the pCML103 construct (Le., pppRNA I-&;Ref. 41, was generated also in uitm by an RNase E preparation that cleaved 9 S ribosomal RNA specifically and exclusively at previouslydescribed sites of RNase E cleavage (see below). A 5' end at position 103 was also observed for RNA I isolated from the me-3071 mutant grown at 33 "C. However, this species was absent or markedly diminished in mutant cells cultured a t 43 "C (Fig. 2, A and B ) , suggesting that itsformation is dependent on a functional me gene product. An additional band observed at position 105 for pCML108RNA I isolated from me+ and rne-3071 bacteria grown at 33 "C was reduced in amount inboth strains a t 43 "c, indicating that itsdisappearance is relatedto the temperature

Effects of Nucleotide Sequence on

RNase E Cleavages

10799

A.

-

RNAII

origin Replication

RNAI

.F'o'y

U

Q Y-F/ \

A

A--cS

B.

A A

pCML 95

G A

deletion 13 nts

A

I

*

RNAseE

pCML 113 A 1ndon5nts

SACAGUAUUUG-

SAUUUC

G~~

AT

SACAGUAUUUGAUUUGSAUUUGAUUUGSAUUAUUUAUUUGWGccC~uAU& SCAAAUACUGU-

--

pCMLlm

(Wild type)

~ ~ 1 - --- 6&ME1 - - pCME9 ~ C M E - - pCME 5*

1 3

~

FIG.1. RNA I, RNA I variants, and plasmid constructs used for this study. Panel A shows the positional relationship o f RNA I and RNA I1 to each other andto the reptication originof ColEl type plasmids. The thin arrows represent RNA transcripts, and the thick arrow represents DNA. Panel 3,sequence and structure of RNA I; the secondary structure of pCML08 RNAI (pBR322 RNA I) has been determined experimentally (data not shown). The structure of RNA I species deduced from the GCG Fold andSquiggles programs (44) is consistent for this RNA I and for other analyzed RNA I variants with the experimentally determined structures (26).All RNA I variants except pCML95 and pCME5 (indicated by an asterisk) have identical secondary structure analyzed by GCG Fold programs (data not shown). The positions of the RNase E cleavage site of pBR322 RNA I and 5' end sequence of the RNA I variants used in thesestudies (pCME1, pCME5, pCME8, and pCMES) are shown. The locations of the insertion in pCML113 and the deletion in pCML95 of mutant RNA I are indicated.Panel C , the plasmid pCMLlO8 is a derivative of pCM128 (33) which fails to make RNA I1 but produces an RNA I species that corresponds in sequence to the RNA I encoded by pBR322.

shift rather than to inactivation of the rne-gene product. This species was eliminated by a G to C substitution, but not by a substitution to A or U at thefourth nucleotide position of the RNA I transcript (Figs. lB and 3). Confirmation that the5' ends at positions 105 and 103 result from the processing of primary transcripts rather than from initiation of transcription a t adventitious sites was obtained by nuclease S1 digestion of DNA-protected cap-labeledRNA I. As only primary transcripts undergo cap labeling by guanylyltransferase and[cY-~PIGTP, cap-labeled transcripts initiatedat the same position but terminated differently will yielda single band in S1 protection experiments, whereas a population of primary transcripts initiated at different locations will show multiple bands (Fig. 4). Primary transcripts of mutationally truncated RNA I variants lacking 3 or 5 nucleotides at the 5' triphosphate end (pCML105 and pCMLlO3, respectively, Fig. 4C), served as positive controls. As shownin Fig. 4A, S2P-labeled capped transcripts having a multiplicity of lengths were observed for pCML108, as well as for pCML105and pCML103; however,in each case only a single labeled species was observed followinghybridization with DNA complementary to the 5' half of the transcript and subsequent treatment with Sf nuclease (Fig. 4, A and B ) . These results indicate that allcapped products of pCML108 have the same 5' triphosphateterminusand consequently establish that the RNA I species 3 and 5 nucleotides shorter than full-length RNA I at the5' end are degradation products. Effects of Sequence Altemtions Near the 5' End of RNA I on Cleavages in the me-3071 Mutant-As shown in Fig. 2, 5' termini specificallyeliminated by a shift of the rne-3071 mutant to 43 "C were observed for some of the constructed RNA I variants, but not for others. For pCME9,which contains a 13nucleotide A+U-rich sequence implicated in therapid decay of

certain heat-shock-inducible transcriptsin Drosophila and mammalian cells (for review see Ref. 40) at its 5' end, a band dependent on r e gene function was observed at nucleotide position 103, immediately upstream from an AU dinucleotide (Fig. 2, A and B ) . However, we did not detect an analogous 5' end adjacent to another AU pair (which, like the intranucleotide bond cleavedin pCME9, is also preceded by a Uf located just 4 nucleotides upstream. Moreover, we did not find any 5' end that was eliminated or reduced in abundance by the rne3071 mutation in the corresponding region of pCMLll3 RNA I (Fig. 2 4 1 , which contains a tandem repeat of the pentanucleotide AUUUG in thesingle-stranded region 5' to the first stemloop. This repeat, whichproduces a 10-nucleotide segment identical to the one found in pCMLlO8, moves the normally cleaved intranucleotide bond 5 nucleotides further from the stem-loop and concurrently provides an additional A+U-rich sequence in the region cleaved (Fig. 1B). As shown in Fig. 2,A and B , a terminuslocated 5' to the UU dinucleotide a t position 102 was seen in both the rne+ and rne-3071 strains at both 33 and43 "C for pCML113 RNA I. An analogous 5' end upstream from a UU pair was observed at the corresponding position of pCMEl RNA I, which contains a sequence(AUUUGAUUUG) that includes two separate AU dinucleotides in the region cleaved.Another 5' end observed a t position 110 forpCML113 RNA I in both N3433 and N3431 at 33 "C was absent or reduced in amounta t 43 "C. This terminus was located at the same A-G intranucleotide bond as the5' end observed at position 105 for pCML108 RNA I. pCML95 was constructed specifically to evaluate the role of the stem-loop structure 3' to the RNase E-cleaved region.This plasmid encodes an RNA I variant that contains a 5' singlestranded region identical to the one foundin wild type pBR322 RNA I (z.e. pCML108) but lacks a 13-nucleotide segment re-

Effects of Nucleotide Sequence on RNase E Cleavages

10800 A

N3431 lrne fs\

N3433 (WT) i

CG CG

CG AT

TA

111 110 109

105 104 103

AT

B

5‘ N3433 (WT)

C

pcA~upuuu

pCML108/N3433 33OC 43k 1

-J 11°

- 108

-

pCML108/N3431 33OC 43t

:

I

I

-2

103

pCMLl13/N3433 33OC 43% pCML113/N3431 33°C 43%

’

g z

~cA~uAuu~GA~uu I I

I

I I

FIG.2. P r i m e r e x t e n s i o n a n a l y s i s m a p p i n g of RNA I 5’ termini produced in vivo. The experimental details are presented under “Materials and Methods.” The host strains (N3431, me-; N3433, me’) and culture temperatures are indicated. 5 ’ termini were analyzed by calibration of each mutant RNAwith a concurrently run DNAsequence ladder extended from the same primer; in the figure, only the DNAsequence ladder forpBR322 DNAis shown. Asynthetic 29-mer (see “Materials and Methods”) was used for both the DNAsequence and the primer extens Panels A and B are autoradiographs of primer extension products resolved on 8% polyacrylamide, 7 M urea gels by electrophoresis. Panel C, comparison of the primer extension results shown in panel A for (wild type) pCML108 RNA I and RNA I encoded by pCML113. The thicknessof the vertical line represents the relative abundance of each RNA species in panel A. The nucleotide positions shown in panels A and B were calibrated using the nucleotide position of wild type RNA I encoded by pCML108.

2, A and B , no rne-dependent cutting occurred in vivo in the mutated RNA I segment; however, a 5‘ end that was unaffected by the me-3071 mutation was seenat position 105. Cleavage of RNA Z Variants by RNase E in Vitro-Although the effects of the rne-3071 mutation on RNA decay in vivo commonly have been taken as evidence for RNase E cleavage nt (for review see Ref. 21), it is known that not all RNA species 108 that accumulateat the nonpermissive temperature in themutant are substrates for RNase E. Conversely, cleavages by ri-I* - 105 bonucleases other than RNase E can be affected by the rne-71 03 3071mutation (3, 4 0 4 3 , 45). To examine specifically the relationship of me-dependent 5’ends found in vivo to cleavages generated in RNA I by RNase E in vitro, we used substrates isolated from the me-3071 strain culturedat 43 “C as well as substrates synthesized in vitro using E. coli RNA polymerase partially purified from the rne+strain N3433. As shown in Fig. 5, during 90 min of incubation under the conditions used for the assay, this preparationcleaved 9 S RNA FIG.3. P r i m e r e x t e n s i o nanalyses of RNA I m u t a n t s carrying G only at the two sites used by Ghora and Apirion (1)to define to A or U or C substitution at the f o u r t h nucleotide f r o m the 5’ originally the enzymatic activity of RNase E and used subseend. The experimental conditions were a s described inFig. 2. The host quently by others to assay RNase E activity (e.g. 16, 46-48). used in this experiment wasN3433. Additionally, it cleaved in vitro synthesized pCML108 RNA I a t quired for formation of the downstreamstem-loop (Fig. lB ). As the same site (position103) found for in vitro cleavage of seen in Fig. 2.4, elimination of this stem-loop reduced the rne pBR322 RNA I (3) (Fig. 5C) andobserved also for rne-dependdependence of the in vivo cleavage occurring at a site that ent cleavage occurring in vivo (Figs. 2, A and B ) . As seen also corresponds to position 103 of pCML108 RNA I. pCME5 RNA I for pBR322 RNA I cut by the RNase E preparation of Tomcsacontains theinverse complementof the 10-nucleotide sequence nyi and Apirion (3), pCML108 RNA I treated with our RNase E normally present in thecleavage box segment. As seen in Fig. preparation showed some 5‘ ends at the 102 position. However, ”

Effects of Nucleotide Sequence on RNase E Cleavages

A

Capping

m

B

Capping + S1

-

-.

10801

108 105

103

'5-

Capped RNA1

3 -

Other capped RNA species

FIG.4. Capping and S1 nuclease protection analyses of RNA I transcripts. The experimental conditions were a s described under "Materials andMethods." Total RNA was isolated from N3431 host carrying the indicated plasmid andgrown a t 33 "C. Panel A, autoradiograph of samples electrophoretically separated on a n 8% polyacrylaminde gel containing 7 M urea. Individual RNA species are indicated. Panel B , schematic representationof strategy of analysis of capped termini protected by DNAsegments homologous to thefirst half of RNA I.The rationale is explained under "Results." The DNA and RNA species are indicated. Panel C summarizes the result of primer extension analysis of RNA I prepared from the corresponding plasmid(gel not shown).

C

B

A YQ YQ qQ min

- + +

mb-

RNase E

9s RNA 5'

-Uncut

"

.--

1 2 3 4

-[E] a+b

i

3'

FIG.5. Digestion by RNaseE of 9 S RNAand pCMLl08 RNA1synthesized in vitro. The experimental conditions were as described under "Materials andMethods." Panel A, time courseof digestion of radioactively labeled synthetic9 S RNA transcript. The uncut RNA and the products resulting from cleavageat the A or B site areindicated. Panel B, map of RNase E cleavage sites in9 S RNA showing the previously identified A and B sites (3). + and - indicate the presence or absenceof partially purified RNase E in the reaction site. Panel C, time course of digestion of synthetic pMCL108 RNA I. The cleavage sites were mappedby primer extension as described in Fig. 2.

Effects of Nucleotide Sequence on

10802

A

pcML1oa

pCMLlO3

pCML113

RNase E Cleavages pCML95

pCMLll3

"

pCML95

-

C G T A a b c d e a b c d e k b c d e ' b b c d h ' a b c d e ' h b c d i

a"

trf

I 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 1920 21 22 23

- 9

4 "

24

ACAGU#A"UUUGAU"UUGGUAU ---DCME~ A U U U G A " U U U G W ---pCME9 AUUAU"U"U*A"UUUGGUAU ---pCME8 G C C C A A U " A " U U G W ---pCME5 CAAAUACUGUGUAU ----

FIG.6.Primer extension analysisof the RNA I component of total RNA isolated from cells and then cleavedin v i t r o by RNase E. The experimental conditions werea s described under "Materials and Methods." The duration of RNase E digestion of RNA obtained from cells containing the indicated mutant constructs is indicated. Differences in the intensityof bands seen in different lanes of the same gel are caused by differences in amountof sample loaded;however, the relative intensityof bands in the same lane was compared in determining the abundance of decay intermediates. Different exposure times were used in analyzing the same gels for constructs pCML113 and pCML95 to resolve bands in different lanes of the gels. Punel A, autoradiograph of primer extension analyses of RNase E-cleaved samples using a primer specific to an unmutated internal sequenceof RNA I: lune a , RNAfrom N3431 culturedat 33"C; lane b, RNAfrom N3431 culturedat 43 "C; lane c, same aslune b except that theRNA was incubated with only digestion buffer 30 min; for lane d , same aslane b except that theRNA was incubated with digestion buffer and RNase for E 30 min;lune e, RNAreaction was identical to ofthat lane d , except that the incubation time was 90Panel min. B summarizes in uitro. # same the results obtained for various pBR322 RNA I variants: * sites of rne-dependent cleavagein uivo and RNase E-mediated cleavage a s * except that the productsof cleavage are less abundant. indicates sitesof RNase E cleavagein vitro which are not associated with detectable rne-dependent 5' ends in uiuo. The region 3' to the underlined segment is identical for allRNA I variants, as indicated in Fig. 1.

no cleavage was detected at the 105 position, consistent with evidence (Fig. 2, A and B ) that the RNA I 5' end observed a t this position in vivo is not affected by the rne-3071 mutation. "he abilityof our RNase E preparation tocleave specifically and exclusively at locations identified previously as sites of RNase E cleavage implies the absence of significant adventitious endoribonucleolytic activity under the assay conditions used. The lack of cleavage of the mutationally truncated singlestranded region at the 5' end of pCML103 RNA I (Fig. 6 A ) by this enzyme is consistent with this conclusion. However, digestion of certain other RNA I variants by this same RNase E preparation generated products that did not correspond to the products of re-dependent cleavages occurring in vivo. The products of in vitro cleavage of the RNA I variants pCML95, pCML113, pCME8, and pCME9 are seen in thegels shown in Fig. 6A and are identified schematically in Fig. 6B.Our results imply that eithernot all sites susceptible to RNase E cleavage in vitro are affected equally by the temperature-sensitiver e 3071 mutationor alternatively, that different decay intermediates produced by re-dependent cleavages in vivo are degraded at different rates. DISCUSSION

The observation that pBR322-encoded RNA I and 9 S RNA are similar insequence at sites cleaved by RNase E(3)provided the first indication that RNase E cleavages are influenced by

the sequence of the substrate. Subsequent comparison of cleavage sites affected by me mutations in vivo, together with an analysis of the effect of substitutions in 3 nucleotides adjacent to the siteof cleavage of bacteriophage T4 gene 32mRNA, led Ehretsmann et al. (22) to propose that RNase E cleavage speciA W ,where ficity is determined by the consensus sequence R R = A or G and W = A or U. Our resultsshow that mutagenized RNA I substrates containing the proposed consensus in the single-stranded region at the 5' end of RNA I are not necessarily cleaved (e.g. RNA I from pCML113); conversely, a sequence at the same location which deviates from the consensus can undergo both me-dependent cleavage in vivo and RNase Emediated cleavage in vitro (e.g. pCME9 RNA I). Our results also are not consistent with the notion that RNase E is a virtually nonspecific single-stranded endonuclease; we find that that nucleotide substitutions in theregion cleaved resulted in highly specific alterations in the position of the cleavage site. All of the RNase E cleavages we observed occurred in regions rich in A and U. However, our results andthose of McDowall et al. (29) show that the specific intranucleotide bond cleaved is not determined by a particular order of nucleotides. What is the basis for the observed ability of mutations within the single-stranded region at the 5' end ofRNA I to affect RNase E cleavagesin theabsence of a defined sequence that is either necessary or sufficient for cleavage? Presumably, the precise position of cleavage in anA+U-rich region is determined

Effects of Nucleotide Sequence on RNase E Cleavages

10803

4. Lin-Chao, S., and Cohen, S . N. (1991) Cell 66,1233-1242 by the effect of sequence on the overall conformation (2.e.higher 5. Carpousis, A. I., Mudd, E.A,, and Krisch,N. M. (1989) Mol. & Gen. Genet.219, order structure) of the substrate, enabling it to interact with 3948 6. h a y z a , D.,Carpousis, A. J., andKrisch, H. M. (1991) Mol.Microbiol. 6, the catalytic siteof RNase E, or possibly with a ribonucleotide 71S725 component of a small ribonuclear protein that may facilitate 7. Mudd, E. A., Prentki, P., Belin, D., and Krisch, H. M. (1988) EMBO J. 7, cleavage. In this regard it is noteworthy that domains of the 36013607 8. Kokoska, R. J., Blumer, K. J., and Steege, D. A. (1990) Biochimie (Paris) 72, urns / r e / h m p l gene product which resemble the U1 small 803-4311 ribonuclear protein havebeen identified by sequence homology 9. Nilsson, G., Lundberg, U., and von Gabain, A. (1988) EMBO J. 7,2269-2275 searches (18, 20, 48). 10. Faubladier, M., Kaymeuang, C., and Bouche, J.-P. (1990) J. Mol. Biol. 212, 461471 Although there is evidence that regions of secondary struc- 11. Nilsson, P., and Uhlin, B. E. (1991)Mol. Microbiol. 5, 1791-1799 ture can affect nearby cleavages by RNase E (16, 22, 271, the 12. Mackie, G. A. (1991)J. Bacteriol. 173, 2488-2497 mechanistic role of such regions is unclear. It has been sug- 13. Regnier, P., and Hajnsdorf, E. (1991) J. Mol. Biol. 217,283-292 14. Babitzke, P., and Kushner, S. R. (1991)Proc. Natl. Acad. Sci. U. S. A. 88, 1-5 gested that stem-loop structures 5' or 3' to sites of RNase E 15. Taraseviciene, L., Miczak,A., and Apirion, D. (1991)Mol. Microbiol.6,851-855 cleavage mayserve as entry sites for the enzyme (16,221, which 16. Cormack, R. S . , and Mackie, G. A. (1992)J. Mol. Biol. 228, 1078-1090 Ono, M., and Kuwano, M. (1979) J. Mol. Biol. 129,343357 would then scan the substrate for a site susceptible to cleavage. 17. 18. Casaregola, S., Jacq, A,, Laoudj,D., McGurk, G., Margarson, S . , Tempete, M., However, other data indicate that5' stem-loop structures can Norris, V., Holland, I. B. (1992) J. Mol. Biol. 228, 3 M O impede RNase E cleavages (27). We found that deletion of the 19. Goldblum, K., and Apirion, D.(1981) J. Bacteriol. 146, 12S132 20. McDowall, K.J., Hernandez, R. G . , Lin-Chao, S., and Cohen, S . N. (1993) J. native stem-loop located 3' to the RNase E cleavage site in Bacteriol. 176, 4245-4249 pCML 108 RNA I (Le. construct pCML95) did notprevent cleav- 21. Melefors, O., Lundberg, U., and von Gabain, A. (1993) in Control of Messenger RNA Stability(Belasco, J. G., and Brawerman,G., eds) pp. 53-70,Academic age by RNase E in vitro; however, another stem-loop brought Press, San Diego near to the cleavage site by the deletion in pCML95 may pro- 22. Ehretsmann, C. P.,Carpousis, A. J., and Krisch, H. M. (1992)Genes & Deu. 6, 149-159 vide an analogous function. As was observed also for the RNA Mackie, G . A. (1992) J. Biol. Chem. 267, 105P1061 encoding the bacteriophage T4 gene 32 protein ( 5 ) ,the amount 23. 24. Yarchuk, O.,Jacques, N., Guillerez, J., and Dreyfus, M. (1992) J. Mol. Eiol. 226,581-596 of decay intermediates relativeto the uncleaved transcript was G., Helmer-Citterich, M., and Castagnoli, L. (1991)P e n d s Genet. 7, altered for the pCML95 construct, in vivo, suggesting thatei- 25. Cesareni 230-235 ther the rate of cleavage or the rate of decay of the cleavage 26. Eguchi, Y.,Itoh, T., and Tomizawa, J. (1991)Annu. Rev. Biochem. 60,631452 products is influenced by the secondary structure of the sub- 27. Bouvet, P., and Belasco, J. G. (1992) Nature 360,488-491 E , Lin-Chao, S . , and Cohen, S . N. (1993)P m . Natl. Acad. Sci. U. S. A. 90, strate. In any case, our finding that pCML95 RNA I is cleaved 28. Xu,6756-6760 by RNase E at the samepositions as pCML108 RNA I indicates 29. McDowall, K. J., Lin-Chao, S., and Cohen, S . N. (1994) J. Biol. Chem. 269, 10790-10796 that anyeffects of stem-loops on RNase E cleavages are related 30. Grant, S . G.,Jessee, J., Bloom, F. R., and Hanahan,D. (1990)Proc. Natl. Acad. to overall structure rather than sequence. Sci. U.S. A . 81, 464M649 The 5' end at position 105 for pCMLlO8 RNA I, which was 31. Lin-Chao, S . , Chen, W.-T., and Wong, T.-T. (1992)Mol. Microbiol.6,3385-3393 Roth, J. R. (1970) Methods Enzymol. 17, 3-35 reduced in amountat 43 "C in both the r e - 3 0 7 1 mutant strain 32. 33. Tucker, W. T., Miller, C. A,, and Cohen, S . N. (1984) Cell 38, 191-201 and the congenic wild type host, was affected by the sequence 34. Meacock, P. A., and Cohen, S . N. (1980) Cell 20, 592542 35. Higuchi, R. G., and Ochman, H. (1989) Nucleic Acids Res. 17,5865 of the substrate,as were thecleavages altered by the me-3071 36. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning: A mutation. As pBR322 RNA I is degraded equally well at 43 and Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 33 "C in me+E. coli (4), the cleavage occurring at position 105 M., Kingston, R., Gilman, M., Wiggs, J., and devera, A. (1983) does not significantly influencethe overall decay of RNA I. This 37. Chamberlin, Methods Enzymol. 101,540468 conclusion is supportedby our finding (data notshown) that an 38. Sohlberg, B., Lundberg,U., Hartl, E-U., andvon Gabain, A. (1993)Proc. Natl. Acad. Sci. U. S. A . 90,277-281 RNA I variant containing a G to C substitution at the fourth 39. Morita, M., and Oka, A. (1979) Eur. J. Biochem. 9 7 , 4 3 5 4 4 3 observed for 40. Yost, H. J., Petersen, R. B., and Lindquist, S. (1990) P e d s Genet. 6,223-227 nucleotide position shows a half-life similar to that the parental transcript despite theabsence of any detectable 41. Pragai B., and Apirion, D. (1982)J. Mol. Biol. 154, 465-484 42. Gurewitz, M., Jain, S. K., and Apirion,D.(1983)Proc. Natl. Acad. Sei. U. S. A. cleavage at position 105 of the variant substrate. 80,445M454

Acknowledgments-We thank G.-C. Shen and Y.-N. Feng for technical assistance and J.-Y. Leu for assisting with some plasmid constructions. REFERENCES 1. Ghora, B. K., and Apirion, D.(1978) Cell 16, 1055-1066 2. Subbarao, M. N., and Apirion, D.(1989)Mol. & Gen. Genet. 217,499404 3. Tomcsanyi, T., and Apirion, D.(1985) J. Mol. Biol. 186,713-720

43. Scrivastava, R. K., Miczak, A,, and Apirion, D. (1990) Biochimie (Paris) 72, 791-802 44. Devereux, J . , Haeberli, P., and Smithies, 0.(1984) NucleicAcidsRes. 12, 387-395 45. Lundberg, U.,von Gabain, A,, andMelefors O.,(1990)EMBO J. 8,2731-2741 46. Mudd, E.A., Krisch, H. M., and Higgins, C. F. (1990)Mol. Microbiol. 4,21272135 47. Melefors, O.,and von Gabain, A. (1991)Mol. Microbiol. 6, 857-864 48. Claverie-Martin, F., Diaz-Torres, M. R., Yancey, S. D., and Kushner, S. R. (1991) J. Eiol. Chem. 266, 2843-2851