Efficient mRNA delivery with graphene oxide ...

Journal of Controlled Release 235 (2016) 222–235

Contents lists available at ScienceDirect

Journal of Controlled Release journal homepage: www.elsevier.com/locate/jconrel

Efficient mRNA delivery with graphene oxide-polyethylenimine for generation of footprint-free human induced pluripotent stem cells Hye Yeon Choi a,1, Tae-Jin Lee b,e,1, Gwang-Mo Yang a, Jaesur Oh b, Jihye Won a, Jihae Han a, Gun-Jae Jeong b, Jongpil Kim c, Jin-Hoi Kim a, Byung-Soo Kim b,d,⁎⁎, Ssang-Goo Cho a,⁎ a Department of Animal Biotechnology (Stem Cell & Regenerative Biotechnology), Animal Resources Research Center, Incurable Disease Animal Model and Stem Cell Institute (IDASI), Konkuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul 05029, Republic of Korea b School of Chemical and Biological Engineering, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 08826, Republic of Korea c Department of Biomedical Engineering, Dongguk University, Seoul 100-715, Republic of Korea d Institute of Chemical Processes, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 08826, Republic of Korea e Department of Pathology and Immunology, Washington University School of Medicine, MO, USA

a r t i c l e

i n f o

Article history: Received 6 April 2016 Received in revised form 1 June 2016 Accepted 3 June 2016 Available online 04 June 2016 Keywords: Gene delivery Graphene oxide-polyethylenimine complex Footprint-free transgene-free Integration-free Human induced pluripotent stem cells iPSC RNA delivery

a b s t r a c t Clinical applications of induced pluripotent stem cells (iPSCs) require development of technologies for the production of “footprint-free” (gene integration-free) iPSCs, which avoid the potential risk of insertional mutagenesis in humans. Previously, several studies have shown that mRNA transfer can generate “footprint-free” iPSCs, but these studies did not use a delivery vehicle and thus repetitive daily transfection was required because of mRNA degradation. Here, we report an mRNA delivery system employing graphene oxide (GO)-polyethylenimine (PEI) complexes for the efficient generation of “footprint-free” iPSCs. GO-PEI complexes were found to be very effective for loading mRNA of reprogramming transcription factors and protection from mRNA degradation by RNase. Dynamic suspension cultures of GO-PEI/RNA complexes-treated cells dramatically increased the reprogramming efficiency and successfully generated rat and human iPSCs from adult adipose tissue-derived fibroblasts without repetitive daily transfection. The iPSCs showed all the hallmarks of pluripotent stem cells including expression of pluripotency genes, epigenetic reprogramming, and differentiation into the three germ layers. These results demonstrate that mRNA delivery using GO-PEI-RNA complexes can efficiently generate “footprint-free” iPSCs, which may advance the translation of iPSC technology into the clinical settings. © 2016 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

1. Introduction Stem cell research is a rapidly developing area of biomedicine. The recently developed technology of induced pluripotent stem cells (iPSCs) is opening up an avenue for efficient biomedical application of such personalized stem cells overcoming the potential for immune rejection. The iPSC technology can be applied to studies of normal development and for designing a platform for patient-specific disease

⁎ Correspondence to: S.-G. Cho, Department of Animal Biotechnology (Stem Cell & Regenerative Biotechnology), Animal Resources Research Center, Incurable Disease Animal Model and Stem Cell Institute (IDASI), Konkuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul 05029, Republic of Korea. ⁎⁎ Correspondence to: B.-S. Kim, School of Chemical and Biological Engineering, Institute of Bioengineering, Institute of Chemical Processes, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 08826, Republic of Korea. School of Chemical and Biological Engineering Institute of Bioengineering Institute of Chemical Processes Seoul National University 1 Gwanak-ro, Gwanak-gu, Seoul 08826, Republic of Korea. E-mail addresses: [email protected] (B.-S. Kim), [email protected] (S.-G. Cho). 1 These authors contributed equally to this study.

modeling, drug screening, and stem cell therapies for the treatment of health problems arising from injury, illnesses, or aging [1,2]. When Yamanaka and colleagues originally generated pluripotent stem cells from differentiated cells, induction of the pluripotent stem cells was caused by forced expression of four transcription factors, namely Oct4, Sox2, c-Myc, and Klf4 (OSCK or Yamanaka factors) via retroviral vectors [2,3]. Following this, considerable improvements were made in the development of novel strategies for delivery of the reprogramming transcriptional factors without genetic integration of foreign genetic material into the host genome. Such non-integrating vectors [4,5], which are based on plasmids [6,7] and episomal DNA [8], have been successfully designed to express the transcriptional factors required for the creation of iPSCs. We also originally developed a nonviral magnetic-nanoparticle-based technology for iPSC generation [9]. However, utilization of viral vectors or any other DNA-based gene delivery system gives rise to serious problems with the therapeutic applications because of the risks of insertional mutagenesis, tumorigenesis, and continued expression of potentially oncogenic proteins by the integrated transgenes [10–12]. Generation of iPSCs free of exogenous DNA by means of RNA viruses such as Sendai virus, synthetic proteins, or

http://dx.doi.org/10.1016/j.jconrel.2016.06.007 0168-3659/© 2016 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

H.Y. Choi et al. / Journal of Controlled Release 235 (2016) 222–235

chemicals has been pursued to overcome the above problems [13,14], but there are still concerns about safety and efficiency [13–18]. Transfection of mRNA may be an alternative and a better strategy for preparation of footprint-free (exogenous-DNA-free and integrationfree) iPSCs. The major limiting factor of nonviral gene delivery systems is the efficient cytosolic diffusion and the nuclear entry of the plasmid DNA (pDNA) [19,20], but unlike pDNA, mRNA does not require delivery into the cell nucleus as translation occurs in the cytosol [19,21]. Moreover, mRNA does not integrate into the genomic DNA [19,22]. Although other studies already demonstrated the generation of iPSCs via mRNA transfer [23–26], the mRNA transfer did not use a delivery vehicle and thus such mRNA transduction systems required repetitive daily transfection due to mRNA degradation. Graphene oxide (GO), a derivative of graphene, recently received considerable attention in relation to its biological applications because GO has advantages such as facile synthesis, high water dispersibility, good colloidal stability, easily tunable surface functionalization, and good biocompatibility [27,28]. Functionalized GO can be utilized in drug and gene delivery systems [29,30]; in particular, polyethylenimine (PEI)-conjugated GO was successfully used as a DNA carrier [30,31]. It

223

was found that negatively charged GO can bind cationic PEI polymers and forms stable GO-PEI complexes, which are highly enriched in positive charges for effective loading of pDNA [32]. Furthermore, GO-PEI may protect mRNA from RNase-mediated degradation. Therefore, we hypothesized that GO-PEI can be used for mRNA delivery into cells for iPSC production without repetitive daily transfection. To test this hypothesis, we delivered mRNAs of four reprogramming transcription factors into adipose tissue-derived fibroblasts by means of GO-PEI (Fig. 1). We successfully generated human iPSCs (hiPSCs) using GO-PEI-RNA complexes as the cells showed self-renewal and pluripotent properties. 2. Materials and methods 2.1. Cell culture and flow cytometry HEK 293T cells were cultured at 37 °C in Dulbecco's modified Eagle's medium (DMEM; Gibco-BRL, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS; Hyclone, Logan, UT, USA) and 1% P/ S (100 U/ml penicillin plus 100 μg/ml streptomycin, Gibco-BRL). ADFs were cultured in α-MEM (Gibco-BRL) supplemented with 10% FBS

Fig. 1. A schematic diagram describing the generation of iPSCs by means of graphene oxide (GO)-polyethylenimine (PEI) complex-mediated mRNA delivery into cells. For generation of footprint-free iPSCs, GO-PEI was loaded with the reprogramming RNAs (RNAs for Oct4, Sox2, c-Myc, and Klf4) and the resulting GO-PEI-RNA complexes were incubated with somatic cells. The dynamic suspension culture (continuous shaking at 60 rpm) caused a significant increase in the GO-PEI-RNA complex-mediated reprogramming efficiency.

224

H.Y. Choi et al. / Journal of Controlled Release 235 (2016) 222–235

and 1% P/S. Embryonic fibroblasts (EFs) were cultured in DMEM supplemented with 10% FBS, 1 × nonessential amino acids (Sigma-Aldrich, Saint Louis, MO, USA), and 1% P/S. To prepare feeder cells for culturing iPSCs, EFs were incubated with 10 μg/ml mitomycin C (Sigma-Aldrich) for 1 h. The resulting iPSC-like colonies were maintained on feeder layers of mitomycin C-treated feeder cells in embryonic stem cell medium (DMEM supplemented with 20% FBS, 2 mM L-glutamine (Sigma-Aldrich), 0.1 mM β-mercaptoethanol (Invitrogen, Carlsbad, CA, USA), and leukemia inhibitory factor (LIF, 1000 U/ml; Chemicon, Temecula, CA, USA). For flow cytometric analysis, cells were trypsinized and harvested by centrifugation at 1000 rpm for 10 min. The collected cells were washed once with phosphate-buffered saline (PBS), transferred to 1.5 ml tube, and spun down at 1000 rpm for 5 min. The cells were then resuspended in PBS and analyzed on a FACScan flow cytometer with Cell Quest software (Beckton Dickinson bioscience, Franklin Lakes, NJ, USA). The cells were excited at 488 nm and their emissions were determined between 515 and 545 nm. 2.2. Preparation and characterization of GO-PEI complexes These complexes were prepared as described previously [31]. Briefly, we dispersed GO (Graphene Supermarket, Calverton, NY, USA) into deionized water at 0.1 mg/ml. Then a 25-kDa PEI (Sigma-Aldrich) solution (1 mg/ml) was slowly added to a GO solution in the course of 10 min. After ultrasonication for ~10 min, the mixture was stirred overnight, washed five times with deionized water by means of centrifugation, and then resuspended in DI water. The size distributions of GO and GO-PEI were obtained by dynamic light scattering spectrophotometer (DLS, DLS-7000, Otsuka Electronics, Japan). To determine whether some small GO/PEI complexes might have been removed by the centrifugation, we collected the supernatant and examined if the supernatant contained GO/PEI complexes with DLS. The particle size distribution in the supernatant obtained after centrifugation was compared with that of GO (Supplementary Fig. 1). The analysis indicated that the supernatant did not contain GO-PEI. FT-IR spectra of GO, PEI, and GO-PEI complexes were recorded on an FT/IR-200 instrument (Jasco Inc., Easton, MD, USA) at ambient temperature. The data were collected from 30 scans at 4 cm− 1 resolution. Size and morphology of GO and GO-PEI were evaluated by a tapping mode atomic force microscope (AFM, INNV-BASE, Veeco, Innova, USA). GO and GO-PEI dispersion in distilled water was dropped onto cover glasses and then naturally dried at room temperature. The samples were scanned by AFM and the obtained images were processed by Veeco SPM Lab 7.0 software. The scanning speed was 1.0 Hz. The surface charge of GO and GO-PEI was measured using an electrophoretic light-scattering spectrophotometer (ELS8000, Otsuka Electronics, Osaka, Japan). GO and GO-PEI were also examined by High Resolution-Transmission Electron Microscope (HR-TEM, JEM-3010, JEOL, Japan) analysis. Droplets of GO and GO-PEI dispersion were deposited on 300 mesh Cu grids (TED PELLA Inc., CA, USA) and then dried overnight at room temperature. HR-TEM was operated at 300 kV to get TEM images of each sample.

5% CO2. The cytotoxicity of GO-PEI and viability of GO-PEI-treated hDFs were tested using CCK-8 (Sigma-Aldrich). Briefly, hDFs were seeded in 24-well plates (2 × 104/well). One day later, the medium was changed to the corresponding serum-free medium. The hDFs were then incubated with different doses of GO-PEI (0, 0.6, 3, 6, 12, 30, and 45 μg/ml). After 24 h of incubation, the cells were washed three times with PBS and 1 ml of the serum-containing culture medium was added. After that, 100 μl of CCK-8 solutions was added to each well and the plates were incubated for 3 h at 37 °C. Absorbance at 450 nm (A450) for each well was measured. For the assay of live and dead cells, hDFs were seeded in 24-well plates (1.2 × 104/well). One day later, the medium was changed to the corresponding serum-free medium. The hDFs were then incubated with different doses of GO-PEI for 24 h. After incubation, the cells were washed three times with PBS and the serum-containing culture medium was added. Live and dead cells were detected with fluorescein diacetate (FDA; Sigma-Aldrich) and EtBr, respectively. The cells were incubated with FDA/EtBr (5 μg/ml or 10 μg/ml) solution for 5 min at 37 °C and then washed twice with PBS. The dead cells turned orange due to the nuclear permeability of EtBr. The viable cells, which are capable of converting the non-fluorescent FDA into fluorescein, turned green. After the staining, the stained samples were examined under a fluorescence microscope (Model IX71 Olympus, Tokyo, Japan). Cell viability was calculated as the number of green cells divided by the number of green cells and red cells and expressed as a percentage. For MTT assay, cells (2 × 104/well in 12-wells) were treated with complexes of RNA with GO-PEI, PEI, GO, or Lipofectamine (Invitrogen). After incubation for 24 h, the cells were incubated with an MTT (Sigma-Aldrich) solution at a final concentration of 0.25 mg/ml for 3 h in an incubator. The number of live cells was then estimated by measuring A570 on an ELISA reader (Bio-Rad, Hercules, CA, USA). We used serum-free condition in the cytotoxicity and cell viability assay to avoid destabilization of positively charged GO-PEI complexes by negatively charged serum proteins [33]. As previously described, GO-PEI complexes were stable in saline (0.9% NaCl) as well as serum-free culture medium [31]. 2.5. Analysis of cellular uptake of GO-PEI Cellular uptake of GO-PEI was analyzed by means of GO-PEI stained with DiI dye according to the manufacturer's instructions (Sigma-Aldrich). Briefly, GO-PEI was stained with 30 μg/ml DiI for 2 h, the solution was centrifuged at 10,000g and the supernatant containing any unbound DiI was discarded. The resulting GO-PEI was gently washed twice with distilled water prior to use for endocytosis. For the cellular uptake test, hDFs were seeded in 24-well plates (1.2 × 104/well). The medium was changed the following day to the corresponding serumfree medium. hDFs were then incubated with different doses of GOPEI (0, 3, 12, and 30 μg/ml) for 24 h. GO-PEI-treated hDFs were fixed with 4% (w/v) paraformaldehyde in PBS for 10 min at room temperature. The cells were stained with 4,6-diamidino-2-phenylindole (DAPI; Vector Laboratories, Burlingame, CA, USA) and examined under a fluorescence microscope (Olympus).

2.3. Gel retardation assay 2.6. Extraction of cellular RNAs or preparation of synthetic mRNA by IVT For this assay, we used different N/P ratios in the GO-PEI-RNA complexes. The mixtures of GO-PEI and RNA were incubated on ice for 20 min and the samples were then heated at 65 °C for 10 min. The GO-PEI-RNA complexes were visualized by electrophoresis in 1% (w/ v) agarose gels with ethidium bromide (EtBr; Sigma-Aldrich) staining. 2.4. Cytotoxicity and cell viability assay hDF (Lonza, Walkersville, MD, USA) were cultured in a growth medium consisting of DMEM (Gibco-BRL) supplemented with 10% (v/v) FBS (Gibco-BRL) and 1% P/S at 37 °C, in a humidified incubator with

For extraction of cellular RNAs, HEK 293T cells were incubated overnight at a density of 3 × 106 cells per 100 mm culture dish and were transfected with a pEF vector encoding Oct4, Sox2, Klf4, c-Myc, or GFP. The total RNA or mRNA was isolated from the HEK 293T cells expressing the reprogramming factors and/or GFP using TRIzol Reagent (Invitrogen) and Oligotex mRNA extraction kit (Qiagen, Valencia, CA, USA). The RNA (2 μg) containing mRNA encoding the reprogramming factors was mixed with GO-PEI and transfected into somatic cells. The Oligotex resin (spin column) was used for the enrichment of poly A+ RNA from total RNA.

H.Y. Choi et al. / Journal of Controlled Release 235 (2016) 222–235

For construction of IVT templates, open reading frame (ORF) PCRs were conducted with the template plasmids containing ORFs of human Oct4, Sox2, Klf4, c-MYC, or GFP using Hotstar Taq DNA polymerase (Qiagen). Splint-mediated ligations were performed using Ampligase Thermostable DNA ligase (Epicenter Biotechnologies, Madison, WI, USA). UTR ligations were accompanied in the presence of 100 nM UTR oligos and 100 nM splint oligos, using 5 cycles of the following annealing profile: 95 °C for 20 s; 45 °C for 1 min; 50 °C for 1.5 min; 55 °C for 1 min; 60 °C for 1 min. All PCR and ligation products were purified using QIAquick clean spin columns (Qiagen). Template PCR products were sub-cloned using the pcDNA 3.3-TOPO TA cloning kit (Invitrogen). The oligonucleotide sequences used in the construction of IVT mRNA templates are shown in Table 1. Next, the constructed IVT template plasmids were linearized using the restriction enzyme Xba I which cleaves downstream of the poly (A) sequence. Linearized plasmid that contains an RNA polymerase promoter site was used as template for IVT using the MEGA script T7 kit (Ambion, Austin, TX, USA). According the manufacturers' protocols, the linearized plasmids (2 μg) were treated with RNA polymerase enzyme mixes and incubated for 3–6 h at 37 °C. After incubation, the reaction mixture was treated with DNase for 15 min at 37 °C to remove residual DNA. The synthesized RNA was then purified using ammonium acetate (2.5 M) precipitation. For 5′ capping of RNA, we used ScriptCap m7G Capping System (Cellscript, Madison, WI, USA) and 2″-O-Methyltransferase (Cellscript) to produce cap 1-capped RNA. After capping of the RNA, the poly (A) tail (~ 150 bases) was added using Poly (A) Polymerase (Cellscript). The synthetic IVT RNAs were purified, resuspended in RNase-free water (Gibco-BRL), quantitated by Nanodrop (Thermo Scientific, Waltham, MA, USA), and stored at − 80 °C until further use.

2.7. Analysis of RNA delivery and an RNase protection assay To analyze the degree of RNA delivery into cells, we compared GOPEI, PEI, and Lipofectamine transfection methods using a GFP-mRNA delivery assay. Total RNA or mRNA including GFP-expressing mRNA was isolated from GFP-expressing HEK 293T cells, which were created by transfection of a GFP-encoding plasmid (pEF-GFP). Moreover, the synthetic IVT GFP-mRNA was prepared using MEGAscript T7 kit (Ambion), ScripCap m7G Capping System (Cellscript) and Poly (A) Polymerase (Cellscript). GFP-mRNA (2 μg) was mixed with GO-PEI, PEI, or Lipofectamine and introduced into HEK 293T cells; the GFP-mRNA delivery was analyzed by means of quantitative real-time RT-PCR with GFP-specific primers and using fluorescence microscopy (Eclipse TE-2000-U, Nikon, Tokyo, Japan). To evaluate the stability of GO-PEI-RNA or Lipofectamine-RNA complexes in presence of ribonuclease A (RNase A [Sigma-Aldrich]; 20, 40, 60 μg/ml), the naked RNA, GO-PEI, GO-PEI-RNA and LipofectamineRNA complexes were incubated in the RNase A solution at 37 °C. The

225

RNase protection effect was analyzed using the above-mentioned GFP-mRNA delivery assay. 2.8. Generation of iPSCs by means of delivery of GO-PEI-RNA complexes GO-PEI-RNA complexes were prepared by mixing GO-PEI (30 μg) and RNA (2 μg) in a serum-free cell medium (500 μl) and by keeping the mixture for 20 min on ice. At first, the reprogramming property of the GO-PEI-RNA complexes was analyzed by GFP expression mediated by the Nanog promoter. The GO-PEI-RNA complexes were introduced into the somatic cells containing the Piggy-BAC-Nanog promoter-GFP at a GO-PEI concentration of 3 μg/ml. The Nanog promoter-mediated GFP expression was analyzed using a fluorescence microscope (Olympus) or a FACScan flow cytometer (Becton Dickinson biosciences). The GO-PEI-RNA complexes were incubated with somatic cells in 6-well plates for 48 h at 37 °C and this process was repeated twice every 48 h. The transfected cells were subsequently cultured with or without dynamic suspension culture (shaking at 60 rpm) for four days. The cells were incubated further and starting on day 7, the cells were passaged onto feeder cells and cultured in ES cell culture medium containing LIF. The medium was refreshed every day until iPSC colonies appeared. The colonies were mechanically picked for isolation of cell clones. 2.9. Quantitative real-time reverse transcription-polymerase chain reaction analysis Total RNA was purified using the TRIzol reagent (Invitrogen) and 5 μg of total RNA was used for a reverse-transcription reaction with SuperScript II (Invitrogen) and an oligo-dT primer, according to the manufacturer's protocols. PCR primers were designed in the Primer3 software and were used to amplify the fragments of the genes of interest (approximately 150–250 bp). Quantitative real-time PCR was carried out using the Fast SYBR Green Master Mix (Applied Biosystems, Stockholm, Sweden). Quantitative gene expression data were normalized to the expression level of the housekeeping gene GAPDH. Quantitative real-time PCR conditions were optimized to utilize the linear amplification range. Primer sequences are presented in Table 2. 2.10. Alkaline phosphatase (AP) activity assay and staining AP staining was performed using the Alkaline Phosphatase Staining Kit (Sigma-Aldrich) according to the manufacturer's instructions. Briefly, cells were fixed and permeabilized with an acetone/formalin/citric acid fixative followed by staining with naphthol/fast red violet (FRV) alkaline solution. Cytochemical images were acquired using a microscope (Olympus). The AP activity assay was performed using the StemTAG AP Activity Assay Kit (Cell Biolabs, San Diego, CA, USA), according to the manufacturers' protocol. Briefly, cells were washed with cold PBS and lysed in cell lysis buffer. After 10 min incubation, the lysate was spun down

Table 1 The oligonucleotide sequences used in the construction of IVT mRNA templates. Genes ORF primers GFP Human Oct4 Human Sox2 Human c-Myc Human Klf4 Splint oligos GFP Human Oct4 Human Sox2 Human c-Myc Human Klf4 UTR oligos 5′UTR 3′UTR

Forward primer

Reverse primer

GTGAGCAAGGGCGAGGAGCTGTT TTACTTGTACAGCTCGTCCATGCCGAGA GCGGGACACCTGGCTTCGGATTTC TCAGTTTGAATGCATGGGAGAGCCCAGA TACAACATGATGGAGACGGAGCTGAAGC TCACATGTGTGAGAGGGGCAGTGTG CCCCTCAACGTTAGCTTCACCAACAGG TTACGCACAAGAGTTCCGTAGCTGTTCA GCTGTCAGCGACGCGCTGCTC TTAAAAATGCCTCTTCATGTGTAAGGCGAGGT TCCTCGCCCTTGCTCACCATGGTGGCTCTTATATTTCTTCTT CCCGCAGAAGGCAGCTTACTTGTACAGCTCGTCCATGC AAGCCAGGTGTCCCGCCATGGTGGCTCTTAGATTTCTTCTT CCCGCAGAAGGCAGCTCAGTTTGAATGCATGGGAG CTCCGTCTCCATCATGTTGTACATGGTGGCTCTTATATTTCTTCTT CCCGCAGAAGGCAGCTCACATGTGTGAGAGGGGC GTGAAGCTAACGTTGAGGGGCATGGTGGCTCTTATATTTCTTCTT CCCGCAGAAGGCAGCTTACGCACAAGAGTTCCGTAG GCGCGTCGCTGACAGCCATGGTGGCTCTTATATTTCTTCTT CCCGCAGAAGGCAGCTTAAAAATGCCTCTTCATGTGTAA TTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATG GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAGTGAGGGTCTAGAA CTAGTGTCGACGC

226

H.Y. Choi et al. / Journal of Controlled Release 235 (2016) 222–235

Table 2 Primer sequences for markers of stem cell pluripotency, germ layer differentiation, and innate immune response.

Pluripotency markers

Germ layer differentiation markers

Innate immune response genes

Genes

Forward primer

Reverse primer

Human Nanog Human TERT Human SSEA4 Human Lin28A Human Rex1 Human PECAM Human SCL Human DESMIN Human PDX1 Human SOX7 Human AFP Human NCAM Human TH Human Nestin RIG-1 IFN-alpha IFN-beta Human GAPDH Rat GAPDH

AAGACAAGGTCCCGGTCAAG CCTGCTCAAGCTGACTCGACACCGTG TGGACGGGCACAACTTCATC CTGGTGGAGTATTCTGTATTGGGAGTG CAGATCCTAAACAGCTCGCAGAAT TCTATGACCTCGCCCTCCACAAA ATGAGATGGAGATTACTGATG GAAGCTGCTGGAGGGAGAG CCCATGGATGAAGTCTACC ACGCCGAGCTCAGCAAGAT GAATGCTGCAAACTGACCACGCTGGAAC GCCAGGAGACAGAAACGAAG CGGGCTTCTCGGACCAGGTGTA GGCGCACCTCAAGATCTCC GTTGTCCCCATGCTGTTCTT ACCCACAGCCTGGATAACAG CATTACCTGAAGGCCAAGGA AGCCTCAAGATCAGCAATG CTTCATTGACCTCAACTAC

CAGGCATCCCTGGTGGTAG GGAAAAGCTGGCCCTGGGGTGGAGC GGGCAGGTTCTTGGCACTCT GAGCAGGGTAGGGCTGTGGATTT GCGTACGCAAATTAAAGTCCAGA GAACGGTGTCTTCAGGTTGGTATTTCA GCCCCGTTCACATTCTGCT ATGGACCTCAGAACCCCTTT GTCCTCCTCCTTTTTCCAC TCCACGTACGGCCTCTTCTG TGGCATTCAAGAGGGTTTTCAGTCTGGA GGTGTTGGAAATGCTCTGGT CTCCTCGGCGGTGTACTCCACA CTTGGGGTCCTGAAAGCTGA GCAAGTCTTACATGGCAGCA ACTGGTTGCCATCAAACTCC CAGCATCTGCTGGTTGAAGA ATGGACTGTGGTCATGAGTCCTT GGAAGGCCATGCCAGTGAGC

and the supernatant was transferred to a new tube. After measurement of the protein concentration using the Bradford Protein Assay Reagent (Bio-Rad), 50 μl of each cell lysate was transferred to a 96-well plate in triplicate and mixed with 50 μl of the AP substrate. After 20 min incubation at 37 °C, the reaction was stopped by adding the stop solution while placing the plate on an orbital shaker (Dae Han Science, Seoul, Korea) for 30 s to ensure thorough mixing. The activity was determined by measuring A405 and was normalized to the amount of the total protein in the reaction. 2.11. Immunocytochemical analysis Cells were fixed with 4% paraformaldehyde for 20 min at room temperature. The cells were washed with PBS and incubated with PBS containing 10% normal goat serum and 0.1% Triton X-100 for 35 min at room temperature. The primary antibodies included antibodies against OCT4 (polyclonal, 1:300, Santa Cruz Biotechnology, Dallas, TX, USA), BRACHURY (monoclonal, 1:500, Santa Cruz Biotechnology), NESTIN (monoclonal, 1:500, Santa Cruz Biotechnology), and ALPHAFETOPROTEIN (monoclonal, 1:200, Santa Cruz Biotechnology). For detection of the primary antibodies, fluorescently labeled (Alexa Fluor 488 or 568; Molecular Probes, Eugene, OR, USA) secondary antibodies were used according to the specifications of the manufacturer. The cells were mounted with Vectashield containing DAPI and were analyzed under a fluorescence microscope (Olympus). 2.12. In vitro differentiation of iPSCs For differentiation of hiPSCs, we prepared EBs on non-tissue-culture plates in DMEM/F12 containing 20% knockout serum replacement (KSR, Invitrogen), 2 mM glutamine, 1 × nonessential amino acids, 1 × 2mercaptoethanol (Invitrogen), and 0.5% antibiotics (Gibco-BRL). The medium was changed every other day. Five days later, EBs were transferred to gelatin-laminin-coated culture dishes in DMEM/F12 containing 20% knockout serum replacement (KSR; Invitrogen), 100 ng/ml BMP4 (R&D Systems, Minneapolis, MN, USA), 1 μM all-trans retinoic acid (RA; Sigma-Aldrich), 2 mM glutamine, 1 × nonessential amino acids, 1 × 2-mercaptoethanol, and 0.5% antibiotics. The differentiated cells were harvested for RNA isolation after 15 days. 2.13. Bisulfite genomic sequencing Genomic DNA was isolated using the DNeasy Tissue Kit (Qiagen). Bisulfite treatment was performed using the EpiTect Kit (Qiagen) following the manufacturer's instructions. The bisulfite-treated DNA was

amplified using primers designed for methylation PCR (http://www. urogene.org//methprimer/index.html) of either human Nanog: the forward primer, 5′-TGG TTA GGT TGG TTT TAA ATT TTT G-3′; reverse primer, 5′-AAC CCA CCC TTA TAA ATT ACTCAAT TA-3′. The resulting amplicons were gel purified, subcloned into a T vector (Promega, Fitchburg, WI, USA) and sequenced. 2.14. Statistical analysis The quantitative data were expressed as mean ± standard deviation (SD). We conducted analysis of variance (ANOVA) using the Bonferroni test. A p value b 0.05 was assumed to denote statistical significance. 3. Results 3.1. Characterization of GO-PEI and GO-PEI-RNA complexes Previously, it was reported that there is no interaction between GO and double-stranded DNA [34]. Therefore, it was necessary to modify GO for loading of pDNA to ensure efficient gene delivery [30]. PEI is known as the golden standard of a cationic polymer [35] for gene transfection because of its strong binding capacity to nucleic acids, effective uptake by cells, and excellent proton sponge effect for the endosomal release of DNA [36] or RNA [37]. We functionalized GO with PEI for mRNA delivery into cells (Fig. 1). The oxygen-containing functional groups such as carboxyl, epoxy, hydroxyl, and carbonyl groups on GO sheet have a strong negative charge [38], which ensures strong binding to PEI due to electrostatic forces [31,39]. After positively charged PEI binds to GO, negatively charged mRNA can bind to the PEI in the GO-PEI complexes. AFM images showed that the sizes of GO and GO-PEI particles were not significantly different, but GO-PEI particles were approximately much thicker than GO (Fig. 2A). AFM images showed that the GO sheets may not be single layer. Size distributions of GO and GO-PEI obtained by DLS (mean diameter 158.6 ± 46.8 nm and 205.5 ± 65.9 nm, respectively; Fig. 2B) supported the AFM result. TEM analysis revealed that GO had a smooth surface and the surface smoothness was changed by the functionalization of GO with PEI (Fig. 2C). In Fourier-transform infrared (FT-IR) analysis, both GO and GO-PEI showed three peaks at 3200– 3500 cm−1, 1665–1760 cm−1, and 1000–1320 cm−1 (top and bottom, Fig. 2D). Each peak at 3200–3500 cm−1, 1665–1760 cm−1, and 1000– 1320 cm−1 demonstrated that GO-PEI possessed O\\H, C_O, and C\\O groups as GO did. PEI and GO-PEI also commonly had five peaks at 3250–3400 cm−1, 2850–3000 cm−1, 1020–1250 cm−1, 665–910 cm−1, and 720–725 cm−1(middle and bottom, Fig. 2D). Two peaks at 2850– 3000 cm−1 and 720–725 cm−1 indicated C\\H vibrations, and the

H.Y. Choi et al. / Journal of Controlled Release 235 (2016) 222–235

227

Fig. 2. Characterization of the graphene oxide (GO)-polyethylenimine (PEI) complex. (A) AFM images of GO and GO-PEI complex. Scale bars: 200 nm. (B) Size distributions of GO and GOPEI obtained by DLS analysis. (C) TEM images of GO and the GO-PEI complex. Scale bar: 50 nm. (D) FT-IR spectra of GO (top), PEI (middle), and GO-PEI complex (bottom). (E) Measurement of the zeta-potential of GO and the GO-PEI complex.

peaks at 3250–3400 cm−1 and 665–910 cm−1 denoted the N\\H vibration. The peak at 1020–1250 cm−1 meant C\\N vibration in the PEI grafting in GO-PEI [31]. The surface charge of GO and GO-PEI was analyzed using an electrophoretic light scattering spectrophotometer. The zeta-potential of GO was −34.66 ± 1.02 mV, whereas that of GO-PEI was +26.68 ± 1.22 mV (Fig. 2E). This result demonstrated that negatively charged GO was changed to a positively charged substance because of PEI binding. Furthermore, the data suggested that RNA, which has a negative charge, could bind to GO-PEI via electrostatic interactions. To determine whether RNA was successfully loaded on the GO-PEI complexes, a gel electrophoresis assay was carried out after incubation of RNA with GO-PEI at different N/P ratios (molar ratios of the amine groups of cationic polymers to phosphate groups of DNA or RNA). The GO-PEI-RNA complex showed significant electrophoretic retardation at an N/P ratio of 30 and 60 (Fig. 3A). Next, cytotoxicity of GO-PEI to human dermal fibroblasts (hDFs) was analyzed. The cytotoxicity of GOPEI was measured using FDA/EtBr staining or the cell counting kit (CCK)-8 assay instead of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay as GO caused spontaneous reduction of MTT and produced a false positive signal [40]. There was no significant difference between GO-PEI-untreated (0 μg) and GO-PEI-treated (0.6, 3, 6, 12,

30 or 45 μg/mL) hDFs in FDA/EtBr staining or the CCK-8 assay (Fig. 3B and C). Moreover, the cell viability assay showed that GO-PEI-treated hDFs were viable after 24 or 48 h. To analyze the uptake of GO-PEI by hDFs, GO-PEI was labeled with the red fluorescence dye, 1,1′dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate (DiI) prior to incubation with the cells. Different amounts of DiI-labeled GOPEI (0, 3, and 12 μg/mL) were added to hDFs for incubation and fluorescence microscopic examination confirmed that the DiI-labeled GO-PEI was taken up by the hDFs (red staining, Fig. 3D). GO/PEI was located mainly in the cell cytoplasm rather than nucleus, although some GO/PEI was located within the nucleus. In addition, the TEM image confirmed the intracellular delivery of the GO-PEI-RNA complexes (Fig. 3E). 3.2. GO-PEI-RNA complex-mediated delivery of mRNA To assess the effectiveness of RNA delivery into the cells, we compared the GO-PEI, and Lipofectamine transfection methods by means of a GFP-mRNA delivery assay. For this purpose, we either extracted the cellular GFP-mRNAs (total RNA or mRNA containing GFP-mRNA) from cells expressing the reprogramming factors (OSCK) or prepared synthetic in vitro transcription (IVT) GFP-mRNA. We could observe

228

H.Y. Choi et al. / Journal of Controlled Release 235 (2016) 222–235

Fig. 3. Uptake of GO-PEI into HDFs. (A) A gel retardation assay of complexes of GO-PEI and mRNA at various N/P ratios (0, 15, 30, and 60) (B) Cytotoxicity of GO-PEI at various concentrations, as evaluated in culture of hDFs. hDFs were stained with FDA and EtBr. The green and orange-red colors indicate viable and dead cells, respectively. Scale bar: 100 μm. (C) The graph shows viability of hDFs incubated with GO-PEI at various concentrations for 24 h, as evaluated by the CCK-8 assay. *p b 0.05 versus 0 μg/ml. (D) Ratio of internalization of GO-PEI into hDFs. Fluorescent images of DiI-labeled GO-PEI (red) within hDFs (after treatment with GO-PEI at various concentrations for 4 h) are shown. The nuclei were stained with DAPI (blue). Scale bars: 100 μm. (E) TEM images of control (no GO-PEI) and GO-PEI- introduced cells (GO-PEI concentration in the cell culture; 30 μg/ml). The right images of each group are enlarged images of white squares. Scale bars represent 2 μm (8000×) and 500 nm (25,000×). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

GFP expression from all the cellular GFP-RNAs as well as the synthetic IVT GFP-mRNA. The GFP-expressing RNA was mixed with GO-PEI or Lipofectamine and the respective complexes were introduced into human embryonic kidney (HEK) 293T cells. We detected GFP expression in GOPEI-RNA (GFP-total RNA, mRNA, IVT mRNA)- or Lipofectamine-RNA (GFP-total RNA, mRNA, IVT mRNA)-treated cells (Fig. 4A). However, cell viability did not observe any significant decrease after incubation with either GO-PEI-RNAs- or Lipofectamine-RNAs-complexes (Fig. 4B). Moreover, introduction of GO-PEI-RNAs into cells did not stimulate the expression of innate immune response genes (e.g., RIG, IFN-alpha, and IFN-beta) (Fig. 4C), although the Lipofectamine-mediated delivery of the exogenous single-stranded RNA (ssRNA) led to a significant increase in the expression of these genes. We also investigated the delivery of

GFP-RNAs into the cell using GO alone or PEI alone, for comparison with GO-PEI. Compared to the high transfection efficiency with GO-PEI-RNAs (about 50%), GO alone (about 20%) or PEI alone (about 20%) revealed significantly lower transfection efficiency (Fig. 4A). Although introduction of GO-PEI-RNAs into cells did not induce apparent cytotoxicity or innate immune response genes expression, treatment of PEI, PEI-RNA, GO, or GORNA led to significant decrease in cell viability and apparent increase in the expression of innate immune response genes (Fig. 4B–C). To assess the stability of GO-PEI-RNA or Lipofectamine-RNA complexes after RNase treatment, naked RNA, GO-PEI-RNA, or Lipofectamine-RNA were incubated with RNase A at 37 °C (Fig. 5A). Regardless of whether the GO-PEI-RNA complex was treated with RNase A after the complex formation, the GFP RNA was successfully delivered

H.Y. Choi et al. / Journal of Controlled Release 235 (2016) 222–235

229

Fig. 4. Comparison of Lipofectamine-RNA or graphene oxide (GO)-PEI-RNA complexes in terms of their transfection efficiency and stability. (A) The percentage of GFP-expressing HEK 293T cells was determined using flow cytometry after transfection with RNAs (GFP-total RNA, GFP-mRNA, or GFP-IVT mRNA), Lipofectamine, GO-PEI, PEI, GO, Lipofectamine-RNAs, GO-PEI-RNAs, PEI-RNA, or GO-RNA complexes for 24 h. (B) Transfected HEK 293T cells incubated for 24 h and cell viability was analyzed; *p b 0.01 compared to control cells. (C) Quantitative real-time RT-PCR analysis of expression of endogenous genes-markers of innate immune response genes. Expression of these genes was analyzed for HEK 293T and the established cell clones of human or rat ADFs. The housekeeping gene Gapdh was used as a loading control; *p b 0.05.

into the cells leading to GFP expression in the GO-PEI-RNA-transfected cells (Fig. 5B and C). Nonetheless, co-treatment with RNase A during the formation of the GO-PEI-RNA complex resulted in a dosedependent loss of the effectiveness of GFP-mRNA delivery. We also observed that the GO-PEI-RNA-transfected cells showed a strong expression of GFP just after 4 h post transfection and maintained this high GFP expression for more than 72 h post-transfection (Fig. 5D).

3.3. Generation of GO-PEI-RNA-iPSCs from adipose tissue-derived fibroblasts by means of GO-PEI-RNA-mediated RNA delivery To generate GO-PEI-RNA-iPSCs (G/RNA-iPSCs) using RNA-based nanofection, we extracted the cellular reprogramming RNAs (total RNA or mRNA) from cells expressing the OSCK or prepared synthetic IVT mRNA encoding OSCK. We applied various culture conditions and

230

H.Y. Choi et al. / Journal of Controlled Release 235 (2016) 222–235

Fig. 5. The GO-PEI-RNA complexes effectively protected RNA. (A) Schematic diagram describing the co- or post-treatment of RNases with GO-PEI-mRNA complexes into cells. The percentage of GFP-expressing HEK 293T cells was determined using flow cytometry (B) and graph (C) after transfection. Cells were incubated with 40 μg/ml RNase A (for Lipofectamine-RNA) or various doses of RNase A (20, 40, or 60 μg/ml) (for GO-PEI-RNA) for 24 h either concurrently with (“Co”) or after the transfection (“Post”). (D) Time course of the percentage of GFP-expressing HEK 293T cells according to flow cytometry after transfection of the GO-PEI-RNA complexes. *p b 0.05.

found that the dynamic suspension culture (continuous shaking at 60 rpm) caused a significant increase in the expression of GFP treated with the GO-PEI-RNA complexes (Fig. 6A and B). GO-PEI was loaded with the reprogramming RNAs and the GO-PEI-RNA complexes were incubated with several types of somatic cells containing the PiggyBAC-Nanog promoter-GFP (Fig. 6C). We incubated the somatic fibroblasts with the GO-PEI-RNA complexes three times at 48 h intervals.

We observed the reprogramming property of the GO-PEI-RNA complexes by analyzing the expression of the Nanog promoter-mediated GFP (Fig. 6D). Moreover, we obtained the iPSC-like colonies from human adipose tissue-derived fibroblasts (hADFs), rat ADFs (rADFs), and mouse embryonic fibroblasts (MEFs) (Fig. 6E). Furthermore, we found that the dynamic suspension culture affected a significant increase in the reprogramming efficiency of the cells treated with the

H.Y. Choi et al. / Journal of Controlled Release 235 (2016) 222–235

231

Fig. 6. Reprogramming of somatic cells into iPSCs using GO-PEI-mediated RNA delivery. (A) A schematic diagram of the procedure for different culture methods (static adherent or dynamic suspension culture) during GO-PEI-GFP-RNA delivery into the somatic cells. (B) FACs analysis of the GFP expression after GO-PEI-mediated delivery of the GFP-RNAs into the somatic cells containing the GFP expression plasmid. (C) A schematic diagram of the procedure for preparation of iPSCs by GO-PEI-mediated RNA delivery into the somatic cells including hADFs or rADFs. (D) FACs analysis of the Nanog promoter-mediated GFP expression after GO-PEI-mediated delivery of the reprogramming RNAs into the somatic cells containing the Piggy-BAC-Nanog promoter-GFP. (E) Bright-field images of the iPSC-like colonies from hADFs, rADFs or MEFs (day 15). (F) Biochemical assessment of alkaline phosphatase activity in various cell clones; *p b 0.05. (G) Reprogramming efficiency was calculated as the number of generated iPSC colonies divided by the number of starting cells.

232

H.Y. Choi et al. / Journal of Controlled Release 235 (2016) 222–235

GO-PEI-RNA complexes (Fig. 6F). During the continuous dynamic suspension culture, GO-PEI-RNA complexes were treated three times at 48 h intervals and then at day 10 post cell seeding, we transferred the suspending cells to a new dish containing feeder cells. The transferred cells were incubated with ES cell medium, which was changed on a daily basis. Colonies with ES cell-like morphological features were observed about three days (for rADF) or eight days (for hADF) after transfer onto feeder cells. The reprogramming efficiency of MEFs or hADFs was 0.04% and 0.03%, respectively (Fig. 6G). In particular, we achieved high reprogramming efficiency (0.12%) with rADFs. The colonies were picked about 14 days (for hADF) after transfer onto the feeder cells; each colony was then transferred separately to an individual gelatincoated dish (Fig. 7A). To establish iPS cell lines, the transferred cells were incubated with ES cell medium and passaged for up to 3 weeks. We next examined the pluripotent properties of the G/RNA-iPSC clones generated from human ADFs. Immunocytochemical analysis revealed that both G/RNA-hiPSCs was positive for Oct4 expression (Fig. 7B) in comparison to control hADFs (data not shown). Furthermore, we analyzed the expression of endogenous pluripotency marker genes in G/RNA-hiPSCs clones. The stemness marker genes, SSEA-4, Lin28A, Rex1, Nanog, and TRA 1-60, were well expressed in G/RNAhiPSCs (Fig. 7C) but not in control hADFs. Reprogramming into iPSCs is accompanied with demethylation of promoters of critical pluripotency genes [41,42]. Therefore, we tried to assess the degree of epigenetic reprogramming by analyzing the methylation patterns of the promoter region of a key pluripotency gene, Nanog. We performed bisulfite sequencing of a 299-bp large region (for hiPSCs) [41] of the Nanog promoter, which contains eight (for hiPSCs) CpG sites [2,43]. Although CpG sites of ADFs were methylated, none or only one CpG site was methylated in G/RNA-hiPSCs (Fig. 7D),

demonstrating that the pluripotent potential of the G/RNA-hiPSCs were similar to that of ES cell lines. 3.4. Differentiation properties of the G/RNA-iPSCs To evaluate pluripotency and differentiation properties of the G/ RNA-iPSCs, embryoid bodies (EBs) from the G/RNA-iPSC clones were prepared and allowed to attach to gelatin-coated dishes. After culturing for 15 days (for hiPSCs), we tested whether the G/RNA-iPSCs could differentiate into the three germ layers. Quantitative real-time RT-PCR analysis revealed that differentiated cells derived from G/RNA-iPSCs showed significant expression of specific genes of the three germ layers. These include mesodermal genes (PECAM, SCL, and DESMIN for hiPSC), endodermal (PDX1, SOX7, and AFP for hiPSC), and ectodermal genes (NCAM, TH and Nestin for hiPSC) (Fig. 8A). We also confirmed the expression of the three germ layer markers, namely NESTIN (ectoderm), BRACHYRY (mesoderm), and ALPHA-FETOPROTEIN (endoderm) by immunocytochemical analysis (Fig. 8B), demonstrating pluripotency of our G/RNA-hiPSCs. 4. Discussion iPSCs were originally generated from differentiated cells via forced expression of the Yamanaka factors using retroviral vectors [2,3]. Thus, these cells were expected to serve not only as powerful tools for research and drug discovery but also as material for personalized regenerative therapies and for combatting immune rejection [44]. A recent report revealed that isogenic human nuclear-transfer embryonic stem cell (NT-ESC) lines and iPSCs (that were derived from the same somatic cells) show similar profiles of gene expression and DNA methylation

Fig. 7. GO-PEI-RNA-mediated generation of iPSCs (G/RNA-iPSCs) from ADFs. (A) Upper panel; a schematic diagram of the procedure for the preparation of hiPSCs by means of GO-PEImediated RNA delivery into hADFs. Lower panel; bright-field images of G/RNA-hiPSCs derived from hADFs; the former formed early iPSC-like colonies (day 18 for hiPSCs), and mature iPSC clones appeared after mechanical picking (day 24 for hiPSCs). (B) Immunocytochemical analysis OCT4 expression in G/RNA-hiPSCs. The nuclei were stained with TOPRO-3. Scale bar: 50 μm. (C) Quantitative real-time RT-PCR analysis of the expression of endogenous pluripotency markers. Expression of the stemness markers such as SSEA-4, Lin28A, Rex1, Nanog, or TRA 1-60, was analyzed in hADFs. The housekeeping gene Gapdh was used as a loading control; *p b 0.05. (D) Bisulfite genomic sequencing of human Nanog promoter region. Open and closed circles indicate unmethylated and methylated CpG dinucleotides, respectively. Three representative sequenced subclones from hADFs and from the above-mentioned iPSC clones are shown.

H.Y. Choi et al. / Journal of Controlled Release 235 (2016) 222–235

233

Fig. 8. In vitro differentiation of GO-PEI-RNA-iPSCs into the three germ layers. (A) Quantitative real-time RT-PCR analyses of differentiation markers of the three germ layers in G/RNAhiPSCs. The housekeeping gene Gapdh was used as a loading control; *p b 0.05. (B) In vitro differentiation potentials of the GO-PEI-RNA-iPSC clones from hADFs was analyzed according to the expression of protein markers of each of the three germ layers (endoderm: ALPHA-FETOPROTEIN, mesoderm: BRACHYURY, ectoderm: NESTIN, all shown in red) using immunocytochemistry. The insets show higher magnification. Scale bars: 50 μm.

[45], thereby providing evidence that the two reprogramming methods result in highly similar cell types. These NT-ESCs and iPSCs closely resemble each other judging by their global transcriptional and DNA methylation signatures, and display a comparable incidence of de novo coding mutations and imprinting aberrations. These findings suggest that both genetic and epigenetic defects in NT-ESCs and iPSCs are inherent during the reprogramming of human somatic cells into pluripotent cells. Although both technologies could be used for a personalized stem cell therapy, the iPSC technology, which does not require oocytes, may have advantages over the somatic cell nuclear transfer (SCNT) technology, which needs oocytes for acquisition of pluripotency. Although techniques for preparation of iPSCs are continually evolving in laboratories, significant hurdles remain for the successful production of clinically safe iPSCs [46]. The retrovirus- or lentivirus-based iPSC production procedures show high reprogramming efficiency but have hampered therapeutic applications of iPSCs due to the concerns about insertional mutagenesis, tumorigenesis, and continued expression of potentially oncogenic proteins by the integrated transgenes [11,25]. Adenoviral or other DNA-based vectors were also developed to generate iPSCs from mouse [47] and human [48] somatic cells [17]. These vectors allow for the transient expression of exogenous genes, but this DNA-based iPSC production procedure can cause integration of the foreign DNA into the host genome at a low frequency. The above problems are important when considering clinical use: the uncontrolled expression of transgenes may have harmful effects during complete reprogramming into pluripotent iPSCs. Quite recently, in a series of five related studies, various researchers tried to clearly demonstrate that the persistent expression of the Yamanaka factors can lead to the

formation of F-class iPSCs [49,50] showing fuzzy borders of colonies whose pluripotent state [50,51] is different from that of conventional iPSCs [49–54]. Substantial efforts have been made to develop protocols for the production of integration-free iPSCs more rapidly, safely, and efficiently [25]. However, to date, the reprogramming efficiency of the integration-free methods, such as episomal plasmid- or protein-based [52] technologies, has been relatively low. Proteins have also been used to generate DNA-free iPSCs [55,56], but the difficulties with production of safe cell-penetrating reprogramming proteins as well as poor reprogramming efficiency have restricted the applicability of the protein-based technology in iPSC production [56]. Low reprogramming efficiency is also an obstacle for the general use of chemical-based technology in iPSC production [14,17,18]. Currently, the Sendai virus is popular as a non-integrating reprogramming vector [16,57]. The Sendai virus replicates in the form of single-stranded RNA [53] in the cytoplasm of the infected cells and thus DNA is neither produced nor integrated into the host genome during transfection with such a vector. Although Sendai virus-based reprogramming results in the formation of iPSCs with high efficiency, the cost of the Sendai virus-based iPSC technology remains high [16,24]. Procedures for the direct delivery of synthetic mRNA or microRNA into cells have also been developed as a safe reprogramming strategy and the synthetic RNA-based method for iPSC production can be optimized to achieve high reprogramming efficiency [26,58]. However, the synthetic RNA needs to be synthesized by IVT and several labor-intensive procedures, such as modification of nucleotides, phosphatase treatment, and supplementation with the interferon inhibitor B18R, which are all needed for improvement of cell

234

H.Y. Choi et al. / Journal of Controlled Release 235 (2016) 222–235

viability. Moreover, this method has additional disadvantages, including the necessity of daily transfection of the exogenous synthetic mRNA, high cost, and the need for large amounts of skilled labor. Therefore, a simpler and less expensive RNA-based technology for iPSC production needs to be developed because such a technology may have several advantages including the speed of colony appearance, high efficiency, and the complete absence of genomic integration of foreign DNA. Protein corona might reduce the cytotoxicity of GO-PEI. Proteins bind to the surface of nanoparticles and form biological coating around the nanoparticles, which is known as the protein corona. Our data indicated that zeta-potential of GO-PEI was +26.68 ± 1.22 mV (Fig. 2D). The negative charge of GO was changed to a positive charge of GO-PEI after PEI binding to GO, which enables negatively charged protein coating around GO-PEI. PEI can enhance protein corona formation. Previously it was reported that protein coating on GO reduced the cytotoxicity of GO [59]. Our data showed that GO-PEI did not show cytotoxicity at certain concentrations (Fig. 3B and C). Therefore, protein corona induced by PEI may decrease the cytotoxicity of GO-PEI. In addition, previous studies showed that cytotoxic and genotoxic effects of GO sheets are size dependent [60–62]. GO sheets with 50–200 nm size could minimize the cytotoxicity and genotoxic effects of GO [60]. Although GO sheets with size of 3.8 ± 0.4 μm were cytotoxic only at concentration higher than 100 μg/ml, GO sheets with size of 11 ± 4 nm were cytotoxic even at a low concentration of 1 μg/ml and genotoxic at 0.1 μg/ml [61, 62]. The size of GO-PEI (205.5 ± 65.9 nm) used in this study may minimize the cytotoxicity. Here, we developed a simple RNA-based technology of iPSC production that enables efficient reprogramming of somatic cells into pluripotent cells without using expensive synthetic RNA. Combinations of negatively charged GO and cationic PEI polymers decrease cytotoxicity, and the GO-PEI complex is still rich in positive charges for successful loading of RNA, which is easily isolated from cells. According to our results, the RNA in the GO-PEI-RNA complex shows high resistance to RNase A leading to a slow turnover of mRNA, which obviates daily transfection procedures. This RNA delivery technology for the GO-PEI-RNAmediated generation of iPSCs absolutely excludes the risk of genomic integration and insertional mutagenesis inherent in all DNA-based techniques. This kind of RNA-mediated iPSC technology may be necessary to inexpensively generate safe transgene- and integration-free iPSCs. We hope that this approach will be developed into a general iPSC production protocol that conforms to clinical requirements. 5. Conclusion Production of safe iPSCs holds great promise for the development of regenerative therapies. We utilized GO-PEI complexes for efficient RNA delivery into adipose tissue-derived fibroblasts and successfully developed a simple RNA-based technology of iPSC production. We found that the dynamic suspension culture significantly increases the reprogramming efficiency of cells treated with GO-PEI-RNA complexes. We efficiently produced iPSCs from human or rat adipose tissue-derived fibroblasts. The GO-PEI-RNA-iPSCs show ESC-like properties, including expression of pluripotency genes and proper colony shape, differentiation potentials, and methylation pattern. The GO-PEI-mediated RNAbased technology of iPSC production may be useful for the preparation of clinically safe and economically feasible iPSCs. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.jconrel.2016.06.007. Acknowledgments This work was supported by grants (NRF-2013M3A9D3045880, NRF2014-029716, NRF-2014M3A9E5073757 and no. 2015R1A5A1009701) from the National Research Foundation of Korea, by a grant (HI15C3029) from the Korea Health Industry Development Institute (KHIDI), Ministry of Health and Welfare, and by a grant (no. 312062-

05) from the Bio-industry Technology Development Program, Ministry of Agriculture, Food and Rural Affairs, Republic of Korea.

References [1] J. Yu, M.A. Vodyanik, K. Smuga-Otto, J. Antosiewicz-Bourget, J.L. Frane, S. Tian, J. Nie, G.A. Jonsdottir, V. Ruotti, R. Stewart, I.I. Slukvin, J.A. Thomson, Induced pluripotent stem cell lines derived from human somatic cells, Science 318 (2007) (1917-1920). [2] K. Takahashi, K. Tanabe, M. Ohnuki, M. Narita, T. Ichisaka, K. Tomoda, S. Yamanaka, Induction of pluripotent stem cells from adult human fibroblasts by defined factors, Cell 131 (2007) 861–872. [3] K. Takahashi, S. Yamanaka, Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors, Cell 126 (2006) 663–676. [4] J. Yu, K. Hu, K. Smuga-Otto, S. Tian, R. Stewart, I.I. Slukvin, J.A. Thomson, Human induced pluripotent stem cells free of vector and transgene sequences, Science 324 (2009) 797–801. [5] R. Zulliger, S.M. Conley, M.I. Naash, Non-viral therapeutic approaches to ocular diseases: an overview and future directions, J. Control. Release 219 (2015) 471–487. [6] K. Okita, M. Nakagawa, H. Hyenjong, T. Ichisaka, S. Yamanaka, Generation of mouse induced pluripotent stem cells without viral vectors, Science 322 (2008) 949–953. [7] K.L. Veiman, K. Kunnapuu, T. Lehto, K. Kiisholts, K. Parn, U. Langel, K. Kurrikoff, PEG shielded MMP sensitive CPPs for efficient and tumor specific gene delivery in vivo, J. Control. Release 209 (2015) 238–247. [8] F. Jia, K.D. Wilson, N. Sun, D.M. Gupta, M. Huang, Z. Li, N.J. Panetta, Z.Y. Chen, R.C. Robbins, M.A. Kay, M.T. Longaker, J.C. Wu, A nonviral minicircle vector for deriving human iPS cells, Nat. Methods 7 (2010) 197–199. [9] C.H. Lee, J.H. Kim, H.J. Lee, K. Jeon, H. Lim, H. Choi, E.R. Lee, S.H. Park, J.Y. Park, S. Hong, S. Kim, S.G. Cho, The generation of iPS cells using non-viral magnetic nanoparticle based transfection, Biomaterials 32 (2011) 6683–6691. [10] K. Okita, T. Ichisaka, S. Yamanaka, Generation of germline-competent induced pluripotent stem cells, Nature 448 (2007) 313–317. [11] N. Sun, M.T. Longaker, J.C. Wu, Human iPS cell-based therapy: considerations before clinical applications, Cell Cycle 9 (2010) 880–885. [12] K. Hong, Cellular reprogramming and its application in regenerative medicine, Tissue Eng. Regener. Med. 12 (2014) 80–89. [13] T. Merdan, J. Kopecek, T. Kissel, Prospects for cationic polymers in gene and oligonucleotide therapy against cancer, Adv. Drug Deliv. Rev. 54 (2002) 715–758. [14] B.C. Heng, M. Fussenegger, Integration-free reprogramming of human somatic cells to induced pluripotent stem cells (iPSCs) without viral vectors, recombinant DNA, and genetic modification, Methods Mol. Biol. 1151 (2014) 75–94. [15] D.A. Robinton, G.Q. Daley, The promise of induced pluripotent stem cells in research and therapy, Nature 481 (2012) 295–305. [16] H. Ban, N. Nishishita, N. Fusaki, T. Tabata, K. Saeki, M. Shikamura, N. Takada, M. Inoue, M. Hasegawa, S. Kawamata, S. Nishikawa, Efficient generation of transgenefree human induced pluripotent stem cells (iPSCs) by temperature-sensitive Sendai virus vectors, Proc. Natl. Acad. Sci. U. S. A. 108 (2011) 14234–14239. [17] Y.Y. Zhou, F. Zeng, Integration-free methods for generating induced pluripotent stem cells, Genomics Proteomics Bioinformatics 11 (2013) 284–287. [18] X.Y. Deng, H.U. Wang, T. Wang, X.T. Fang, L.L. Zou, Z.Y. Li, C.B. Liu, Non-viral methods for generating integration-free, induced pluripotent stem cells, Curr. Stem Cell Res. Ther. 10 (2015) 153–158. [19] M. Mockey, C. Goncalves, F.P. Dupuy, F.M. Lemoine, C. Pichon, P. Midoux, mRNA transfection of dendritic cells: synergistic effect of ARCA mRNA capping with Poly(A) chains in cis and in trans for a high protein expression level, Biochem. Biophys. Res. Commun. 340 (2006) 1062–1068. [20] S.T. Crowley, K.G. Rice, Evolving nanoparticle gene delivery vectors for the liver: what has been learned in 30 years, J. Control. Release 219 (2015) 457–470. [21] S.L., A.L. Parker, Targeting of polyelectrolyte RNA complexes to cell surface integrins as an efficient cytoplasmic transfection mechanism, J. Bioact. Compat. Polym. 17 (2002) 229–238. [22] V.F. Van Tendeloo, P. Ponsaerts, Z.N. Berneman, mRNA-based gene transfer as a tool for gene and cell therapy, Curr. Opin. Mol. Ther. 9 (2007) 423–431. [23] L. Warren, Y. Ni, J. Wang, X. Guo, Feeder-free derivation of human induced pluripotent stem cells with messenger RNA, Sci. Rep. 2 (2012) 657. [24] N. Yoshioka, E. Gros, H.R. Li, S. Kumar, D.C. Deacon, C. Maron, A.R. Muotri, N.C. Chi, X.D. Fu, B.D. Yu, S.F. Dowdy, Efficient generation of human iPSCs by a synthetic self-replicative RNA, Cell Stem Cell 13 (2013) 246–254. [25] A. Mehta, V. Verma, M. Nandihalli, C.J. Ramachandra, G.L. Sequiera, Y. Sudibyo, Y. Chung, W. Sun, W. Shim, A systemic evaluation of cardiac differentiation from mRNA reprogrammed human induced pluripotent stem cells, PLoS One 9 (2014), e103485. [26] L. Warren, P.D. Manos, T. Ahfeldt, Y.H. Loh, H. Li, F. Lau, W. Ebina, P.K. Mandal, Z.D. Smith, A. Meissner, G.Q. Daley, A.S. Brack, J.J. Collins, C. Cowan, T.M. Schlaeger, D.J. Rossi, Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA, Cell Stem Cell 7 (2010) 618–630. [27] Y. Wang, Z. Li, J. Wang, J. Li, Y. Lin, Graphene and graphene oxide: biofunctionalization and applications in biotechnology, Trends Biotechnol. 29 (2011) 205–212. [28] S. Goenka, V. Sant, S. Sant, Graphene-based nanomaterials for drug delivery and tissue engineering, J. Control. Release 173 (2014) 75–88. [29] L. Zhang, J. Xia, Q. Zhao, L. Liu, Z. Zhang, Functional graphene oxide as a nanocarrier for controlled loading and targeted delivery of mixed anticancer drugs, Small 6 (2010) 537–544.

H.Y. Choi et al. / Journal of Controlled Release 235 (2016) 222–235 [30] H. Kim, R. Namgung, K. Singha, I.K. Oh, W.J. Kim, Graphene oxide-polyethylenimine nanoconstruct as a gene delivery vector and bioimaging tool, Bioconjug. Chem. 22 (2011) 2558–2567. [31] L. Feng, S. Zhang, Z. Liu, Graphene based gene transfection, Nanoscale 3 (2011) 1252–1257. [32] J.L. Xia Hong, M. Wang, J. Xu, W. Guo, J. Li, Y. Bai, T. Li, Fabrication of magnetic luminescent nanocomposites by a layer-by-layer self-assembly approach, Chem. Mater. 16 (2004) 4022–4027. [33] X. Gao, K.S. Kim, D. Liu, Nonviral gene delivery: what we know and what is next, AAPS J. 9 (2007) E92–104. [34] Z. Tang, H. Wu, J.R. Cort, G.W. Buchko, Y. Zhang, Y. Shao, I.A. Aksay, J. Liu, Y. Lin, Constraint of DNA on functionalized graphene improves its biostability and specificity, Small 6 (2010) 1205–1209. [35] D. Fischer, T. Bieber, Y. Li, H.P. Elsasser, T. Kissel, A novel non-viral vector for DNA delivery based on low molecular weight, branched polyethylenimine: effect of molecular weight on transfection efficiency and cytotoxicity, Pharm. Res. 16 (1999) 1273–1279. [36] D. Putnam, C.A. Gentry, D.W. Pack, R. Langer, Polymer-based gene delivery with low cytotoxicity by a unique balance of side-chain termini, Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 1200–1205. [37] S. Hobel, I. Koburger, M. John, F. Czubayko, P. Hadwiger, H.P. Vornlocher, A. Aigner, Polyethylenimine/small interfering RNA-mediated knockdown of vascular endothelial growth factor in vivo exerts anti-tumor effects synergistically with Bevacizumab, J. Gene Med. 12 (2010) 287–300. [38] M.-j. Li, C.-m. Liu, Y.-b. Xie, H.-b. Cao, H. Zhao, Y. Zhang, The evolution of surface charge on graphene oxide during the reduction and its application in electroanalysis, Carbon 66 (2014) 302–311. [39] S. Tenzer, D. Docter, J. Kuharev, A. Musyanovych, V. Fetz, R. Hecht, F. Schlenk, D. Fischer, K. Kiouptsi, C. Reinhardt, K. Landfester, H. Schild, M. Maskos, S.K. Knauer, R.H. Stauber, Rapid formation of plasma protein corona critically affects nanoparticle pathophysiology, Nat. Nanotechnol. 8 (2013) 772–781. [40] K.H. Liao, Y.S. Lin, C.W. Macosko, C.L. Haynes, Cytotoxicity of graphene oxide and graphene in human erythrocytes and skin fibroblasts, ACS Appl. Mater. Interfaces 3 (2011) 2607–2615. [41] C. Merkl, A. Saalfrank, N. Riesen, R. Kuhn, A. Pertek, S. Eser, M.S. Hardt, A. Kind, D. Saur, W. Wurst, A. Iglesias, A. Schnieke, Efficient generation of rat induced pluripotent stem cells using a non-viral inducible vector, PLoS One 8 (2013), e55170. [42] M.Y. Chang, D. Kim, C.H. Kim, H.C. Kang, E. Yang, J.I. Moon, S. Ko, J. Park, K.S. Park, K.A. Lee, D.Y. Hwang, Y. Chung, R. Lanza, K.S. Kim, Direct reprogramming of rat neural precursor cells and fibroblasts into pluripotent stem cells, PLoS One 5 (2010), e9838. [43] J. Liao, C. Cui, S. Chen, J. Ren, J. Chen, Y. Gao, H. Li, N. Jia, L. Cheng, H. Xiao, L. Xiao, Generation of induced pluripotent stem cell lines from adult rat cells, Cell Stem Cell 4 (2009) 11–15. [44] M. Song, S. Paul, H. Lim, A.A. Dayem, S.G. Cho, Induced pluripotent stem cell research: a revolutionary approach to face the challenges in drug screening, Arch. Pharm. Res. 35 (2012) 245–260. [45] B. Johannesson, I. Sagi, A. Gore, D. Paull, M. Yamada, T. Golan-Lev, Z. Li, C. LeDuc, Y. Shen, S. Stern, N. Xu, H. Ma, E. Kang, S. Mitalipov, M.V. Sauer, K. Zhang, N. Benvenisty, D. Egli, Comparable frequencies of coding mutations and loss of imprinting in human pluripotent cells derived by nuclear transfer and defined factors, Cell Stem Cell 15 (2014) 634–642. [46] M. Silva, L. Daheron, H. Hurley, K. Bure, R. Barker, A.J. Carr, D. Williams, H.W. Kim, A. French, P.J. Coffey, J.J. Cooper-White, B. Reeve, M. Rao, E.Y. Snyder, K.S. Ng, B.E. Mead, J.A. Smith, J.M. Karp, D.A. Brindley, I. Wall, Generating iPSCs: translating cell reprogramming science into scalable and robust biomanufacturing strategies, Cell Stem Cell 16 (2015) 13–17.

235

[47] M. Stadtfeld, M. Nagaya, J. Utikal, G. Weir, K. Hochedlinger, Induced pluripotent stem cells generated without viral integration, Science 322 (2008) 945–949. [48] W. Zhou, C.R. Freed, Adenoviral gene delivery can reprogram human fibroblasts to induced pluripotent stem cells, Stem Cells 27 (2009) 2667–2674. [49] S.E. Vidal, M. Stadtfeld, E. Apostolou, F-class cells: new routes and destinations for induced pluripotency, Cell Stem Cell 16 (2015) 9–10. [50] D.S. Lee, J.Y. Shin, P.D. Tonge, M.C. Puri, S. Lee, H. Park, W.C. Lee, S.M. Hussein, T. Bleazard, J.Y. Yun, J. Kim, M. Li, N. Cloonan, D. Wood, J.L. Clancy, R. Mosbergen, J.H. Yi, K.S. Yang, H. Kim, H. Rhee, C.A. Wells, T. Preiss, S.M. Grimmond, I.M. Rogers, A. Nagy, J.S. Seo, An epigenomic roadmap to induced pluripotency reveals DNA methylation as a reprogramming modulator, Nat. Commun. 5 (2014) 5619. [51] P.D. Tonge, A.J. Corso, C. Monetti, S.M. Hussein, M.C. Puri, I.P. Michael, M. Li, D.S. Lee, J.C. Mar, N. Cloonan, D.L. Wood, M.E. Gauthier, O. Korn, J.L. Clancy, T. Preiss, S.M. Grimmond, J.Y. Shin, J.S. Seo, C.A. Wells, I.M. Rogers, A. Nagy, Divergent reprogramming routes lead to alternative stem-cell states, Nature 516 (2014) 192–197. [52] M. Benevento, P.D. Tonge, M.C. Puri, S.M. Hussein, N. Cloonan, D.L. Wood, S.M. Grimmond, A. Nagy, J. Munoz, A.J. Heck, Proteome adaptation in cell reprogramming proceeds via distinct transcriptional networks, Nat. Commun. 5 (2014) 5613. [53] J.L. Clancy, H.R. Patel, S.M. Hussein, P.D. Tonge, N. Cloonan, A.J. Corso, M. Li, D.S. Lee, J.Y. Shin, J.J. Wong, C.G. Bailey, M. Benevento, J. Munoz, A. Chuah, D. Wood, J.E. Rasko, A.J. Heck, S.M. Grimmond, I.M. Rogers, J.S. Seo, C.A. Wells, M.C. Puri, A. Nagy, T. Preiss, Small RNA changes en route to distinct cellular states of induced pluripotency, Nat. Commun. 5 (2014) 5522. [54] S.M. Hussein, M.C. Puri, P.D. Tonge, M. Benevento, A.J. Corso, J.L. Clancy, R. Mosbergen, M. Li, D.S. Lee, N. Cloonan, D.L. Wood, J. Munoz, R. Middleton, O. Korn, H.R. Patel, C.A. White, J.Y. Shin, M.E. Gauthier, K.A. Le Cao, J.I. Kim, J.C. Mar, N. Shakiba, W. Ritchie, J.E. Rasko, S.M. Grimmond, P.W. Zandstra, C.A. Wells, T. Preiss, J.S. Seo, A.J. Heck, I.M. Rogers, A. Nagy, Genome-wide characterization of the routes to pluripotency, Nature 516 (2014) 198–206. [55] H. Zhou, S. Wu, J.Y. Joo, S. Zhu, D.W. Han, T. Lin, S. Trauger, G. Bien, S. Yao, Y. Zhu, G. Siuzdak, H.R. Scholer, L. Duan, S. Ding, Generation of induced pluripotent stem cells using recombinant proteins, Cell Stem Cell 4 (2009) 381–384. [56] D. Kim, C.H. Kim, J.I. Moon, Y.G. Chung, M.Y. Chang, B.S. Han, S. Ko, E. Yang, K.Y. Cha, R. Lanza, K.S. Kim, Generation of human induced pluripotent stem cells by direct delivery of reprogramming proteins, Cell Stem Cell 4 (2009) 472–476. [57] N. Fusaki, H. Ban, A. Nishiyama, K. Saeki, M. Hasegawa, Efficient induction of transgene-free human pluripotent stem cells using a vector based on Sendai virus, an RNA virus that does not integrate into the host genome, Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 85 (2009) 348–362. [58] D. Subramanyam, S. Lamouille, R.L. Judson, J.Y. Liu, N. Bucay, R. Derynck, R. Blelloch, Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cells, Nat. Biotechnol. 29 (2011) 443–448. [59] Y. Chong, C. Ge, Z. Yang, J.A. Garate, Z. Gu, J.K. Weber, J. Liu, R. Zhou, Reduced cytotoxicity of graphene nanosheets mediated by blood-protein coating, ACS Nano 9 (2015) 5713–5724. [60] E. Hashemi, O. Akhavan, M. Shamsara, S. Valimehr, R. Rahighi, DNA and RNA extractions from eukaryotic and prokaryotic cells by graphene nanoplatelets, RSC Adv. 4 (2014) 60720–60728. [61] O. Akhavan, E. Ghaderi, A. Akhavan, Size-dependent genotoxicity of graphene nanoplatelets in human stem cells, Biomaterials 33 (2012) 8017–8025. [62] S. Abdolhosseinzadeh, H. Asgharzadeh, H. Seop Kim, Fast and fully-scalable synthesis of reduced graphene oxide, Sci. Rep. 5 (2015) 10160.