EHD3: A Protein That Resides in Recycling ... - Wiley Online Library

Download PDF
10 downloads 3536 Views 1MB Size Report
Comment
a nuclear export signal in EHD3. The effect of ..... (http://expasy.hcuge.ch/tools.html). Multiple .... Photoshop software (Mountain View, CA, USA). Two-hybrid ...
Traffic 2002; 3: 575–589 Blackwell Munksgaard

Copyright C Blackwell Munksgaard 2002 ISSN 1398-9219

EHD3: A Protein That Resides in Recycling Tubular and Vesicular Membrane Structures and Interacts with EHD1 Emilia Galperin, Sigi Benjamin, Debora Rapaport, Rinat Rotem-Yehudar, Sandra Tolchinsky and Mia Horowitz* Department of Cell Research and Immunology, Tel-Aviv University, Ramat-Aviv, Israel 69978 * Corresponding author: Mia Horowitz, [email protected]

Here we report the characterization of an eps15 homology (EH) domain containing protein designated EHD3. EHD3 was mapped to human chromosome 2p22–23, while the murine Ehd3 homolog was mapped to chromosome 17p21. Both the human and the mouse genes contain a polymorphic (CA) repeat in their 3ƒUTR. One 3.6-kb Ehd3 transcript was mainly detected in adult mouse brain and kidney and at day 7 of mouse development. On the other hand, human tissues exhibited two, 4.2- and 3.6-kb, EHD3 RNA species. They were predominantly expressed in heart, brain, placenta, liver, kidney and ovary. EHD3, expressed as a green fluorescent fusion protein was localized to endocytic vesicles and to microtubule-dependent, membrane tubules. There was a clear colocalization of EHD3-positive structures and transferrincontaining recycling vesicles, implying that EHD3 resides within the endocytic recycling compartment. Shuffling the N-terminal domain of EHD1 (previously shown to reside in the transferrin-containing, endocytic recycling compartment) with that of EHD3 resulted in a chimeric EHD protein that was localized mainly to tubules instead of the endocytic vesicles, implicating the N-terminal domain as responsible for the tubular localization of EHD3. Mutant EHD3 forms, missing the N-terminal or the C-terminal domains, lost their tubular localization. Results of two-hybrid analyses indicated that EHD1 and EHD3 interact with each other. In addition, EHD1 and EHD3 could be coimmunoprecipitated from cellular extracts, confirming the interaction implied by two-hybrid analysis. Moreover, coexpression of EHD1 and EHD3 resulted in their colocalization in microtubule-dependent tubules as well as in punctate forms. Based on its specific intracellular localization and its interaction with EHD1, we postulate that EHD3 localizes on endocytic tubular and vesicular structures and regulates their microtubule-dependent movement. Key words: EHD protein, EH domain, endocytosis, microtubule-dependent membrane tubules

Received 17 September 2001, revised and accepted for publication 8 May 2002 Endocytosis is a complex process characterized by a diversity of protein–protein interactions, which are mediated via distinct structural modules (1). The best-defined endocytic process is the clathrin-coated vesicle pathway, which has gained attention in recent years. The cytoplasmic tail of membranal receptors associates with a heterotetrameric adaptor protein complex, dubbed, adaptor protein complex (AP)-2 (1). AP-2 recruits and polymerizes clathrin and other accessory proteins, including dynamin, amphiphysin and eps15 homology (EH) domain-containing proteins, in a cascade that leads to the formation of clathrin-coated vesicles. The clathrin-coated vesicles reach the early endosomes, where many ligand–receptor complexes dissociate. Some receptors undergo recycling to the plasma membrane through recycling compartments, while others are directed to lysosomes or proteosomes for degradation (2,3). Early endosomes first migrate on microtubule tracts towards late endosomes before reaching the perinuclear cytoplasm. It was also suggested that microtubule-based vesicle transport might facilitate the movement of membrane-bound components from the plasma membrane to early endosomes (4). Some proteins participating in endocytosis and/or intracellular trafficking contain an EH domain, first identified in Eps15 – an epidermal growth factor receptor (EGFR) phosphorylated substrate (5–7). Eps15 contains three structural domains: (a) An N-terminal region with three EH domains, directing protein–protein interactions through the amino acids Asn-Pro-Phe (NPF) of target proteins (8). The EHdomain spans ⬃100 amino acids, 50% of which are conserved among different proteins that harbor this domain (9). (b) A central region containing heptad repeats characterizing coiled-coil structures, which enable dimerization and oligomerization (10). (c) The C-terminus has prolinerich regions and Asp-Pro-Phe (DPF) motifs that enable the protein to interact with the a-adaptin subunit of the AP-2 complex (11). The EH domain-containing protein family [for review see (12)] also includes Eps15R, yeast pan1P, Intersectin, Reps1, g-synergin (13–15) and EHD1–EHD4 (16,17). EHD1 was localized to endocytic recycling, transferrin-containing vesicles and contains an EH domain and a coiled-coil module, shared by Eps15 (16,18,19). Furthermore, the protein is expressed in tissues and cell types that are stimulated by insulin-like 575

Galperin et al. Table 1: Homology (in percentage) between different EHDs and the mouse Ehd3, at the cDNA (upper panel) and the protein level (lower panel)

Ehd3 mouse EHD3 mouse

EHD1 human

Ehd1 mouse

PAST1 Drosophila

RME1 Caenorhabditis elegans

EHD Plasmodium

78 85

80 85

64 56

66 67

53 45

Accession numbers for the different cDNAs are as follows: EHD1 – AF099011; mEhd1 – AF099186; mEhd3 – AF155883; C. elegans RME1 – AF357876; Drosophila PAST-1 – U70135; Plasmodium falciparum – AAC98707.

growth factor-1 (IGF-1) signals, and is found in complexes with IGF-1 receptor. Therefore, we suggested a role for EHD1 in IGF-1 receptor endocytosis (20). EHD1 (also designated RME1) was shown to regulate the distribution and function

of the endocytic-recycling compartment in Caenorhabditis elegans and mammalian cells. Expression of a dominant negative EHD1, containing a point mutation near the EH domain, resulted in redistribution of the endocytic recycling

Figure 1: Schematic illustration of the mouse and human EHD3 genes. (A) Structure of EHD3 genes in comparison to EHD1. The initiation and stop codons are depicted. The boxes represent exons. The numbers underneath the exons and some introns indicate their size in bp. Arrows represent primers used for PCR analysis. Hatched bar, CA-repeat; dotted bar, MIR element. (B) Mapping of mouse Ehd3 gene was performed as described in Materials and Methods. The illustration includes loci mapped on chromosome 17, adjacent to the mEhd3 locus. Human EHD3 was mapped using the GeneBridge4 somatic cell hybrid panel. ESTs, other known genes, and the distances were determined from the GeneMap98 (http://www.ncbi.nlm.nih.gov/genemap/). The illustration includes loci mapped on human chromosome 2, adjacent to the EHD3 locus.

576

Traffic 2002; 3: 575–589

EHD3 Resides in the Recycling Compartment

Figure 2: Multiple sequence alignment of several EHD proteins. Amino acid homology between human EHD1 (hEHD1), mouse Ehd1 (mEHD1), human EHD3 (hEHD3), mouse Ehd3 (mEHD3), Caenorhabditis elegans RME1 (CelegRME1), Drosophila PAST1 (PAST1), and Plasmodium falciparum EHD (PLASMODIUM) is shown. Identical amino acids are shaded with black, similar – with gray. The accession numbers are as described in Table 1.

compartment and slowed down transferrin receptor recycling in mammalian cells (19). In this work, we describe EHD3, another member of the EHD Traffic 2002; 3: 575–589

family. We followed the expression pattern of the gene and the intracellular localization of the corresponding protein. Our findings suggest the intriguing possibility that EHD3 localizes to endocytic recycling structures and directs their motility. 577

Galperin et al.

Results Characterization of mouse and human EHD3 Comparison of the mEhd1 genomic sequence to several genomic clones we had isolated, revealed the existence of a related homolog. Database analysis yielded an overlapping expressed sequence tag (EST) (AI643156). A PCR fragment corresponding to this EST was amplified from mouse genomic DNA and used to clone a mouse homolog from a mouse fetal brain cDNA library. This cDNA, designated mEhd2 (AF155883), consisted of a 1.6-kb open reading frame (ORF), 370 bp of 5ƒUTR and about 1.8 kb of 3ƒUTR, and had 57% overall homology to mouse Ehd1 and 80% identity – within the ORF. However, the sequence of the human homolog was published as EHD3 (17). We therefore adopted the HUGO nomenclature committee designation Ehd3 for the mouse sequence. Table 1 summarizes the

homology between mouse Ehd3 and different EHD cDNAs and proteins. Using an EHD3 genomic sequence that existed in a BAC (AL 121657.1), we amplified a 370-bp fragment from its 3ƒUTR and used it as a probe to clone the human EHD3 cDNA from a human fetal brain cDNA library. The EHD3 genes are comprised of six exons (Figure 1A), while the EHD1 genes contain only 5 exons (21). Both EHD3 genes contain a CA-repeat and an MIR (mammalian-wide interspersed repeat) element within their last exon (Figure 1A). Both the mouse and the human (CA) repeats were found to be polymorphic. Four alleles were identified in mice, containing 21, 22, 24 and 28 (CA) repeats, and four different alleles were evident in humans, whose sizes represented 16, 17, 18 and 19 (CA) repeats (data not shown). Using PCR amplification of the CA-repeat from two mouse parental strains and back-cross DNA samples, the mEhd3 gene was mapped to chromosome 17p21, 0.53 CM distal to D17Bir12 on the Jackson Laboratory map, near the markers D17Bir12, D12Xrf234 and D17Bir13 (Figure 1B). This places mEhd3 in a region of conserved synteny between mouse chromosome 17p21 and human chromosome 2. Human EHD3 was mapped by amplifying DNA from GeneBridge4 somatic cell hybrids panel to chromosome 2p22–p23, 2.22 cR from marker D2S352 and 3.36 cR from CHLC.GATA8F07.440, between markers D2S352 and WI-9798 (Figure 1B). The predicted mouse and human EHD3 proteins are 535 amino acids in length (Figure 2). The proteins consist of three regions: (a) An N-terminal domain which contains three conserved sequence elements specifying GTP binding proteins: a P-loop, extending from amino acid 65–72 (GXXXXGKS/T in general and in EHD3: GQYSTGKT); an N/TKXD motif, spanning amino acids 279–282 (NKAD in EHD3) and DXXG between amino acids 153–156 (DTPG in EHD3) (22). GTP binding proteins participate in a variety of processes, including transport processes. (b) A central region spanning amino acids 200–400 that has a predicted structure of coiled-coil a-helices. (c) A C-terminal region contains a single EH motif. Like the EHD1 proteins, the EHD3 proteins contain a nuclear localization signal between amino acids 315–332.

Figure 3: Expression pattern of EHD3. RNA, extracted from several mouse organs, electrophoresed through a formaldehyde-agarose gel and blotted (A) or a Northern blot (Clontech) containing RNA extracted from mouse embryos at different ages (the numbers represent days of embryonic development) (B) were hybridized with a 32P-labeled 3ƒUTR mEhd3 cDNA as a probe. The blot in (A) was washed and rehybridized with rRNA cDNA as a probe, to quantify the amounts of loaded material. The results indicated that comparable amounts of RNA were loaded in the different lanes (not shown). From the migration pattern of the 28S and 18S rRNA, it was obvious that the bands in the different lanes represent the same EHD3 RNA species. (C) Northern blots containing RNA extracted from different human tissues were hybridized with a 32Plabeled 3ƒUTR EHD3 cDNA as a probe. Sk. muscle, skeletal muscle.

578

RNA expression Northern blot analysis on mouse tissues revealed one 3.6 kb RNA species in mouse brain and kidney (Figure 3A). During mouse development, the expression of Ehd3 was prominent at day 7, while low expression was noted at days 11–17 (Figure 3B). These results indicate that Ehd3 is highly regulated during mouse embryonic development. On the other hand, human tissues exhibited two, 4.2 and 3.6 kb, EHD3 RNA species. They were predominantly expressed in heart, brain, placenta, liver, kidney and ovary. Low expression was observed in lung, skeletal muscle, prostate, testis, colon and leukocytes. The 4.2-kb EHD3 RNA was hardly evident in brain and heart (Figure 3C). Overall, EHD3 expression in Traffic 2002; 3: 575–589

EHD3 Resides in the Recycling Compartment

mouse and human was low compared to that of EHD1 (data not shown). Cellular localization of EHD3 The low mEhd3 levels, evident in the RNA expression profile (see Figure 3A), made it impossible to follow the intracellular localization of endogenous Ehd3. We therefore adopted fluorescence microscopy on cell lines, transfected with a plasmid expressing GFP-EHD3 fusion protein, in order to study EHD3 intracellular localization. In 80–100% of transfected HeLa cells, EHD3 was localized to a network of tubules dispersed throughout the cytoplasm (Figure 4A) and to punctate vesicular structures (Figure 5A). From analysis of 200 cells, it is obvious that there is an equilibrium between the abundance of EHD3-containing tubules and EHD3-containing vesicles. To define the tubular network with which GFP-EHD3 is associated, immunofluorescence microscopy was performed on GFP-EHD3-transfected cells using anti-btubulin antibody. As shown in Figure 4(A–C), EHD3-associated tubular structures coincided only occasionally with microtubules. However, EHD3-associated tubular structures depended on the integrity of the microtubular network. Upon treatment with nocodazole, an agent that disrupts microtu-

bules, most of the GFP-EHD3 was concentrated in large punctate structures (Figure 4D). The same results were obtained after treatment with colchicine, another microtubuledisrupting drug (Figure 4E). These results strongly suggested that the integrity of the EHD3-containing tubular structures is microtubule dependent. Actin labeling of cells expressing GFP-EHD3 did not result in a colocalization of actin with EHD3 (Figure 4F), suggesting that EHD3 is not associated with actin microfilaments. This conclusion was further supported by treatment of EHD3-expressing cells with cytochalasin D. While the actin microfilaments completely dissociated, the treatment had no effect on EHD3 localization (data not shown). In order to test whether the punctate fluorescence corresponds to endocytic vesicles, Texas-Red-conjugated transferrin endocytosis was performed for 12 min. Optical sectioning analysis revealed that the dots of GFP-EHD3 partially colocalized with transferrin, suggesting that GFP-EHD3 localized to endocytic recycling vesicles (Figure 5,A–C). Interestingly, following nocodazole treatment, EHD3-associated tubular structures disappeared and a large fraction of EHD3 colocalized with peripheral, transferrin-containing vesicles (Figure

Figure 4: Intracellular localization of EHD3. CHO cells were transfected with GFP-EHD3 for 48 h. Cells were fixed, reacted with anti-btubulin antibodies, mounted and scanned by confocal microscope. (A) GFP-EHD3 expression (green) (B) b-tubulin fluorescence (red) (C) overlay image. 48 h after transfection, the cells were treated either with 20 mg/ml nocodazole for 1 h at 37 æC (D) or with 10 mM colchicine for 20 h at 37 æC (E). They were then fixed, permeabilized and labeled with anti-b-tubulin antibody (red), mounted and scanned. In (F), TRITCphalloidin, diluted 1: 1000 in PBS was applied for 20 min at RT after fixation. t, tubule; v, vesicle. Scale bars represent 10 mm.

Traffic 2002; 3: 575–589

579

Galperin et al.

580

Traffic 2002; 3: 575–589

EHD3 Resides in the Recycling Compartment Figure 5: Cellular distribution of EHD3. Sixteen hours after transfection of HeLa cells with GFP-EHD3, Texas-Red-conjugated transferrin endocytosis was performed for 12 min. Following extensive washes in PBS, the coverslips were mounted (A–C). Shown are representative confocal microscopic images depicting the cellular distribution of GFP-EHD3 (green, A) and transferrin (red, B). Overlay image depicts colocalization in yellow (C). HeLa cells transfected as above were treated with 20 mg/ml nocodazole for 45 min in a serum free medium, containing 20 mM HEPES and 0.1% BSA. They were then incubated with Texas-Red-labeled transferrin, at 37 æC for 12 min. The cells were washed, fixed and observed using confocal microscopy. Nocodazole-treated GFP-EHD3 is depicted in (D), transferrin is depicted in (E), and (F) represents merged images of GFP-EHD3 and transferrin. Sixteen hours after transfection with GFP-EHD3, HeLa cells, grown on coverslips, were starved for 30 min as described under Materials and Methods. Texas-Red transferrin uptake was performed for 2 min. At the end of the pulse or after different periods of chase, the coverslips were washed with ice-cold PBS and fixed with 3.7% paraformaldehyde, mounted and scanned (G-J). t, tubule; v, vesicle. Scale bars represent 10 mm.

5D–F). These results imply that the membrane tubules and the vesicles represent components of the same compartment, the endocytic recycling compartment. To further explore the possible association of EHD3 with the endosomal, transferrin-containing compartment, a transferrin

pulse-chase experiment was performed. Cells were transfected with GFP-EHD3 and labeled with Texas-Red transferrin for 2 min. At the end of the pulse and at different times of chase, cells were fixed and visualized (Figure 5G–K). After 2min of uptake, which allows transferrin transit through early endosomes (1), there was a partial localization with EHD3 in vesicles (Figure 5G). Following a 10-min chase, transferrin labeling concentrated in vesicular structures, the recycling endosomes (23), exhibiting partial overlap with EHD3 (Figure 5H–I). After 20-min chase, there was already little transferrin labeling inside cells (Figure 5,J), indicating that most of the labeled transferrin was removed from them. Thus, the results presented strongly suggest that the EHD3-containing vesicles and the EHD3 membrane tubules are elements of the recycling compartment. We also tested the necessity of EHD3 domains for its targeting. To that end, we generated several deleted forms of EHD3 conjugated to GFP (Figure 6A). In transiently transfected HeLa cells, GFP-EHD3 displayed typical punctate or tubular structures (Figure 6B), while GFP-EHD3DN was diffusely distributed within the cytoplasm of the cells with some punctate appearance, completely different from the normal counterpart (Figure 6E). GFP-EHD3DC displayed major nuclear localization in addition to a diffuse cytoplasmic distribution (Figure 6H). EHD3, like all other members of the EHD

Figure 6: Intracellular localization of EHD3 mutants and distribution of transferrin. Schematic illustration of EHD3 and EHD3mutated constructs (A). HeLa cells were transiently transfected with GFP-EHD3 (B–D), GFP-EHD3DN (E–G) or GFP-EHD3DC (H–J) plasmids. Twenty-four hours later, cells were incubated with Texas-Red-labeled transferrin, at 37 æC for 12 min The cells were washed, fixed and observed using confocal microscopy. GFP: A, D, G; Transferrin: B, E, H; merge: C, F, I. t, tubule; v, vesicle. Scale bars represent 10 mm.

Traffic 2002; 3: 575–589

581

Galperin et al.

Figure 7: Intracellular localization of chimeric proteins. A scheme illustrating the structure of the chimeric EHD1/EHD3 and EHD3/ EHD1 proteins (A). HeLa cells were transiently transfected with EHD1/EHD3 (B) or EHD3/EHD1 (D). Twenty-four hours later, the cells were incubated with Texas-Red-conjugated transferrin, at 37 æC for 12 min (C) or were treated with 20 mg/ml nocodazole for 1 h at 37 æC (E). The cells were washed, fixed and mounted. Green fluorescence was emitted by GFP, red fluorescence by Texas Red; superimposed images are yellow. Scale bars represent 10 mm.

family, contains a nuclear localization signal (NLS). Despite the existence of the NLS, we have not observed EHD1 or its mutant forms (GFP-EHD1DN or GFP-EHD1DC) (M. Pasmanick-Shore and M. Horowitz, unpublished) or EHD3 in the nucleus. It is plausible that the truncated EHD3, missing the Cterminal domain, became available for the nuclear transport system through its NLS. Computer analysis failed to predict a nuclear export signal in EHD3. The effect of EHD3 mutant proteins expression on transferrin endocytosis was tested as well and quantified by analyzing 10–20 cells overexpressing GFP-fusion protein in each preparation. None of the constructed mutants showed inhibition of transferrin internalization (Figure 6C,F,I). These results indicated that overexpres-

sion of EHD3 mutants does not affect transferrin uptake and clathrin-mediated endocytosis. As mentioned, EHD3 is highly homologous to the previously described EHD1; nonetheless, they have distinct cellular localization. Therefore, it was of interest to determine which domain is responsible for the tubular pattern of EHD3 expression. To that end, the N-terminal domain of EHD3 was coupled to a fragment of EHD1 containing the coiled-coil and the C-terminal domains. The reciprocal chimera was constructed as well (Figure 7A). In HeLa cells transfected with the EHD1/EHD3 plasmid, the chimeric protein localized to transferrin-containing endocytic vesicles (Figure 7B–C),

Figure 8: Interaction between EHD1 and EHD3 proteins and their colocalization. (A–C) EGY48 Yeast strain expressing the construct p8op-lacZ was initially transformed with either pLexA/EHD1 or pLexA/Ehd3 bait plasmids and underwent further transformation with prey constructs expressing pB42AD/EHD1, pB42AD/Ehd3 or pB42AD/Rubisco of tomato. Four isolated colonies from each transformation were seeded on Galactose/Raffinose/Uracyl-/histidine-/tryptophane-/X-gal plate (X-gal), on galactose/raffinose/uracyl-/histidine-/tryptophane-/ leucine-plate (Leu-) and on glucose/uracyl-/histidine-/tryptophane-(Ura-/His-/Trp-). Colonies 1–4: pLexA/EHD1 π pB42AD/EHD1, 5–8: pLexA/EHD1 π pB42AD/Ehd3,9–12:pLexA/Ehd3 π pB42AD/EHD1,13–16: pLexA/Ehd3 π pB42AD/Ehd3,17–20:pLexA/EHD1 π pB42AD/ Rubisco of tomato, 21–24: pLexA/Ehd3 π pB42AD/Rubisco of tomato. Growth on Leu- plates and blue colonies on the X-gal plates indicate protein–protein interaction. CHO cells were cotransfected with HIV gp120 tag-EHD1 (designated tag-EHD1 in the Figure) and GFP-EHD3 (D-F) or GFP-EHD1 and myc-EHD3 (G-I). Twenty-four hours later, cells were fixed in 3.7% paraformaldehyde, permeabilized and interacted with the appropriate antibodies, as explained in Materials and Methods. Green fluorescence was emitted by GFP, red fluorescence by Cy3conjugated second antibodies, and superimposed images are yellow. Scale bars represent 10 mm. (J) Lysates of CHO cells, transfected with either HIV gp120 tag-EHD1, GFP-EHD3 or both, were prepared 48 h after transfection. The lysates were subjected to immunoprecipitation with anti-HIV gp120 tag antibody for 3 h at 4 æC. The precipitates were electrophoresed through SDS-PAGE and blotted onto a nitrocellulose paper. The blot was decorated with EHD1 antibodies. (K) Lysates of CHO cells, transfected with either GFP-EHD1, myc-tag-EHD3 or both, were prepared 48 h after transfection. The lysates were subjected to immunoprecipitation with anti-myc-tag antibody (Cell Signaling Technology) for 3 h at 4 æC. The precipitates were electrophoresed through SDS-PAGE and blotted onto a nitrocellulose paper. The blot was decorated with EHD1 antibodies.

582

Traffic 2002; 3: 575–589

EHD3 Resides in the Recycling Compartment

Traffic 2002; 3: 575–589

583

Galperin et al.

whereas the counterpart chimera (EHD3/EHD1) localized to nocodazole-sensitive tubules (Figure 7D–E). Therefore, not more than the 156, N-terminal, amino acids of EHD3 are responsible for its specific tubular localization.

teins colocalize to the same cellular compartments. Strong FRET signal was observed in either vesicular or tubular structures. The presence of positive FRETc signal demonstrates that EHD1 and EHD3 form a complex in live cells.

Interaction between EHD1 and EHD3 In order to test the possibility of interaction between EHD1 and EHD3, both were cloned into the bait pLexA and the prey pB42AD vectors. Both proteins were tested for their ability to self-dimerize and to interact with each other. The results indicated that each protein is able to self-dimerize and that these two proteins are able to interact with each other to form oligomers (Figure 8A–C). The ability of EHD1 to interact with EHD3 has raised the possibility that these proteins interact with each other to promote specific trafficking processes of recycling structures. To investigate this assumption, cells were cotransfected with EHD1- and EHD3-expressing plasmids. As shown in Figure 8(D–I), EHD1 coupled either to GFP or to an HIV-gp120 epitope tag and EHD3, linked to a myc-tag or as a GFP fusion, respectively, colocalized in tubular as well as large punctate structures.

It is therefore plausible that the interaction between EHD1 and EHD3 is involved in the regulation of microtubule-dependent movement of recycling endocytic vesicles and acquisition of tubular appearance.

To further confirm the interaction between EHD1 and EHD3, coimmunoprecipitation of lysates, prepared from cells cotransfected with EHD1- and EHD3-expressing plasmids, was performed. To that end, CHO cells were cotransfected with either GFP-EHD3 or HIV gp120 tag-EHD1, or both of them together. Cell lysates were immunoprecipitated with anti-HIV gp120 epitope tag-antibody and the corresponding blot was decorated with anti-EHD1 antibodies (Figure 8J). In a parallel experiment, CHO cells were transfected with GFP-EHD1 or myc-tag-EHD3, or both of them together. The cell lysates were immunoprecipitated with anti-myc-tag antibody and the corresponding Western blot was decorated with anti-EHD1 antibodies (Figure 8K). The results indicated that HIV gp120 tag-EHD1 and GFP-EHD3 or GFP-EHD1 and myc-tag-EHD3 were present in the same complexes and therefore coimmunoprecipitated. To demonstrate interactions of EHD1 and EHD3 in living cells, we used the CFP-EHD3 and YFP-EHD1 chimeric proteins and FRET (fluorescence resonance energy transfer) microscopy. Because the energy transfer between CFP and YFP occurs only when the distance between two proteins is less than 5 nm, this technique can be used for detection of direct interaction of proteins. CFP-EHD3 and YFP-EHD1 proteins were transiently expressed in HeLa cells. Western blotting of cell lysates with anti-GFP antibodies detected EHD1 and EHD3 fusion proteins of appropriate molecular mass (Figure 9A). Interaction of CFP-EHD3 and YFP-EHD1 was analyzed utilizing the digital images through YFP, CFP and FRET channels from single cells (Figure 9B). Corrected FRET (FRETc) was calculated for the entire image on a pixel-by-pixel basis using a three-filter FRET method and presented as an intensity-modulated pseudocolor image (Figure 9B). As was shown by immunofluorescence experiments, EHD1 and EHD3 chimeric pro584

Discussion In this study we have identified a novel mouse EH-domaincontaining protein, EHD3, a member of the EH-domain containing protein family. This protein shares 86% and 85% overall homology with mouse and human EHD1 proteins, respectively. EHD3 and EHD1 are highly conserved and have homologs in nematode, Drosophila, Plasmodium, mouse, rat and human (17). Interestingly, the EHD3 gene contains six exons, while EHD1 is composed of five exons (21). Exon one in EHD1 is split into two exons in EHD3. The 3ƒUTR of the mouse and the human EHD3 cDNAs contain a polymorphic (CA) repeat. These polymorphic repeats might be useful tools for assays such as genetic population studies and gene mapping. Northern blot analysis indicated a tissue-specific expression of mEhd3. A 3.6-kb transcript was observed in adult mouse brain and kidney. High mEhd3 expression level was detected at day 7 of embryonic development. This expression is entirely different from that observed for EHD1 (16), although further analysis is required to verify whether the two proteins are mutually expressed in certain cell types. Human tissues exhibited two, 4.2- and 3.6-kb EHD3 RNA species, which were dominantly expressed in heart, brain, placenta, liver, kidney and ovary. Low expression was observed in lung, skeletal muscle, prostate, testis, colon and leukocytes. The 4.2-kb EHD3 RNA was hardly evident in brain and heart. Overall, EHD3 expression in mouse and human was low compared to that of EHD1 (E. Galperin and M. Horowitz, unpublished). The nature of the EHD3 RNA species in human is not clear. It is possible that the difference in expression pattern between mouse and human results from low mEhd3 levels and detection problems. Structurally, both EHD1 and EHD3 contain the same domains. The N-terminal domain harbors a GTP binding site with the sequence G(x)4GKT(x)6I, DxxG and NKxD that is completely conserved in evolution (22). Our data suggest that the N-terminal domain is responsible for the different cellular localization of EHD1 and EHD3. The central part of the two proteins has a coiled-coil structure proposed to participate in the formation of homo- or heterodimers (24). Their C-terminus contains an EH domain, a hallmark of proteins participating in molecular trafficking associated with endocytosis. We have already demonstrated that EHD1 is localized to transferrin-containing endocytic vesicles (16) and in this study, we show that EHD3, as a GFP-fusion protein, is Traffic 2002; 3: 575–589

EHD3 Resides in the Recycling Compartment

Figure 9: Interaction of EHD1 and EHD3. (A) Cells transiently expressing CFP-EHD3, or YFP-EHD1 were lysed, and CFP- or YFP-fusion proteins were detected by Western blotting using anti-GFP antibodies. (B) YFP-EHD1 and CFP-EHD3 were transiently expressed in HeLa cells. YFP, CFP and FRET images were acquired at room temperature. FRETc was calculated as described in (31), and is presented as pseudocolor intensity-modulated image FRETc/YFP. a.l.u.f.i., arbitrary linear units of fluorescence intensity.

Traffic 2002; 3: 575–589

585

Galperin et al.

associated with endocytic vesicles and tubular structures, which are part of the endocytic recycling compartment (ERC). The tubular pattern of localization is dependent on the integrity of microtubules. We could exemplify movement of the GFP-EHD3 tubules and vesicles in living cells (data not shown). It is well known that vesicular trafficking is regulated by two separate but interactive cytoskeletal networks, namely the actin filaments and microtubules. Movement of vesicles along the surface of actin filaments or microtubules depends on association with molecular motors (25). In polarized epithelial cells, microtubules and actin are required for efficient transcytosis and delivery of proteins to late endosomes and lysosomes. Microtubules are also important in apical recycling pathways and, in some polarized cell types, basolateral recycling requires actin (26). EHD3 devoid of its C-terminal, EH domain-containing region, displayed nuclear localization, in contrast to the parallel EHD1 mutant. EHD3, like all other members of the EHD family, contains a NLS between amino acids 315 and 332. Accumulation of the chimeric protein missing the C-terminal domain in the nucleus, highlights the possibility that EHDs shuttle between cytoplasmic compartments and the nucleus. Several endocytic proteins have already been shown to be transported into the nucleus. Epsin, the NPF containing protein, through which it interacts with Eps15, was shown to localize in the nucleus with PLZF (promyelocytic leukemia Zinc finger) protein (27). Eps15 was transiently localized in the nuclei of cells following Leptomycin B treatment and was shown to act as a positive modulator of transcription in a GAL4-based transactivation assay (28). EH-containing proteins that are involved in intracellular trafficking may also be important elements in the import of cytoplasmic proteins into the nucleus, or even in transcription. Results of two-hybrid analysis indicated a strong interaction between EHD1 and EHD3. We have shown that EHD1 and EHD3 were able to form dimers or hetero-oligomers in the two-hybrid assay. We could confirm EHD1–EHD3 interaction by their colocalization in transfected cells and their coimmunoprecipitation. Moreover, FRET results clearly indicated interaction between EHD1 and EHD3 in live cells. Notably, mouse Ehd3 was expressed mainly in mouse kidney and brain. Epithelial kidney cells and brain neurons are established as cells in which endocytic uptake and processing of macromolecules depend on an elaborate vesicle transport machinery. Transcytosis from the basolateral plasma membrane to the apical plasma membrane in epithelial polarized cells is regulated by the cytoskeletal network (25,29). Therefore, it is very tempting to speculate that EHD3 participates in such processes. In summary, we describe a new member of the EHD family, which is a resident of the endocytic recycling compartment. The presented results strongly suggest an interaction between EHD1 and EHD3, which may be involved in regulating the movement of recycling endocytic vesicles along microtu586

bule-dependent tubular tracks. This interaction may also lead to the formation of the tubular structures. Our findings raise the possibility that EHD3 participates in tubular-mediated transport of EHD1-containing recycling endocytic vesicles and highlight the role of the EHD proteins in endocytosis and intracellular trafficking.

Materials and Methods Libraries and screening A mouse fetal brain cDNA library in LambdaZap II vector (Stratagene, USA) and a human fetal brain cDNA library in Chron BS vector were screened with a PCR fragment representing the 3ƒUTR (mouse or human, respectively). Plasmids bearing the mouse cDNA inserts were rescued by helper phage-mediated excision according to the manufacturer’s recommendations. Plasmids bearing the human cDNA inserts were rescued by digestion with NotI and subsequent self-ligation. Probe preparation Probes were prepared by the random priming technique using commercial kits according to the manufacturers’ recommendations. Chromosomal mapping of the mouse or the human gene Genetic mapping of the mouse Ehd3 gene was performed by analysis of 2 multilocus crosses. PCR amplification of a CA-repeat was performed with primers P1 and P2 (Table 2) on genomic DNA from two parental mouse strains: Mus m. domesticus (B) and Mus spretus (S), and the back-cross panel ((B¿S)¿B) and ((B¿S)¿S) obtained from the Jackson Laboratory. The data were sent to the Jackson Laboratory, where linkage analysis was performed. Human EHD3 was localized by radiation hybrid mapping using the GeneBridge4 (Research Genetics, Huntsville, AL, USA) panel of somatic cell hybrids amplified with primers P3 and P4 (Table 2). PCR amplification was performed on a 93-hybrid panel using 20 ng of genomic DNA according to the manufacturer’s recommendations. Data were submitted to the Whitehead Institute/MIT radiation hybrid mapping web site for map placement (http://www-genome.wi.mit.edu/cgi-bin/contig/rhmapper.pl). Computer analysis, databases and Internet sources The analysis of the resulting sequences was performed with numerous computer programs available through several databases in NCBI: GenBank, Swissprot, STS, EST, Alu, PDB, GSS and the ‘Tools’ option of EXPASY (http://expasy.hcuge.ch/tools.html). Multiple sequence alignments between human, mouse, C. elegans, Drosophila melanogaster and Plasmodium falciparum proteins were performed using the CLUSTAL W program (EMBL) and shaded by MacBoxshade.

Table 2: Sequence of oligonucleotide primers used in this study Name

Sequence

P1 P2 P3 P4 P5 P6 P7

5ƒ GACAGACAGTATCAAAG 3ƒ 5ƒ CTCAGACAAAGGTGAACCC 3ƒ 5ƒ CCTGTCCCTGCTCTGCC 3ƒ 5ƒ GACAAATGCACTGCAGTAG 3ƒ 5ƒ ATGTTCAGTTGGCTGGGTAAC 3ƒ 5ƒ CAGCTTCAAAGAGCTTCC 3ƒ 5ƒ GCGCGGATCCGAATTCGGCCATGCACGAGGACAT CATCATCTCATTATGGGACATCTTCAGCT GGGTC 3ƒ 5ƒ GGGCATCTCTTTCTTGAGGG 3ƒ

P8

Traffic 2002; 3: 575–589

EHD3 Resides in the Recycling Compartment RNA analysis RNA was prepared from mouse organs using the TRIreagent kit (MRC, USA), according to the manufacturer’s recommendations. RNA samples were electrophoresed through a 1% agarose gel containing 6% formaldehyde and transferred onto a nylon membrane. Prehybridization was carried out for 0.5 h in 0.5 M Na-phosphate buffer pH 7.4, 7% SDS and 1 mM EDTA at 65 æC. Hybridization was in the same buffer with 107 cpm of the appropriate probe at 65 æC for 18 h. After one wash in 2¿SSC, 0.1% SDS for 15 min at 65 æC and additional washes in 0.2¿SSC, 0.1% SDS at 65 æC, the filter was exposed to an X-ray film. Construction of vectors To create GFP-EHD3, an 800-bp mouse Ehd3 cDNA PCR fragment, obtained with primers P5 and P6 (see Table 2) was cloned into pEGFP-C3 (Clontech, CA, USA) within the Ecl136II restriction site. The resulting vector was digested with the restriction enzyme SmaI and ligated to a SmaIHincII mouse Ehd3 fragment. To construct GFP-EHD3DC fusion protein, GFP-EHD3 was digested with XhoI and ClaI (internal site), and the liberated fragment was cloned into the XhoI site of pEGFP-C3, following end blunting. To create GFP-EHD3DN, GFP-EHD3 was digested with ScaI to remove the N-terminal domain-containing fragment and self-ligated. To construct EHD1/EHD3 expression vector, GFP-EHD1 was digested with BamHI and ligated to a 2172-bp fragment created by digesting an EHD3containing plasmid with BamHI. The resulting chimera contained 156 amino acids of human EHD1 fused to 397 amino acids of human EHD3. For EHD3/EHD1, a 633-bp human EHD3 PCR fragment, encoding the first 211 amino acids of the protein, was inserted into the Ecl136II site of pEGFP-C3, such that an Ecl136II site was created at the 3ƒ end of the ligated fragment. The plasmid was digested with Ecl136II and ligated to a 2400-bp human EHD1 PCR fragment, encoding 323 amino acids of the corresponding protein. To construct myc-EHD3, a 1743-bp fragment (obtained by digestion of an EHD3-containing plasmid with NsiI and NotI) was cloned into the compatible sites of pCMV-Neo-Myc vector. For the HIV gp120 tag-EHD1, we generated a PCR fragment, containing the tag sequence adjacent to a partial EHD1 sequence using primers P7 and P8 (see Table 2). The resulting DNA was digested with BamHI and ligated to a pcDNA3 containing human EHD1 cDNA, digested with BamHI. To construct CFP-EHD3, a 2.5-kb mouse Ehd3 cDNA fragment containing the entire ORF was cloned in pECFP-C3 (Clontech) between the Ecl136II and the SmaI restriction sites. To generate YFP-EHD1, the ORF cDNA fragment of EHD1 was cloned into EcoRI and SalI restriction sites of pEYFPC3 (Clontech). Transfection One microgram of plasmid DNA was introduced into cells using the FuGene 6 (Boehringer Mannheim, GmbH, Mannheim, Germany) transfection reagent, according to the manufacturer’s recommendations. For cotransfections, 1 mg of each plasmid was used with the FuGene 6 reagent (Boehringer Mannheim), according to the manufacturer’s recommendations. For the FRET experiments, cells were transfected with 0.4 mg of plasmid DNA, using Effectene transfection reagent (Qiagen, Valencia, CA, USA), according to the manufacturer’s recommendations. YFP-EHD1 and CFP-EHD3 were detected on a Western blot using polyclonal antibodies to GFP from Clontech (Palo Alto, CA, USA). Endocytosis of transferrin Transfected cells, grown on coverslips, were incubated for 30 min in binding medium [Dulbecco’s Modified Eagle’s Medium (DMEM), 0.1% BSA, 20 mM HEPES, pH 7.2] to deplete transferrin present in the serum. Follow-

Traffic 2002; 3: 575–589

ing incubation with 5 mg/ml Texas-Red-conjugated transferrin (Molecular Probes, Eugene, OR, USA) at 37 æC, cells were rapidly cooled to 4 æC, washed with cold phosphate buffered saline (PBS) and fixed with 3.7% paraformaldehyde. The fixed cells were mounted for microscopy. For transferrin pulse-chase, HeLa cells, grown on coverslips, were transfected with GFP-EHD3 for 16 h. Following starvation in DMEM containing 20 mM HEPES pH 7.2 and 1 mg/mL BSA for 30 min, the cells were labeled with 15 mg/ ml Texas-Red transferrin for 2 min. After several washes with ice-cold PBS, chase medium was added [DMEM supplemented with 10% dialyzed fetal calf serum (FCS), 20 mM HEPES, 100 U/ml penicillin, 100 mg/ml streptomycin, 50 mM deferoxamine mesylate (Sigma-Aldrich, Rehovot, Israel), 1500 mg/ml unlabeled hollo-transferrin (Biological Industries, Beit-Haemek, Israel)] and chase was performed for different time periods. At the end of the pulse or the chase, coverslips were washed with ice-cold PBS and fixed with 3.7% paraformaldehyde. Cells, immunofluorescence and confocal microscopy Chinese hamster ovary (CHO) cells were cultured in F12 (HAM) (Beit-Haemek) supplemented with 10% FCS. HeLa cells were cultured in DMEM (Beit-Haemek) supplemented with 10% FCS. Cultures were maintained at 37 æC with 5% CO2. For immunofluorescence and confocal microscopy, cells grown on coverslips for 1 day, were transfected with the desired plasmid for 24–48 h. Following rinsing with PBS at room temperature (RT), cells were fixed with 3.7% paraformaldehyde for 30 min at RT. After rinsing with PBS, they were permeabilized with 0.1% triton X-100 for 3–5 min, washed with PBS and incubated in blocking buffer (10–20% normal goat serum and 1% BSA in PBS) for 0.5–1 h at RT. For tubulin staining, the cells were incubated with anti-b-tubulin antibodies (Sigma T4026) at RT for 1 h. After rinsing with PBS, the slides were incubated with the monoclonal indocarbocyanin (Cy3)-labeled secondary antibody (Jackson Laboratory) for 30 min at RT. The cells were then washed extensively with PBS and mounted on a glass slide in mounting reagent (Galvanol). For actin staining, transfected cells were fixed and permeabilized as described above. TRITC-phalloidin (Sigma P1951) diluted 1 : 1000 in PBS was applied for 20 min at RT. Cells were then washed extensively with PBS and mounted on a glass slide. Cotransfected cells were fixed with 3.7% paraformaldehyde and permeabilized with 0.5% triton in PBS for 3 min. Following blocking, cells were reacted with the relevant anti-tag antibodies for 1 h at RT. The tag coupled to EHD1 was an HIV-gp120 epitope, recognized by the GV1A8 murine monoclonal antibody, a kind gift from Dr G. Denisova and Prof. J. Gershoni, of Tel-Aviv University (30). EHD3, ligated to the myc-tag, was stained with commercial anti-myc-tag polyclonal antibodies (ABR Affinity Bioreagents, Golden, CO, USA). Cells were then washed extensively with PBS and mounted. For treatment with nocodazole (Sigma), colchicine (Sigma) or cytochalasin D (Sigma), cells on coverslips were incubated with medium containing the appropriate drug at 37 æC. After treatment, cells were fixed and permeabilized as described above. Fluorescently stained cells were analyzed using a 410 Zeiss confocal laser scan microscope (CLSM), pinhole 20 (Zeiss, Oberkochen, Germany) with the following configuration: 25 mW argon and HeNe lasers, 488, 568 and 633 maximum lines. All images depict single sections of 0.4 mm. Contrast and intensity for each image were manipulated uniformly using Adobe Photoshop software (Mountain View, CA, USA). Two-hybrid system The ORFs of the human EHD1 or the mouse Ehd3 cDNAs were cloned in frame into the EcoRI and the XhoI sites of the ‘bait’ pLexA vectors (Interac-

587

Galperin et al. tion trap matchmaker system, Clontech, CA, USA). The recombinant pLexA-EHD1 and pLexA-Ehd3 vectors were used to transform the EGY48 yeast strain and were tested for protein expression, entrance to the nucleus and inability to activate the system. EHD1 and mEhd3 were also cloned into the ‘prey’ pB42AD vector (Interaction trap matchmaker system, Clontech) and were used to transform either EGY48/pLexA/EHD1 or EGY48/ pLexA/mEhd3 strains. The transformed colonies were first grown on Glucose/Histidineª/Uracylª/Tryptophan-plates, and four individual colonies from each transformation were assayed for growth either on Galactose/ Raffinose/Histidineª/Uracylª/Tryptophanª/Leucine- or Galactose/Raffinose/Histidineª/Uracylª/Tryptophanª/X-gal plates. Growth on Leucineplates or Blue-colored colonies on X-gal plates indicated interaction between the bait and the prey recombinant proteins. To verify specificity of the interaction, the different recombinant bait plasmid proteins were assayed for interaction with prey plasmid encoding a nonrelevant protein (Rubisco, a kind gift from Dr Adi Avni Department of Plant Research, TelAviv University). Coimmunoprecipitation of EHD1 and EHD3 Forty-eight hours after transfection with 5 mg of the appropriate DNA, cells were lysed (10 mM HEPES, 1 mM MgCl2, 100 mM NaCl, 0.5% NP-40, pH 8.0, containing 1 mM PMSF, 10 mg/ml Leupeptin and 10 mg/ml Aprotonin). The extracts were subjected to immunoprecipitation with the anti-tag antibody, conjugated to immobilized protein A beads, for 4 h at 4 æC. After 2 washes in the same buffer, the samples were separated through SDSPAGE. The proteins were transferred onto a nitrocellulose membrane and incubated with anti-EHD1 antibodies (3.5 mg/ml) overnight at 4 æC. Detection was carried out by secondary antibodies conjugated to horseradish peroxidase, followed by ECL. Living cell fluorescent imaging These experiments were performed in Dr A. Sorkin’s lab (Department of Pharmacology, UCHSC, University of Colorado). The fluorescence imaging workstation was described previously (30). Cells were grown on coverslips that were mounted in a microscopy chamber. The images were acquired at room temperature using 2 ¿ 2 binning mode. FRET measurements were performed as previously described (31). FRETc images are presented in pseudocolor mode. FRETc intensity is displayed stretched between the low and high renormalization values, according to a temperature-based lookup table with blue (cold) indicating low values and red (hot) indicating hot values. To eliminate the distracting data from regions outside of cells, the YFP channel was used as a saturation channel, and the FRETc images are displayed as YFP intensity-modulated images. In these images, data with YFP values greater than the high threshold of the saturation channel are displayed at full saturation, whereas data values below the low threshold will be displayed with no saturation (i.e. black). All calculations were performed using the Channel Math and FRET modules of the SlideBook software.

Acknowledgments We thank Dr Galina Denisova and Prof. Jonathan Gershoni for the kind gift of the HIV-gp120 epitope tag and the anti-tag GV1A8 murine monoclonal antibody, and Drs Leonid Mitelman and Alex Barbul for excellent technical assistance with the confocal microscope. We are grateful to Dr Sasha Sorkin for critical reading of the manuscript. This work was partially supported by grants from the Israel Cancer Research Foundation (ICRF), the Israeli Ministry of Health, the Van Bates Foundation and the Amson Fund (to M.H.). R. Rotem-Yehudar was funded by a postdoctoral fellowship from the Valazzi-Pikovsky foundation.

588

References 1. Mellman I. Endocytosis and molecular sorting. Annu Rev Cell Dev Biol 1996;12:575–625. 2. Kirchhausen T, Bonifacino JS, Riezman H. Linking cargo to vesicle formation: receptor tail interactions with coat proteins. Curr Opin Cell Biol 1997;9:488–495. 3. Lewin DA, Mellman I. Sorting out adaptors. Biochim Biophys Acta 1998;1401:129–145. 4. Clague MJ. Molecular aspects of the endocytic pathway. Biochem J 1998;336:271–282. 5. Coda L, Salcini AE, Confalonieri S, Pelicci G, Sorkina T, Sorkin A, Pelicci PG, Di Fiore PP. Eps15R is a tyrosine kinase substrate with characteristics of a docking protein possibly involved in coated pits-mediated internalization. J Biol Chem 1998;273:3003–3012. 6. Confalonieri S, Salcini AE, Puri C, Tacchetti C, Di Fiore PP. Tyrosine phosphorylation of Eps15 is required for ligand-regulated, but not constitutive, endocytosis. J Cell Biol 2000;150:905–912. 7. Di Fiore PP, Pelicci PG, Sorkin A. EH: A novel protein–protein interaction domain potentially involved in intracellular sorting. Trends Biochem Sci 1997;22:411–413. 8. de Beer T, Carter RE, Lobel-Rice KE, Sorkin A, Overduin M. Structure and Asn-Pro-Phe binding pocket of the Eps15 homology domain. Science 1998;281:1357–1360. 9. Salcini AE, Confalonieri S, Doria M, Santolini E, Tassi E, Minenkova O, Cesareni G, Pelicci PG, Di Fiore PP. Binding specificity and in vivo targets of the EH domain, a novel protein–protein interaction module. Genes Dev 1997;11:2239–2249. 10. Tebar F, Confalonieri S, Carter RE, Di Fiore PP, Sorkin A. Eps15 is constitutively oligomerized due to homophilic interaction of its coiledcoil region. J Biol Chem 1997;272:15413–15418. 11. Fazioli F, Minichiello L, Matoskova B, Wong WT, Di Fiore PP. eps15, a novel tyrosine kinase substrate, exhibits transforming activity. Mol Cell Biol 1993;13:5814–5828. 12. Santolini E, Salcini AE, Kay BK, Yamabhai M, Di Fiore PP. The EH Network. Exp Cell Res 1999;253:186–209. 13. Guipponi M, Scott HS, Chen H, Schebesta A, Rossier C, Antonarakis SE. Two isoforms of a human intersectin (ITSN) protein are produced by brain-specific alternative splicing in a stop codon. Genomics 1998;53:369–376. 14. Wendland B, Emr SD, Riezman H. Protein traffic in the yeast endocytic and vacuolar protein sorting pathways. Curr Opin Cell Biol 1998;10:513–522. 15. Yamabhai M, Hoffman NG, Hardison NL, McPherson PS, Castagnoli L, Cesareni G, Kay BK. Intersectin, a novel adaptor protein with two Eps15 homology and five Src homology 3 domains. J Biol Chem 1998;273:31401–31407. 16. Mintz L, Galperin E, Tultzinski S, Bromberg Y, Fein A, Kozak C, Joyner A, Horowitz M. EHD1 – an EH domain containing protein with a specific expression pattern. Genomics 1999;59:66–76. 17. Pohl U, Smith JS, Tachibana I, Ueki K, Lee HK, Ramaswamy S, Wu Q, Mohrenweiser HW, Jenkins RB, Louis DN. EHD2, EHD3, and EHD4 encode novel members of a highly conserved family of EH domaincontaining proteins. Genomics 2000;63:255–262. 18. Grant B, Zhang Y, Paupard MC, Lin SX, Hall DH, Hirsh D. Evidence that RME-1, a conserved C. elegans EH-domain protein, functions in endocytic recycling. Nat Cell Biol 2001;3:573–579. 19. Lin SX, Grant B, Hirsh D, Maxfield FR. Rme-1 regulates the distribution and function of the endocytic recycling compartment in mammalian cells. Nat Cell Biol 2001;3:567–572. 20. Rotem-Yehudar R, Galperin E, Horowitz M. Association of insulin like growth factor 1 receptor with EHD1 and SNAP29. J Biol Chem 2001;276:33054–33060.

Traffic 2002; 3: 575–589

EHD3 Resides in the Recycling Compartment 21. Haider NB, Searby C, Galperin E, Mintz L, Horowitz M, Stone EM, Sheffield VC. Evaluation and molecular characterization of EHD1, a candidate gene for Bardet–Biedl syndrome 1 (BBS1) [In Process Citation]. Gene 1999;240:227–232. 22. Vetter IR, Wittinghofer A. The guanine nucleotide-binding switch in three dimensions. Science 2001;294:1299–1304. 23. Mukherjee S, Ghosh RN, Maxfield FR, Endocytosis. Physiol Rev 1997;77:759–803. 24. Okamoto PM, Tripet B, Litowski J, Hodges RS, Vallee RB. Multiple distinct coiled-coils are involved in dynamin self-assembly. J Biol Chem 1999;274:10277–10286. 25. Hamm-Alvarez SF, Sheetz MP. Microtubule-dependent vesicle transport. modulation of channel and transporter activity in liver and kidney. Physiol Rev 1998;78:1109–1129. 26. Apodaca G. Endocytic traffic in polarized epithelial cells. role of the actin and microtubule cytoskeleton. Traffic 2001;2:149–159. 27. Hyman J, Chen H, Di Fiore PP, De Camilli P, Brunger AT. Epsin 1 un-

Traffic 2002; 3: 575–589

28.

29. 30.

31.

dergoes nucleocytosolic shuttling and its eps15 interactor NH (2) terminal homology (ENTH) domain, structurally similar to Armadillo and HEAT repeats, interacts with the transcription factor promyelocytic leukemia Zn (2) π finger protein (PLZF). J Cell Biol 2000;149:537– 546. Vecchi M, Polo S, Poupon V, van De Loo JW, Benmerah A, Di Fiore PP. Nucleocytoplasmic shuttling of endocytic proteins. J Cell Biol 2001;153:1511–1518. Matter K, Mellman I. Mechanisms of cell polarity: Sorting and transport in epithelial cells. Curr Opin Cell Biol 1994;6:545–554. Gershoni JM, Stern B, Denisova G. Combinatorial libraries, epitope structure and the prediction of protein conformations. Immunol Today 1997;18:108–110. Sorkin A, McClure M, Huang F, Carter R. Interaction of EGF receptor and grb2 in living cells visualized by fluorescence resonance energy transfer (FRET) microscopy. Curr Biol 2000;10:1395–1398.

589