Graefe’s Arch Clin Exp Ophthalmol (2003) 241:321–326
L A B O R AT O R Y I N V E S T I G AT I O N
DOI 10.1007/s00417-003-0638-4
Andrea Schneemann Ateunette Leusink-Muis Thomas van den Berg Philip F. J. Hoyng Willem Kamphuis
Received: 19 September 2002 Revised: 13 December 2002 Accepted: 28 January 2003 Published online: 15 March 2003 © Springer-Verlag 2003
A. Schneemann · T. van den Berg P. F. J. Hoyng · W. Kamphuis (✉) Glaucoma Research Group, Netherlands Ophthalmic Research Institute, KNAW, Meibergdreef 47, 1105 BA Amsterdam, The Netherlands e-mail:
[email protected] Tel.: +31-20-5666101 Fax: +31-20-5666121 A. Leusink-Muis Department of Pharmacology, Utrecht Institute of Pharmaceutical Sciences, Utrecht University, Utrecht, The Netherlands
Elevation of nitric oxide production in human trabecular meshwork by increased pressure
Abstract Background: The presence of the nitric oxide (NO)-producing enzyme nitric oxide synthase (NOS) in the trabecular meshwork and the effect of various drugs acting through the NO pathway on the outflow facility and trabecular contractility suggest a role for NO in the regulation of outflow and intraocular pressure (IOP). Methods: To model the effect of elevated IOP on the NO production in the trabecular meshwork, we perfused anterior segments of human donor eyes in vitro and studied the effect of raised perfusion pressure on NO levels in the perfusate. Furthermore, we evaluated using quantitative PCR whether enhanced perfusion pressure had an effect on the NOS gene expression levels. Results: Elevating the pressure from 10 mmHg to 25 mmHg caused a significant increase in NO production from 3.6±0.9 pmol/min to 5.9±1.6 pmol/min (mean ± SEM), corresponding to an average increase of 66%. These high NO levels were
Introduction The aqueous humour produced in the ciliary body leaves the eye mainly via the trabecular meshwork (TM), located in the anterior chamber wedged between the iris and the cornea. The TM is able to regulate the level of outflow, thus maintaining the intraocular pressure (IOP) within specific limits [4]. A dysfunction in the meshwork altering the outflow is expected to lead to an increased IOP and may result in neuronal damage in the
reduced by application of L-NAME, an NOS inhibitor, to 2.6±0.6 pmol/ min. Addition of L-NAME before raising the pressure decreased the basal NO production but was not able to block the increase in NO production after raising the pressure. The transcript level of iNOS was significantly increased in the trabecular meshwork after raising the perfusion pressure. Conclusion: These results show that NO production increased after elevation of the pressure gradient over the trabecular meshwork, accompanied by an upregulation of iNOS gene expression. Previous studies have demonstrated that enhanced NO levels facilitate outflow. Taken together, the data indicate the existence of a regulatory feedback mechanism in the trabecular meshwork, which may contribute to the regulation of the IOP. In this system an increase in IOP will enhance NO production, which, in turn, increases the outflow facility, leading to a normalization of the IOP.
retina, as seen in glaucoma. Several factors determine the outflow: the composition of the extracellular matrix, the contractile properties of the meshwork itself, and the forces exerted on the meshwork by the ciliary muscle and by a contractile sheet that runs from the scleral spur into the meshwork. Together, these factors control the shape and volume of the spaces between the trabecular lamellae and hence the outflow resistance [12]. A variety of IOP-modulating substances, acting through various mechanisms, influence the outflow
322
through the TM [20, 31]. Nitric oxide (NO) has been suggested to be involved in the regulation of TM outflow [16, 23, 24]. This molecule is known for its regulation of vasomotor tone, inhibition of platelet aggregation and cell adhesion to the endothelium, and vascular smooth muscle cell proliferation [2]. NO is formed from L-arginine by the enzyme nitric oxide synthase (NOS) and passes easily through the cellular membrane to neighbouring cells. It reacts with guanylate cyclase, resulting in elevation of cyclic GMP levels. Three different isoforms of NOS have been identified. Neuronal NOS or brain NOS (nNOS, bNOS or NOS I) and endothelial NOS (eNOS or NOS III) are known as “constitutive” and are usually Ca2+ dependent. The third isoform, inducible NOS (iNOS or NOS II), is Ca2+ independent and its expression is induced in response to cytokines or other inflammatory agents [10]. Several studies have shown IOP-lowering effects of NO in vivo. Drugs acting as NO donors lower IOP in both rabbits and monkeys [3, 28], and 8-bromo-cGMP decreases IOP in rabbits [6]. L-Arginine applied intravenously to human subjects lowers IOP [7]. Furthermore, studies have shown the human TM to be an NOS-enriched tissue [24], containing mainly the eNOS isoform with a smaller amount of nNOS. Another study showed that compounds acting on the NO pathway can induce contraction or relaxation of bovine TM tissue [30]. Our previous studies, using the anterior segment perfusion model of human donor eyes, revealed that L-NAME, a competitive inhibitor of NOS, inhibits both flow rate and cGMP production, whereas sodium nitroprusside, an NO donor, increases both the flow and the cGMP production [27]. In relation to glaucoma, it is of interest that the TM of POAG patients contains less NOS than that of normal controls [23], suggesting that the NO pathways in POAG patients may be affected. Taken together, these results suggest a role for NO in mediating outflow through the TM, but the precise mechanism is unknown. In view of our previous results, we reasoned that if NO plays a role in maintenance of the IOP at a constant level, NOS activity might be upregulated in response to a raise of the IOP, resulting in a increased synthesis of NO. In line with this hypothesis is the observation that cultured human TM cells exposed to hydraulic pressures of 30, 40 and 50 mmHg had higher intracellular NO levels than those exposed to 0–25 mmHg [21]. To evaluate the effect of elevated IOP on the production of NO by TM cells within a more physiological context, we perfused human anterior segments at normal and high pressures. We measured the production of NO and, because all three NOS isoforms are known to be subject to transcriptional regulation [11, 14], we also determined the transcript levels of the NOS isoforms in the TM.
Material and methods Donors, preparation of anterior segments and perfusion conditions For both experiments, human donor eyes, unsuitable for corneal transplantation, were obtained from the Cornea Bank Amsterdam at the Netherlands Ophthalmic Research Institute. Only the age of the donor, time of death and time of enucleation were known. Under aseptic conditions, the eyes were hemisected at the equator. Conjunctiva, vitreous, lens, iris and uvea were removed carefully. The average age of the donors of the first group (n=10) was 68±6 years (mean ± SD). The average enucleation time and postmortem time were 9±3 h and 22±12 h (mean ± SD), respectively. The average age of the donors of the second group (n = 7) was 68±9 years. The average enucleation time and post-mortem time were 7±4 h and 38±14 h, respectively. The anterior segments were mounted on a perfusion apparatus connected to a real-time flow measurement system. The culture medium used for perfusion was Eagle’s minimum essential medium (EMEM, supplemented with 2% foetal bovine serum, 100 U/ml penicillin, and 50 µg/ml streptomycin; Instruchemie, Hilversum, The Netherlands) at 37°C and 5% CO2 in atmosphere. For a detailed description, see Dijkstra et al [8, 9]. The anterior segments were perfused with EMEM under standard conditions: temperature was 37°C, the pressure kept constant, and 5% CO2 in atmosphere. Every 20 s the pressure and flow were recorded. Anterior segments with a flow higher than 5 µl/min and lower than 0.75 µl/min at perfusion at 10 mmHg were excluded from this study. The anterior segments with a flow higher than 5 µl/min were discarded because of probable leakage, while a flow below 0.75 µl/min is indicative of low vitality of the tissue [18] or possibly glaucomatous conditions. Unfortunately, we did not have both eyes of the same donor available for our studies, which prevented us from performing experiments running experimental and control conditions side by side. Perfusion regime For the experiments described here, all eyes were perfused at 10 mmHg overnight to establish a stable baseline flow. Two groups of anterior segments were subjected to different experimental conditions. In the first series, after stabilization of the flow at 10 mmHg, the pressure was raised to 25 mmHg. After 2 h of perfusion at 25 mmHg, 100 µM of the NOS inhibitor L-NAME (Sigma-Aldrich, The Netherlands ) was added to the medium. In the second series, after stabilization of the flow at 10 mmHg, 100 µM L-NAME was added to the medium 2 h before the pressure was elevated to 25 mmHg. The perfusate was collected during a 2-h period before and after elevation of the pressure or addition of the medication for measurement of the NO levels in the perfusate. Nitric oxide assay To determine the amount of NO that was released by the TM, the perfusate was collected and stored at −20°C until analysis. NO is a very unstable molecule in solution with a half-life of only a few seconds. The major part of NO is oxidized into nitrite in the absence of oxyhaemoglobin or superoxide anions. Perfusate (100 µl) was injected into the purge vessel connected to a Sievers 270B nitric oxide analyser (Sievers, Boulder, CO, USA). The purge vessel contained 2 ml 1% NaI in glacial acetic acid to reduce nitrite back into NO, according to the following reaction: 2 NaI+2 CH3COO+NO2→NO+I2H2O+2 NaCH3COO. Data are presented as area under the curve and compared with the calibrations with standard solutions of potassium nitrite in accordance with the manufacturer’s instructions.
323
Table 1 Primer sequences, amplicon length, exon position, and GenBank accession code for the NOS isoform-specific real-time Q-PCR Gene
Forward sequence
Reverse sequence
Amplicon length (bp)
Exon
GenBank acc. no.
eNOS nNOS iNOS
GCGGCTGCATGACATTGAG CACCCTGCGAACGTACGAA AAGCCCAGGTTCTACTCCATCAG
TCGCGGTAGAGATGGTCAAGTT GCTGAAAACCTCATCGGTGTCT AGGTGACCACGGCCACAGT
96 94 79
Exon 23–24 Exon 28 Exon 27
NM000603 NM000620 NM000625
The quantification of NO production relies on an indirect method, that is the detection of the nitrite levels, and any other nitrite source could give rise to false-NO signals. However, the only known additional source for nitrite levels in biological models are bacteria that convert dietary nitrate into nitrite or exposure to gaseous nitrogen oxides such as nitrous anhydride or nitrogen dioxide [5, 13]. Perfusion regime and quantitative PCR In previous experiments we investigated whether alterations in prostanoid receptor gene expression level in response to increased perfusion pressure contributed to the regulatory mechanisms that maintain the IOP within specific limits [26]. Here the same cDNA samples were used again to determine changes in transcript levels of nNOS, iNOS and eNOS using real-time quantitative PCR. Full details on mean age of the donors and mean enucleation and postmortem times have been presented before [27]. All anterior segments were perfused at 10 mmHg for 24 h to reach equilibrium, followed by three different pressure regimes. Anterior segments were perfused for 1 h or 3 h at 30 mmHg (n=5 and n=5, respectively) to be compared with a group of anterior segments perfused only for the equilibration period at 10 mmHg (n=6). The TM was immediately removed from the anterior segment at the end of each perfusion experiment and stored at −80°C. For a detailed description of the total RNA isolation and cDNA synthesis, see Kamphuis et al. [19]. In short: After the RNA isolation the total yield was treated with DNAse I. Then the RNA was transcribed into cDNA using 100 ng of random primers and 200 U reverse transcriptase (InVitrogen first strand synthesis system for RT-PCR). The cDNA (final volume, 50 µl in 10 mM Tris and 1 mM EDTA) was stored at −20°C until analysis. Four reference genes were considered: β-actin, major histocompatibility complex class I (MHC), glyceraldehyde-3-phosphate dehydrogenase (GADPH), and hypoxanthine phosphoribosyltransferase (HPRT). A cDNA array study showed no differences in HPRT and MHC levels between eyes perfused at low and at high pressures, and the outcome of our previous experiments confirmed that HPRT expression was not subject to regulation by pressure- or donor-related parameters [15]. The sequence of the NOS primers and the GenBank accession codes are given in Table 1. Details on the primers for the reference genes were described previously [19]. The transcript levels of the three NOS isoforms and of four reference genes were assessed using realtime Q-PCR. The quantitative assessment of mRNA levels was performed using the SYBRE Green detection system (ABI Prism 5700 Sequence Detection System; Applied Biosystems, The Netherlands), which monitors the accumulation of DNA-dependent fluorescence in the course of the PCR. To assess the amplification efficiency of the primer pairs we prepared a dilution range of a cDNA pool containing a fraction of all individual cDNA samples used in this study. Accordingly, the precise relation between the starting amount of cDNA and the outcome (number of cycles) of the assay was estimated and used to correct small differences in efficiencies between the PCRs (for details see: Applied Biosystems Users Bulletin 2 and [19]). Furthermore, the gene levels for nNOS, iNOS and eNOS were normalized against the level of a reference gene to correct for a variant cDNA
load between the samples. Non-template controls were included for each primer pair to check for contamination. To check the reproducibility of the assay, the HPRT levels of all samples were determined in two independent sessions by two different researchers (correlation coefficient was 0.946, n=29). To assess the effect of organ culture and perfusion on the expression of the NOS isoforms, nNOS, iNOS, and eNOS gene levels were measured in the TM isolated from 10 unperfused human donor eyes. The same set of TM cDNAs was used to profile the expression pattern of the prostanoid receptor genes; for details on the donors and procedures see Kamphuis et al. [19]. Data analysis The age of the donors, and the enucleation and post-mortem times of the eyes are given as mean ± standard deviation. Flow was calculated as the average flow over a period of 15 min. From the determined NO concentrations in the samples, the NO production in the perfusate was calculated and presented as the amount (pmol) of NO produced per minute per anterior segment. All NO and flow data are expressed as mean ± standard error of mean (SEM). The effect of elevation of the pressure and addition of the medication on flow and the amount of NO produced was calculated as the relative increase and decrease compared with baseline values by pairwise analysis. For a statistical evaluation, Student’s t-test for matched pairs was used. We studied whether age and enucleation and post-mortem times had an effect on the individual flow and NO production. Linear regression analysis was used to determine the effect of elevating the pressure and L-NAME on both flow and NO production. Data on the NOS gene levels are represented as relative amounts against the amount of the HPRT reference gene. Data were analysed using a two-tailed Student’s t-test, assuming unequal variances. P
