embryonic stem cells differentiated in vitro ...

From bloodjournal.hematologylibrary.org by guest on July 14, 2011. For personal use only.

1996 87: 2740-2749

Overexpression of HOXB4 enhances the hematopoietic potential of embryonic stem cells differentiated in vitro CD Helgason, G Sauvageau, HJ Lawrence, C Largman and RK Humphries

Information about reproducing this article in parts or in its entirety may be found online at: http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requests Information about ordering reprints may be found online at: http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprints Information about subscriptions and ASH membership may be found online at: http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtml

Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036. Copyright 2011 by The American Society of Hematology; all rights reserved.

From bloodjournal.hematologylibrary.org by guest on July 14, 2011. For personal use only.

Overexpression of HOXB4 Enhances the Hematopoietic Potential of Embryonic Stem Cells Differentiated In Vitro By Cheryl D. Helgason, Guy Sauvageau, H. Jeffrey Lawrence, Corey Largman, and R. Keith Humphries Little is known about molecular the mechanisms controlling primitive hematopoietic stem cells, especially during embryogenesis. Homeobox genes encode a family of transcription factors that have gained increasing attention as master regulators of developmental processes and recently have been implicated in the differentiation and proliferation of hematopoietic cells. Several Hox homeobox genes are now known t o be differentially expressed in various subpopulations of human hematopoietic cells and one such gene, HOXB4, has recently been shown t o positively determine the proliferative potential of primitive murine bone marrow cells, including cells with long-term repopulatingability. To determine if this gene might influence hematopoiesisat the earliest stages of development, embryonic stem (ES) cells were geneticallymodified by retroviral gene transfer t o overexpress HOXR4and the effect on theirin vitro differentiation was examined. HOX84 overexpression significantly increased the number of progenitors of mixed erythroidlmy-

eloid colonies anddefinitive, but notprimitive, erythroid colonies derived from embryoidbodies (EBs) at various stages after induction of differentiation. There appeared t o be no significant effect on thegeneration of granulocyticor monocytic progenitors, nor on the efficiency of EB formation or growth rate. Analysis of mRNA from EBs derived from HOXWtransduced ES cells on different days of primary differentiation showed a significant increase in adult P-globin expression, with no detectable effect on GATA-1 or embryonic globin (pH-1). Thus, HOXB4 enhances the erythropoietic, and possiblymore primitive, hematopoietic differentiaES cells. Theseresults provide newevidence tive potential of implicating Hox genes in the control of very early stages in the development ofthe hematopoietic system andhighlight the utilityof the ES model for gaining insights into the molecular genetic regulation of differentiation and proliferation events. 0 7996 by The American Society of Hematology.

T

and B cluster are expressed in distinct patterns related to the functional capacities of the cell.'."' HOXBl is of particular interest in this regard. The highest levels of expression were found in the most primitive subpopulations of human hematopoietic cells, whereassignificantly lower levels of the transcript were detected in more mature committedprogenitors." Studies withantisenseoligonucleotideshaveindicatedthe importance of this gene, along with other B-cluster genes, in the differentiation and proliferation of various clonogenic cells from primitive populations of human BM cells."' Similarly, studies with murine BM transduced with a HOXB4 retrovirus showed enhanced proliferation of hematopoietic cells, including cells with long-term repopulating ability." Despite this recent progress in elucidating the importance o f Hox genes in adult hematopoiesis, the role of these genes in theontogeny of thehematopoieticsystemhasreceived little attention. As in the adult hematopoieticsystem, HOXBl is of interest from adevelopmentalpoint of view. In situ hybridization studies with murine embryos revealed expression in derivatives ofwhich ultimately the gives rise to cells of the hematopoietic system and HOXBl mRNA has also been observedin the fetal liver.'* These expressionstudies suggest thatafunctionmayexist for this gene in the development and differentiation of the hematopoieticsystem. However, it is difficult to evaluate the significance of these observations in vivo becauseof the scarcity of the cells of interest. Embryonicstem (ES) cellsare totipotent cells derived from the inner cell mass of the developing blastocyst. They canbe maintained in vitro forextended periods, andcan be genetically manipulated, without loss of their potential. Importantly, ES cells can differentiate in vitro into embryoid bodies (EBs) containinga variety of cell types,including cells of thehematopoieticsystem'"'" and thus providea powerful model to study the processes involved in the establishment and differentiation of the hematopoietic system. A second advantageof this system is that it permits the evaluation of gene function without concern for fetal lethality as

HE MOLECULAR mechanismsregulating the development and differentiation of the hematopoietic system are not clearly understood. It is believed that a combination of internal and external signals coordinately interact to induce self-renewal ordifferentiation of a pluripotent hematopoietic stem cell (HSC). Although little is known about the genes involved in these processes, transcription factors are likely to be essential regulators. The mammalian Hox family of homeobox genes encode transcription factors that show a strictly regulated pattern of expression during embryonic and fetal development suggestive that,as for theHOM-C genes in Drosophila, they are involved in controllingcell fate.'-4 A role for the Hox genesin regulating adult bone marrow (BM)hematopoiesisisbecoming apparent.Expression of genes from the A, B, and C clusters has been detected in a variety of hematopoietic cell lines, as well as in a number of leukemias.'" Recent studies with purified populations of human CD34' BM cells showed that genes of both the A From the Terry Fox Laboratory, British Columbia Cancer Agency; the Department of Medicine, Universiry of British Colunbia, Vancouver, BC, Canada; and the Department of Veterans Affairs Medical Center and University of California, the Department of Medicine, Sun Francisco. Submitted June 20, 1995; accepted November 13, 1995. Supported by the National Cancer Institute of Canadn (R.K.H.) with funds from the Canadian Cancer Society and the Veterans Affairs Research Service ( C L . and H.J.L.). C.D.H. is the recipient of a Medical Research Council of Canada Postdoctoral Fellowship and G.S. is U recipient of a Medical Research Council of Canada Clinician Scientist Award. Address reprint requests to R. Keith Humphries, MD, PhD, T e r q Fox Laboratory, 601 W 10th Ave, Vancouver, BC, Canada V52 lL3. The publicationcosts of this article were defrayed in part by page charge payment. This article must therefore he hereby mnrked "advertisement" in accordance with 18 U.S.C. section 1734 solely to indicate this fact. 0 1996 by The American Society of Hematology. 0006-4971/96/8707-0030$3.00/0 2740

Blood, Vol 87, No 7 (April 1). 1996: pp 2740-2749

From bloodjournal.hematologylibrary.org by guest on July 14, 2011. For personal use only. HOX64 ENHANCESESHEMATOPOIESIS

IN VITRO

exemplified by recent studies on the effect of "knocking out" the vav proto-oncogene." Although the in vitro differentiation of ES cells could be used to identify extrinsic factors that regulate hematopoietic development, more success has been achieved using this sytem to examine the roles of various transcription factors, including rbtn2," GATA- l ,l9 and GATA-2,20in hematopoiesis. To gain further insight into the possible roles of Hox genes in developmental hematopoiesis, we turned to the ES model and examined the effect of engineered overexpression of HOXB4 in ES cells by retroviral transduction. We demonstrate marked enhancement in the generation of definitive erythroid andmixed colony progenitors with no obvious effect on the plating efficiency or growth of the ES-derived embryoid bodies, and thus provide new evidence implicating Hox genes in the control of very early stages of hematopoietic development. MATERIALS AND METHODS Cell culture. CCE ES cells (kindly provided byDr G. Keller, National Jewish Center, Denver, CO) and EFC-1" ES cells (kindly provided byDr A.G. Smith, Edinburgh Centre for Genomic Research, Edinburgh, UK) were maintained on gelatinized dishes in Dulbecco's modified essential medium (DMEM) supplemented with 10%selected fetal calf serum (FCS), 4 mmoVL glutamine, 2X nonessential amino acids, 0.1 mmol/L 2-mercaptoethanol (Sigma Chemical CO,St Louis MO), and leukemia inhibitory factor (LIF) supplied as a supernatant (prepared attheTerryFox Lab) from Cos cells transfecred with an LIF expression vector. Unless otherwise stated, all reagents for cell culture and in vitro differentiation of ES cells were purchased from StemCell Technologies Inc ([STI], Vancouver, BC, Canada). The ecotropic retroviral packaging cell line GPE + 86 was maintained in HXM medium consisting ofDMEM supplemented with 10% heat-inactivated (55°C for 30 minutes) newborncalf serum (GIBCO-BRL Canada, Burlington, Ontario), 15 pg/mL hypoxanthine (Sigma), 250 pg/mL xanthine (Sigma), and 25 pg/mL mycophenolic acid (Sigma). Viral-producing cells were cultured in HXM medium containing 1 mg/mL of the neomycin analog G418 (Sigma). Unless otherwise specified, all cell culture was performed in humidified incubators at 37°C with a mixture of 5% CO2 in air. In vitro differentiution of ES cefls and assay for hematopoieric progenitors in developing embryoid bodies. The methods used for the differentiation of ES cells and the quantitation of progenitors within the EBs were essentially as described by Keller et al.'4 ES cells used in these experiments were maintained in culture for less than 15 passages. Forty-eight hours before differentiation, cells were passaged at low density (5 X IO4 cells per 25-cm2 flask) in Iscove's modified essential medium (IMDM) supplemented as described above. Cells were obtained with 0.25% Trypsin-l mmol/LEDTA (GIBCO-BRL), washed with IMDM containing 5% FCS, and were suspended at 4 to 5 X IO3 cells/mL. Methylcellulose for differentiation consisted of 0.8% cu-methylcellulose supplemented with 1% bovine serum albumin (BSA), 15% selected FCS, 2.5 X molL 2-mercaptoethanol (Sigma), 160 ng/mL Steel Factor (SF) supplied as a Cos-cell-derived supernatant, and IMDM to volume. In certain experiments (see Fig 3), ES cells were differentiated in 0.9% Iscove's methylcellulose supplemented with 15% selected FCS, 450 pmoVL monothioglycerol (Sigma), 40 ng/mL SF supplied as a Cos-cell-derived supernatant, and IMDM to volume. ES cells were added to the methylcellulose to yield a final density of 300 to 500 cells/mL and 1.O-mL aliquots were distributed into 35-mm Petri-style dishes (STI). Cultures were fed at day

2741

8 or 10 of differentiation by layering 0.5 mL of 0.4% methylcellulose containing recombinant human erythropoietin (Epo; 3 U/mL), SF (Cos-supematant; 160 ng/mL), and either pokeweed mitogen-stimulated murine spleen cell conditioned medium (SCCM; 2%) or 30 ng/mL IL-3 plus 30 ng/mL IL-6 (both supplied as Cos cell supernatants) onto each dish. Primary plating efficiency was determined by calculating the percentage of ES cells which formed EB (ie, number ofEB formed divided by number ofES plated multiplied by 100 equals the percent plating efficiency). At various stages of the primary differentiation EBs were procured for replating in secondary methylcellulose cultures to detect hematopoietic progenitors. Before day 10, EBs were obtained, pelleted, and treated with Trypsin-EDTA for approximately 2 minutes. EBs were disrupted by passage through a 21-gauge needle and the cells were pelleted and counted. After day 10, the isolated EBs were incubated at37°C for 60 to 90 minutes in a solution of 0.25% collagenase (Sigma) in phosphate-buffered saline (PBS) supplemented with 20% FCS. Single-cell suspensions were prepared as described above. The number of cells per culture was determined by dividing the total cell yield by the number of primary differentiation cultures procured. Cells were plated in either 0.8% a-methylcellulose (ST1 M3230) or 0.9% Iscove's methylcellulose (ST1 M4100) supplemented with 3 U/mL Epo, 2% SCCM, 160 ng/mL SF, and IMDM. In some experiments SCCM was replaced by combinations of cytokines supplied as supernatant from transfected Cos cells (Terry Fox Laboratories). Hematopoietic colonies were scored microscopically after 10 to 14 days using standard criteria." In some experiments isolated colonies were plucked and centrifuged onto slides for cytological analysis. Retrovirul infection of ES cells. Retroviruses were constructed using the MSCV 2.1 retroviral vectorz3(kindly provided byDr R. Hawley, Sunnybrook Research Institute, Toronto, Ontario, Canada). The human HOXB4 cDNA encompassing the entire coding region (kindly provided in a plasmid by E. Boncinelli, Ospedale S. Faffaele, Milan, Italy) was isolated and cloned into theXba 1 site directly upstream of the pgk-neo' cassette by blunt-end ligation using standard Stable polyclonal retroviral producer lines were generated by calcium phosphate transfer of DNA (10 pg per construct) into GPE + 86 cells followed by selection with 1 rng/mL G418 (GIBCO-BRL). The viral titers of the GPE + 86-pgk-neo' and GPE + 86-HOXB4-pgk-neo' producer cells were determined by transfer of G418 resistance toNIH 3T3 cellsz5 to be 3 to 5 X IO6 colony-forming units (CFU)/mL and 3 to 5 X IO5 CFU/mL, respectively. Confluent plates of viral producers were incubated for 24 hours in DMEM-10% FCS supplemented as for the ES cells, without LIF. supernatants were collected, filtered through a 22-pm filter (Millipore, Bedford, MA), and supplemented with LIF and 2 pg/mL polybrene" before addition to the ES Cells. Freshly passaged ES cells were resuspended at 5 X IO4 cells in 5 mL viral supernatant per 25-cm2 gelatinized flask and were incubated as usual with 1 or 2 changes of the viral supernatant over 24 hours. Adherent cells were rinsed with PBS and fresh medium was added for a further 24-hour culture period. At 48 hours postinfection ES cells were obtained and transferred to fresh flasks with 0.8 mg/ mL G418 (GIBCO-BRL). Polyclonal populations of G418-resistant cells were expanded for further study. In all cases a mock-infected (polybrene only) control was maintained. To generate sublines from virally infected and parental cell lines, 25 or 50 cells were placed into individual gelatinized wells of a 96well plate. When colonies of ES cells were visible, cells were obtained and expanded as described above. RNA extraction, cDNA synthesis, and polymerase chain reaction (PCR) ampl$cation. Single-cell suspensions were derived from parental, neo-transduced, or HOXBI-transduced ES cells at various

From bloodjournal.hematologylibrary.org by guest on July 14, 2011. For personal use only. HELGASON ET AL

2742

stages of the primary differentiation. In addition, pools of erythroid (eight colonies) and GM or GEMM (four colonies) colonies were plucked after 8 days in methycellulose. RNA extraction and cDNA synthesis for each of these sample types were performed as described previously.“9 PCR conditions (pH, magnesium, and KC1 concentrations. gene 32 protein) were optimized for first-strand cDNA synthesis. This procedure has been shown to quantitatively preserve the differences between frequent and rare transcripts over a wide range for cell ~ numbers ranging from 1,OOO to 1 0 . cells.‘‘ Southern blot ana/vsis. High-molecular-weight genomic DNA was isolated from undifferentiated ES cells by standard procedures” to determine the clonality of retrovirally infected ES cells. The DNA was digested with either Ssr I, which cuts once in the viral LTRs to release the proviral genome, or EcoRI, which cuts once in the proviral genome to release fragments unique to the integration site. The digested DNA was separated on a 1% agarose geland passively transferred onto an ionic nylon membrane (Zeta-probe; Bio-Rad. Mississauga, Ontario, Canada). Similarly, IO-yL aliquots ofthe PCR-amplified cDNA were electrophoresed and transferred. Probes were labeled with ”P-dCTP (3,OOO Cilmmol: Amersham, Oakville. Ontario, Canada) by random priming and were purified on Sephadex-G50 columns (Pharrnacia Biotech, Uppsala, Sweden) before use. Blots were hybridized for 20 hours at 65°C in 4.4X SSC (SSC: 3 molL sodium chloride, 0.3 molL tri-sodium citrate), 7.5% formamide, 0.75% sodium dodecyl sulfate (SDS), 1.5 mmol/L EDTA, 0.75% skim milk powder. 370 ygImL salmon sperm DNA. and 7.5% dextran sulfate. Membranes were washed twice at65°C for 30 minutes each in 0.3X SSC, 0.1% SDS, and I mgImL sodium pyrophosphate. To reprobe blots, they were stripped in a l % SDS solution at 95°C for 20 to 30 minutes and tested for the absence of a signal by overnight exposure toKodak X-OMAT XARSfilm (Eastman Kodak. Rochester, NY). Probes usedin these studies include the following: the HOXR4 full-length cDNA; an Xho IISal I fragment ofthe neo resistance gene derived from pMC1Neo”; a 295-bp Sau3A-Acc I fragment of &major globin encompassing the first exon and intron (provided by P. LeBoulch, Massachusetts Institute of Technology, Boston); and a 1.8-kb cDNA fragment of GATA-I isolated from the pXM-GATA1 expression vector (provided by S. Orkin, Howard Hughes Medical Institute, Boston, MA). A 269-bp fragment of embryonic globin (pH-I) to be used as a probe was PCR-amplified from the genomic DNA of undifferentiated ES cells using the 5‘ primer-S’TTGTTACAGCTCCTGGGCAA3’ and the 3’ primer-S’CCCCAAAAAGTCAATGTTATTAAG3’. Similarly, a 98-bp cDNA fragment of HoxhR was PCR-amplified using the 5’ primer-S’CCCAGCAGTAAATGCGAGCAG3’ andthe 3’ primer-5’AGCCTACTTCTTGTCACCCTT3 ’. RNase protection. Total cellular RNA was isolated from undifferentiated ES cell populations using the TRIzol reagent (GIBCOI BRL) and manufacturer’s instructions. A template for RNase protection was prepared by subcloning a 256-nucleotide EcoRI-Apa I fragment of HOXR4 cDNA into a bluescript vector. The RNase protection assay was performed using standard techniques.” A control probe, protecting a 150-nucleotide fragment of mouse 0-actin. was used to ensure that equivalent amounts of RNA were utilized for each sample. RESULTS Overexpression qf HOXB4 enhances the hematopoietic diferenriation of CCE ES cells. To determine if Hox genes

might be regulators of hematopoiesis during ontogeny, undifferentiated CCE ES cells were transduced with either a HOXB4 or a Neo (control) retrovirus by supernatant infec-

e m

0 Q) S

x

0 X

a

z

a +

Actin

Fig l. Expression of HOXB4 from the retroviral LTR. Total RNA was isolated from undifferentiated parental, neo-transduced. and HOXBQtransducedCCE ES cells. RNase protection assays were performed using a HOX84 probe to demonstrate transcription from the retroviral LTR. An actin probe was used to confirm the presence of equivalent amounts of RNA in each sample.

tion. Figure I demonstrates expression of the HOXR4 message from the retroviral insert in undifferentiated ES cells. Although there did not appear to be endogenous expression of this gene in undifferentiated cells, the more sensitive RTPCR technique (detailed in Fig 4) suggests thatverylow levels may be present at day 4 and day 8. Parental cells and retrovirally transduced cells, selected for G418 resistance, were differentiated in vitro as described. No significant differences in the ability to form EBs in the primary differentiation were detected among the three groups yielding plating efficiencies of 3 . 0 % -+ 3.8% for parental, 46.1% -+ 1 5 8 % for Neo-transduced, and 32.6% 5 S.096 for HOXB4-transduced cells (mean 2 SEM of four determinations). In addition, HOXB4 overexpression did not alter the growth kinetics (number of cells per EB; not shown) or total number of cells generated in these cultures (Fig 2). Thus, HOXB4 altered neither the primary plating efficiency nor the overall yield of cells during the primary differentiation. Replating of these cells in conditions to detect hematopoietic progenitors showedthat for parental,neo-transduced, and HOXB4-transduced cells the appearance of various hematopoietic progenitors followed a time course similar to

From bloodjournal.hematologylibrary.org by guest on July 14, 2011. For personal use only. HOXB4 ENHANCES ES HEMATOPOIESIS IN VITRO

2743

l Fig 2. HOX64overexpressiondoes not change the cell yield from primary dflercwrtiation cultures. Equivalentnumbers (500) ofparental,neo-transduced, or HOX64-transduced CCEES cells were dfferentiated in methylcellulose for 8 to 20 days. No significant differences in the number of EBs formed were detected among the three groups. At each time point EBs were obtained and cell yields were determined for parental (-4, Neo-transduced (- -), and cultures.Valuesare the HOXWtrensduced I-) mean f SEM of four separate determinations.

8

14

that observed by others using the CCE cell line. However, a pronounced influence of HOXB4 overexpression was seen on the numbers of erythroid colony-forming (CFC-E) and mixed-lineage (granulocyte/erythroidmacrophage/megakaryocyte; CFC-GEMM) progenitors detected (Fig 3). As shown in two representative experiments (n = 6), there was no obvious effect on the number of primitive (large, nucleated cells in small c~lonies'~) erythroid progenitors detected (day 7 or day 10). However, overexpression of HOXB4 increased the number of definitive erythroid colonies observed at all time points examined between days 12 and 20 of the

CFC-E

CFC-GM

10

12

16

18

20

Days oi Plimsry Dllhnnliation

primary differentiation. There was also a marked increase in the number of CFC-GEMM detected in HOXB4-transduced cultures compared with either Neo-transduced or parental controls. In contrast, overexpression of HOXB4 did not significantly affect the number of CFC-GM observed. Overall, there was a slight increase in the total number of hematopoietic CFC throughout the primary differentiation. The increase in definitive, but not primitive, erythropoiesis was confirmed by quantitating each type of erythroid colony at day 10 and day 12 when the increase was first observed. On both days there was no significant difference in the num-

CFC-GEMM

Total CFC

Days of Primary Differentiation Fig 3. HOXB4 overexpression enhances the hematopoietic differentiation of CCE ES cells. Equivalent numbers of parental (-4,Nso-transCCEES cells were differentiated in methylcellulose for various periods oftime. EBs were obtained duced (- -1, or HOXBQtransduced (-1 in the presence of3 U/mL Epo and160 ng/mL SF supplemented and single-cell suspensions were plated in secondary methylcellulose cultures with 30 ng/mL interleukin-3 (IL-3) plus 30 ng/mL IL-6. Results from two representative experiments (total of six) are shown.

From bloodjournal.hematologylibrary.org by guest on July 14, 2011. For personal use only. HELGASON ET AL

2744

A

day 0

day 4

day 8

" " -

day 1 2

day 18

B

PE

PNB4PNEMPNB4PN84PNB4

day 12

day 8

dE

N B4 B4 B4

HOXB4

GM GEMM B4 B4 B4

.~...

Hoxb8

HOD4

pHlglobin

PH1-globin blobin

@globin GATA-1

Actin

Fig 4. Expression of various genes in EBs isolated on different days of primary differentiation. Total RNA was isolated from either 50,000 cells derived from parental (P), neo-transduced(NI, or HOXWtransduced ( 8 4 ) CC€ EBs at various stages ofthe primary differentiation (A) or from pools of eight erythroid or fourG M or GEMM colonies (B). Sampleswere reverse transcribedand PCR-amplifiedto generate representative total cDNA populationswhich were electrophoresed and blotted. The resultant Southern blots were hybridized to probes for HOXB4, Hoxb8, pH-1 globin, adult P-globin, GATA-1, and actin as described.

ber of primitive erythroid colonies detected in neo- or HOXB4-transduced cultures (376 ? I 15 v 493 ? 156; mean ? SEM of four determinations). In contrast, HOXB4-transduced cells gave rise to 1,534 2 245 definitive erythroid colonies per culture on day 12 compared with 290 t 44 per culture arising from neo-transduced cells. A similar, though less pronounced, difference was also observed on day IO. The identity of the colonies scored as primitive or definitive was confirmed by plucking and pooling individual colonies to examine globin expression patterns. These experiments confirmed that the primitive erythroid colonies expressed primarily pH-I globin, whereas colonies scored as definitive erythroid expressed primarily adult &globin (Fig 4B). Table 1 summarizes the results from six experiments comparing the ratios of progenitors detected in HOXBCtransduced cultures to those initiated with parental or Neo-transduced cells in the various experimental conditions after 14 days or 16 days of primary differentiation. Conditions for the detection of hematopoietic progenitors were varied throughout the course of the study to optimize the system and to confirm the specificity of the HOXB4 effect. Regardless of whether a defined cytokine cocktail or SCCM was used for the detection of hematopoietic progenitors similar magnitudes of difference were observed between HOXB4-trans-

duced and control cells. However, greater numbers of progenitors were observed for all groups in the former plating condition, especially in the CFC-E and total CFC compartments. For example, at day 14 the number of erythroid progenitors detected ranged from 316 to 1,840 per culture in the parental cell line. The range was 138 to 1,030 on day 16. Similar magnitudes of variationwere observed in all progenitor types on both days regardless of whether parental, neo-transduced, or HOXB4-transduced cells were used. Ratios compared to parental controls were calculated within individual experiments to enable comparison. This analysis showed a twofold to threefold increase in CFC-E atboth day 14 ( P S .05) and day 16 ( P = .05). CFC-GEMM were increased sixfold above controls in HOXB4-transduced cells at both time points ( P S .05 at day 14 and P S . 0 1 at day 16 compared with Neo-transduced cells). Overexpression of HOXB4 increased total numbers of hematopoietic CFC twofold ( P = .05 on day 14 and P s . 0 5 on day 16 compared with Neo-transduced cells), with no significant differences in the numbers of CFC-GM detected. Cytospin analysis was performed on colonies derived from day 14 primary differentiation cultures of Neo-transduced and HOXB4-transduced CCE ES cells to confirm colony identification bawd on in situ scoring. Analysis of 46 randomly plucked

From bloodjournal.hematologylibrary.org by guest on July 14, 2011. For personal use only. HOXB4 ENHANCES ES HEMATOPOIESIS IN VITRO

2745

Table 1. Increased Numbersof CFC-E and CFC-GEMM Are Detecteda t Days 14 and 16 of Primary Differentiationin Cultures initiatedWith HOXBQTransduced ES Cells Progenitors Relative to Parental ES Grouo

CFC-E

CFC-GM

CFC-GEMM

Total CFC

Day 14 Neo-transduced HOXB4transduced

0.96 -C 0.11 2.19 i 0.37'

0.93 t 0.12 1.32 f 0.42

1.09 i 0.22 5.94 t 1.74*

0.90 f 0.13 1.95 +- 0.34'

Day 16 Neo-transduced HOXB4transduced

0.89 2 0.13 3.48 -C 0.70*

0.85 i 0.10 1.05 i 0.12

0.93 i 0.20 6.56 -C 0.72t

0.84 i 0.13 1.88 ? 0.22*

Equivalent numbers of parental, Neo-transduced, or HOXB4transduced CCE ES cells were differentiated in m (n = 4) orIscove's (n = 2) methylcellulose for 14 or 16 days. EBs were obtained and single-cell suspensions were plated in secondary methylcellulose cultures in the presence of 3 U/mL Epo and 160 ng/mL SF supplemented with either 2% SCCM (n = 2) or 30 ng/mL IL-3 plus 30 ng/mL IL-6 (n = 4) to detect hematopoietic progenitors. Values presented are the ratio of progenitors, compared with parental, detected in Neo-transduced or HOXB4 transduced cultures. Statistical analysis to compare populations was performed using a Student's t-test. P S .05, t P S ,001 compared with Neo-transduced ratios.

colonies derived from HOXB4-transdud cells showed that 27 (59%) were mixedgranulocyte/erythroid/mmphage/megakaryocyte (GEMM), 12 (26%) were megakaryocyte-*id or eryh i d , and 7 (15%) were pure granulocyte/macrophage (GM). In contrast,only 7 of 22colonies(32%)arisingfrom Nee transduced cells were multilineage (GEMM), while 9% (2 of 22) were erythroid or erythroid-megakaryocyte and the remainder (13 of 22; 59%) were GM. Thus, this examination showed that both cultures contained a variety ofhematopietic cells and confirmed the enhanced number of erythroid and multilineage colonies observed in HOXB4-transduced cultures. No cells with abnormal morphology were detected in the HOXB4 cultures. Total cellular RNA was isolated at various stages of the primary differentiation from EBs derived from parental, Neo-transduced, and HOXB4-transduced ES cells. After reverse transcription and PCR-amplification, the total cDNA samples were analyzed by Southern blot analysis. Results of a representative hybridization (n = 2) withavariety of probes are presented in Fig 4A. HOXB4 expression was detectable at very low levels in the EBs at day 4 and day 8 of differentiation. As expected, higher levels of HOXB4 were detected in the HOXB4-transduced population at all times. Interestingly, there was an apparent upregulation of expression at later time points (compare day 8 levels with day 12; Fig 4A), possibly because of increased transcription from the viral LTR in differentiated cells. We examined levels of HOXB4 expression from the viral LTR in various colony types by plucking colonies, isolating RNA, and generating cDNA. As shown in Fig 4B, expression levels were very high in colonies scored as definitive erythroid, GM, and GEMM. Although somewhat lower levels were detectable in primitive erythroid colonies, these levels were still markedly higher than endogenous HOXB4 levels, which were virtually undetectable. Adult @-globinexpression was first observed at day 8 of the primary differentiation, with levels increasing greatly between day 8 and day 12. A pronounced enhancement of expression was observed in the HOXB4-transduced cells. More impressively, this difference was still readily apparent at day 18. Thus, there wasa correlation between the in-

creased @-globinexpression in the primary cultures and the enhancement of erythropoiesis observed after replating of the HOXB4-transduced CCE cell line. In contrast, overexpression of HOXB4 had little or no effect on the levels of embryonic @H-l globin, GATA-1, or Hoxb8, a gene 5' to Hoxb4, detected in the differentiating EBs. Hematopoietic progenitors of the EFC-I ES cell line are increased by overexpression of HOXB4. To r d e out that the results obtained with the CCE ES cells were cell-line specific, similar studies were performed with EFC-1 ES cells transduced with either a HOXB4 or a Neoretrovirus. Quantitative examination of the hematopoietic differentiation of this line showed a timecourse which resembled that of CCE. Similar to the observation with the CCE cell lines, HOXB4 overexpression altered neither the plating efficiency (25.4% ? 2.6%,16.6% t 1.5%, and24.5% t 3.3% for parental, neo-transduced, and HOXB4-transduced cells, respectively; mean 2 SEM for three separate determinations) nor the cell yield (for example, day 14 of primary differentiation cell yields were [ X 10'1: parental, 11.8 2 1.2; Neo-transduced, 9.6 2 1.0; and HOXB.l-transduced,11.7 ? 0.3; mean ? SEM for three separate determinations). EBs derived fromtheparentalandtransducedEFC-Icell lines were dismpted at day 14 ofprimarydifferentiationand cells were plated for detection of progenitors. As observed with the CCE ES cells, HOXB4-transduced EFC-l cells gave rise to anincreasednumberofdefinitiveerythroid CM3 andCFCGEMM leading to anincrease in the total number of hematopoietic precursors detected (Fig 5A). No significant differences in the number of CFC-GM were observed among the three lines. Five sublines were generated from each of the three populations to assess whether the observations might be attributed to clonal variations within the EFC-1 cell line. Selection of unique populations was confirmed by Southern blot analysis to examine retroviral integration sites (Fig 6). RNase protection was used to verify expression of HOXB4 from the viral LTR in each of the sublines (Fig 7). All sublines were differentiated in a manner similar to the polyclonal populations and the number of hematopoietic CFC present at day 14 was examined by replating in secondary meth-

From bloodjournal.hematologylibrary.org by guest on July 14, 2011. For personal use only. HELGASON ET AL

2746

A

Fig 5. Overexpression of HOXB4 enhances thehematopoietic differentiation of the EFC-l ES cell line. Polyclonal populations of parental (01,neolanil56

I

Total CFC

7 m

Subline ylcellulosecultures(Fig5B). As for the CCE cellline,the enhancement of hematopoiesis appearedto be restricted to CFCE and CFC-GEMM with a fivefold increase in the number of erythroid progenitors ( 1,296 t 155 v 250 2 3 1;P 5 .OO1;mean 2 SEM of five sublines) and a %fold increase in the number of CFC-GEMM (161 2 36 v 3.1 2 2.2; P S .05; mean t SEM of five sublines) detected in the HOXB4-transduced cell lines compared with the neo-transduced cell lines. There was no significant effecton granulocyte-macrophage progenitor (CFC-GM) numbers. Overall there wasa marked increasein the total number of hematopoietic CFC detected. DISCUSSION

There is increasing evidence that Hox genes are involved in regulating the maintenance andor differentiation events

duced (El) EFC-1 EScells (500 per culture)weredifferentiated in methylcellulose t o give rise t o EBs that were obtained at day 14. Single-cell suspensions were plated insecondary methylcellulose cultures in the presence of 3 UlmL Epo, 160 nglmL SF, and 2% SCCM t o detect hematopoietic progenitors (A). Results are expressed as the mean t SEM of duplicatedishes in two experiments. Sublines were generated fromeach of the polyclonal populations and each of these sublines (five per group) was differentiated in the same manner as thepolyclonal populations. CFC-erythroid, CFC-GM, CFCGEMM, and total CFC (B) were detected byplating single-cell suspensions derived fromday 14 EBs in methylcellulose supplemented as described forthe polyclonal population. Results are expressed as the mean t SEM for duplicate dishes in two independent experiments. The values above each set of sublines are the mean? SEM for the five sublines. Significance was determined using the two-tailed Student's t-test: * P S .001; * * P S .02; ***P S .005.

within the hematopoietic system. Of particular interest is HOXB4, which is expressed in the mesoderm and fetal liver at stages that correlate with hematopoietic development and differentiation during embryogenesis. In the adult hematopoietic system, HOXB4 is expressed in the more primitive subpopulations of human CD34' BM cells and its expression is downregulated in more mature subpopulations? Studies with murine BM transduced with a HOXB4 retrovirus suggest that this gene enhances the proliferative potentialof hematopoietic cells, including the self-renewal capacity of HSCs, in vivo." Interestingly, there was no apparent effect on differentiative processes and overexpression did not lead to leukemogenesis. In light of these provocative findings with adult BM, we examined the role of HOXB4 on the earliest stages of development and differentiation of the he-

From bloodjournal.hematologylibrary.org by guest on July 14, 2011. For personal use only. HOXB4 ENHANCESESHEMATOPOIESIS

IN VITRO

2747

Fig 6. Southern blot analysis of retroviral integration into the EFC-1 subline. EFC-1 ES cells were infected with a retrovirus containinga neo' gene with or without theHOXB4 cDNA.Infected cells were selected in the presence of G418 and DNA was isolated from parental, neo-transduced, and HOX84-transduced undifferentiated ES cells. The DNA was cutso as t o release either the provirus (Sst I digest) or t o cut once within the viral genome t o show sites of viral integration (EcORI digest). Blots were probed with a single-copy gene, the erythropoietinreceptor, t o normalize DNA levels in each lane (internal).

21kh

-

3.9 kb

-

27kb

-

2.O kh

-

Internal

-

matopoietic system by inducing overexpression in ES cell lines. Under the culture conditions used in these studies, both the CCE and the EFC-I ES cells differentiated efficiently to give rise to hematopoietic progenitors detectable as early as day 8. In accordance with previous studie~'~.''.'~ the earliest progenitors detected gave rise to colonies with the morphology typical of the primitive erythroid lineage (small colonies of large, nucleated cells). Throughout the time course of differentiation of both cell lines there was a gradual switch from primitive to definitive erythropoiesis. This switch corresponded with the appearance of myeloid progenitors (CFCGM and CFC-GEMM). Mast cell progenitors (included within the CFC-GM determinations) were predominant at the latest time points examined (days 18 to 20). The numbers of definitive erythroid and myeloid progenitors detected were similar to those reported We by detected fewer primitive erythroid precursors, possibly because of the use of FCS rather than plasma-derived serum in the secondary methylcellulose cultures. Overexpression ofHOXB4 significantly enhanced the

number of hematopoietic progenitors detected atvarious times in the ES differentiation cultures. However, in sharp contrast to its effects in adult BM. HOXU4 expression elicited selective enhancement of specific pools within the ES cell hematopoietic compartment. Although there was no apparent influence on the primitive (yolk-sac like) erythroid progenitors, this lack of effect might be attributed to comparatively low levels of HOXU4 expression from the viral LTR in this cell population. However, because the level of engineered expression was considerably higher than endogenous expression (compare day 8 primitive erythroid of neo-transduced and HOXB4-transduced, Fig 4B) it seems likely that HOXB4 does notinfluence erythropoiesis at this stage of differentiation. In contrast, the numberof definitive erythroid (CFC-E) and myeloiderythroid (CFC-GEMM) progenitors was significantly increased. The relative lack of effect on CFC-GM progenitors suggests that the most significant consequence of constitutive HOXB4 expression is the enhanced proliferation of a common pluripotent precursorthat has differentiated from the pure myeloidpathwaytoward the erythroid lineage.

neo-transduced HOXB4-transduced parental M

1

2

3

4

S

P

5.8 1

2

3

4

5

P

1

2

3

4

S

HOXB4

-

Actin

Fig 7. RNase protection detects HOXB4expression from theviral LTR in EFC-1 ES cells. Total RNA was isolated from undifferentiated parental, neotransduced, and HOXB4transduced EFC-1ES cells. RNase protection assays were carried out using a HOXB4 probe or an actin probe as described for Fig 1.

From bloodjournal.hematologylibrary.org by guest on July 14, 2011. For personal use only.

HELGASON ET AL

2748

Our observation that the erythroid lineage is most significantly enhancedmight reflect therelative developmental stages of the populations examined. In contrast to the adult BM-derived populations used previously, it has been suggested that ES-derived hematopoietic progenitors are equivalent in properties to yolk-sac or early fetal liver population^.^",^' Because transcription factors are thought to functionin a coordinated mannerto generate a cascade of events leading to phenotypic changes in the cells of interest,” it may only be the ES-derived definitive erythroid andmultilineageprogenitorsthat possess the accessory molecules required for a phenotypicresponse to H O X B 4 overexpression. The lack of effect on CFC-GMsuggests that these progenitors do not express the necessary cofactors required to induce a proliferative or differentiative response. Alternatively, differences between the in vivo environment and that of isolated stem cells may be reflected by changes in either cell-surface molecules or responsiveness to external stimuli that influence the capacity of a cell for proliferation in a specific lineage. It may be possible to use these differences between the progenitors to elucidate the molecular events involved in the H O X B 4 response. However, further clarification of this point awaits the identification and isolation of the hematopoietic stem cell(s) generated in ES differentiation cultures. Studies of genes expressed in differentiating EBs correlate with the observation of enhanced erythropoiesis in HOXB4transduced ES cells. Expression of the erythroid-specific gene adult /?-globin was dramatically increased in HOXB4transduced cells, raising the possibility that HOXB4 is involved its transcription. Although this may be a direct effect, it is also possible that HOXB4 alters the transcription of other factors, including other Hox genes, involved in controlling /?-globin expression. Despite the fact that few cellular targets of Hox genes have been identified,’3 there is ample evidence to suggest that cross-regulation amongst the various proteins may be important for their Preliminary results of expression levels in EB suggest that overexpression of HOXB4 does not influence the low level of expression of the more 5‘ gene Hoxb8 at any time during the differentiation time course (Fig 4A). Despite this observation, the effect of altered HOXB4 expression on the transcription of other Hox genes in relevant cell populations is certainly one avenue that must be explored when it becomes possible to isolate pure hematopoietic populations from differentiated EB. We have determined that constitutive HOXB4 expression in ES cells leads to enhanced proliferation of erythroid and mixed erythroid/myeloid progenitors without a reduction in granulocyte/macrophage progenitor yield. These findings suggest a predominantly proliferative effect of HOXB4 rather than one impacting on lineage commitment as observed previously for adult BM. However, differences in both the stage and lineage-specificity of the effects observed in the two systems suggest that the in vitro differentiation of ES cells may provide a system to study the role of Hox proteins in blood development as well as a means for elucidating, at the molecular level, some of the mechanisms by which this family of regulatory proteins influence hematopoiesis.

ACKNOWLEDGMENT

The authors thank Patty Rosten and technical assistance.

Chris R. Simms tor expert

REFERENCES

I . Graham A, Papalopulu N, Krumlauf R: The murine and drosophila homeobox gene complexes have common features of organization and expression. Cell 57:367, 1989 2. McGinnis W,KrumlaufR:Homeobox genes andaxial patterning. Cell 68:283, 1992 3 . Kenyon C: If birdscanfly,why can’t we? Homeotic genes and evolution. Cell 78: 175, 1994 4. Krumlauf R: Hox genes in vertebrate development. Cell 78:191, 1994 5. Lawrence HJ, Largman C: Homeobox genes in normal hematopoiesis and leukemia. Blood 80:2445, 1992 6. Lawrence HJ, Stage KM, Mathews CHE, Detmer K, Scibienski R, MacKenzie M, Migliaccio E, Boncinelli E, Largman C: Expression of Hox C homeobox genes in lymphoid cells. CellGrowth Different 4:665, 1993 7. Petrini M, Quaranta MT, Testa U, Samoggia P, Tritarelli E, Care A, Cianetti L, Valtieri M, Barletta C, Peschle C: Expression of selected human HOX-2 genes in BIT acute lymphoid leukemia and interleukin-2/interleukin-I P-stimulated natural killer lymphocytes. Blood 80:185, 1992 8. Lawrence HJ, Sauvageau G, Ahmadi N, Lopez AR, LeBeau MM, Link M, Humphries K, Largman C: Stage- and lineage-specific expression of the HOXAIO homeobox gene in normal and leukemic hematopoietic cells. Exp Hematol 23:1160, 1995 9. Sauvageau G, Lansdorp PM, Eaves CJ, Hogge DE, Dragowski WH, Reid DS, Largman C, Lawrence HJ, Humphries, RK: Differential expression of homeobox genes in functionally distinct CD34’ subpopulations of humanbonemarrow cells. Proc NatlAcad Sci USA 91:12223, 1994 10. Giampaolo A, Sterpetti P, Bulgarini D, Samoggia P, Pelosi E, Valteri M, Peschle C:Key functional role and lineage-specific expression of selected HOXB genes in purified hematopoietic progenitor differentiation. Blood 84:3637, 1994 1 1. Sauvageau G, Thorsteinsdottir U, Eaves CJ, Lawrence HJ, Largman C, Lansdorp PM, Humphries RK: Overexpression of HOXBl in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo. Genes Dev 9:1753, 1995 12. Graham A, Papalopulu N, Lorimer J, McVey JH, Tuddenham EGD, Krumlauf R: Characterization of a murine homeobox gene, HOX-2.6,related to drosophila deformed gene. Genes Dev 2:1424, 1988 13. Holland PWH, Hogan BLM: Expression of homeo box genes during mouse development: A review. Genes Dev 2:773, 1988 14. Keller G, Kennedy M, Papayannopoulou T, Wiles MV: Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol Cell Biol 13:473, 1993 15. Schmitt RM, Bruyns E, Snodgrass HR: Hematopoietic development of embryonic stem cells in vitro: Cytokine and receptor gene expression. Genes Dev 5:728, 1991 16. Wiles MV: Embryonic stem cell differentiation in vitro, in Wassarman PM, DePamphilis ML (eds): Methods in Enzymology, v01 225. San Diego, CA, Academic, 1993, p 900 17. Zmuidzinas A, Fisher K-D, Lira SA, Forrester L, Bryant S. Bernstein A, Barbacid M: The vav proto-oncogene is required early in embryogenesis but not for hematopoietic development in vitro. EMBO J 14:1, 1995 18. Warren AJ, Colledge WH, Carlton MBL, Evans MJ, Smith

From bloodjournal.hematologylibrary.org by guest on July 14, 2011. For personal use only. HOXB4 ENHANCES ES HEMATOPOIESIS IN VITRO

2749

AJH, Rabbitts TH: The oncogenic cysteine-rich LIM domain protein rbtn2 is essential for erythroid development. Cell 78:45, 1994 19. Weiss MJ, Keller G, Orkin SH: Novel insights into erythroid development revealed through in vitro differentiation of GATA-1embryonic stem cells. Genes Dev 8:1184, 1994 20. Tsai F-Y, Keller G, Kuo FC, Weiss M, Chen J, Rosenblatt M, Alt F W , Orkin SH:An early haematopoietic defect in mice lacking the transcription factor GATA-2. Nature 371:221, 1994 21. Nichols J, Evans EP, Smith AG: Establishment of germ-line competent embryonic stem (ES) cells using differentiation inhibiting activity. Development 110:1341, 1990 22. Humphries RK, Eaves AC, Eaves CJ: Self-renewal of hemopoietic stem cells during mixed colony formation in vitro. Proc Natl Acad Sci USA 78:3629, 1981 23. Hawley RG, Fong AZC, Bums BF, Hawley TS: Transplantable myeloproliferative disease induced in mice by an interleukin-6 retrovirus. J Exp Med 176:1149, 1992 24. Davis L, Kuehl M, Battey J: Subcloning fragments into plasmid vectors and plasmid construction, in Davis LG, Kuehl Battey JF (eds): Basic Methods in Molecular Biology. Norwalk, C T , Appleton and Lange, 1994, p 277 25. Cone RB, Mulligan RC: High efficiency gene transfer into mammalian cells: Generation of helper-free recombinant retrovirus with broad mammalian host range. Proc Natl Acad Sci USA 81:6349, 1984 26. Lovell-Badge RH: Introduction of DNA into embryonic stem cells, in Robertson El (ed): Teratocarcinomas and Embryonic Stem Cells: A Practical Approach. Oxford, UK, IRL, 1987, p 153 27. Davis L, Kuehl M, Battey J: Preparation of genomic DNA, in Davis LG, Kuehl WM. Battey JF (eds): Basic Methods in Molecular Biology. Norwalk, CT, Appleton and Lange, 1994, p 305 28. Thomas KR, Cappechi MR: Site-directed mutagenesis by

WM.

gene targeting in mouse embryo-derived stem cells. Cell 51503, 1987 29. Davis L, Kuehl M, Battey J: Preparation and analysis of RNA from eukaryotic cells, in Davis LG, Kuehl WM, Battey JF (4s): Basic Methods in Molecular Biology, Norwalk, CT, Appleton and Lange, 1994, p 319 30. Chen U: Careful maintenance of undifferentiated mouse embryonic stem cells, in Compans RW, Cooper M, Koprowski H, McConnell I, Melchers F, Nussenweig V, Oldstone M, Olsnes S , Potter M, Saedler H, Vogt PK, Wagner H, Wilson I (4s): Current Topics in Microbiology and Immunology, v01 177. Berlin, Germany, Springer-Verlag, 1992, p 3 3 1. Burkert U, von Ruden T, Wagner E F Early fetal development from in vitro differentiated embryonic stem cells. New Biologist 3:698, 1991 32. Orkin SH: Transcription factors and hematopoietic development. J Biol Chem 270:4955, 1995 33. Edelman GM, Jones FS: Outside and downstream of the homeobox. J Biol Chem 268:20683, 1993 34. Zappavigna V, Renucci A, Izpisua-Belmonte J-C, Urier G, Peschle C, Duboule D: HOX4 genes encode transcription factors with potential auto- and cross-regulatory capacities. EMBO J 104177, 1991 35. Popper1 H, Featherstone MS: An autoregulatory element of the murine Hox-4.2 gene. EMBO J 11:3673, 1992 36. Capovilla M, Brandt M, Botas J: Direct regulation of decapentaplegic by ultrabithorax and its role in drosophila midgut morphogenesis. Cell 76:461, 1994 37. Zappavigna V, Sartori D, Mavilio F: Specificity of HOX protein function dependsonDNA-protein and protein-protein interactions, both mediated by the homeo domain. Genes Dev 8:732,1994