Plant Cell Tiss Organ Cult DOI 10.1007/s11240-010-9825-2
ORIGINAL PAPER
Enhanced resistance against bacterial wilt in transgenic tomato (Lycopersicon esculentum) lines expressing the Xa21 gene Amber Afroz • Zubeda Chaudhry • Umer Rashid Ghulam Muhammad Ali • Farhat Nazir • Javaid Iqbal • Muhammad Rashid Khan
•
Received: 7 February 2010 / Accepted: 13 August 2010 Ó Springer Science+Business Media B.V. 2010
Abstract To enhance bacterial wilt resistance in tomato plants and simplify the protocol of Agrobacterium tumefaciens mediated gene transfer, parameters affecting transformation efficiency in tomato have been optimized. A. tumefaciens strain EHA101, harboring a recombinant binary expression vector pTCL5 containing the Xa21 gene under the control of the CaMV 35S promoter was used for transformation. Five cultivars of tomato (Rio Grande, Roma, Pusa Ruby Pant Bahr and Avinash) were tested for transformation. Transformation efficiency was highly dependent on preculture of the explants with acetosyringone, acetosyringone in co-cultivation media, shoot regeneration medium and pre-selection after co-cultivation without selective agent. One week of pre-selection following selection along with 400 lM acetosyringone resulted in 92.3% transient GUS expression efficiency in Rio Grande followed by 90.3% in Avinash. The presence and integration of the Xa21 gene in putative transgenic plants was confirmed by polymerase chain reaction (PCR) and Southern blot analyses with 4.5–42.12% PCR-positive shoots were obtained for Xa21 and hygromycin genes, respectively. Transgenic plants of the all lines showed resistance to bacterial wilt. T1 plants (resulting from selfA. Afroz (&) M. R. Khan Department of Biochemistry, Faculty of Biological Sciences, Quaid-i-Azam University, Islamabad, Pakistan e-mail:
[email protected] Z. Chaudhry Department of Botany, Hazara University, Mansehra, Pakistan A. Afroz U. Rashid G. M. Ali F. Nazir J. Iqbal Plant Genomics and Biotechnology Program, National Institute for Genomics and Advanced Biotechnology (NIGAB), PGRI, National Agriculture Research Center Park Road, Islamabad, Pakistan
pollination of transgenic plants) tested against Pseudomonas solanacearum inoculation in glasshouse, showed Mendelian segregation. Keywords Tomato Pseudomonas solanacearum Acetosyringone Hygromycin Agrobacterium mediated transformation Abbreviations BW Bacterial wilt Hpt Hygromycin phosphotransferase Hyg Hygromycin YEP Yeast extract phosphate IAA Indole-3-acetic acid PCR Polymerase chain reaction STEM Stem exudate VP Vascular portion
Introduction Tomato (Lycopersicum esculentum) has contributed greatly for the advancement in plant molecular biology because of short life cycle, small genome size and availability of transformation system (Izawa and Shimamoto 1996). It was the first food crop in U.S. for which a genetically engineered variety was marketed (Breuning and Lyons 2000) and also for which a disease resistance gene was positionally cloned (Martin et al. 1993). It is affected by various biotic and abiotic stresses. Bacterial wilt (BW) caused by Pseudomonas solanacearum is a serious plant disease in tropics and warm climate regions in the world, causes bacterial wilt to more than 200 plant species in 50 families including most of
123
Plant Cell Tiss Organ Cult
solanaceous plants such as potato, tomato, pepper, tobacco, eggplant, banana, cowpea, ginger and peanut (Hayward 1991). Economic impact of the disease appears to be manifested as result of a lack of farmer’s ability to propagate and grow disease free tomato with average tomato yield. Breeding programmes are too laborious in comparison to development of optimized genetic engineering protocol for production of resistant cultivars. Plant transformation is an alternative research tool for production of genetically modified commercial crops. There is no report regarding the tomato transformation for production of resistance against bacterial wilt. Different genes such as hrp B, hrp G, alpha-thionin and caffeoyl CoA 3-O-methyltransferase genes were reported to be important in bacterial wilt resistance for their involvement in infection process (Vasse et al. 2000; Carmona et al. 1993; Miao et al. 2008). Prf gene had been reported to improve resistance of tomato by activating the Pto and Fen pathways, with activation of systemic acquired resistance (Oldroyd and Staskawicz 1998). Proteins such as iron ABC transporter and ferredoxin-I protein were speculated for bacterial wilt resistance (Afroz et al. 2010; Huang et al. 2007). Xa21 gene is member of rice family that provides broad spectrum Xanthomonas resistance in rice. Resistance genes from monocots and dicots are highly conserved, suggesting their common functional domains (Song et al. 1995). Kinase activity of the Xa21 is very important for full resistance and it had been reported in orange for production of resistance against bacterial canker (Andaya and Ronald 2003; Omar et al. 2007; Mendes et al. 2009). Xa21 was reported for first time for development of bacterial wilt resistance in tomato. There is one preliminary report which is about the early investigations for integration of Xa21 gene in two tomato cultivars in T0 generation. But there is no data for the pathological test for wilt resistance and inheritance analysis in T1 generation (Chaudhry and Rashid 2010). Agrobacterium mediated genetic transformation is widely used as a low-cost, effective transformation method for both dicotyledonous and monocotyledonous plants. Genes which, had been reported against stresses using Agrobacterium mediated transformation of tomato were coat protein gene against leaf curl virus, bspA gene for drought tolerance and chitinase gene against Verticillium dahliae (Raj et al. 2005; Roy et al. 2006; Tabaeizadeh et al. 1999). Most of the reports are related to the optimization and improvement of the transformation protocols (Cortina and Culianez-Macia. 2004; Ahsan et al. 2007; Abu-ElHeba et al. 2008; Gao et al. 2009; Jabeen et al. 2009; Paramesh et al. 2010). Wide range of factors such as plant genotype, explants, acetosyringone concentration, co cultivation media and period had been reported to influence gene transfer efficiency from Agrobacterium to plant cells
123
(van Wordragen and Dons 1992; Uranbey et al. 2005). Simple, time and cost saving, reproducible and efficient tomato transformation method is still a basic demand for large-scale transgenic tomato production. In this study, tomato lines harboring Xa21 gene were developed and assessed for their resistance to BW. In addition, different transformation parameters were optimized to develop a simple, rapid and efficient method for Agrobacteriummediated genetic transformation in tomato.
Materials and methods The seeds of five tomato cultivars Roma, Rio Grande, Pusa Ruby, Pant Bahr and Avinash were provided by Horticultural Research Institute, National Agriculture Research Centre, Islamabad, Pakistan and the seeds were surface sterilized according to the method of (Park et al. 2003). To remove surfactants, sterilized seeds were rinsed three times with deionised sterile water and blotted on sterile filter paper. Seeds were germinated in the dark at 24°C on a germination medium (Table 1). Seedlings were grown for 7 days in a growth chamber in dark until sprouting and after wards shifted to fluorescent light (600 lmol m-2 s-1; 16 h light/8 h dark) at 25°C and 70% relative humidity. Hypocotyls and leaf sections (0.5–1.0 cm) obtained from 21 days old in vitro grown seedlings were used for Agrobacterium-mediated genetic transformation. Agrobacterium tumefaciens culture and cocultivation with explants The Agrobacterium tumefaciens strain, EHA101 with pTCL5, containing Xa21 gene, hygromycin phosphotransferase gene (Hpt) and an intron-GUS-gene was used for transformation (Fig. 1). A single colony of A. tumefaciens carrying the binary vector was inoculated in YEP (Table 1) broth containing 50 mg l-1 of kanamycin and 50 mg l-1 of Hyg and grown overnight on rotary shaker at 28 ± 2°C. Overnight-grown bacterial precultures were adjusted to OD600 nm = 1.0, unless otherwise stated, diluted tenfold with YEP broth, and grown for another 4 h. Cultures were collected by centrifugation at 4,0009g for 10 min at room temperature, and resuspended in cocultivation liquid medium (Table 1) with different concentrations of acetosyringone (Ahsan et al. 2007). Hypocotyls and leaf sections were incubated for 2 days on preculture medium (Table 1), before being subjected to A. tumefaciens infection. Precultured explants were submerged in the bacterial suspension for 15 min and blotted onto a sterile paper towel, and cultured on cocultivation medium (Table 1) for 3 days at 28 ± 2°C in the dark. To compare effect of acetosyringone concentration on transformation efficiency, Amino Acid
Plant Cell Tiss Organ Cult Table 1 Media used in tomato transformation Culture medium
Additional components
YEP media
10 g yeast extract, 10 g bactopeptone, 5 g NaCL, pH adjusted to 7.2
Germination medium
30 g l-1 sucrose, 4 g l-1 gelrite, pH 5.8
Preculture medium
0.5 mg l-1 IAA, 1.5 mg l-1 kinetin, 100 lM acetosyringone, 30 g l-1 sucrose, 4 g l-1 gelrite, pH 5.8
Co-cultivation liquid medium
0.5 mg l-1 IAA, 1.5 mg l-1 kinetin, 100, 200, 300, 400 lM acetosyringone, 30 g l-1 sucrose, pH 5.8
Co-cultivation medium
0.5 mg l-1 IAA, 1.5 mg l-1 kinetin, 100, 200, 300, 400 lM acetosyringone, 30 g l-1 sucrose, 4 g l-1 gelrite, pH 5.8
Washing medium
0.5 mg l-1 IAA, 1.5 mg l-1 kinetin, 500 mg l-1 cefatoxime, 30 g l-1 sucrose, pH 5.8
Pre-selection medium Selection medium
0.5 mg l-1 IAA, 1.5 mg l-1 kinetin, 30 g l-1 sucrose, 500 mg l-1 cefatoxime, 4 g l-1 gelrite, pH 5.8 0.5 mg l-1 IAA, 1.5 mg l-1 kinetin, 500 mg l-1 cefatoxime, 50 mg l-1 hyg, 30 g l-1 sucrose, 4 g l-1 gelrite, pH 5.8
Rooting medium
0.5 mg l-1 IAA, 50 mg l-1 hyg, 30 g l-1 sucrose, 4 g l-1 gelrite, pH 5.8
All media were prepared in MS basal medium including vitamins (Murashige and Skoog 1962) except YEP medium
from primary explants and transferred to the rooting medium for 2 weeks (Table 1). Rooted plants were shifted to pots containing mixture of soil, sand and farm manure in ratio of (1:1:1) after acclimatization. Fig. 1 Schematic diagram of a part of the T-DNA region of transformation vector pTCL5 RB Right Border, LB Left Border, 35S Cauliflower Mosaic Virus 35S promoter, GUS ß-Glucuronidase Coding Region, INT First Intron of the Caster Bean Catalase Gene, Hpt Hygromycin phosphotransferase
media (Toriyama and Hinata 1985) along with different concentrations of acetosyringone (50–400 lM) were used in cocultivation. GUS assay Histochemical GUS assay was carried out as described by Jefferson (1987). Hypocotyl and leaf sections were incubated in x-gluc solution containing 1 mg 5-bromo-4chloro-3-indolyl-b-D-glucuronide, 0.5% triton X-100, 20% methanol, and 50 mM sodium phosphate buffer (pH 7.0). The reaction mixture was incubated at 37°C overnight. The tissues giving blue coloration were scored as transgenics. Selection and shoot regeneration After co-cultivation, the infected explants were decontaminated with washing medium (Table 1). To improve number of selected regenerants, explants were placed on pre-selection medium (Table 1) without Hyg for 2, 3, 5, 7 and 15 days. Approximately 5 leaf sections and hypocotyls were cultured per dish and 100 leaf sections and hypocotyls were used for each treatment. Each experiment was repeated at least thrice. After 4 weeks, the regenerated shoots were transferred to the same selection media for further development. Elongated shoots (3–5 cm) were detached
Pathogenicity test P. solanacearum samples were collected from the Katha Saghral Research Station, Pakistan and revived on Tetrazolium medium (Kelman 1954). Bacterial strain was derived either from stem exudate (STEM) or from vascular portion (VP). Bacterial suspension of P. solanacearum was prepared by transferring isolated colonies from TZC plates into a tube with 5 ml sterile distilled water for each culture. Bacterial suspensions were transferred to a 100 ml beaker and cell density was adjusted to 108 cfu ml-1 (through Gennie spectrophotometer at 620 nm). Twenty-one days old seedlings of five tomato cultivars were used for inoculation. Plants were not watered a day before inoculation to reduce moisture content in the pots. Roots of tomato seedling were slightly injured by inserting a scalpel in the pot to facilitate bacterial infection. About 30 ml of bacterial suspension was poured on the surface of each pot. Inoculated plants were regularly watered and kept in growth chamber under white fluorescent light (600 lM m-2 s-1; 16 h light/8 h dark) at 25°C and 70% relative humidity. Appearance of symptoms was observed after 7, 21 and 27 days. Leaves of the transformed and control tomato lines were inoculated with P. solanacearum. DNA isolation and polymerase chain reaction (PCR) analysis Genomic DNA was extracted from leaf tissues of control and transgenic plants according to cetyltrimethylammonium
123
Plant Cell Tiss Organ Cult
bromide (CTAB) method (Sambrook and Russell 2001). Forward and reverse primers used for Hyg gene (670 bp) were F 50 –30 (GCTCCA TACAAGCCAACCAC) & R 50 –30 (CGAAAAGTTCGACAGCGTCTC) and for Xa21 gene (1.4 Kb) were F 50 –30 (ATA GCA ACT CAT TGC TTGG) and R 50 –30 (CGA TCG CTA TAA CAG CAA AAC). 10 ll PCR reaction contained 10 ng of the template DNA, containing 2 ll of 10 x PCR buffer, 0.6 ll of 0.1 M MgCl2, 1 ll of 10 mM dNTP mixture, 0.5 ll of 5 lM each forward and reverse primer, 0.3 ll of Taq polymerase and 4.1 ll of nanopure water. PCR reactions were run for 35 cycles with an initial denaturation step for 3 min (94°C), annealing temperature (51°C for Xa21 and 55°C for Hyg) for 2 min and extension (72°C) for 3 min, followed by 35 cycles of denaturation (94°C) for 1 min, annealing (52°C) for 1 min and extension (72°C) for 2 min with a final extension cycle of 15 min (72°C). The amplified PCR products were analyzed by agarose gel electrophoresis on 0.8% (w/v) agarose gel. Southern blot analysis The genomic DNA samples were extracted and purified from young leaves of transgenic and non-transgenic plants using CTAB method (Sambrook and Russell 2001). For this purpose 10 lg of total genomic DNA of selected lines was digested with Pst I and incubated at 37°C overnight. The digested DNA was fractionated on 0.8% agarose gel supplemented with 10 lg ml-1 ethidium bromide at 40 V in TAE buffer for 5–6 h. DNA was depurinated, denatured, neutralized and was transferred onto nylon membrane (Hybond-Amersham) by capillary method using 10X SSC (150 mM sodium citrate and 1.5 M NaCl) as transfer buffer for 20 h. The membrane was removed from gel and crosslinked in UV crosslinker (CL-1000 Ultraviolet Crosslinker-UVP) at 120 mJ cm-2 energy. To block the attachment of probe to non-specific nucleic acid binding sites, membrane was treated with 0.2 ml cm-2 prehybridization solution. Probing was done with biotin labelled Xa21 (839 bp) fragments using the Biotin DecaLabel DNA Labeling kit (Fermentas, Germany) for labeling purified DNA products of specific genes, following the manufacturer’s instructions. Stable transformation frequency and data analyses The systematic optimization of various parameters enabled us to obtain high levels of putative transgenic plants. Transformation frequency was defined as percentage of number of hypocotyls and leaf sections regenerated with positive PCR and Southern blot results divided by total number of explants used. The data was analyzed using MSTAT-C statistical software. The means were compared by least significance difference test (LSD) at P B 0.01
123
(Steel and Torrie 1984). Seeds obtained from the T0 generation were grown in glass house to raise T1 generation. T1 plants were tested for P. solanacearum inoculation.
Results Effects of the pre-selection without selection for 2, 3, 5 and 7 days on transformation frequency Different parameters effecting transformation were assessed on the basis of transient GUS expression of transformed leaf sections and hypocotyls (Fig. 2d, e). To examine effects of pre-selection period on transformation efficiency, co-cultivated explants after washing with washing medium (Table 1) were transferred to pre-selection medium for 0, 2, 5, 7 and 15 days. GUS expression was found to be maximum in Avinash, Rio Grande and Roma (90.8, 89.3 and 83.4%) respectively with hypocotyls after 7 days of pre-selection before Hyg selection (Table 2). Maximum GUS activity irrespective of the genotype was recorded with 7 days of pre selection using both hypocotyls and leaf sections respectively. On average maximum transformation efficiency irrespective of preselection period was recorded in Avinash with both hypocotyls and leaf sections followed by Rio Grande, Roma, Pusa Ruby and Pant Bahr. GUS expression was not recorded without pre-selection, ranked 2nd after 5 days of pre-selection and reduced to 20–24% after 15 days of preselection (Table 2). More than 7 days of preselection resulted in escapes, so 7 days of pre selection was optimized. Morphogenic responses were recorded for different pre-selection periods. Direct selection without preselection resulted in higher necrotic damage. On other hand 2, 5 and 7 days of pre-selection following selection resulted in less necrotic damage. Effect of preculture with acetosyringone Acetosyringone concentrations of 0, 100, 200, 300 and 400 lM were used in the co-cultivation medium (Table 1). Without acetosyringone, GUS expression was minimum (17.3% in Rio Grande and 9% in Pusa Ruby) for hypocotyls (Table 3). At 200 lM acetosyringone GUS expression increased to 66.3% in Rio Grande followed by 63% in Avinash with leaf sections. Same trend was followed using hypocotyls with maximum GUS expression in Rio Grande (69.7%) and Avinash (65.3%). At 300 and 400 lM GUS percentage was further increased both in hypocotyls and leaf sections with maximum calli proliferation (Fig. 2a). Maximum GUS expression was observed in Rio Grande (92.3%), Avinash (90.3%) and Roma (82.3%) using
Plant Cell Tiss Organ Cult
Fig. 2 Effect of different concentrations of acetosyringone on morphology of leaf sections and hypocotyls present on selection medium a Rio Grande leaf sections showing proliferation at 400 lM acetosyringone b Avinash hypocotyls undergoing organogenesis at 400 lM acetosyringone on selection medium c Roma showing
organogenesis on selection regeneration medium just before shifting to soil d GUS expression of leaf and e Hypocotyl on selection f Rio Grande plant established in soil in bags from the selection rooting medium acclimatized, covered by polythene for 7 days to retain humidity and afterwards removed
Table 2 Effect of preselection period on GUS expression of hypocotyls and leaf sections co-cultivated with EHA101 (pTCL5) in five tomato cultivars Hypocotyls PS
Leaf sections
Rio Grande d
Roma
0.00
0.00
0
0.00
2
21.00c
24.00c
5
b
b
7 15
62.00
a
89.30
c
24.83
Pusa Ruby
d
52.10
a
83.43
c
24.30
d
Pant Bahr e
Avinash
Rio Grande
e
d
Roma
Pusa Ruby
0.00
0.00
d
0.00
d
Pant Bahr
Avinash
e
0.00
0.00d 20.00c
0.00
0.00
18.0c
13.33d
21.00d
20.30c
21.00c
15.6c
13.33d
b
b
62.67
b
b
53.57
b
47.8
b
b
59.0b
90.83
a
81.33
a
77.2
a
a
88.77a
24.93
c
22.27
c
18.8
c
c
22.4c
47.4
45.97 a
71.37
c
c
77.43 20.73
a
21.5
57.63
a
87.07
c
23.03
41.13 65.23 18.17
PS Preselection period Means not followed by the same letter are statistically different at P \ 0.01
hypocotyls as explants source with 400 lM acetosyringone (Table 3). Maximum GUS activity irrespective of the genotype was recorded with 400 lM acetosyringone using both hypocotyls and leaf sections respectively. On average maximum transformation efficiency irrespective of preselection period was recorded in Avinash and Rio Grande with both hypocotyls and leaf sections followed by Roma, Pusa Ruby and Pant Bahr.
Production of transgenic plants After the optimization of all parameters, the newly developed protocol was applied to five tomato cultivars, and the transformation frequency was compared. Considerable genotypic variation was observed in selective shoot regeneration. Hypocotyls produced relatively greater number of Hyg positive plants and in turn transformation
123
Plant Cell Tiss Organ Cult Table 3 GUS expression of hypocotyls and leaf disc 15–21 days after selection with different concentrations of acetosyringone in co-cultivation medium Hypocotyls
Leaf sections
AS
Rio Grande
Roma
Pusa Ruby
Pant Bahr
Avinash
Rio Grande
Roma
Pusa Ruby
0 lM
17.33f
11.7e
10e
9e
15e
17.3f
13.0d
10.0d
8.0d
13.0e
d
e
d
d
d
26.6d
50 lM
30
e
20.3
d
100 lM 200 lM
d
53 69.7c
42 62.3b
300 lM
85.3b
400 lM
92.3a
16.3
c
d b
d
16
30
29.0
18.3
15.0
Pant Bahr
13.3
Avinash
41.7 55.7c
c
36.3 47.7b
c
54.7 65.3b
d
50 66.3c
c
41.3 58.3b
c
38.0 52.6b
c
33.6 45.3b
50.6c 63.0b
81.7a
71a
67.3a
92.3a
80.3a
77.3a
69.0a
64.3a
89.3a
82.3a
75.7a
70a
90.3a
80.0a
77.3a
74.3a
69.6a
86.6a
AS Acetosyringone Means not followed by the same letter are statistically different at P \ 0.01
Table 4 Transformation efficiency of tomato cultivars with leaf sections and hypocotyls Hypocotyl
Leaf sections
Cultivars
Hyg R calli
Hyg R plant
GUS (?) plants
TE
Rio Grande
71.67a
51.3ab
33.67a
42.08a
Roma Pusa Ruby
a
ab
62.3
ab
42.3 b
21.67
25.33
c
c
12.33
c
7.00 c
31.6
ab
8.75
Pant Bahr
b
c
20.00
5.333
3.667
Avinash
70.33a
54.00a
32.50a
c
Hyg R calli
Hyg R plant
GUS (?) plants
TE
61.67a
42.6ab
32.33a
40.42a
b
b
28.73b
c
7.50c
c
3.33
4.18c
30.0ab
37.5ab
a
62.3
39.67 b
20.57
b
10.3
c
23.00
6.00 c
4.58
17.67
5.33
40.62a
61.33a
49.6ab
Hyg R calli: Hygromycin resistant calli, Hyg R plant: Hygromycin resistant plant, GUS (?) plants: GUS positive plants, TE: Transformation efficiency Means not followed by the same letter are statistically different at P \ 0.01
efficiency in all genotypes as compared to leaf sections. Highest number of Hyg resistant calli were produced in Rio Grande (71.6%) followed by Avinash (70.3%) from hypocotyls. While in leaf sections highest percentage of Hyg resistant calli (61.6%) were recorded in Rio Grande followed by Roma, Avinash, Pusa Ruby and Pant Bahr (Table 4; Fig. 2). Maximum transgenic plants were produced in Avinash (54%), followed by Rio Grande (51.3%), Roma (42.3%) in hypocotyls. Highest transformation efficiency were recorded in Rio Grande (42.08%), followed by Avinash (40.6%), and lowest in Pant Bahr (4.5%) using hypocotyls (Table 4). Similarly, on average higher transformation efficiency (25.5%) in hypocotyls and (23.67%) in leaf sections was obtained in all cultivars with higher acetosyringone concentration. Higher transformation efficiency (4.5–42.12%) was obtained in all cultivars of tomato tested with 400 lM acetosyringone (Fig. 2b, c). Hypocotyls produced relatively greater number of Hyg resistant, GUS (?) calli, plants and in turn transformation efficiency in the respective genotype as against the leaf sections. More than 300 Hyg resistant and GUS (?) plants were produced in transformation experiments. About 5% of plants were albinos which failed to survive in soil. No morphological and physiological variation was observed in all other plants. Fifteen plants of Rio Grande, 12 of Roma,
123
7 of Pusa Ruby and Pant Bahr and 15 of Avinash grew to maturity and seeds were collected to raise T1 generation (Table 5). Molecular analysis of transgenic plants The putative transgenic plants, derived from independent Hyg resistant calli, were grown in a greenhouse. The presence and integration of desired genes into transgenic plant genome was confirmed by PCR and Southern blot analyses. Five independent, Hyg resistant putative transgenic lines of five different tomato cultivars were randomly selected for molecular analysis. Plasmid DNA (pTCL5) was used as a positive control and negative control consisted of tissue cultured non transformed tomato line. PCR analysis was conducted for Hyg and Xa21 gene. Expected gene size (670 bp) for Hyg was observed in all lines except one line of Roma (L2). Gene size for Xa21 (1.4 kb) was observed in all lines except one line of Rio Grande (L5) (Fig. 3a, b). Southern blot analysis Southern blot analysis was performed to confirm integration of Xa21 and to provide information related to its
Plant Cell Tiss Organ Cult Table 5 Symptoms development after the inoculation of transgenic lines (expressing Xa21 gene) of T0 generation with P. solanacearum Bacterial strain sourcea
Replicates
STM STM
Tomato cultivars
Days after inoculation 7
14
21
1
Roma
–
–
–
2
Roma
–
–
–
STM VP
3 1
Roma Roma
– –
– –
? –
VP
2
Roma
–
–
–
VP
3
Roma
–
?
–
STM
1
Rio Grande
–
–
–
STM
2
Rio Grande
–
–
–
STM
3
Rio Grande
–
–
–
VP
1
Rio Grande
–
–
?
VP
2
Rio Grande
–
–
–
VP
3
Rio Grande
–
–
–
STM
1
Pusa Ruby
–
–
–
STM
2
Pusa Ruby
–
–
–
STM
3
Pusa Ruby
–
–
–
VP
1
Pusa Ruby
–
–
–
VP
2
Pusa Ruby
–
–
–
VP STM
3 1
Pusa Ruby Pant Bahr
– –
– –
– –
STM
2
Pant Bahr
–
–
–
STM
3
Pant Bahr
–
–
–
VP
1
Pant Bahr
–
–
–
VP
2
Pant Bahr
–
–
–
VP
3
Pant Bahr
–
–
–
STM
1
Avinash
–
–
–
STM
2
Avinash
–
–
–
STM
3
Avinash
–
–
–
VP
1
Avinash
–
–
?
VP
2
Avinash
–
–
–
VP
3
Avinash
–
–
–
a
P. solanacearum isolates from stem exudates (STM) and vascular portion (VP) were streaked on TZC medium
pattern of integration into plant genome. Genomic DNA from 5 randomly selected PCR-positive transgenic lines of Rio Grande, Roma, Pusa Ruby, Pant Bahr and Avinash were digested with Pst I, which has a unique restriction site at the 50 end of the integrated sequence of Xa21, and hybridized with a transgene (Xa21) specific probe. Results confirmed the presence of 1–2 copies of the transgene per genome in T0 lines (Fig. 3c).
Fig. 3 a Molecular analysis of transgenic and non-transgenic tomato plants (a) PCR amplification of the 670 bp fragment corresponding to the CaMV 35S promoter and the nested fragment of the insert in the transgenic plants (see Fig. 1); lane N, non-transgenic plants; lane (P), pTCL5; lanes 1, 3–6, transgenic plants. b (PCR) amplification of the 1.4 Kb fragment corresponding to the CaMV 35S promoter and the nested fragment of the insert in the transgenic plants (see Fig. 1); lane N, non-transgenic plants; lane (P), pTCL5; lanes 1–4 and 6 transgenic plants c Southern blot analysis of genomic DNA from five PCRpositive T0 tomato plants. Fifteen micrograms of genomic DNA per lane isolated from the leaves of transgenic and non-transgenic tomato plants and digested with PstI. Digested DNA was separated on 0.8% agarose, transferred to membrane and hybridized to a biotin labeled probe Xa21 (839 bp) (c) lanes 1–5, transformed, lane 6, nontransformed plant (control), lane 7, ?ive control (plasmid pTCL5)
derived either from STEM or from VP. Roma and Rio Grande developed no disease symptoms, on other hand, Pusa Ruby and Pant Bahr developed disease symptoms within 7 days after inoculation (Afroz et al. 2009). While after 21 days all the cultivars developed the diseased symptoms in control plants. To evaluate resistance of transgenic plants to BW, transgenic three-week-old lines (as this stage was most susceptible to BW) were inoculated with wilt strains/isolates. All PCR positive transgenic plants exhibit resistance against the pathogen (Table 6). Inheritance of transgenes
Wilt bioassay Plants of each cultivar were inoculated with P. solanacearum and examined for the development of symptoms after 7 days of inoculation, and the bacterial strain was
The inheritance of the Xa21 gene in T1 generation of three lines of susceptible cultivar Pant Bahr and moderately resistant cultivar Rio Grande were tested for bacterial wilt resistance and inheritance data was recorded (Table 6;
123
Plant Cell Tiss Organ Cult Table 6 Levels of resistance/ susceptibility/resistance of T1 transgenic plants of two tomato cultivars lines (Rio Grande & Pant Bahr) observed after P. solanacearum inoculation (Expected ratio 3:1)
Resistant
v2
P-value
6
18
0
1.649
8
22
0.011
1.631
28
10
18
0.42
1.314
Pant Bahr (1)
24
9
15
0.5
1.283
Pant Bahr (2)
26
4
22
0.321
1.368
Pant Bahr (3)
16
4
12
0
1.649
Pant Bahr (4)
20
4
16
0.066
1.558
Test lines of tomato
Number of T1 seedling
Rio Grande (1)
24
Rio Grande (2)
30
Rio Grande (3)
Susceptible
Fig. 4 Levels of susceptibility/resistance of transgenics (T1) and the control tomato cultivars after P. solanacearum inoculation. Transgenic plants showed very little or no symptoms 3 weeks after inoculation a, c, d Roma, Rio Grande and Avinash b, e, f Pusa Ruby and Pant Bahr
Fig. 4). In all the transgenics Mendelian segregation (3:1) was observed, which indicates that transgenes were inserted into single locus in the genome and inherited as single unit. Each individual progeny plant was considered a line and therefore statistical analysis was not performed over the number of progenies rather was based on the number of symptoms appear on leaves. Functional expression of the transgene expressed stability of Xa21 gene for bacterial control. Results showed that Xa21 maintained its wide resistance spectrum and functional expression in a new genetic background.
Discussion Development of molecular biology allows the identification and cloning of disease resistance genes (R-genes) used in conventional breeding to similar or taxonomically diverse species for improvement in disease resistance (Thilmony et al. 1995; Wang et al. 1996). Resistance R-genes have proven to be more functional when cloned and transferred from resistant to susceptible genotypes of
123
the same species because of restricted taxonomic functionality (Goggin et al. 2006). Xa21 gene is one of the popular R-gene which is effective in controlling multiisolates of Xanthomonas oryzae pv. oryzae when transferred to susceptible rice cultivars (Wang et al. 1996; Hao et al. 2009; Park et al. 2010). Transgenic rice plants expressing Nat Xa21 gene were reported to be fully resistant to Xoo strain (PXO99Az) and reduction in its expression causes susceptibility of transgenic rice to bacterial strains (Park et al. 2010). Inspite of effectiveness of Xa21 gene in controlling bacterial diseases especially bacterial blight in rice, it had not been reported in dicots except in citrus where its expression resulted in enhanced resistance to bacterial canker caused by Xanthomonas axonopodis pv. Citri (Mendes et al. 2009). It raises the possibility of utilizing Xa21 gene for introduction of bacterial wilt resistance in tomato. The objective of the present study was to investigate the role of bacterial blight resistant gene Xa21 isolated from wild rice, in developing bacterial wilt stress tolerance in tomato. In this research project Xa21 gene was successfully introduced into tomato elite cultivars via Agrobacterium mediated transformation.
Plant Cell Tiss Organ Cult
In this sonario conditions were optimized for an efficient transformation system. 50 mg l-1 Hyg was selected as selective agent, as suitable amount of selection agent can efficiently inhibit non-transformed growth (Khan et al. 2003). Two days of co-cultivation was found to be better for controlling bacterial growth and maximum GUS expression (Zhang et al. 2006). Preselection for 7 days before selection was found to effective as without preselection only 10% hypocotyls and leaf segments initiated callus (Jabeen et al. 2009; Zhang et al. 2006). Acetosyringone was found to be very effective in transformation; as GUS percentage was highest with 100 and 400 lM acetosyringone in preculture and in co-cultivation medium respectively. Resuspension of the A. tumefaciens cells in Amino Acid media with 400 lM acetosyringone increased number of Hyg resistant shoots by augmenting the virulence of A. tumefaciens which in turn increased the transformation efficacy. High transformation efficiency with 200 lM acetosyringone in co-culture media was reported in tomato (Cortina and Culianez-Macia 2004; Raj et al. 2005). Wounding of explants prior to transformation is important to provide accessibility for Agrobacterium to transform competent cells that may locate more deeply in the tissue, but it may reduce transformation efficiency due to triggering of reactive oxygen species at the infection site (Wojtaszek 1997). Acetosyringone was found to be alternate, as it assisted in transformation without wounding of explants, and resulted in multiple T-DNA insertion into target genome (Kuta and Tripathi 2005). Transformation efficiency of 4.5–42.12% was observed and true transformed shoots were rooted within 1 week in selection medium. Raj et al. (2005) reported quiet higher transformation efficiency (49.5%) in tomato cv Pusa Ruby using cotyledon as explant for introduction of insect resistance. While (Qiu et al. 2007; Wu et al. 2006) reported 20.8 and 27% transformation efficiencies in tomato cvs respectively. Difference in transformation efficiency can be due to difference in bacterial strain, plasmid construct or genotypic variation (Park et al. 2003). Integration of Xa21 and Hyg resistant gene in T0 plants was confirmed by PCR. Baisakh et al. (2000) and Tu et al. (2000) reported the presence of 1.4 kb fragment of Xa21 gene in resistant transgenic rice plants by using the same primer sequence. Omar et al. (2007) reported insertion of 1.2 kb segment of Xa21 in citrus. Southern blot analysis confirmed the 1–2 copy of gene per transformed tomato genome. In general, direct gene transfer methods resulted in multiple insertions and rearranged fragments in transgenic plants in comparison to Agrobacterium-mediated transformation (Krasnyanski et al. 1999). Transgenic plants with multiple copies of the integrated DNA, at one or more chromosomal locations, have been shown to be more likely to exhibit transgene ‘‘silencing’’ (James et al. 2002), affecting the
level and stability of gene expression. Tang et al. (2007) obtained post-transcriptional gene silencing in transgenic lines with more than three copies of a T-DNA, but not in transgenic lines with one copy of a T-DNA. Xa21 from a wild species, O. longistaminata, is the first resistance gene to be cloned and transferred in any cereal crop plants. Due to its wide spectrum of resistance (Song et al. 1995; Wang et al. 1996), it is of great value in breeding tomato for BW resistance. Mendelian segregation was observed with the 49 transgenic lines of T0. The resistance spectrum was evaluated for transgenic T1 plants/lines (Fig. 4). The reaction of the transgenic T1 plants to bacterial wilt pathogen was studied with VP and Mendelian segregation (3:1) was observed. Transformation of cloned Xa21 into the tomato varieties improves the spectrum of resistance of this important wilt strain. It also provides an opportunity to assess its stability and its function in a new genetic background. Through artificial inoculation, it was observed that the level of resistance of the transgenic plants to BW was higher than that of the control plants. The level of resistance to P. solanacearum did not vary among transgenic tomato cultivars of same genetic background, contrasting with the results obtained with transgenic orange expressing Xa21 gene with variable resistance of the citrus cultivars to citrus canker of same genetic background (Mendes et al. 2009). The results are in line with (Zhai et al. 2004), who reported the resistance of transgenic rice lines to X. oryzae pv. oryzae, (based on lesion length) was almost the same within a same genetic background. So, transgenes originated from the tomato genome may result in better gene expression and regulation like rice genome. The results reported herein show the possibility of changing the resistance level of important commercial tomato cultivars to bacterial wilt, with the selection of lines with high resistance to the pathogen. The level of resistance to bacterial wilt may influence the success of eradication programmes and also indicate specific cultivars that could be cultivated in areas where P. solanacearum is endemic (Christiano et al. 2007). Efforts will be made in order to perform field trials with selected resistant lines, evaluating not only for disease resistance, but also for agronomic traits and fruit quality.
Conclusions This research article is the first report presenting the enhanced resistance against bacterial wilt in five different transgenic tomato lines expressing the Xa21 gene. In past there was enhanced canker resistance in citrus expressing Xa21 gene, which show the variable resistance to canker in citrus genome of same genetic background. While in this article uniform resistance to bacterial wilt was observed in
123
Plant Cell Tiss Organ Cult
the tomato lines of same genetic background. Integration of transgene into tomato lines was confirmed by PCR and Southern blot analyses. Technical modifications such as pre-selection and preculturing of explants with acetosyringone had improved the transformation efficiency. Even though a significant variation was observed regarding the stable transformation frequency among the five cultivars, we obtained 4.5–42.12% transformation frequency, which is quiet high in comparison to the previous reports (Ahsan et al. 2007). Current protocol proved to be a simple approach for Agrobacterium-mediated gene transfer in tomatoes and there is potential for it to be applied to other commercial varieties. Acknowledgments Authors are thankful to Dr Shaukat Ali for help in English language corrections.
References Abu-El-Heba GA, Hussein GM, Abdalla NA (2008) A rapid and efficient tomato regeneration and transformation system. Agric For Res 12(58):103–110 Afroz A, Khan MR, Ahsan N, Komatsu S (2009) Comparative proteomic analysis of bacterial wilt susceptible and resistant tomato cultivars. Peptides 30:1600–1607 Afroz A, Khan MR, Komatsu S (2010) Proteomic analysis of tomato cultivars treated with growth elicitor’s jasmonic acid and salicylic acid. Protein Pept Lett 17(7):836–846 Ahsan N, Lee SH, Lee DG, Anisuzzaman M, Alam MF, Yoon HS, Choi MS, Yang JK, Lee BH (2007) The effects of wounding type, preculture, infection method and cocultivation temperature on the Agrobacterium mediated gene transfer in tomatoes. Ann Appl Biol 151:363–372 Andaya CB, Ronald PC (2003) A catalytically impaired mutant of the rice Xa21 receptor kinase confers partial resistance to Xanthomonas oryzae pv. oryzae. Physiol Mol Plant Pathol 62:203–208 Baisakh N, Datta K, Rashid H, Oliva N, Datta SK (2000) Agrobacterium tumefaciens-mediated transformation of an elite indica rice maintainer line IR68899B with a reconstructed T-DNA carrying multiple genes. Rice Genet Newslett 17:122–125 Breuning G, Lyons JM (2000) The case of the FLAVR SAVR tomato. Calif Agric 54:6–7 Carmona MJ, Molina A, Fernandez JA, Lopez-Fando JJ, GarciaOlmedo F (1993) Expression of the alpha-thionin gene from barley in tobacco confers enhanced resistance to bacterial pathogens. Plant J 3:457–462 Chaudhry Z, Rashid H (2010) An improved Agrobacterium mediated transformation in tomato using hygromycin as a selective agent. Afr J Biotech 9(13):1882–1891 Christiano RCS, Dalla Pria M, Jesus WC Jr, Parra JRP, Amorim L, Bergamin Filho A (2007) Effect of citrus leaf-miner damage, mechanical damage, and inoculum concentration on severity of symptoms of Asiatic citrus canker in Tahiti lime. Crop Prot 26:59–65 Cortina C, Culianez-Macia FA (2004) Tomato transformation and transgenic plant production. Plant Cell Tissue Organ Cult 76(3):269–275 Gao N, Shen W, Cao Y, Su Y, Shi W (2009) Influence of bacterial density during preculture on Agrobacterium-mediated transformation of tomato. Plant Cell Tissue Organ Cult 98:321–330
123
Goggin FL, Jia L, Shah G, Hebert S, Williamson VM, Ullman DE (2006) Heterologous expression of the Mi-1.2 gene from tomato confers resistance against nematodes but not aphids in eggplant. Mol Plant Microbe Interact 19:383–388 Hao ZN, Wang J, Wang LP, Tao RX (2009) Influences of the disease resistance conferred by the individual transgenes, Pi-d2, Pi-d3 and Xa21, on the transgenic rice plants in yield and grain quality. Afr J Biotechnol 8(19):4845–4848 Hayward AC (1991) Biology and epidemiology of bacterial wilt caused by Pseudomonas solanacearum. Annu Rev Phytopathol 29:65–87 Huang H-E, Liu C-A, Lee MJ, Kuo CG, Chen HM, Ger MJ, Tsai YC, Chen YR, Lin MK, Feng TY (2007) Resistance enhancement of transgenic tomato to bacterial pathogens by the heterologous expression of sweet pepper Ferredoxin-I protein. Biochem Cell Biol 97(8):900–906 Izawa T, Shimamoto K (1996) Becoming a model plant: the importance of rice to plant science. Trends Plant Sci 1:95–99 Jabeen N, Mirza B, Chaudhary Z, Rashid H, Gulfraz M (2009) Study of the factors affecting Agrobacterium mediated gene transformation in tomato (lycopersicon esculentum mill.) cv. Riogrande using rice chitinase (cht-3) gene. Pak J Bot 41(5):2605–2614 James VA, Avart C, Worland B, Snape JW, Vain P (2002) The relationship between homozygous and hemizygous transgene expression levels over generations in populations of transgenic rice plants. Theor Appl Genet 104:3–561 Jefferson RA (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Rep 5:387–405 Kelman A (1954) The relationship of pathogenesity of Pseudomonas solanacearum to colony appearance in a tetrazolium medium. Phytopathology 44:693–695 Khan MA, Rashid H, Ansar M, Chaudhary Z (2003) High frequency shoot regeneration and Agrobacterium-mediated DNA transfer in canola (Brassica napus). Plant Cell Tissue Org Cult 75:223–231 Krasnyanski S, May RA, Loskutov A, Ball TM, Sink KC (1999) Transformation of the limonene synthase gene into peppermint (Mentha piperita L.) and preliminary studies on the essential oil profiles of single transgenic plants. Theor Appl Genet 99: 676–682 Kuta DD, Tripathi L (2005) Agrobacterium-induced hypersensitive necrotic reaction in plant cells: a resistance response against Agrobacterium-mediated DNA transfer. Afr J Biotechnol 4: 752–757 Martin GB, Vicente MC, Tanksley SD (1993) High resolution linkage analysis and physical chraracterization of the Pto bacterial resistance locus in tomato. Mol Plant Microbe Interact 6:26–34 Mendes BMJ, Cardoso SC, Boscariol-Camargo RL, Cruz RB, Mourao Filho FAA, Bergamin Filho A (2009) Reduction in susceptibility to Xanthomonas axonopodis pv. citri in transgenic Citrus sinensis expressing the rice Xa21 gene. Plant Pathol 59(1):68–75 Miao L, Shou S, Zhu Z, Jiang F, Zai W, Yang Y (2008) Isolation of a novel tomato Caffeoyl CoA 3-O-methyltransferase gene following infection with bacterium Ralsotonia solanacearum. J Phytopathol 156:588–596 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassay with tobacco tissue culture. Plant Physiol 15:472–493 Oldroyd GE, Staskawicz BJ (1998) Genetically engineered broadspectrum disease resistance in tomato. Proc Natl Acad Sci USA 95:10300–10305 Omar AA, Song WY, Grosser JW (2007) Introduction of Xa21, a Xanthomonas-resistance gene from rice, into ‘Hamlin’ sweet orange (Citrus sinensis L. Osbeck) using protoplast-GFP cotransformation or single plasmid transformation. J Hortic Sci Biotechnol 82(6):914–923
Plant Cell Tiss Organ Cult Paramesh H, Fakrudin B, Kuruvinashetti MS (2010) Genetic transformation of a local variety of tomato using gus gene: an efficient genetic transformation protocol for tomato. J Agric Technol 6(1):87–97 Park SH, Morris JL, Park JE, Hirschi KD, Smith RH (2003) Efficient and genotype-independent Agrobacterium-mediated tomato transformation. J Plant Physiol 160(10):1253–1257 Park C-J, Bart R, Chern M, Canlas PE, Bai W, Ronald PC (2010) Overexpression of the endoplasmic reticulum chaperone BiP3 regulates XA21-mediated innate immunity in rice. PloS ONE 5(2):1–12 Qiu D, Diretto G, Tavarza R, Giuliano G (2007) Improved protocol for Agrobacterium mediated transformation of tomato and production of transgenic plants containing carotenoid biosynthetic gene CsZCD. Scientia Hort 112:172–175 Raj SK, Singh R, Pandey SK, Singh BP (2005) Agrobacterium mediated tomato transformation and regeneration of transgenic lines expressing tomato leaf curl virus coat protein gene for resistance against TLCV infection. Curr Sci 88(10):1674–1679 Roy R, Purty RS, Agrawal V, Gupta SC (2006) Transformation of tomato cultivar ‘Pusa Ruby’ with bspA gene from Populus tremula for drought tolerance. Plant Cell Tissue Organ Cult 84:55–67 Sambrook J, Russell D (2001) Molecular cloning: a laboratory manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbour, pp 6.33–6.62 Song WY, Wang GL, Chen LL, Kim HS, Pi LY, Holsten TE, Gardner J, Wang BG, Zhai WX, Zhu LH, Fauquet CM, Ronald PC (1995) A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21. Science 270:1804–1806 Steel RGD, Torrie JH (1984) Principles and procedures of statistics. McGraw Hill Book Co. Inc., New York, pp 72–177 Tabaeizadeh Z, Agharbaoui Z, Harrak H, Poysa V (1999) Transgenic tomato plants expressing a Lycopersicon chilense chitinase gene demonstrate improved resistance to Verticillium dahliae race 2. Plant Cell Rep 19:197–202 Tang W, Newton RJ, Weidner DA (2007) Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine. J Exp Bot 58:545–554
Thilmony RL, Chen Z, Bressan RA, Martin GB (1995) Expression of the tomato Pto gene in tobacco enhances resistance to Pseudomonas syringae pv. tabaci expressing avrPto. Plant Cell 7: 1529–1536 Toriyama K, Hinata K (1985) Panicle culture in liquid media for obtaining anther calli and protoplasts in rice. Jpn J Plant Breed 35:449–452 Tu J, Datta K, Khush GS, Zhang Q, Datta SK (2000) Field performance of Xa21 transgenic indica rice (Oryza sativa L.), IR72. Theor Appl Genet 101:15–20 Uranbey S, Sevimay CS, Kaya MD, Ipek A, Sancak C, Basxalma D, Er C, Ozcan S (2005) Influence of different co-cultivation temperatures, periods and media on Agrobacterium tumefaciensmediated gene transfer. Biologia Plantarum 49:53–57 van Wordragen MF, Dons HJM (1992) Agrobacterium tumefaciens mediated transformation of recalcitrant crops. Plant Mol Biol Rep 10:12–36 Vasse J, Genin S, Frey P, Boucher C, Brito B (2000) The hrpB and hrpG regulatory genes of Ralstonia solanacearum are required for different stages of the tomato root infection process. Mol Plant Microbe Interact 13:259–267 Wang GL, Song WY, Ruan DL, Sideris S, Ronald P (1996) The cloned gene, Xa21, confers resistance to multiple Xanthomonas oryzae pv. oryzae isolates in transgenic plants. Mol Plant Microbe Interact 9:850–855 Wojtaszek P (1997) Oxidative burst: an early plant response to pathogen infection. Biochem J 322:681–691 Wu Y, Chen Y, Liang X, Wang X (2006) An experimental assessment of the factor influencing Agrobacterium-mediated transformation in tomato. Russ J Plant Physiol 53(2):252–256 Zhai W, Chen C, Zhu X, Chen X, Zhang D, Li X, Zhu L (2004) Analysis of T-DNA-Xa21 loci and bacterial blight resistance effects of the transgene Xa21 in transgenic rice. Theor Appl Genet 109:534–542 Zhang Y, Xu J, Han L, Wei W, Guan Z, Cong L, Chai T (2006) Efficient shoot regeneration and Agrobacterium-mediated transformation of Brassica juncea. Plant Mol Biol Rep 24:255a–255i
123
