Enhancement of Feline Immunodeficiency Virus ... - Journal of Virology

JOURNAL OF VIROLOGY, Dec. 1997, p. 9640–9649 0022-538X/97/$04.0010 Copyright © 1997, American Society for Microbiology

Vol. 71, No. 12

Enhancement of Feline Immunodeficiency Virus (FIV) Infection after DNA Vaccination with the FIV Envelope J. RICHARDSON,1 A. MORAILLON,2 S. BAUD,1 A.-M. CUISINIER,3 P. SONIGO,1 AND G. PANCINO1* Geńe´tique des Virus et Immunopharmacologie Molećulaire, ICGM-CNRS UPR415, Institut Cochin de Geńe´tique Molećulaire, 75014 Paris,1 Geńe´tique Molećulaire Geńe´tique Virale, Institut National de la Recherche Agronomique, Ecole Nationale Ve´te´rinaire d’Alfort, 947094 Maisons-Alfort Cedex,2 and Virbac Laboratories, 06511 Carros Cedex,3 France Received 11 June 1997/Accepted 12 September 1997

Despite intensive experimentation to develop effective and safe vaccines against the human immunodeficiency viruses and other pathogenic lentiviruses, it remains unclear whether an immune response that does not afford protection may, on the contrary, produce adverse effects. In the present study, the effect of genetic immunization with the env gene was examined in a natural animal model of lentivirus pathogenesis, infection of cats by the feline immunodeficiency virus (FIV). Three groups of seven cats were immunized by intramuscular transfer of plasmid DNAs expressing either the wild-type envelope or two envelopes bearing mutations in the principal immunodominant domain of the transmembrane glycoprotein. Upon homologous challenge, determination of plasma virus load showed that the acute phase of viral infection occurred earlier in the three groups of cats immunized with FIV envelopes than in the control cats. Genetic immunization, however, elicited low or undetectable levels of antibodies directed against envelope glycoproteins. These results suggest that immunization with the FIV env gene may result in enhancement of infection and that mechanisms unrelated to enhancing antibodies underlay the observed acceleration. nodeficiency virus (FIV) and equine infectious anemia virus, has resulted in acceleration or clinical aggravation of infection (28, 64, 74). In infection of goats by caprine arthritis-encephalitis virus (CAEV), an association between progressive arthritis and the humoral response to the CAEV envelope glycoproteins or to peptides corresponding to immunogenic domains of the CAEV transmembrane glycoprotein, including the PID, has been observed (7, 29, 37). Whereas the viral envelope is naturally expressed in an oligomeric form, in most vaccination trials the envelope (Env) glycoproteins have been introduced as monomers. Broadly neutralizing antibodies, however, appear to be principally directed against conformational epitopes of HIV envelope glycoproteins (23, 67). Most of such epitopes are dependent on the oligomeric structure of the viral envelope and are not present on monomeric envelope glycoproteins (8, 38, 61, 68). The development of DNA vaccination, whereby the immunogen is expressed endogenously and therefore retains higherorder structure, permits the presentation of envelope to the immune system in a natural oligomeric form. Such presentation could improve the response to conformational epitopes and potentially improve the degree of protection achieved (49, 77). Humoral and cellular responses against Env glycoproteins have been obtained after inoculation of mice and monkeys with vectors expressing HIV and simian immunodeficiency virus envelope glycoproteins, respectively (18, 32, 43, 72, 73). Nevertheless, antibody responses were often weak and transient, and protection from infection was not achieved in macaques vaccinated with SIV env DNA (31). In this study, we undertook an evaluation of the effect of vaccination with the FIV env gene on the development of infection in cats after challenge. Three groups of seven cats were vaccinated with wild-type env or two env genes containing mutations in the sequence coding for the PID, in an attempt to modify the humoral response to this domain, which has been postulated to be involved in the induction of enhancing anti-

Efforts to develop an effective vaccine against infections caused by lentiviruses, including the human immunodeficiency virus (HIV), are confounded by an insufficient understanding of the role of host immunity in persistent infection. One of the issues under debate is whether certain components of the immune response developed against HIV, instead of protecting against infection, may actually promote viral pathogenesis. Such a possibility was recognized after the finding that sera from HIV-infected individuals can enhance HIV type 1 (HIV-1) infection in vitro (30, 59). Two of the factors involved in serum-mediated enhancement of HIV-1 infectivity were shown to be anti-HIV-1 antibodies and complement (25, 58, 70). In some studies, a correlation between in vitro enhancement of HIV infection by sera from HIV-1-infected individuals and progression to disease has been described (19, 24). In clinical trials, most of the vaccines for human AIDS undergoing evaluation have been based on the viral envelope, which is the principal target for neutralizing antibodies (39, 41, 53). However, among concerns raised about the efficacy of HIV recombinant envelope protein gp120 (rgp120) in prevention of infection (9, 36), the possibility that such a vaccine might enhance infection has been evoked (35, 66). Although evidence for a deleterious role of the antienvelope immune response in vivo is lacking, human monoclonal antibodies directed to epitopes contained within the HIV-1 gp120 and to a conserved region of the HIV-1 transmembrane glycoprotein, the principal immunodominant domain (PID), were shown to enhance HIV infection of different cell types (15, 56, 57, 62, 69). Furthermore, vaccination with envelope preparations from different animal lentiviruses, including the feline immu* Corresponding author. Mailing address: Geńe´tique des Virus et Immunopharmacologie Molećulaire (ICGM-CNRS UPR0415), Institut Cochin de Geńe´tique Molećulaire, 22 rue Mećhain, 75014 Paris, France. Phone: (331) 40.51.64.31. Fax: (331) 40.51.72.10. E-mail: [email protected]. 9640

VOL. 71, 1997

DNA VACCINATION WITH FIV Env

bodies (48). Upon viral challenge, the kinetics of infection was assessed by measurement of plasma viral load by quantitative competitive reverse transcription-PCR (QC-PCR). According to these analyses, the acute phase of viral infection occurred earlier in cats immunized with the envelope glycoproteins than in control cats, suggesting that immunization with the env gene accelerated viral dissemination. MATERIALS AND METHODS FIV Env expression vectors. For the expression of wild-type and mutated env genes, gag, pol, and vif genes were deleted from the FIV 34TF10 provirus (45). The vector thus obtained expresses functional envelope glycoproteins upon transfection of feline fibroblasts (CrFK cells) (45). A truncated matrix protein (MA) (first 99 amino acids) is also expressed at low levels (not shown). Three plasmids were used as vaccines; pTD20ds contains the env gene from the 34TF10 molecular clone (71), while pn14 and pn92 contain env genes derived from 34TF10 and bearing mutations in the sequence coding for the four aminoterminal amino acids of the PID loop (48). These mutations modified the antigenic properties of this domain, strongly reducing its reactivity with sera from FIV-infected cats (48). Wild-type and mutated sequences of PID were as follows: CNQNQFFC (34TF10), CEHQHFFC (n14), and CRPAAFFC (n92). Plasmids pn14 and pn92 were grown in Escherichia coli DH5a, and plasmid pTD20ds was grown in E. coli HB101. Plasmids were purified by using the Wizard Megaprep system (Promega), followed by two phenol-chloroform extractions and ethanol precipitation. In vitro expression of vaccine DNAs was tested by enzyme-linked immunosorbent assay (ELISA) or by syncytium-forming assay after transfection of CrFK cells as previously described (45). Plasmid pUC18 (Gibco BRL) was used as a control. DNA immunization and virus challenge. Twenty-eight 3-month-old specificpathogen-free cats (IFFA-CREDO, St. Germain sur l’Arbrefle, France) were randomly assigned to three vaccine groups and one control group. Animals received two intramuscular injections of 200 mg of DNA in sodium phosphatebuffered saline in each gastrocnemius muscle. Three inoculations at 2-week intervals were administered. To reduce the variability of DNA uptake and gene expression, 300 ml of 25% sucrose in phosphate-buffered saline were injected in the muscle 15 min before DNA injections (10, 43). Challenge was performed 2 weeks after the third DNA inoculation by intraperitoneal injection of 10 50% cat infectious doses of an FIV Petaluma stock (gift of M. Hosie, University of Glasgow). Assays for anti-Env and anti-p24 antibodies. Humoral responses induced in cats by DNA injection and viral challenge were monitored by ELISA. The anti-Env response was assessed against continuous epitopes comprised in peptides corresponding to the immunogenic SU2 and TM2 domains of the surface (SU) and transmembrane (TM) glycoproteins of the FIV envelope (46). The peptide sequences were RAISSWKQRNRWEWRPD (SU2) and QELGCNQN QNFFCKV (TM2), the latter cyclized by creation of a disulfide bond between the two cysteines to enhance the sensitivity of the test; shorter peptides corresponded to the wild-type and mutated sequences of the cysteine loop of the PID (48). The anti-Env response to the entire SU glycoprotein was evaluated on purified rgp100 expressed in E. coli and derived from the FIV Bangston isolate (34), since rgp100 from the Petaluma strain was unavailable. The anti-Gag response was assessed by using Gag-p24 and Gag-p17 expressed as glutathione S-transferase fusion proteins (54) (gift of O. Jarrett, University of Glasgow). Each well of microplates (Immunolon II; Dynatech) was coated with 0.5 mg of antigen for peptides, rgp100, and p17 and with 0.1 mg for p24. ELISAs were performed as previously described (2), with minor modifications. Assays were performed in duplicate, and results were expressed as means. In each microplate, wells coated with the TM2 peptide and treated with a reference pool of FIVpositive cat sera diluted to 1/4,000 were included. Normalization of the results to the reference serum allowed direct comparison of ELISA results obtained at different times and on separate plates. Moreover, values of optical density (OD) obtained with FIV antigens were corrected by subtraction of the background level observed in assays using an irrelevant peptide. Sera collected on the day of challenge were also tested for the ability to immunoprecipitate envelope glycoproteins from the FL-4 cell line, chronically infected with the Petaluma strain of FIV (78), after metabolic labeling as previously described (45). Finally, binding of selected sera to the oligomeric form of the FIV envelope was assessed by flow cytometry using the FL-4 cell line, according to an established procedure (55). Viral infectivity assay. To determine whether sera from vaccinated cats could modify infection, serial dilutions (1/5, 1/25, and 1/125) of a stock of the Petaluma isolate and a single dilution of sera (1/5) were prepared in RPMI 1640 containing 10% heat-inactivated fetal calf serum, 100 IU of penicillin and 100 mg of streptomycin per ml, 50 mM 2-mercaptoethanol (2-ME), and 10 mM HEPES. Feline serum was combined with an equal volume of neat and serially diluted virus and incubated in a final volume of 100 ml for 1 h at 37°C in quadruplicate in eight-strip cluster tubes (Costar). Following activation for 3 days in the presence of 5 mg of concanavalin A per ml, feline peripheral blood mononuclear cells (PBMC) were adjusted to 4 3 106/ml in complete RPMI with 2-ME, HEPES, and 200 U of recombinant human interleukin 2 (IL-2) per ml, and 0.1 ml of the

9641

suspension (4 3 105 cells) was added to the tubes. Infection was allowed to proceed overnight. Virus inoculum was removed by washing cells twice with 0.5 ml of complete RPMI. Cells were then resuspended in 0.2 ml of feline serum diluted in complete RPMI with 2-ME, HEPES, and 100 U of IL-2 per ml and transferrred to wells of 96-well microtiter plates. Half the medium was replaced 4 days after infection. Aliquots of 10 ml were removed 7 days after infection for analysis of reverse transcriptase activity (20). Virus isolation. Virus isolation was performed by whole-blood culture (21) or, in some cases, by PBMC culture as already described (40). Quantification of viral burden. Plasma viral load was measured by QC-PCR. Amplification of wild-type template yielded an initial product of 312 bp and a nested product of 165 bp, corresponding to nucleotides 1059 to 1370 and 1157 to 1321 of the 34TF10 molecular clone (71). Molecular constructions. A conserved region of the gag gene of FIV was selected as the target sequence for reverse transcription and nested PCR amplification. The 312-bp target sequence was amplified from a plasmid (pKSgag) containing the entire gag gene of the Wo strain of FIV (47), using a 59 primer comprising the 59 sequence of the target template and a KpnI restriction endonuclease site and a 39 primer comprising the 39 sequence of the target template and an XbaI site. The amplification product was subcloned into the corresponding sites of pBluescript KS1, yielding pBSQCgag. To prepare a template for the synthesis of competitor RNA, a deletion of 31 nucleotides was introduced into the gag sequence by PCR. The 39 portion of the wild-type sequence was amplified by using a 59 primer, SHDWoG128, complementary to the natural HindIII site (nucleotides 1241 to 1246) and bearing a 31-nucleotide discontinuity, and a 39 primer, RXWoG139, comprising the 39 sequence of the target template and an XbaI site. Competitor templates have been prepared in similar fashion by Pistello et al. (52) and Diehl et al. (12). The sequences of primers were as follows: SHDWoG128, GGATGAAAGCTTAAA G/CCCCTGATGGTCCTAGAC (1235 to 1250/1282 to 1299) and RXWoG139, GCTCTAGATCTTGCTTCTGCTTGTTGTTCTTGAG (1345 to 1370). The amplification product was purified, digested with HindIII and XbaI, and substituted for the corresponding fragment of pBSQCgag, yielding pBSQCDgag. Synthesis of competitor RNA. Competitor RNA was synthesized by using T3 RNA polymerase (Promega) as the runoff transcription product of pBSQCDgag linearized with XbaI. DNA template was hydrolyzed with RQ1 RNase-free DNase (Promega). Competitor RNA was purified by absorption to silica (RNeasy; Qiagen) and quantified by measurement of absorbance at 260 nm. RNA was aliquoted and stored at 280°C. Preparation of plasma RNA. Plasma was filtered (0.45-mm-pore-size filter), and cell-free RNA was extracted from 140 ml of filtered plasma in duplicate by using a viral RNA kit (Qiagen) and eluted in 50 ml of water according to the manufacturer’s instructions. Aliquots of RNA were stored at 280°C. Competitive reverse transcription-PCR (RT-PCR). For synthesis of complementary DNA, 2.5 ml of viral RNA was combined with 2.5 ml of different numbers of copies of RNA competitor. RNA was denatured at 65°C for 5 min and immediately placed on ice. Reagents for reverse transcription (15 ml) were added as a master mix. Final reaction mixtures contained 0.3 U of random hexanucleotides (Pharmacia) ml21, 0.5 mM deoxynucleoside triphosphate (dNTP), 10 mM dithiothreitol, 13 commercial buffer, and 100 U of Superscript II (both Gibco BRL) in a volume of 20 ml. Reaction mixtures were held at 25°C for 10 min to promote primer annealing and then incubated at 42°C for 50 min. Reverse transcriptase was inactivated by incubation at 95°C for 5 min. Highly conserved sequences were selected for primer sites. External primers were SWoG107 (59-CAATATGTAGCACTTGACCCAAAAAT-39 [1059 to 1084]) and RWoG139 (59-TCTTGCTTCTGCTTGTTGTTCTTGAG-39 [1345 to 1370]). Nested primers were SWoG116 (59-CTCTGCAAATTTAACACCTAC GACA-39 [1157 to 1182]) and RWoG133 (59-GCTGCAGTAAAATAGGGTA ATGGTCT-39 [1296 to 1321]). Complementary DNA was amplified by nested PCR using external primers SWoG107 and RWoG139 and internal primers SWoG116 and RWoG133. For the first amplification, PCR reagents (80 ml) were added as a mix to 20 ml of complementary DNA. Complete reactions contained 200 mM dNTP, 1.5 mM MgCl2, 0.1 mM each external primer, 0.83 commercial buffer, and 0.25 U of Taq polymerase (both from Gibco BRL). DNA was denatured at 94°C for 3 min, subjected to 28 cycles (94°C for 30 s, 55°C for 30 s, and 72°C for 30 s), and elongated at 72°C for 7 min. For the nested amplification, 2 ml of the product of the first amplification was transferred to 98 ml of reaction mix containing 200 mM dNTP, 1.5 mM MgCl2, 0.5 mM each nested primer, 13 commercial buffer, and 0.25 U of Taq polymerase (both from Gibco BRL). DNA was denatured at 94°C for 3 min, subjected to 28 cycles (94°C for 30 s, 52°C for 30 s, and 72°C for 30 s), and elongated at 72°C for 7 min. Analysis. Amplification products (10 ml) were subjected to electrophoresis on 2.75% agarose gels. Digitized images of gels stained with ethidium bromide were acquired by using an Imager (Appligene) (Fig. 1), and densitometric analyses were performed with the software program NIH Image. Density of the competitor product was adjusted for the difference in length between the wild-type and competitor sequences. The logarithm of the ratio of competitor to wild-type density was plotted against the logarithm of the number of copies of competitor RNA added to each reaction. The best-fit line was determined by the method of least squares, and the number of copies of wild-type RNA was determined as the intersection of the x axis (51). The assay permits the detection of 10 copies of

9642

RICHARDSON ET AL.

FIG. 1. Quantification of plasma viremia by QC-PCR. Viral RNA extracted from plasma was reverse transcribed and amplified by PCR in the presence of serial dilutions of competitor RNA as described in Materials and Methods. Copy numbers of competitor RNA (from left to right) were 105, 3 3 104, 104, 3 3 103, and 103. A 100-bp ladder (Gibco BRL) is shown on the right.

RNA in one reaction, which sets the lower limit of detection as 1,430 RNA copies per ml of plasma when viral RNA is extracted from 140 ml of plasma.

RESULTS Prechallenge antibody response. Four groups of seven cats were inoculated with pTD20ds, pn14, pn92, or pUC DNA.

J. VIROL.

Following vaccination, a vigorous antibody response to Env was not achieved. When absorbance values higher than twice those obtained with preimmune serum and with an irrelevant antigen were considered to be positive, three cats (Liesse, Ligne, and Limoges) injected with plasmid pn14 and four cats (Loggia, Lola, Longe, and Lotte) injected with plasmid pn92 mounted a weak response to the rgp100 (Fig. 2). No reactivity with the SU2 and TM2 peptides, which correspond to highly immunogenic domains, was found in vaccinated cat sera. Sera from cats vaccinated with the mutated envelopes were also tested for reactivity with two nonapeptides representing the respective mutated PID sequences in comparison with a nonapeptide corresponding to the wild-type sequence. Reactivity with the mutant PID peptide was detected in some cats; in particular, one cat that received the pn14 envelope (Libertine) and one cat that received the pn92 envelope (Lithurgie) developed strong responses against the peptides representing the respective mutated PID sequence, while no reactivity was found with the wild-type peptide (data not shown). Sera collected at the day of challenge, diluted 1/50, were unable to immunoprecipitate Env from the FL-4 cell line (data not shown) and did not bind detectably to oligomeric Env at the surface of FL-4 cells, as assessed by flow cytometry (data not shown). The activity of sera collected at the day of challenge

FIG. 2. Pre- and postchallenge antibody responses to rgp100. Sera were tested weekly after challenge over 9 weeks for groups A, B, and D and over 8 weeks for group C. ELISAs were performed with 1/100 dilutions of cat sera. OD values were normalized as described in Materials and Methods. OD values higher than twice the mean values obtained with preimmune serum and with irrelevant antigen were considered indicative of an Env-specific response. The times of DNA inoculation are indicated by vertical arrows. The day of viral challenge is indicated by a large arrow. WT, wild type.

VOL. 71, 1997


9643

FIG. 3. Longitudinal analysis of plasma viremia after challenge. Plasma viral load was determined at 2, 3, and 4 weeks following infection. Virus titers were determined by QC-PCR. FIV RNA copy numbers were calculated as described in Materials and Methods. Dotted lines indicate the threshold of detection (1,430 FIV RNA copies). WT, wild type.

from cats vaccinated with the wild-type envelope was also tested in a viral infectivity assay performed in primary blasts; neither neutralizing nor enhancing activity was observed (data not shown). Viral burden. After challenge, all cats became infected, as determined by measurement of plasma viremia and virus isolation. However, the kinetics of infection were strikingly different in Env-vaccinated cats in comparison with control cats (Fig. 3). Longitudinal plasma virus titers were monitored at 2, 3, and 4 weeks after challenge (Fig. 3). While at 2 weeks viral RNA was not detected in control cats, a positive signal was found in 9 of 21 Env-vaccinated cats. In two cats of the pn14 group and one cat of the pn92 group, viral loads were greater than 104 RNA copies per ml of plasma. Three weeks after challenge, a high titer of viral RNA (1.27 3 106) was found in the plasma of only one cat in the control group, and the threshold of detection was reached in two other cats of this group. Conversely, at the same time point, in most (17 of 21) plasma samples from the Env-vaccinated cats, viral RNA levels were higher than 104 copies of RNA per ml; in several cases, viral RNA levels higher than .106 copies of RNA per ml were attained. Viral loads of Env- and pUC-vaccinated cat groups were compared at 3 weeks on the basis of areas under the curve (11), using the nonparametric Mann-Whitney test, and

found to be significantly different (P 5 0.02). Statistically significant differences were not found between viral loads of groups immunized with wild-type and mutant Envs. The level of viral RNA remained below the threshold of detection at 4 weeks in one cat of the control group (Lueur) and in two cats of the p92 group (Lotte and Loupe), although virus was isolated by whole blood culture at 3 and 4 weeks from each of these three cats (data not shown). Postchallenge antibody response. Cats were monitored for 9 weeks (8 weeks for the pn92 group) for antibody response against Env and Gag antigens. Antibody responses to Env antigens are presented in Fig. 2, 4, and 5. Figure 2 shows the reactivity against rgp100 during immunization and after viral challenge; Fig. 4 and 5 show the kinetics of the antibody response to SU2 and TM2 peptides, respectively, after viral challenge. In general, the appearance of the anti-Env antibodies paralleled the development of plasma viremia. Antibodies to the SU2 and TM2 peptides appeared between weeks 3 and 7 after viral challenge in the Env-vaccinated animals and between weeks 5 and 7 in the control group. Despite the high degree of similarity among the three Envs used as immunogens, substantial differences were observed among the vaccinated groups in the development of the humoral response to Env after challenge. Unlike cats immunized

9644

RICHARDSON ET AL.

J. VIROL.

FIG. 4. Kinetics of postchallenge antibody response against the SU2 peptide. Sera were tested weekly over 9 weeks for groups A, B, and D and over 8 weeks for group C. ELISAs were performed with 1/25 dilutions of cat sera. OD values were normalized as described in Materials and Methods. WT, wild type.

with mutated envelopes, the majority (four of seven) of cats vaccinated with the wild-type envelope did not develop a detectable response to the SU2 peptide, in spite of a vigorous anti-TM2 response. It is unclear whether vaccination may have selectively suppressed the humoral response directed against SU epitopes in these cats. Anti-Env antibody responses developed after challenge by the mutant n14 and n92 envelopes were also divergent. Whereas anti-TM2 responses were similar in the two groups, the response to the SU glycoprotein was more vigorous in pn14-vaccinated animals than in pn92-vaccinated cats. Modification of the PID may alter the folding and assembly of envelope glycoproteins (44). Thus, the presentation of the three different Envs to the immune system during vaccination may have primed cats for disparate antiviral responses subsequent to challenge. While the anti-TM2 antibodies continued to increase over time after challenge in all cats, in several cases the anti-SU2 antibodies decreased, after a peak of activity, in the last week(s) of monitoring (Fig. 4). This phenomenon may reflect the decline of the acute-phase virus load and perhaps modification in antibody specificity due to the variability of SU and, in particular, of the third variable region of the FIV envelope, V3, containing the SU2 epitope. The antibody response to Gag proteins was evaluated by ELISA using p17 and p24 as antigens. Antibodies against p17 were the first to appear. In most vaccinated cats, anti-p17 reactivity was detected earlier than in the control cats, and in

some vaccinated animals, reactivity was detected before challenge (Fig. 6). This is likely due to a response raised against the truncated form of p17 expressed by the DNA vectors (see Materials and Methods). Viral challenge might then have boosted antibody responses. The anti-p24 response was detected later, and some cats did not seroconvert during the study period (Fig. 7). In accordance with levels of plasma viremia, anti-p24 reactivity appeared earlier and was stronger in most Env-vaccinated cats than in control cats. DISCUSSION In this study, infection was sharply accelerated subsequent to genetic immunization of cats with the Env glycoproteins. Such immunization, however, did not induce substantial anti-Env responses. While a weak response to the gp100 developed in several vaccinated cats, the only antibody response raised to a linear peptide from FIV Env before challenge was found in cats that received Envs with mutated PIDs and was directed against peptides containing the modified sequences. This finding suggests that the immunodominance of the PID may result from its position in the Env structure rather than from the amino acid sequence. However, the failure to elicit a response against the wild-type envelope precluded comparison with Envs bearing mutations in the PID and assessment of the

VOL. 71, 1997


9645

FIG. 5. Kinetics of postchallenge antibody response against the TM2 peptide. Sera were tested weekly over 9 weeks for groups A, B, and D and over 8 weeks for group C. See the legend to Fig. 4 for ELISA conditions and interpretation. WT, wild type.

putative role of anti-PID antibodies in enhancement of viral pathogenesis. Using a vaccination protocol similar to that employed in this study, Okuda et al. elicited a humoral response to the HIV-1 Env in vaccinated monkeys (43). Differences between the latter study and ours reside in the expression vector, the origin of the lentivirus envelope, and the animal species. The type and the efficiency of the immune response to DNA vaccination may depend on the promoter directing gene expression, the protein expressed, and the genetic background of the animals (50). A defective FIV provirus was also used, in another study, to vaccinate cats against FIV proteins (17). No antibody response was obtained. Several studies suggested that in contrast with other DNA-expressed antigens, lentivirus Env glycoproteins are inefficient at raising antibodies. Multiple inoculations are required to elicit low titers of Env-specific antibodies, and the antibody response is transient (31, 32, 72, 73). The acceleration of acute infection observed after challenge in the cats vaccinated with Env, in comparison with those that received pUC, was striking. Viremia appeared earlier in most cats of the Env-vaccinated groups, and the viremic peak was established more quickly. The mechanisms involved in this enhancement of early viral dissemination are unclear. An acceleration of infection in cats vaccinated with the FIV Env expressed by recombinant vaccinia virus has also been described (64). Enhanced infection after viral challenge was es-

tablished in naive cats by passive transfer of plasma from vaccinated cats, and the authors therefore proposed that the enhancement was mediated by anti-Env antibodies (64). In our study, it is unlikely that enhanced infection was related to antibodies, since the anti-Env humoral response elicited by DNA vaccination was weak or undetectable. Nevertheless, the influence of antibodies cannot be completely excluded, since antibody-dependent enhancement has been observed to occur at high antibody dilutions (60, 70). Moreover, it has been suggested that low-affinity antibodies, which may be undetectable in our immunological assays, could be involved in enhancement of viral infection (33). We found, however, no evidence for the presence of antibodies or other soluble factors capable of augmenting viral infection in vitro: whereas sera from individuals infected with HIV-1 frequently increase infection of primary human blasts (30), prechallenge sera from immunized cats did not modify infection of mitogen-activated feline PBMC (data not shown). Other immune phenomena, such as cellular activation, may have caused the acceleration of infection. FIV replicates more efficiently in activated cells in vitro and in vivo (40a), as has been shown for HIV-1 (42, 65, 79, 80), and can infect B and T lymphocytes (16). Specific priming of cells of T and B lineages by Env vaccination, while insufficient (or inappropriate) for the induction of detectable levels of antibodies, may have been sufficient to render cells more susceptible to viral infection.

9646

RICHARDSON ET AL.

J. VIROL.

FIG. 6. Antibody response against p17. ELISA was performed with 1/100 dilutions of cat sera. The times of DNA inoculation are indicated by vertical arrows. The day of viral challenge is indicated by a large arrow. WT, wild type.

This eventuality has been considered in the case of HIV infection. Schwartz developed a mathematical model to describe the effect of T-cell activation on HIV infection which predicts that the expansion of HIV-specific CD41 lymphocytes due to immunization would enhance HIV replication in the earliest phase of infection (63). Broader activation of the immune system could arise from nonclonal mechanisms. The HIV-1 Env has been described to possess qualities of both human T-cell and B-cell superantigens (1, 6, 27, 76). It may be speculated that the activation of lymphoid cells induced by the FIV Env mediates expansion of particular compartments of the immune system, increasing the target cell population and hence the rate of viral replication in the first phase of infection (13). Finally, nonspecific activation of the immune system induced by immunization with a foreign protein cannot be formally excluded, although the extent of generalized activation following DNA vaccination, for which conventional adjuvants are not used, might not be expected to be high. In the present study, the cellular response to vaccination was not studied. Work is in progress to analyze in detail the immune response elicited in the cat by vaccination with different Env expression vectors. It has been shown that immunization with oligomeric Env glycoproteins elicits a humoral response which differs from that induced by monomeric Env and that, in particular, conformational epitopes presented on Env oligomers may not be conserved in monomers (14). Therefore, immunization with oligomeric forms of Env might be predicted to improve reac-

tion with native envelope glycoproteins and the induction of protective immunity. In the present study, however, genetic immunization with the gene env, which should hypothetically provide highly authentic expression of Env, resulted in an accelerated acute-phase infection. This observation suggests that, at least when an optimal immunization is not achieved, Env DNA vaccination can be deleterious. The expression of Env glycoproteins in a microenvironment where an inflammatory reaction is developing, as may occur after the injection of sucrose and the deleted FIV provirus, may resemble viral expression in the first phases of natural infection. After infection with a limited infectious dose of FIV, a period of localized viral replication ensues, followed by seeding in lymphoid tissues (3, 4). If the antiviral response develops similarly following genetic immunization and infection, it is conceivable that the virus may take advantage of immune responses similar to those which caused the enhancement in our experiment to increase the efficacy of dissemination following natural exposure. The long-term effect of an augmentation in viral load during the primary infection of cats by FIV is unknown. Recently, a correlation between the inability to control the plasma viral load in the first phase of infection and the evolution of disease in SIV infection of rhesus monkeys has been described (22). Nevertheless, a correlation between survival and plasma viremia in the primary peak was not found (75). Due to the extended length of the asymptomatic period and the late appearance of the terminal stages in experimental FIV infection (5), study of the relationship between viral load and clinical out-

VOL. 71, 1997


9647

de Recherche sur le SIDA and the Ensemble Contre le SIDA/Sidaction, and by Biomed 2 grant from the European Economic Community. REFERENCES

FIG. 7. Antibody response against p24. ELISA was performed with 1/100 dilutions of cat sera. OD values greater than twice the mean values obtained with serum collected on the day of challenge were considered indicative of anti-p24 seroconversion. Open circles, no reactivity; black circles, anti-p24 reactivity. High background found in some serum samples from cats marked with asterisks did not permit a clear interpretation of the results. wt, wild type.

come is prohibitively long. Nevertheless, it will be necessary to explore the possibility that the acceleration of FIV infection by Env vaccination could worsen prognosis. Such information would be useful in appreciating the risk that such a phenomenon represents in human vaccination. Conflicting results have been obtained in the feline model after immunization with Env. In a recent study, Hosie et al. (26) reported that vaccination with purified FIV Env glycoproteins from the Petaluma isolate reduced the viral load after challenge with the homologous virus, although less efficiently than vaccination with inactivated whole virus. The observations of enhancement of FIV infection after vaccination by Siebelink et al. (64) and ourselves and suppression of infection in the study by Hosie et al. (26) suggest the existence of counteracting immune responses induced by vaccination with Env. These responses could not be limited to the induction of enhancing versus neutralizing antibodies. As a prerequisite to the development of vaccines against lentiviruses, we must learn which interactions between virus and host immunity determine the balance between enhancement and protection and how this balance may be displaced in favor of protection. ACKNOWLEDGMENTS We thank T. Vahlenkamp for valuable advice on developing a competitive RT-PCR. We express our appreciation to T. Leste-Lasserre, K. Goude, and the staff of the cattery of the Ecole Nationale Ve´te´rinaire for technical assistance. This work was supported by the Ministe`re de la Recherche et de la Technologie (Saut Technologique 95T0007), by the Agence Nationale

1. Akolkar, P. N., B. Gulwani-Akolkar, N. Chirmule, S. Pahwa, V. S. Kalyanaraman, R. Pergolizzi, S. Macphail, and J. Silver. 1995. The HIV glycoprotein gp160 has superantigen-like properties. Clin. Immunol. Immunopathol. 76:255–265. 2. Avrameás, A., A. D. Strosberg, A. Moraillon, P. Sonigo, and G. Pancino. 1993. Serological diagnosis of feline immunodeficiency virus (FIV) infection based on synthetic peptides from Env glycoproteins. Res. Virol. 144:209–218. 3. Bach, J.-M., M. Hurtrel, L. Chakrabarti, J.-P. Ganie`re, L. Montagnier, and B. Hurtrel. 1994. Early stages of feline immunodeficiency virus infection in lymph nodes and spleen. AIDS Res. Hum. Retroviruses 10:1731–1738. 4. Beebe, A. M., N. Dua, T. G. Faith, P. Moore, N. Pedersen, and S. Dandekar. 1994. Primary stage of feline immunodeficiency virus infection: viral dissemination and cellular targets. J. Virol. 68:3080–3091. 5. Bendinelli, M., M. Pistello, S. Lombardi, A. Poli, C. Garzelli, D. Matteucci, L. Ceccherini-Nelli, G. Malvaldi, and F. Tozzini. 1995. Feline immunodeficiency virus: an interesting model for AIDS studies and an important cat pathogen. Clin. Microbiol. Rev. 8:87–112. 6. Berberian, L., L. Goodlick, T. J. Kipps, and J. Braun. 1993. Immunoglobulin VH3 gene products: natural ligands for HIV gp120. Science 261:1588–1591. 7. Bertoni, G., M.-L. Zahno, R. Zanoni, H.-R. Vogt, E. Peterhans, G. Ruff, W. P. Cheevers, P. Sonigo, and G. Pancino. 1994. Antibody reactivity to the immunodominant epitopes of the caprine arthritis-encephalitis virus gp38 transmembrane glycoprotein associates with the development of arthritis. J. Virol. 68:7139–7147. 8. Broder, C. C., P. L. Earl, D. Long, S. T. Abedon, B. Moss, and R. W. Doms. 1994. Antigenic implications of human immunodeficiency virus type 1 envelope quaternary structure: oligomer-specific and -sensitive monoclonal antibodies. Proc. Natl. Acad. Sci. USA 91:11699–11703. 9. Cohen, J. 1993. Jitters jeopardize AIDS vaccine trials. Science 262:980–981. 10. Davis, H. L., R. G. Whalen, and B. A. Demeneix. 1993. Direct gene transfer into skeletal muscle in vivo: factors affecting efficiency of transfer and stability of expression. Hum. Gene Ther. 4:151–159. 11. Dawson, J. D. 1994. Comparing treatment groups on the basis of slopes, areas-under-the-curve, and other summary measures. Drug Inf. J. 28:723– 732. 12. Diehl, L. J., C. K. Mathiason-DuBard, L. O’Neil, and E. A. Hoover. 1995. Longitudinal assessment of feline immunodeficiency virus kinetics in plasma by use of a quantitative competitive reverse transcriptase PCR. J. Virol. 69:2328–2332. 13. Dobrescu, D., S. Kabak, K. Mehta, C. H. Suh, A. Asch, P. U. Cameron, A. S. Hodtsev, and D. N. Posnett. 1995. Human immunodeficiency virus 1 reservoir in CD41 T cells is restricted to certain Vb subsets. Proc. Natl. Acad. Sci. USA 92:5563–5567. 14. Earl, P. L., C. C. Broder, D. Long, S. A. Lee, J. Peterson, S. Chakrabarti, R. W. Doms, and B. Moss. 1994. Native oligomeric human immunodeficiency virus type 1 envelope glycoprotein elicits diverse monoclonal antibody reactivities. J. Virol. 68:3015–3026. 15. Eaton, A. M., K. E. Ugen, D. B. Weiner, T. Wildes, and J. A. Levy. 1994. An anti-gp41 human monoclonal antibody that enhances HIV-1 infection in the absence of complement. AIDS Res. Hum. Retroviruses 10:13–18. 16. English, R. V., J. C. M., D. H. Gebhard, and M. B. Tomkins. 1993. In vivo lymphocyte tropism of feline immunodeficiency virus. J. Virol. 67:5175–5186. 17. Flynn, J. N., M. J. Hosie, C. A. Cannon, M. A. Rigby, A. H. Mackay, D. A. Argyle, T. Miyazawa, O. Jarret, D. E. Onions, and J. C. Neil. 1997. FIV, SIV and SHIV vaccination, p. 60. Fondation Marcel Merieux, Annecy, France. 18. Fuller, D. H., M. Murphey-Corb, J. Clements, S. Barnett, and J. R. Haynes. 1996. Induction of immunodeficiency virus-specific immune responses in rhesus monkeys following gene gun-mediated DNA vaccination. J. Med. Primatol. 25:236–241. 19. Fust, G., F. D. Toth, J. Kiss, E. Ujhelyi, I. Nagy, and D. Banhegi. 1994. Neutralizing and enhancing antibodies measured in complement-restored serum samples from HIV-1 infected individuals correlate with immunosuppression and disease. AIDS 8:603–609. 20. Goff, S., P. Traktman, and D. Baltimore. 1981. Isolation and properties of Moloney murine leukemia virus mutants: use of a rapid assay for release of virion reverse transcriptase. J. Virol. 38:239–248. 21. Guiot, A. L., D. Rigal, D. Pialot, and G. Chappuis. 1995. Development of a simple, rapid and accurate in vitro whole blood technique for the detection and semi-quantification of FIV cellular viremia. Vet. Microbiol. 47:331–342. 22. Hirsch, V. M., T. R. Fuerst, G. Sutter, M. W. Carrol, L. C. Yang, S. Goldstein, M. Piatak, Jr., V. R. Elkins, W. G. Alvord, D. C. Montefiori, B. Moss, and J. D. Lifson. 1996. Patterns of viral replication correlate with outcome in simian immunodeficiency virus (SIV)-infected macaques: effect of prior immunization with a trivalent SIV vaccine in modified vaccinia virus ankara. J. Virol. 70:3741–3752. 23. Ho, D. D., M. S. C. Fung, H. Yoshiyama, Y. Cao, and J. E. Robinson. 1992.

9648

RICHARDSON ET AL.

Discontinuous epitopes on gp120 important in HIV-1 neutralization. AIDS Res. Hum. Retroviruses 8:1337–1339. 24. Homsy, J., M. Meyer, and J. A. Levy. 1990. Serum enhancement of human immunodeficiency virus (HIV) infection correlates with disease in HIVinfected individuals. J. Virol. 64:1437–1440. 25. Homsy, J., M. Meyer, M. Tateno, S. Clarkson, and J. A. Levy. 1989. The Fc and Not CD4 receptor mediates antibody enhancement of HIV infection in human cells. Science 244:1357–1360. 26. Hosie, M. J., T. H. Dunsford, A. De Ronde, B. J. Willett, C. A. Cannon, J. C. Neil, and O. Jarrett. 1996. Suppression of virus burden by immunization with feline immunodeficiency virus Env protein. Vaccine 14:405–411. 27. Imberti, L., A. Sottini, A. Bettinardi, M. Puoti, and D. Primi. 1991. Selective depletion in HIV infection of T cells that bear specific T cell receptor Vb sequences. Science 254:860–862. 28. Issel, C. J., D. W. Horohov, D. F. Lea, W. V. Adams, S. D. Hagius, J. M. McManus, A. C. Allison, and R. C. Montelaro. 1992. Efficacy of inactivated whole-virus and subunit vaccines in preventing infection and disease caused by equine infectious anemia virus. J. Virol. 66:3398–3408. 29. Knowles, D., W. Cheevers, T. McGuire, T. Stem, and J. Gorham. 1990. Severity of arthritis is predicted by antibody response to gp135 in chronic infection with caprine arthritis-encephalitis virus. J. Virol. 64:2396–2398. 30. Kostrikis, L. G., Y. Cao, H. Ngai, J. P. Moore, and D. D. Ho. 1996. Quantitative analysis of serum neutralization of human immunodeficiency virus type 1 from subtypes A, B, C, D, E, F, and I: lack of direct correlation between neutralization serotypes and genetic subtypes and evidence for prevalent serum-dependent infectivity enhancement. J. Virol. 70:445–458. 31. Lu, S., J. Arthos, D. C. Motefiori, Y. Yasutomi, K. Manson, F. Mustafa, E. Johnson, J. C. Santoro, J. Wissink, J. I. Mullins, J. R. Haynes, N. L. Letvin, M. Wyand, and H. L. Robinson. 1996. Simian immunodeficiency virus DNA vaccine trial in macaques. J. Virol. 70:3978–3991. 32. Lu, S., J. C. Santoro, D. H. Fuller, J. R. Haynes, and H. L. Robinson. 1995. Use of DNAs expressing HIV-1 Env and noninfectious HIV-1 particles to raise antibody responses in mice. Virology 209:147–154. 33. Lund, O., J. Hansen, E. Mosekilde, J. O. Nielsen, and J.-E. S. Hansen. 1993. A model of enhancement and inhibition of monocytes by antibodies against HIV. J. Biol. Phys. 19:133–145. 34. Lutz, H., R. Hoffmann-Lehmann, K. Bauer-Pham, E. Holznagel, F. Tozzini, M. Bendinelli, G. Reubel, A. Aubert, D. Davis, D. Cox, and E. Young. 1995. FIV vaccine. I. Immune response to recombinant FIV env gene products and outcome after challenge infection. Vet. Immunol. 46:115–125. 35. Mascola, J. R., B. J. Mathieson, P. M. Zack, M. C. Walker, S. B. Halstead, and D. S. Burke. 1993. Summary report: workshop on the potential risks of antibody-dependent enhancement in human HIV vaccine trials. AIDS Res. Hum. Retroviruses 9:1175–1184. 36. McElrath, M. J., L. Corey, G. P. D., T. J. Matthews, D. C. Montefiori, L. Rowen, L. Hood, and J. I. Mullins. 1996. Human immunodeficiency virus type 1 infection despite prior immunization with a recombinant envelope vaccine regimen. Proc. Natl. Acad. Sci. USA 93:3972–3977. 37. McGuire, T. C., D. P. Knowles, W. C. Davis, A. L. Brassfield, T. A. Stem, and W. P. Cheevers. 1992. Transmembrane protein oligomers of caprine arthritis-encephalitis lentivirus are immunodominant in goats with progressive arthritis. J. Virol. 66:3274–3250. 38. Moore, J. P., Y. Cao, L. Qing, Q. J. Sattentau, J. Pyati, R. Koduri, J. Robinson, C. F. Barbas III, D. R. Burton, and D. D. Ho. 1995. Primary isolates of human immunodeficiency virus type 1 are relatively resistant to neutralization by monoclonal antibodies to gp 120, and their neutralization is not predicted by studies with monomeric gp 120. J. Virol. 69:101–109. 39. Moore, J. P., and D. D. Ho. 1995. HIV neutralization: the consequence of viral adaptation to growth on transformed T cells. AIDS. 9(Suppl. A):S117– S136. 40. Moraillon, A., F. Barre-Sinoussi, A. Parodi, R. Moraillon, and C. Dauguet. 1992. In vitro properties and experimental pathogenic effect of three feline immunodeficiency viruses (FIV) isolated from cats with terminal disease. Vet. Microbiol. 31:41–54. 40a.Moraillon, A., J. Richardson, and G. Pancino. Unpublished data. 41. Nara, P. L., R. R. Garrity, and J. Goudsmit. 1991. Neutralization of HIV-1: a paradox of humoral proportions. FASEB J. 5:2437–2455. 42. O’Brien, W. A., K. Grovit-Ferbas, A. Namazi, S. Ovcak-Derzic, H.-J. Wang, J. Park, C. Yeramian, S.-H. Mao, and J. A. Zack. 1995. Human immunodeficiency virus-type 1 replication can be increased in peripheral blood of seropositive patients after influenza vaccination. Blood 86:1082–1089. 43. Okuda, K., H. Bukawa, K. Hamajima, S. Kawamoto, K.-I. Sekigawa, Y. Yamada, S.-I. Tanaka, N. Ishi, I. Aoki, M. Nakamura, H. Yamamoto, B. R. Cullen, and J. Fukushima. 1995. Induction of potent humoral and cellmediated immune responses following direct injection of DNA encoding the HIV type 1 env and rev gene products. AIDS Res. Hum. Retroviruses 11:933–942. 44. Pancino, G., L. Camoin, and P. Sonigo. 1995. Structural analysis of the principal immunodominant domain of the feline immunodeficiency virus transmembrane glycoprotein. J. Virol. 69:2110–2118. 45. Pancino, G., S. Castelot, and P. Sonigo. 1995. Differences in feline immu-

J. VIROL.

46. 47. 48. 49. 50.

51. 52.

53. 54. 55.

56.

57.

58. 59. 60.

61. 62.

63. 64.

65.

66. 67. 68.

69.

70.

nodeficiency virus (FIV) host cell range correlate with envelope fusogenic properties. Virology 206:796–806. Pancino, G., C. Chappey, W. Saurin, and P. Sonigo. 1993. B epitopes and selection pressures in feline immunodeficiency virus envelope glycoproteins. J. Virol. 67:664–672. Pancino, G., I. Fossati, C. Chappey, S. Castelot, B. Hurtrel, A. Moraillon, D. Klatzmann, and P. Sonigo. 1993. Structure and variations of feline immunodeficiency virus envelope glycoproteins. Virology 192:659–662. Pancino, G., and P. Sonigo. 1997. Retention of viral infectivity after extensive mutation of the highly conserved immunodominant domain of the feline immunodeficiency virus envelope. J. Virol. 71:4339–4346. Pardoll, D. M., and A. M. Beckerleg. 1995. Exposing the immunology of naked DNA vaccines. Immunity 3:165–169. Pertmer, T. M., T. R. Roberts, and J. R. Haynes. 1996. Influenza virus nucleoprotein-specific immunoglobulin G subclass and cytokine responses elicited by DNA vaccination are dependent on the route of vector delivery. J. Virol. 70:6119–6125. Piatak, M. J., K.-C. Luk, B. Williams, and J. D. Lifson. 1993. Quantitative competitive polymerase chain reaction for accurate quantitation of HIV DNA and RNA species. BioTechniques 14:70–80. Pistello, M., S. Menzo, M. Giorgi, L. Da Prato, G. Cammarota, M. Clementi, and M. Bendinelli. 1994. Competitive polymerase chain reaction for quantitating feline immunodeficiency virus load in infected cat tissues. Mol. Cell. Probes 8:229–234. Poignard, P., P. J. Klasse, and Q. J. Sattentau. 1996. Neutralization of the human immunodeficiency virus type 1. Immunol. Today 17:239–246. Reid, G., M. A. Rigby, M. McDonald, M. J. Hosie, J. C. Neil, and O. Jarrett. 1991. Immunodiagnosis of feline immunodeficiency virus infection using recombinant viral p17 and p24. AIDS 5:1477–1483. Richardson, J., I. Fossati, A. Moraillon, S. Castelot, P. Sonigo, and G. Pancino. 1996. Neutralization sensitivity and accessibility of continuous B cell epitopes of the feline immunodeficiency virus envelope. J. Gen. Virol. 77:759–771. Robinson, W. E., M. K. Gorny, J. I. Xy, W. M. Mitchell, and S. Zolla-Pazner. 1991. Two immunodominant domains of gp41 bind antibodies which enhance human immunodeficiency virus type 1 infection in vitro. J. Virol. 65:4169–4176. Robinson, W. E., T. Kawamura, D. Lake, Y. Masuho, W. M. Mitchell, and E. M. Hersh. 1990. Antibodies to the primary immunodominant domain of human immunodeficiency virus type 1 (HIV-1) glycoprotein 41 enhance HIV-1 infection in vitro. J. Virol. 64:5301–5305. Robinson, W. E., D. C. Montefiori, and W. M. Mitchell. 1988. Antibodydependent enhancement of human immunodeficiency virus type 1 infection. Lancet i:790–794. Robinson, W. E., D. C. Montefiori, and W. M. Mitchell. 1987. A human immunodeficiency virus infection-enhancing factor in seropositive sera. Biochem. Biophys. Res. Commun. 149:693–699. Robinson, W. E., D. C. Montefiori, W. M. Mitchell, A. M. Prince, H. J. Alter, G. R. Dreesman, and J. W. Eichberg. 1989. Antibody-dependent enhancement of human immunodeficiency virus type 1 (HIV-1) infection in vitro by serum from HIV-1-infected and passively immunized chimpanzees. Proc. Natl. Acad. Sci. USA 86:4710–4714. Sattentau, Q. J., S. Zolla-Pazner, and P. Poignard. 1995. Epitope exposure on functional, oligomeric HIV-1 gp41 molecules. Virology 206:713–717. Schutten, M., A. C. Andeweg, M. L. Bosch, and A. D. M. E. Osterhaus. 1995. Enhancement of infectivity of a non-syncytium inducing HIV-1 by sCD4 and by human antibodies that neutralize syncytium inducing HIV-1. Scand. J. Immunol. 41:18–22. Schwartz, D. H. 1994. Potential pitfalls on the road to an effective HIV vaccine. Immunol. Today 15:54–57. Siebelink, K. H. J., E. Tijhaar, R. C. Huisman, W. Huisman, A. de Ronde, I. H. Darby, M. J. Francis, G. F. Rimmelzwaan, and A. D. M. E. Osterhaus. 1995. Enhancement of feline immunodeficiency virus infection after immunization with envelope glycoprotein subunit vaccines. J. Virol. 69:3704–3711. Stanley, S. K., M. A. Ostrowski, J. S. Justement, K. Gantt, S. Hedayati, M. Mannix, K. Roche, D. J. Schwartzentruber, C. H. Fox, and A. S. Fauci. 1996. Effect of immunization with a common recall antigen on viral expression in patients infected with human immunodeficiency virus type 1. N. Engl. J. Med. 334:1222–1230. Steele, F. R. 1995. gp120: Good, bad or indifferent. Nat. Med. 1:1105–1106. Steimer, K. S., C. J. Scandella, P. V. Stiles, and N. L. Haigwood. 1991. Neutralization of divergent HIV-1 isolates by conformation-dependent human antibodies to gp120. Science 254:105–108. Sullivan, N., Y. Sun, J. Li, W. Hofman, and J. Sodroski. 1995. Replicative function and neutralization sensitivity of envelope glycoproteins from primary and T-cell line-passaged human immunodeficiency virus type 1 isolates. J. Virol. 69:4413–4422. Takeda, A., J. E. Robinson, D. D. Ho, C. Debouck, N. L. Haigwood, and F. Ennis. 1992. Distinction of human immunodeficiency virus type 1 neutralization and infection enhancement by human monoclonal antibodies to glycoprotein 120. J. Clin. Invest. 89:1952–1957. Takeda, A., C. U. Tuazon, and F. A. Ennis. 1988. Antibody-enhanced infec-

VOL. 71, 1997 tion by HIV-1 via FC receptor-mediated entry. Science 242:580–583. 71. Talbott, R. L., E. E. Sparger, K. M. Lovelace, W. M. Fitch, N. C. Pedersen, P. A. Luciw, and J. H. Elder. 1989. Nucleotide sequence and genomic organization of feline immunodeficiency virus. Proc. Natl. Acad. Sci. USA 86:5743–5747. 72. Wang, B., J. Boyer, V. Srikantan, K. Ugen, L. Gilbert, C. Phan, K. Dang, M. Merva, M. G. Agadjanyan, M. Newman, R. Carrano, D. McCallus, L. Coney, W. V. Williams, and D. B. Weiner. 1995. Induction of humoral and cellular immune responses to the human immunodeficiency type 1 virus in non human primates by in vivo DNA inoculation. Virology 211:102–112. 73. Wang, B., K. E. Ugen, V. Srikantan, M. Agadjanyan, K. Dang, Y. Refaeli, A. Sato, J. Boyer, W. Williams, and W. D. B. 1993. Gene inoculation generates immune responses against human immunodeficiency virus type 1. Proc. Natl. Acad. Sci. USA 90:4156–4160. 74. Wang, S. Z.-S., K. E. Rushlow, C. J. Issel, R. F. Cook, S. J. Cook, M. L. Raabe, Y.-H. Chong, L. Costa, and R. C. Montelaro. 1994. Enhancement of EIAV replication and disease by immunization with a baculovirus-expressed recombinant envelope surface glycoprotein. Virology 199:247–251. 75. Watson, A., J. Ranchalis, B. Travis, M. J., W. Sutton, P. R. Johnson, S.-L. Hu, and N. L. Haigwood. 1997. Plasma viremia in macaques infected with


76. 77. 78.

79. 80.

9649

simian immunodeficiency virus: plasma viral load early in infection predicts survival. J. Virol. 71:284–290. Westby, M., F. Manca, and A. G. Dalgleish. 1996. The role of host immune responses in determining the outcome of HIV infection. Immunol. Today 17:120–125. Wolff, J. O., R. W. Malone, P. Williams, W. Chong, G. Acsadi, A. Jani, and P. L. Felgner. 1990. Direct gene transfer into mouse muscle in vivo. Science 247:1465–1468. Yamamoto, J. K., C. D. Ackley, H. Zochlinski, H. Louie, E. Pembroke, M. Torten, H. Hansen, R. Munn, and T. Okuda. 1991. Development of IL-2independent feline lymphoid cell lines chronically infected with feline immunodeficiency virus: Importance for diagnostic reagents and vaccines. Intervirology 32:361–375. Zack, J. A., S. J. Arrigo, S. R. Weitzman, A. S. Go, A. Haislip, and I. S. Y. Chen. 1990. HIV-1 entry into quiescent primary lymphocytes: molecular analysis reveals a labile, latent viral structure. Cell 61:213–222. Zagury, D., J. Bernard, R. Leonard, R. Cheynier, M. Feldman, P. S. Sarin, and R. C. Gallo. 1986. Long-term cultures of HTLV-III-infected T cells: a model of cytopathology of T-cell depletion in AIDS. Science 231:850–853.