Three of these enhancers-3'a enhancer (3'aE) (hsl,2), hs3, and hs4-constitute a locus control region (LCR) active at the plasma cell stage (6). Experiments have ...
Proc. Natl. Acad. Sci. USA Vol. 93, pp. 4392-4397, April 1996
Immunology
Concerted repression of an immunoglobulin heavy-chain
enhancer, 3'aE(hs1,2) MALLIKA SINGH
AND
BARBARA K. BIRSHTEIN*
Department of Cell Biology, Albert Einstein College of Medicine, Bronx, NY 10461
Communicated by Matthew D. Scharff, Albert Einstein College of Medicine of Yeshiva University, Bronx, NY, December 26, 1995 (received for review October 3, 1995)
gene targets critical for B-cell differentiation have not yet been elucidated (33). In light of the general function of BSAP as a transcriptional activator, we wanted to elucidate the apparent repressive function of BSAP in the context of 3'aE(hsl,2) to gain insight into disparate mechanistic roles that BSAP may play. We have discovered concerted repression of 3'aE(hsl,2) in B cells: BSAP's role as a repressor of 3'aE(hsl,2) depends not only on a and b BSAP binding sites but also on other cis elements that are capable of protein binding, namely an octamer (Oct) motif and a stretch of G residues resembling switch sequences ("G-rich motif'). In the absence of BSAP binding, proteins binding to the Oct and the G-rich motifs function as transcriptional activators.
The transcription factor, B-cell-specific acABSTRACT tivator protein (BSAP), represses the murine immunoglobulin heavy-chain 3' enhancer 3'aE(hsl,2) in B cells. Analysis of various 3'aE deletional constructs indicates that sequences flanking a and b BSAP-binding sites are essential for appropriate regulation of the enhancer. An octamer motif 5' of the a site and a specific G-rich motif 3' of the b site were identified by competition in electrophoretic mobility-shift assays and methylation-interference foot-printing analysis. Site-directed mutagenesis of either the octamer or G-rich sites resulted in the complete release of repression of 3'aE(hsl,2), implicating these two motifs in the repression of this enhancer in B cells. However, when both BSAP-binding sites were mutated, the octamer and G-rich motifs functioned as activators. Moreover, in plasma cells, when BSAP is not expressed, 3'aE(hsl,2) is active, and its activity depends on the presence of the other two factors. These results suggest that in B cells, 3'aE(hsl,2) is down-regulated by the concerted actions of BSAP, octamer, and G-rich DNA-binding proteins. Supporting this notion of concerted repression, a physical interaction between BSAP and octamer-binding proteins was demonstrated using glutathione S-transferase fusion proteins. Thus, concerted repression of 3'aE(hsl,2) in B cells provides a sensitive mechanism by which this enhancer, either individually or as part of a locus-controlling region, is highly responsive to any of several participating factors.
MATERIALS AND METHODS Cell Lines. Murine B-cell lines include BASC (pro-B), 18-81 (pre-B), W231, A-20, and M12.4.1 (B cell), and S194 (plasma cell). All the cell lines were grown in suspension culture at 37°C in 5-7% CO2 in RPMI 1640 medium (BioWhittaker), as described in ref. 11. Electrophoretic Mobility-Shift Assays (EMSAs) and Methylation-Interference Foot-Printing Analysis. EMSAs were done as described (11). For competition with specific a-Oct-1 and a-Oct-2 antisera (Santa Cruz Biotechnology), 1 ,ul of undiluted antisera was added to each reaction mixture and preincubated overnight at 4°C. Methylation-interference footprinting analysis was done as described (11). RNase Protection Analysis. Plasmid vector OVEC-S containing a rabbit f3-globin reporter gene was used for RNase protection assay (19). A complementary oligonucleotide containing the wild-type b binding site of BSAP in 3'aE(hsl,2)
Immunoglobulin genes are exquisitely regulated during B-cell development, in processes of DNA recombination, including V(D)J joining and class switch recombination, and in levels of gene expression, including alternative splicing. These events not only occur by intrinsic B-cell-specific developmental pathways but also in response to antigen through interactions with T cells and stromal cells in particular anatomic compartments (1). Heavy-chain genes are presumed to be regulated by proteins that react with cis-acting elements, such as the immunoglobulin heavy-chain (IgH) intronic enhancer, E/x (2), and four other enhancers located 3' of the Ca gene (3-7). Three of these enhancers-3'a enhancer (3'aE) (hsl,2), hs3, and hs4-constitute a locus control region (LCR) active at the plasma cell stage (6). Experiments have so far implicated a role for 3'aE(hsl,2) in class switching and in high levels of IgH expression in plasma cells (8, 9). We have shown that in B-cell lines, 3'aE(hsl,2) is repressed by the transcription factor, B-cellspecific activator protein (BSAP) (Pax 5) (10); in plasma cells, where BSAP is not expressed, 3'aE(hsl,2) is active (11, 12). In addition to its role in limiting the expression of 3'aE(hsl,2), BSAP has been shown to be essential for early B-cell development (as well as the development of the central nervous system) (13, 14). Although transcriptional studies have identified several genes that are apparently positively regulated by BSAP (15-17), including CD19 (18), those BSAP
(CCCTGGGGTGTTGAGCCACCCATCCTTGCCCATCTCCTGTCATGTCCT) was cloned into OVEC-S and used for SP6 RNA mapping (15). DNA Transfections and Chloramphenicol Acetyltransferase (CAT) Assay. 3'aE(hsl,2) was mutated at various sites using different mutant oligonucleotides, as cited in Fig. 1, and PCR, as described previously (11). Mutant enhancers were subcloned in the CAT expression vector QM 293 (11). DNA
transfections used the DEAE-dextran method as described in ref. 11, except that transfection in the A-20 cell line was done as described in ref. 20. At least three to five experiments were done for each cell type. Protein-Protein Interaction Assay. For interaction of BSAP with immobilized glutathione S-transferase (GST) fusion proteins, GST and GST-POU (Oct-2), domain fusion proteins (gifts from H. Singh, University of Chicago) and GST-POU1, GST-POU1, and GST-POU3 (gifts from R. Roeder, Rockefeller University) were used as described by Luo and Roeder (21). BSAP cDNA (a gift from S. Desiderio, The Johns Abbreviations: IgH, immunoglobulin heavy chain; 3'aE, 3'a enhancer; BSAP, B-cell-specific activator protein; CAT, chloramphenicol acetyl-
publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
The
transferase; GST, glutathione S-transferase; EMSA, electrophoretic mobility-shift assay. *To whom reprint requests should be addressed.
4392
Proc. Natl. Acad. Sci. USA 93 (1996)
Immunology: Singh and Birshtein 930 wt AAACAAACATCCATTTGCATGTGCCCTTGTGA mut AAACAAACATCCtccatacaGTGCCCTTGTGA
A OVEC-Oligob (+)/(-) Oligob l-globin
737 wt CATCATCAATAGGGGTCATGGACCCCAGTCCC Oligoa Oligo a: mut CATCATCAATcaaGcTtATGGACCCCAGTaCC
655
Oligo b: wt CCCTGGGGTGTTGAGCCACCCATCCTTGCCCA
I,globin
p-globin SV40 enh.
TATA
B
SV40 enh. TATA
a. +
.I
c2I
481 G
OVEC-Ref
OVEC-S
SV40 enh.
TATA
mut CCCTGGGGTaTTatcaataatATCCTTaCCCA
G-nch:
4393
(0
wt TGAGAAGGGGTGGGGGAGGGGGTCTGGGCT mut TGAGAAGGatcaatcatcaatGTCTGGGCT
U)
.0 O
O
0
>
0)
O
C)
0)
(0
0
309-
FIG. 1. Oligonucleotides used for competition and mutagenesis.
Hopkins University School of Medicine, Baltimore) was expressed using a coupled transcription-translation system (Promega). RESULTS BSAP Mediates Partial Repression Through Either a or b Binding Sites. Our initial studies (11) used site-specific mu-
tagenesis and transient transfection assays to document repression of 3'aE(hsl,2) in B cells through the interaction of BSAP with one of its two binding sites, the higher affinity b site (Fig. 2). Similar studies have shown that, despite the apparent lack of occupancy of the a site as assessed by in vivo footprinting studies (28), the a site can also mediate repression in B-cell lines (data not shown). Moreover, 3'aE(hsl,2) in which both a and b sites were mutated [3' aE(ab mut)] was even more active than either of the single mutants (data not shown). Thus, BSAP partially represses 3'aE(hsl,2) through either the a or the b binding sites; full repression is observed only when both sites can be occupied. BSAP Can Function as an Activator When Binding to the Isolated b Binding Site. With the exception of 3'aE(hsl,2), where BSAP was shown to act as a repressor, BSAP has been reported to be a transcriptional activator. As all BSAP sites are unique in sequence, neither the a nor the b binding sites of 3'aE(hsl,2) precisely matches the consensus motifs (22). It was, therefore, of interest to determine whether the BSAP binding sites within 3'aE(hsl,2) were inherently repressive. The b binding site was cloned in both orientations into the OVEC-S vector, which contains a ,j-globin reporter gene (19), and transiently transfected together with a reference construct (OVEC-Ref) into the M12.4.1 cell line. Correctly initiated /3-globin gene transcripts (designated 5' end) of both the test and the reference constructs were measured by RNase protection analysis. As with other BSAP-binding sites, such as a site from the promoter of CD19 gene (18) (Fig. 3, lane 4), the b binding site activated transcription in both orientations (lanes 2 and 3). No transcriptional increase was observed in the plasma cell line, J558L, which, like other plasmacytes, lacks BSAP expression (data not shown). Thus, we ascribe the repressive function of BSAP in the context of 3'aE(hsl,2) to its interaction with another factor(s), which can bind to adjacent sequences. XbaI PstI
Oct
Ca
rol
0,' 50 50
EcoRI
BI
NcoI
KpnI G rich
BSAPI BSAP
bp
FIG. 2. Schematic representations of the murine 3'aE(hsl,2). Different cis elements involved in the regulation of 3'aE(hsl,2)namely, octamer, a and b binding sites of BSAP, and G-rich DNA-are shown here.
242 + 238 217 201
-
-
-
190--
180-
-
160147 123 f 110 90-
5'end
} Reference
1
2
3
4
FIG. 3. The 3'aE(hsl,2) BSAP b binding site acts as a B-cellspecific activator element. (A) Schematic diagram of OVEC plasmids. The b BSAP-binding site of 3'aE(hsl,2) was cloned in OVEC-S in both orientations (indicated by arrows). (B) Plasmids OVEC-b (+/-) and OVEC-S were transiently transfected into M12.4.1 cells, together with OVEC-Ref containing an internal deletion in the /3-globin leader sequence (21). The 5' end refers to correctly initiated transcripts of the ,3-globin gene; reference denotes transcripts of the plasmid OVECRef. The slower mobility band represents the upstream transcript. Marker sizes are given in nucleotides.
Sequences Flanking a and b BSAP-Binding Sites of 3'aE(hsl,2) Are Important for Appropriate Regulation by BSAP. Our initial approach to analysis of 3'aE(hsl,2) function, using various deletional constructs, was based on the initial supposition that the enhancer activity was the product of a linear array of motifs. While later results (see below) revealing the concerted regulation of 3'aE(hsl,2) were not consistent with this assumption, this approach has permitted us to localize and identify key regulators. Transient transfection assays were carried out using a 250-bp Pst I/Nco I core segment, which contains both a and b BSAP-binding sites. As shown in Fig. 4, in the BSAP(-) plasma cell line S194, both 3'aE(P/N, wt) (line 3) and 3'aE(P/N, b mut) (line 4) showed only 11-12% of the activity of the full-length enhancer, suggesting that in plasma cells, the activity of 3'aE(hsl,2) depended on sequences flanking the central core. In BSAP(+) B-cell lines W231 and M12.4.1 and A-20 (data not shown), the core enhancer segment (line 3) showed low-level activity, similar to that of full-length 3'aE(wt) (line 1); and in none of the B-cell lines was enhanced activity observed with the core enhancer, when the b BSAP site was mutated (line 4). Therefore, we concluded that sequences flanking the central core
segment were essential for the activation observed in B-cell lines when BSAP-binding sites were mutated. We then examined enhancer activity upon the addition of either the 5' flank [3'aE(X/N)] or the 3' flank [3'aE(P/K)] to the central core. Transient transfection assays in the S194 plasma cell line showed that addition of the 5' octamercontaining flank to the central core gave activity (line 5) equivalent to that of full-length 3'aE(hsl,2) (line 1), confirming previous observations documenting the importance of the octamer motif to the 3'aE(hsl,2) activity at this stage (23). Addition of the 3' flank resulted in approximately one-fifth of the total activity (line 7). As expected, mutation of the b
4394
Proc. Natl. Acad. Sci. USA 93 (1996)
Immunology: Singh and Birshtein (CONSIRLC.TS
1)
3'(uE
2)
bmut
(OTI I
.CO_NSTRL CI S
XbaiI Pstl
Ncol Kpl
\MAIl
l.
wt
3)
P/N wt
4)
P/N, bmul
l
RELATIVE ACTIVITY S1944W231
10°
.....
2.D2D53 I
i
I
- -1.0
.0
b
a
Oct
M12.4.1
50f.. 100 _IJ 100
K
aX Oct
8.0
3.0
105
a bN I)L_.a
12
] N
2.3
I
I.0
'1 '1
3.2 5)
X/N wt
Oct
x 6) X/N, bmut
II -N
1.7 __.....LN
Oct
3.2 '
7) P/K wt 8) P/K, bmut
a
b
K
a
$
K
100
2.3
21.5
5.3 9)
EL
Xbal --
XbaI iOct
11111-119 1,
5.0
N
WI
FIG. 4. Activities of truncated versions of 3'aE(hsl,2) in B cells. Different truncated forms of 3'aE(hsl,2) were made using PCR and cloned in the enhancerless CAT expression vector, QM 293. The relative activity was determined by representing wild-type 3'aE(hsl,2) repressed-state (B cells) as 1 and active-state (plasma cells) as 100 on an activity scale. [In actual experiments, the repressed-state represents 4- to 5-fold activation; the active-state represents -35- to 40-fold activation, whereas 3'aE(hsl,2) with any single mutation also has -40- to 50-fold activation over the empty vector.] Bars represent the averages of relative activities. The Rous sarcoma virus-/3-galactosidase expression vector was cotransfected with the test plasmid in each transfection as an index of transfection efficiency. Equal ,3-galactosidase units within each set were used for the CAT assay.
BSAP-binding site had no obvious effect on activity in this BSAP(-) cell line (lines 6 and 8). In B-cell lines, the constructs, X/N, wt (line 5) and P/K, wt (line 7) were somewhat more active ("2-fold) than the fulllength wild-type enhancer (line 1), indicating that 5' and 3' flanking segments were involved in the full repression of 3'aE in BSAP(+) cell lines. In both M12.4.1 and A-20 (data not shown), mutation of the b BSAP-binding site in either construct resulted in -2- to 3-fold increase in activity (compare line 6 with 5 and line 8 with 7), suggesting that in the full-length enhancer, both 5' and 3' flanking sequences contributed equally to the increased activity observed in these B-cell lines, when the b BSAP-binding site was mutated. In contrast, in W231 B cells, only with the addition of the 5' flank was an incremental increase in activity observed when the b BSAPbinding site was mutated (compare line 6 with 5 and line 8 with 7 of Fig. 4). This observation suggested that factors that bind to the 3' flank and contribute to the activation of 3'aE(hsl,2) in M12.4.1 and A-20 cell lines when BSAP no longer binds may be absent from W231 cell line. An Octamer Motif in the 5' Flank and a Stretch of G Residues (G-Rich Motif) in the 3' Flank Are Two Major Sites Bound by Proteins. EMSA was performed with both 5' and 3' flanks to identify specific sequences that might be involved in the regulation of 3'aE(hsl,2). Competition analysis confirmed that none of the complexes was formed by BSAP. The 5' flank (Xba I/Pst 1-180, data not shown) was found to form three DNA-protein complexes using W231 nuclear extracts, two of which were also present in S194 plasma cells. Competition of EMSA with a defined Oct motif and use of specific a-Oct-1 and a-Oct-2 antisera confirmed that in W231 cells, the Oct site present in 3'aE(hsl,2) was bound by both Oct-1 and Oct-2. It is likely that the slowest mobility band in S194 cells is also formed by Oct-1 (Oct-2 binding is not apparent). Although the identity of the second shared complex has not yet been determined, one candidate involves a recently identified ETSAP-1 element (24).
Using the 3' flank (Nco I/Kpn 1-150)
as a
probe, nuclear
extracts from M12.4.1 and S194 cells (Fig. 5A) and A-20, 18-81 (pre-B), and Basc (pro-B) cells (data not shown) showed a
similar shifted pattern consisting of a slow-migrating complex. W231 cells, however, had a major doublet of faster mobility (bands W, and W2) in addition to a smaller amount of the shared complex; two different preparations of nuclear extracts showed the same EMSA pattern. Our experiments (see below) showed that all of these complexes shared a common binding site. Methylation-interference foot-printing analysis of Wi and W2 complexes from W231 cell extract identified a stretch of G residues (G-rich motif) that showed marked interference because of methylation (Fig. 5B). The C-rich complementary DNA strand, as expected, showed no detectable interference (data not shown). An oligonucleotide complementary to the protected G-rich region competed with the formation of the doublet with the W231 extract (Fig. 5C, lane 2), as well as with the formation of the major slow-migrating complex formed by extracts from M12.4.1 and S194 cell lines (data not shown). It is interesting to speculate that the differences in mobility observed with W231 extracts compared to those from M12.4.1 and A-20 might correlate with differences in activation observed upon addition of the 3' flank to the central enhancer core (see Fig. 4, lines 7 and 8). The sequence of the protected region bears a striking homology to tandem G-rich repeats found in immunoglobulin switch sequences. To determine whether a common switch sequence binding protein was involved in binding to this G-rich motif, cross-competition of EMSA was carried out using a panel of sequences, including segments of S,u (25), Sp3 (26), and a stretch of 13 guanine residues present 5' of the Sy2a region (27). Because other studies demonstrated that certain proteins that bind to G-rich sequences were single-stranded DNA-binding proteins, both single-stranded and doublestranded oligonucleotides were used as competitors (25). Of these, only the double-stranded oligonucleotide corresponding to the 5'Sy2a GI3 sequence partially competed (27) (data not
Immunology: Singh and Birshtein
Proc. Natl. Acad. Sci. USA 93
0,7'V
CV
C5o"
.
4395
C
B
A
(1996)
N
0
iN 0O
4
O
0
G 534 T
00
W,
. ":
.,., :..
r
W2
G
2fi4;f-~~~~ _
1
2
3
.
1
\
G G 522
SF
1
_~
F
3' flank (Ncol/Kpn1-150)
G
~~.
a X
F
A
2
2 3
4
5
3' flank
3
4
3' flank
5'' 3' ,r1;
.'
( ;* ';i, I, : .': A s. '('rT"t 3' '; .l:i .: A ; ; .;;. r, J.'' AA 5e 5'
FIG. 5. A G-rich motif is the major protein binding site in the 3' flank. (A) EMSA was carried out with the 3' flank. Arrows indicate two protein-DNA complexes with W231 extract. (B) Methylation-interference foot-printing analysis was carried out with the 3' flank using W231 extract. Methylated G residues that interfered with binding are indicated by asterisks. The sequence shown here is in the reverse orientation of that in the GenBank database (accession no. X62778). (C) Competition with both wild-type (100-fold) and mutated G-rich oligonucleotides (100-, 250-, and 500-fold).
shown). Thus, it appears that a novel protein is involved in binding to a G-rich motif in 3'aE(hsl,2). Both Octamer- and G-Rich DNA-Binding Proteins Are Involved in Repression of 3'aE(hsl,2) in BSAP(+) B Cells.
We wanted to determine the role of the octamer motif in the 5' flank and the G-rich motif in the 3' flank in the regulation of 3'aE(hsl,2) in B-cell lines. Our experiments documented an essential role of these motifs in repression of 3'aE(hsl,2). Transient transfection assays in M12.4.1 revealed that mutation of either the Oct (Fig. 6, line 2) or the G-rich sequence (line 3) resulted in increased activity [-8.5-fold and 10-fold enhanced activity, respectively, over the 3'aE wt (line 1)]. This level of activity was comparable to that observed when both a and b BSAP-binding sites were mutated [3'aE, ab mut, line 4].
CON STRRICTS MAP OF THE CONSTRUCTS , t
a
b
G rich|
oct
a
b
3) G mut
oct
a
b
GK K
4) abmut
Xoct
-a
Wt I
2)Octmut X
5)
Oct/ ab mut
longer expressed.
To determine whether the repressive activity of Oct-binding proteins in B-cell lines depended on BSAP binding, we assessed Oct or G-rich DNA mutations in combination with mutations of both a and b BSAP-binding sites. As observed in RELATIVE ACTIVITY S194
M12.4.1
5
10
15
510
o
A
E-
K
G K
16
100
~~~~~1.0 8.5
1-I 50
10.0
G
130
_-18.0
130 45
2.2
X oct 6) G/ab mutX 7)
no
KpnI
Xbal
1)3'aE wt
Similar observations were made in the A-20 B cell line (data shown). We conclude that in addition to BSAP, proteins interacting with Oct and G-rich motifs are involved in the repression of 3'aE(hsl,2) activity in these B-cell lines. In contrast, in the S194 plasma cell line in which BSAP is not expressed, the octamer motif contributes to -50% activity (lines 2 and 5). Together, these experiments show that octamer-binding proteins are repressive in B cells, in which BSAP is present, and active in plasma cells in which BSAP is not
K X
2.1 601
F
i-o oct
10.7
FIG. 6. Contributions of BSAP, Oct-1/Oct-2, and G-rich motifs to the regulation of 3'aE(hsl,2) activity. Constructs were made in QM 293, either with mutations of Oct or G-rich DNA alone or along with ab mutations. Transient transfections were carried out as described in ref. 11, followed by CAT assays. Bar represents the average of relative activities (see Fig. 4).
4396
Immunology: Singh and Birshtein
Proc. Natl. Acad. Sci. USA 93 (1996)
Fig. 6, there was a 4- to 5-fold decrease in activity in 3'aE(Oct/ab mut) (line 5) and in 3'aE(G/ab mut) (line 6), as compared with the activated enhancer (lines 2, 3, or 4). These results show that in the absence of BSAP binding, in M12.4.1 and in A-20 cells (data not shown), both Oct- and G-rich DNA-binding proteins function as activators of 3'aE(hsl,2). Thus, we conclude that BSAP is required to bind to 3'aE(hsl,2) for Oct and G-rich DNA motifs to be repressive. Furthermore, as implied from the studies of 3'aE/Oct mut or the 3'aE/G mut, BSAP can also be involved, either directly or indirectly, in the activation process along with either the G-rich or Oct-binding proteins, respectively (compare line 2 with 5 and line 3 with 6). Together, these experiments show that binding of any two of the three factors, Oct, G-rich DNAbinding protein, and BSAP, supports full transcriptional activation of 3'aE(hsl,2) at the B-cell stage, whereas binding of all three factors is necessary for repression. Evidence for Redundant Activators Binding a and b BSAP Sites and G-Rich Motif in Plasmacytes. Our data show that mutation of the G-rich sequence in the context of wild-type 3'aE(hsl,2) has no significant impact on 3'aE(hsl,2) activity in S194 cells (Fig. 5, lines 1 and 3). Similarly, mutations of a and b BSAP-binding sites do not alter 3'aE(hsl,2) activity (lines 1 and 4). However, mutation of all three binding sites together-i.e., a, b, and G-rich motif-results in -40% loss of activity (lines 1 and 6). One possible explanation to account for these findings is that binding to ab or to G-rich DNA motifs may be redundant in terms of effects on enhancer activity. Alternatively, mutation of the a and b BSAP-binding sites may alter the binding of other, non-BSAP factors in plasma cells, resulting in detectable changes in activity when binding to the G-rich site is prevented (28).
BSAP Can Bind to the POU Domains of Oct-i and Oct-2 Proteins. We have generated a model to account for these findings (Fig. 7 and Discussion) that is based on physical interactions among multiple transcription factors to effect repression. As this model would predict a potential interaction between BSAP- and Oct-binding proteins, we examined this possibility using a protein-protein interaction assay. The respective GST-POU domain fusion proteins of Oct-1 (POU-1) and Oct-2 (POU-2) were incubated with radiolabeled BSAP and further incubated with glutathione-agarose beads; after being washed, the bound proteins were eluted with glutathione and analyzed by SDS/PAGE and fluorography. Fig. 8 shows the interactions of BSAP protein with GST-POU-1 (lanes 2 and 3) and GST-POU-2 (lane 4), but not with the control GST protein (lane 5). BSAP failed to bind to two other GST fusion proteins (data not shown). Thus, BSAP appears to be capable Xbal
m71
Oct
-Z a
Kpnl m1 b G-rich
3'zE in non-B cell
Activation domains affected by physical roximitv biMndinfg protein
indi
BSAP
3'c/E in B cells
protein
Repressed state Activation domiaiins bintding ip>rotefin7
exposed
j
ndng
rotein
pi
3
i
Active state
E
plasma
cells
FIG. 7. A model for concerted repression of 3'aE(hsl,2) in B cells. A schematic diagram is shown here to explain the simultaneous repressive function of three factors-namely, BSAP, Oct-1/Oct-2, and G-rich DNA-binding protein at the B-cell stage. 3'aE(hsl,2) is not drawn to scale. While not shown here, KB binding also contributes to
repression (34).
GST-fusions
NT
BSAP--
Lanes:
*
o
1
2
T
.
3
4
5
FIG. 8. Specific interaction of BSAP with Oct-1 and Oct-2 POU domains. Lane 1 shows the in vitro translated 35S-labeled BSAP protein. Two different amounts of GST-POU-1 proteins (20 and 10 g,g, respectively) were used in lanes 2 and 3, whereas 20 g,g of GST-POU-2 protein and 40 g/g of GST protein were used in lanes 4 and 5, respectively.
of directly interacting with the POU domains of both Oct-1 and Oct-2 proteins.
DISCUSSION Concerted Binding Is Necessary to Repress 3'aE(hsl,2) Activity at the B-Cell Stage. Our studies show that tight regulation of 3'aE(hsl,2) is observed only with the 600-bp intact enhancer,
as truncated constructs were found to have incomplete repression
at the B-cell stage (Fig. 4). Moreover, whereas the interaction of BSAP with either the a or b binding site represses 3'aE, the isolated b BSAP-binding site of 3'aE(hsl,2) can function as an activator when assayed in the OVEC vector (Fig. 3). Interactions of BSAP with proteins binding to other cis elements are, therefore, critical in modulating the function of BSAP from an activator to a repressor. Thus far, we have identified two cis elements-an octamer sequence residing 5' and a G-rich sequence 3'-which, together with BSAP-binding sites, are essential for repression of 3'aE(hsl,2), and our data do not exclude involvement of other proteins. In fact, we have recently shown that the KB-binding site in 3'aE(hsl,2) is also involved in repression in B cells (34). A Model for Repression of 3'aE(hsl,2) by BSAP, Oct1/Oct-2, and G-Rich DNA-Binding Protein. The fact that BSAP can directly interact with the POU domains of both Oct-1 and Oct-2 (Fig. 8) is consistent with our model of concerted repression of 3'aE(hsl,2) at the B-cell stage, as depicted in Fig. 7. The constellation of binding proteins could, as a result of their close proximity, repress either by direct occlusion of their activation domains or through recruitment of some other factor(s) that mediates repression. Alternatively, the conjugative binding of these regulators may prevent binding of other, yet-to-be-identified activators, resulting in repression. However, examination of mutants that cannot bind BSAP, and also either Oct- or G-rich DNAbinding proteins, argues against the necessary involvement of other independent strong activators in M12.4.1 cells (or in A-20 cells). In these mutants, steric hindrance would be released, permitting interaction with other putative factors and, hence, activity. The weak activities displayed by these mutants-i.e., 3'aE(Oct/ab mut) and 3'aE(G/ab mut)implicate a requirement for BSAP, Oct, and G-rich DNAbinding proteins as key players in transcriptional activation of 3'caE(hsl,2) at this stage. Additional factors-e.g., the recently identified member of the Ets-family of proteins, Elf-1 (24) and NF-aP (28)-might be involved in maintenance of 3'aE(hsl,2) activity in activated B cells and plasma cells. Our experiments
Immunology: Singh and Birshtein show that NF-aP binding, as predicted, does not contribute to repression of 3'aE(hsl,2) in B-cell lines (M. S. and B. K. Birshtein, unpublished observation). Differences in activity between deletional (Fig. 4) and binding-site-mutated constructs (Fig. 6) of 3'aE(hsl,2) might reflect the loss of some of
these other motifs. The model shows the binding of only one BSAP molecule in accord with our previous EMSA data (11). Binding of both a and b sites to a single molecule of BSAP would significantly constrain the enhancer. Two groups have shown that Pax proteins can induce conformational changes in bound DNA (29, 30). After B-cell activation, when BSAP is no longer expressed, the rigidity in the DNA structure would be released, thereby exposing the activation domains of bound proteins. In B cells in which BSAP is present, mutations that lead to a loss of binding of BSAP (or Oct- or G-rich DNA-binding proteins), would presumably act similarly-i.e., they would expose the activation domains of remaining bound proteins. This is, indeed, what we found in plasma cells where Oct and G-rich DNA motifs contributed to activation. During the course of B-cell maturation, Oct and G-rich DNAbinding proteins appear to be constitutively expressed, whereas BSAP transcription is regulated such that it is no longer expressed at the plasma cell stage. The fact that 3'aE(hsl,2) is active at the plasma cell stage, despite the presence of two of the three proteins responsible for repression of this region at the B-cell stage, strongly suggests that BSAP acts as a modulator of the activities of the other two proteins. However, our model predicts that activation of 3'aE(hsl,2) could result from losses in the binding of any proteins that contribute to concerted repression-e.g., Oct, G-rich DNA-binding protein, BSAP, or KB (34), which occur during B-cell development. Various proteins that modulate the function of octamer-binding protein have been identified (21, 31, 32), and the same scenario could well apply to either the G-rich DNA-binding protein BSAP or KB. A mechanism of concerted repression of 3'aE(hsl,2) provides a sensor for various intracellular and extracellular signals that might modulate any of several participating transcription factors that bind to 3'aE(hsl,2). Such fine-tuning of this enhancer might be particularly useful in its interactions with other regulatory elements, as part of a locus control region-i.e., 3'aEhs3 and 3'a-hs4 (6). Applied to other regulatory elements, such a mechanism provides a way in which an enhancer can be fully activated by specific modulation of individual transcription factors. We thank Dr. Laurel A. Eckhardt of Hunter College and Jennifer S. Michaelson and Renee M. DeFeo of the Albert Einstein College of Medicine for critical reading of the manuscript and Nasrin Ashouian for technical assistance. This work was supported by National Institutes of Health Grants R37 AI 13509 and P30CA13330. 1. Grosschedl, R. & Baltimore, D. (1985) Cell 41, 885-897. 2. Gillies, S. D., Morrison, S. L., Oi, V. T. & Tonegawa, S. (1983) Cell 33, 717-728.
Proc. Natl. Acad. Sci. USA 93
(1996)
4397
3. Dariavach, P., Williams, G. T., Campbell, K., Pettersson, S. & Neuberger, M. S. (1991) Eur. J. Immunol. 21, 1499-1504. 4. Lieberson, R., Giannini, S. L., Birshtein, B. K. & Eckhardt, L. A. (1991) Nucleic Acids Res. 19, 933-937. 5. Matthias, P. & Baltimore, D. (1993) Mol. Cell. Biol. 13, 15471553. 6. Madisen, L. & Groudine, M. (1994) Genes Dev. 8, 2212-2226. 7. Michaelson, J. S., Giannini, S. L. & Birshtein, B. K. (1995) Nucleic Acids Res. 23, 975-981. 8. Cogn6, M., Lansford, R., Bottaro, A., Zhang, J., Gorman, J., Young, F., Cheng, H.-L. & Alt, F. W. (1994) Cell 77, 737-747. 9. Lieberson, R., Ong, J., Shi, X. & Eckhardt, L. A. (1995) EMBO J. 14, 6229-6238. 10. Adams, B., Dorfler, P., Aguzzi, A., Kozmic, Z., Urbanek, P., Fogy, I. M. & Busslinger, M. (1992) Genes Dev. 6, 1589-1607. 11. Singh, M. & Birshtein, B. K. (1993) Mol. Cell. Biol. 13,3611-3622. 12. Neurath, M. F., Strober, W. & Wakatsuki, Y. (1994)J. Immunol. 153, 730-742. 13. Urbanek, P., Wang, Z.-Q., Fetka, I., Wagner, E. F. & Busslinger, M. (1994) Cell 79, 901-912. 14. Wakatsuki, Y., Neurath, M. F., Max, E. E. & Strober, W. (1994) J. Exp. Med. 179, 1099-1108. 15. Liao, F., Birshtein, B. K., Busslinger, M. & Rothman, P. (1994) J. Immunol. 153, 2904-2911. 16. Okabe, T., Watanabe, T. & Kudo, A. (1992) Eur. J. Immunol. 22, 37-42. 17. Zwollo, P. & Desiderio, S. (1994) J. Biol. Chem. 269, 1531015317. 18. Kozmic, Z., Wang, S., Dorfler, P., Adams, B. & Busslinger, M. (1992) Mol. Cell. Biol. 12, 2662-2672. 19. Westin, G., Gerster, T., Muller, M. M., Schaffner, G. & Schaffner, W. (1987) Nucleic Acids Res. 15, 6787. 20. Feldhaus, A. L., Mbangkollo, D., Arvin, K. L., Klug, C. A. & Singh, H. (1992) Mol. Cell. Biol. 12, 1126-1133. 21. Luo, Y. & Roeder, R. G. (1995) Mol. Cell. Biol. 15, 4115-4124. 22. Czerny, T., Schaffner, G. & Busslinger, M. (1993) Genes Dev. 7, 2048-2061. 23. Grant, P. A., Arulampalam, V., Ahrlund-Richter, L. & Pettersson, S. (1992) Nucleic Acids Res. 20, 4401-4408. 24. Grant, P. A., Thompson, C. B. & Pettersson, S. (1995) EMBO J. 14, 4501-4513. 25. Fukita, Y., Mizuta, T., Shirozu, M., Ozawa, K., Shimizu, A. & Honjo, T. (1993) J. Biol. Chem. 268, 17463-17470. 26. Wuerffel, R., Jamieson, C. E., Morgan, L., Merkulov, G. V., Sen, R. & Kenter, A. L. (1992) J. Exp. Med. 176, 339-349. 27. Liao, F., Giannini, S. L. & Birshtein, B. K. (1992) J. Immunol. 148, 2909-2917. 28. Neurath, M. F., Max, E. E. & Strober, W. (1995) Proc. Natl. Acad. Sci. USA 92, 5336-5340. 29. Chalepakis, G., Wijnholds, J. & Gruss, P. (1994) Nucleic Acids Res. 22, 3131-3137. 30. Epstein, J., Cai, J., Glaser, T., Jepeal, L. & Maas, R. (1994)J. Biol. Sci. 269, 8355-8361. 31. Gstaiger, M., Knoepfel, L., Georgiev, O., Schaffner, W. & Hovens, C. M. (1995) Nature (London) 373, 360-362. 32. Strubin, M., Newell, J. W. & Matthias, P. (1995) Cell 80,497-506. 33. Michaelson, J. S., Singh, M. & Birshtein, B. K. (1996) J. Immunol. 156, 2349-2351. 34. Michaelson, J. S., Singh, M., Snapper, C. M., Sha, W. C., Baltimore, D. & Birshtein, B. K. (1996) J. Immunol. 156, in press.