epidermolytic palmoplantar keratoderma (NEPPK)

© 1995 Oxford University Press

Human Molecular Genetics, 1995, Vol. 4, No. 10

1875-1881

Novel mutations in keratin 16 gene underly focal nonepidermolytic palmoplantar keratoderma (NEPPK) in two families M.K.Shamsher*, H.A.Navsaria, H.P.Stevens, R.C.Ratnavel, P.E.Purkls, D.P.Kelsell1, W.H.I.McLean2, LJ.Cook 3 , W.A.D.GriffHhs3, S.Gschmeissner4, N.Spurr4 and I.M.Leigh Experimental Dermatology Research Laboratory, London Hospital Medical College, 56 Ashfield St, London E1 2BL, 'ICRF, Clare Hall, South Mimms, Herts, ^ R C Cell Structure Research Group, University of Dundee DD1 4HN, ^ t John's Dermatological Centre, St Thomas' Hospital, London SW1 and 4ICRF EM Unit, 44 LIF London WC2, UK Received April 26, 1995; Revised and Accepted July 17, 1995

INTRODUCTION The palmoplantar keratodermas (PPKs) are a heterogeneous group of disorders, characterised by thickening of the palms and soles with marked hyperkeratosis on histopathology (1). Palmoplantar keratodermas are normally inherited in an autosomal dominant manner (Unna-Thost, Vohwinkel, Vorner and focal forms), although recessive and sporadic (punctate forms) have also been reported (2). Classification of the *To whom correspondence should be addressed

hereditary PPKs localised primarily to the hands and feet is difficult, because of inter- and intra-individual variations in clinical features within affected family members; the variable histological appearance particularly whether epidermolysis of affected keratinocytes is present or not; and the varying use of different nomenclatures by different clinicians. The most important features in the clinical classification of PPKs are the pattern of distribution of the hyperkeratosis on the palm and sole (whether diffuse, focal or punctate), the presence or absence of associated malignancy and the pattern of inheritance. Additional criteria include the presence of skin lesions on areas other than the palms and soles, the age of onset of the keratoderma, the severity of the disease process and the histological findings. The finding of the underlying genetic mechanisms and specific mutations in candidate genes will greatly facilitate the development of a logical definitive classification of the PPKs based on an insight into cell and tissue function. Keratins are expressed in all epithelial cells in a tissue- and differentiation-specific manner (3-6). Keratin proteins are the major constituents of terminally differentiated keratinocytes, whose functions are structural and protective in the epidermis, nails and hair. These keratin intermediate filaments form a cytoskeletal network within keratinocytes, which maintains structural integrity both of the individual keratinocytes and throughout the entire epidermis by interconnections through desmosomal junctions. Over 30 known keratins genes fall into two subtypes, type I and type II, based on mobility on 2D gel electrophoresis and sequence homology. The type I (acidic) keratins include the epithelial keratins 9-20. These keratins, except for keratin 18, are on a gene cluster locus on chromosome 17q 12—q21 (7). The type II (basic) keratin cluster is on chromosome 12ql 1—ql3(8) and includes epithelial keratins 18. Keratin 18 gene is found next to keratin 8 on the type II gene cluster. In tissues keratins are coexpressed as obligate heterodimers containing particular type I and type II proteins. Keratins share with other intermediate filaments a consensus structure of a conserved alpha-helical rod domain flanked by non-helical head and tail regions. Highly conserved sequences have been identified in all keratins (Fig. 1) in the helix initiation and termination motifs. Attempts at determining the functional regions of keratin filaments have centred on the introduction

Downloaded from http://hmg.oxfordjournals.org/ at Queen Mary, University of London on September 1, 2015

Keratins K6 and K16 are expressed in suprabasal Interfollicular epidermis in wound healing and other pathological conditions associated with hyperprolrferatlon, such as psoriasis and are induced when keratlnocytes are cultured In vitro. However, these keratins are also constitutively expressed In normal suprabasal mucosal and palmoplantar keratlnocytes. Mutations in keratins have been reported in the basal keratin pair K5 and K14 In epidermolysis bullosa simplex and In suprabasal epidermal keratins K1, K2 and K10 in epidermolytic Ichthyoses. Two families with autosomal dominant disorder of focal non epidermolytic palmoplantar keratoderma, have oral mucosal and follicular lesions In addition to the palmoplantar hyperkeratosis. Previous studies have shown linkage in these families to the type I keratin gene cluster at 17q12-q21 and this report shows that the cDNA of affected members of both families have novel heterozygous mutations in the expressed keratin 16 gene. These mutations (R10C and N8S) lie in the helix initiation motif of the 1A domain. These mutations do not appear to cause epidermolysis on light or electron microscopy, which may reflect differences in function, assembly or interaction of the 'hyperproliferative' or 'mucoregenerative' keratins from other major types of keratins. The mutations reported here are the first to describe the molecular pathology of focal non epidermolytic palmoplantar keratoderma.

1876


II

ii

JZf

Type II 1A

IB

2A

2B

Typ. 1

* O D D

O D D 24

II

17

IS

0 0 0 17

7

a

B

of mutated or truncated cDNA sequences (particularly of the boundary peptides) into a variety of cell-lines (9-12), which cause disruptions in filament assembly. Headless and tail-less mutants can assemble to form filaments but the conserved regions are necessary for tetramer and higher order filament assembly formations. Expression of mutant basal keratins in transgenic mice has been shown to cause marked phenotypic abnormalities with blistering (13,14) and expression of mutant suprabasal keratins causes epidermolytic hyperkeratosis (15— 17). Further evidence of the critical role of these cytoskeletal proteins in maintaining epithelial integrity has come from the recent discovery that mutations in keratin intermediate filaments are implicated in multiple mechanobullous epidermal diseases. The blistering disease epidermolysis bullosa simplex (EBS) is caused by mutations in basal keratins 5 and 14, which leads to lysis of basal keratinocytes in response to minor external trauma (16-20). In bullous ichthyosiform erythroderma mutations in the keratins 1 and 10 found in suprabasal epidermis cause suprabasal cell lysis and epidermolytic hyperkeratosis (14,21). Both groups of diseases affect the palms and soles as well as other body sites. Mutations in the gene for keratin 2e, which is limited in expression to the upper epidermis, results in the milder ichthyosis bullosa of Siemens (IBS) (22). The expression of keratin 9 (K9) is confined to palm and sole skin and mutations in the 1A boundary peptide have been identified in epidermolytic PPK (EPPK) (23-28). Initially, linkage of the EPPK with microsatellite markers was demonstrated to the keratin cluster on chromosome 17ql2-q21 and subsequent multiple different point mutations in K9 gene identified in many EPPK families. A missense mutation in the helix 1A rod domain of K9 was also found in a pedigree with EPPK and breast and ovarian cancers, probably resulting from separate events in two closely linked genes. Deletions into this region are presumed to disrupt the endogenous keratin network with aberrant filament structure in K9 gene mutations as in other forms of EPPK. Keratins 6 (K6) and 16 (K16) are unusual as both are site restricted in normal epidermis to the upper outer hair root sheath and nail bed, palm and sole skin and suprabasal

Figure 2. Pedigree 1 and 2 investigated in this study The number immediately below a symbol denotes age (years) at last observation. ( • , • ) , keratoderma.

orogenital mucosal keratinocytes (29,30). However, they are rapidly induced in interfollicular epidermis on wounding or inflammation. mRNAs for K6/K16 are found suprabasally in the normal interfollicular epidermis so post-transcriptional controls of K6/K16 may play a vital role in the expression of these proteins (3). Keratin 6 and K16 are expressed at high levels in cultured keratinocytes from both normal skin and in psoriatic, corneal, conjuctival and oesophageal samples so these provide a good source of K6/K16 mRNA and protein. On studying a large number of families with non-epidermolytic PPK (NEPPK) a distinct phenotype was observed of focal palmoplantar keratoderma with orogenital and follicular lesions. As linkage of these families to the type I keratin cluster on chromosome 17 had been observed (31) and the lesions localised to sites of K16 expression, K16 was identified as a potential target gene and missense point mutations in the helix initiation motif were sought and identified in two unrelated kindred. RESULTS Clinical features: a common clinical phenotype Both pedigrees demonstrated an identical clinical phenotype with focal NEPPK, follicular and orogenital hyperkeratosis (31). The keratoderma was inherited as an autosomal dominant


II

Figure 1. A brief illustration showing the basic conserved domains in the two Type 1 and II keratins, where all known mutations associated with EBS, BIE, EPPK and IBS have been located. Arrows indicate mutational hotspots to date

Human Molecular Genetics, 1995, Vol. 4, No. JO 1877

GATCGAT

sequencing of DNA extracted from blood of 10 affected members and three unaffected members from Pedigree 1 and the two affected members from Pedigree 2, was not informative. In our previous study on pachyonychia congenita (33), genomic sequencing of K16 was similarly uninformative because multiple alleles (at least eight) of K16 genes and pseudogenes dilute the PCR product and make sequencing unreliable. In view of our experience with pachyonychia congenita, we therefore decided to sequence K16 cDNA from members of this focal pedigrees, for the expressed K16 gene. mRNA from cultured keratinocytes was reverse transcribed and the cDNA obtained was amplified with PCR using various primer sets to include the 1A, IB, 2A, 2B, linkers and termination hot-spots. cDNA was also obtained and amplified from tissue biopsies and from 20 normal healthy controls. The resultant products were sequenced by direct single stranded sequencing using magnetic beads (Dynal Ltd).

Vf Figure 3. (a) Palmar biopsy from the left hypothenar eminence demonstrating hypergranulosis, acanthosis and hyperkeratosis without evidence of epidermolysis. (b) Electron microscopy demonstrating a normal keratin filament network in the suprabasal cells from the palm.

and developed at -6-7 years of age. Subtle nail changes with widening of the onychocorneal band was observed in all affected members of both pedigrees, with terminal splinter haemorrhages being seen intermittently. The larger pedigree consists of -20 members, of which 11 were affected with PPK (Fig. 2a). The other unrelated family consists of a living affected father with a single affected daughter (Fig. 2b). Histopathology investigation shows no epidermolysis With light microscopy acanthosis, hypergranulosis and hyperkeratosis of the palmoplantar epidermis were seen but without evidence of epidermolysis (Fig. 3a). Electron microscopy of involved palm skin confirmed the presence of gross hyperkeratosis with a normal keratin intermediate network (Fig. 3b) which was demonstrated from all affected sites. Keratin mutation analysis in focal NEPPK Sequencing of Kl 6 gene from genomic DNA was complicated by the presence of homologous pseudogenes (32). Genomic

K16 mutation in focal NEPPK In Pedigree 1, a novel heterozygous mutation in the K16 gene was identified within the conserved helical rod 1A sequence, in a transformed keratinocyte cell-line of an affected member (Fig. 2a: Generation III: patient no. 5), replacing an arginine with cysteine. This mutation was also observed in cDNA transcribed from tissue biospies of this patient and the patients mother (R10C) (Fig. 4). In order to confirm that this mutation was also present in the genomic DNA of affected members, a strategy was devised to enrich the K16 gene (See Materials and methods). This involves digesting the genomic DNA with a restriction enzyme that restricts the pseudogene only and leaves the K16 gene intact, thereby allowing only enrichment of the K16 gene when amplified by PCR. This mutation destroys a restriction enzyme site (Acil) enabling RFLP analysis on K16 enriched genomic DNA or on cDNA from other members of the family (Fig. 5) to allow rapid screening of the population. Only the affected members from Pedigree 1 showed presence of the mutant allele, whereas members of Pedigree 2 and controls were homozygous for the normal allele. Polymorphisms were also excluded from a control population of 30 normal unrelated samples by RFLP analysis. The two affected members of Pedigree 2 (Fig. 2b) show another novel mutation in primary cell-lines at the 1A region, substituting an asparagine to serine (N8S) (Fig. 6). This mutation creates a new Dde\ site not normally present in the functional K16


Figure 4. Sequencing with mutation in Pedigree 1. Sequencing results show substitution of C to T at the first base residue of RIOC (a), which is not observed in normal controls (b).

1878


1 2 3 4 5 6 7 8

910111213

GATC

Figure 6. Sequencing with mutation in Pedigree 2. This involves a substitution of A to G at the second base residue of N8S in the cDNA of members of Pedigree 2 (a). This substitution is not observed in the cDNA of normal controls (b).

gene. By an unfortunate coincidence, this same base change occurs in the published pseudogene sequence (32), so that a screening test for genomic DNA based on this Ddel site was not possible. Therefore cDNA from keratinocytes cultured from 20 normal unrelated individuals was prepared and RFLP analysis confirmed that the mutation was not found in the normal population. None of the other changes reported in the K16 pseudogene were found in the affected cDNA, therefore the genetic lesion is a point mutation in the functional gene and not due to activation of the pseudogene. Keratinocyte cultures were not obtainable from unaffected family members. Sequencing of other hotspots of Kl6 in the two pedigrees confirmed no other mutations in these sites. DISCUSSION The molecular pathology of focal NEPPK This report represents the first cases in which point mutations in the K16 gene have been reported in any form of NEPPK. Reappraisal of the largest reported tylosis family with carcinoma of the oesophagus, the Howel-Ewans family (34) have shown an identical phenotype to these families with focal NEPPK with oral lesions and follicular papules. However, in

The mutational sensitivity of the 1A domain of keratins Both mutations described here occur in the highly conserved helix initiation motif, where numerous keratin mutations have been reported to date. The arginine mutation is particularly analogous to the 5-methyl-CpG mediated mutations reported in K9, K10 and K14 (37). The asparagine mutation would also be predicted to be disruptive to alpha helical conformation. Reduction of K16 expression may be due to instability of the mutated mRNA and in situ hybridization experiments on tissue biopies would determine if downregulation of K16 may be occurring. Peptide disruption assays and cross linking studies have illustrated that the boundary peptide sequences interact in polymerisation. Intermediate filaments are thought to form filaments spontaneously and so must encode all the neccessary structural information for filament assembly. Although it is unlikely that simple hydrophobic interactions between residues in the 1A region can account for the specificity of pairing in keratin molecules, we do see that mutations in these residues do lead to an ineffective keratin cytoskeleton, as demonstrated by experiments with transgenic mice with mutated K14 expression and Kl/10 expression which give rise to the EBS and EH phenotypes respectively (12,13). A point mutation may not only disrupt the molecular structure of a protein, but may also influence protein folding and interfere with assembly of the protein. The translated mutant K16 protein, if any, may have a higher rate of degradation than normal K16, perhaps due to its inability to form stable heterodimers. The molecular pathology of other NEPPKs and associated disorders There have been previous reports of linkage of diffuse NEPPK to both chromosome 17q (28) and 12q (38) with a single report of a mutation in the VI end domain of keratin 1 in diffuse NEPPK (Unna-Thost subtype) (39). In one pattern of pachyonychia congenita a point mutation in the 1A region of K16 has recently been demonstrated (33). The mutation described in this pachyonychia congenita family occurred in an amino acid in the 1A region (L15P) and this mutation is predicted to be equally disruptive in keratin intermediate filament assembly. The clinical phenotypes of pachyonychia congenita and focal NEPPK are very similar with focal hyperkeratotic lesions developing over the pressure points of the sole, palms and extrapalmoplantar sites in response to recurrent trauma. The only significant difference is the extent of nail involvement (pachyonychia being grossly thickened and curved nails, which are not found in focal NEPPK). Substitution of N8S is probably less disruptive to the helical structures than L15P, as both asparagine and serine have small uncharged side chains at physiological conditions. It may be that the alpha-helical conformation of this part of the 1A is not the only thing necessary for the correct function of K16. As discussed earlier, this residue may be involved in other important interactions, for example in higher-order filament


Figure 5. RFLP on cDNA of patients using Acil restriction site analysis. Lane I and 2: RFLP with cDNA of two affected members of Pedigree 2, which do not have an Acil restriction site mutation, therefore is homozygous for the normal alleles. Lanes 3-5: Unaffected members of Pedigree I are homozygous for this site, showing digested fragments of 84 and 119 bp. Control population also show homozygosity for this site (not shown). Lane 6: Phi XI74/Hind 3 Ladder. Lane 7-13: Affected members of Pedigree 1; destruction of Acil site in mutated allele is indicated by undigested fragment of 203 bp. Genomic RFLP analysis using enriched K16 gene yielded the same results.

the Howel-Evans family, linkage to the keratin clusters has been excluded and the gene has been mapped to a distant region of chromosome 17q (35,36). Thus focal NEPPK can result from abnormalities in site restricted K16 (and presumably its obligate partner in vivo K6), but also from other gene abnormalities, which may have regulatory effects on the expression of K6 and K16 genes.

Human Molecular Genetics, 1995, Vol. 4, No. 10 1879 assembly. The arginine mutation may also affect filament assembly of K16, causing the similar phenotype as observed when the asparagine residue is mutated. Interestingly, the mutated arginine residue has been reported in -50% of BCIE cases, where R10S, R10H, R10C and R10P all produce very similar phenotypes. A great deal of phenotypic variation has been identified in all known keratin disorders to date, therefore it is probably best to consider pachyonychia congenita and focal NEPPK as clinical variations of the same disease.

Future work These results do not rule out the possibility that K16 may interact into the cell cytoskeletal system in a different manner to the other keratins, thereby mutations or molecular changes in the profile of K16 is not as disruptive as mutations in other keratins which may play a more essential role in the fragility of the cell. Future work to determine keratin-keratin interaction in vivo, to determine the promiscuity of keratins is needed. Transfections and microinjection experiments of different pairs of keratin cDNAs into fibroblasts will yield more information on the keratin-keratin interactions. Transfection of mutant K16 into normal keratinocytes cultures would determine if these mutations are causative of focal PPK, or if other factors also play a role in the pathogenesis of this disease, which may be

MATERIALS AND METHODS Test samples Blood samples and skin biopsies from palms, buccal mucosa and non-involved skin was collected from affected members of the pedigrees for analysis. Blood was also obtained from unaffected members and from healthy controls from the normal population. Segregation analysis with markers flanking the keratin gene clusters had excluded 12q as the site of mutation and demonstrated linkage of Pedigree 1 to the type 1 keratin locus 17ql2-q21. (Z = 3.2 at 6 = 0.0); however, meaningful lod scores could only be obtained for the larger family. Hlstopathology and transmission electron microscopy The skin samples from all patients were processed for electron-microscopy using a standard protocol (42). Briefly fixation was achieved with 1% monomeric gluteraldehyde for 2 h to allow morphological and immunoelectronmicroscopy of a single specimen. After dehydration in graded ethanol series, specimens were embedded in araldite. Ultrathin sections were stained with uranyl acetate and lead citrate. Keratinocyte culture Keratinocytes were cultured from affected palm and arm skin of individuals from each pedigree using the method of Rheinwald and Green with 3T3 feeder cells and added mitogens (43). Established keratinocyte cultures were obtained from only one patient in Pedigree 1 (Generation in, patient no. 5) and from the two affected patients in Pedigree 2. Control keratinocytes cultures were obtained from normal interfollicular skin of the 20 healthy controls. Keratinocyte transfection All cultured keratinocytes were immortalised with human papilloma virus type 16 using the protocol for oral keratinocytes (44). Briefly, the keratinocytes were cultured to 80% confluence in T25 sized flasks with complete keratinocyte medium (45) and 3T3 feeders. The cells were incubated overnight in keratinocyte growth medium (KGM) (Clonetics). Transfection was performed with 10 u.g of pJ4W16 (46) using lipofectin (BRL) in Optimen (Gibco). Mutational analysis Extraction ofgenomic DNA. Genomic DNA was extracted from blood samples as described by Millar et al (47). DNA was resuspended to 1 u.g/|il concentrations. Extraction ofmRNA. All keratinocyte cultures were grown to 80% confluence in T75 cell culture flasks (-2X10 6 cells) and mRNA from cell cultures of affected and non-affected individuals and normal controls was isolated as described by the Dynal polyT beads manufacturer. The mRNA was bound specifically to 75 ul of polyT magnetic beads which were then reverse transcribed as described below. Tissue sections from two patients in Pedigree 1 (Generation U, patient no: 1 and Generation III, patient no: 5) were also treated in a similar manner. PCR Bound mRNA obtained from cultured keratinocytes and tissue sections were reverse transcribed using AMV reverse transcriptase (Promega) at 42°C for 20 min and cDNA obtained was resuspended in 50 ul of sterile DEPC treated distilled water. One microlitre of toe bound mRNA was used as template in 100 uJ PCR reactions using standard PCR reagents and buffers for Perkin Elmer Amplitaq polymerase. Primers designated K16P5B: biotinylated 5'GTGCTGGCTTTGGTGGTGGT3' and BQ6: 5'GGGACTGTAGTCTTTGATCTCACTGG3' were designed to amplify the 1A region of K16 gene from both cDNA and genomic DNA. An additional primer was also designed at the 5' end of the sequence of interest and designated BQ9:5'CATGAAGGGCTCCTGCGG3'. A 203 bp and 450 bp PCR product was obtained with primer sets BQ6/K16P5B and BQ9/K16P5B respectively. Primers used for the


The lack of epidermolysis in affected keratinocytes parallels in vitro studies There is an apparent problem that putative disruptive mutations in suprabasal keratins fail to predispose the keratinocytes to lysis on trauma unlike the findings in all the other mechanobullous disorders to date, including Kl and K9 mutations. Epidermolysis is not found in pachyonychia congenita with K16 and K17 mutation. Changes in K16 pachyonychia congenita were only found in a small percentage of suprabasal keratinocytes with clumps only. External trauma may be required to induce the morphological changes because lesions occur only at sites of friction and disappear when the patients are rested. Similarly, lesions in the cytoskeleton in K5 and K14 mutations in EBS Koebner and Weber-Cockayne are not shown at the electron microscopic level. In cultured keratinocytes from EBS Dowling-Meara with a 1A argininecysteine mutations, keratin filament clumping is seen but is reduced on passaging of the cells and in keratinocytes from EBS Weber-Cockayne, no abnormalities of the filament cytoskeleton have been seen in vitro unless trauma such as heatshock or trysinisation is used (40). In a family with EBS Koebner, characterised by K14 knockout, absence of keratin filaments was a striking feature of the in vivo presentation on the basal keratinocytes (41). However, whenever keratinocytes were cultured in vitro, a good cytoskeletal network was obtained, again presumably because of the induction of other keratins, at least K4/K13 and K6/K16/K17. This raises the possibility of other keratins or intermediate filaments may stabilise the cytoskeleton and offers the possibility of keratin manipulation for gene therapy or pharmaceutical treatment Correlation of genotype and phenotype in families with keratin gene mutations is therefore much more diverse than has been suggested in previous publications, there is wide variation within families with the same gene mutations (34,36), which suggest that external, epigenetic and genetic factors may influence the complex presentation of phenotype.

the cause of variations in the clinical phenotype of this disease. Assays on skeletal fragility after transfection is also needed. Meanwhile, the abundance of mutations currently being published continues to yield more information about the functions and significance of a particular keratin in its role as a protective structure and enable us to understand better the mechanism of filament assembly.

1880


amplification of the IB, 2A, 2B, linkers and termination hot-spots are as listed below: K16P1: 5'CCAGTGAGATCAAAGACTACAGTCCC3' and K16P3 (biotinylated): 5'ATCCATCTCCACGTTCACAT3' (to amplify the IB and 2A regions). BQ11 (biotinylated): 5 "TC ACTTGCAGA A AGCATCCCTG3' and BQ4:5'GGGGAAGAATAGGATTGGCCAGATGC3' (to amplify the 2B and helix termination regions). The cycling parameters used were 95°C, 5 min followed by 95°C, 1 min; 55°C, 1 min; 72°C, 3 min for 35 cycles and an additional extension step at 72°C for 5 min. Polymerase chain reaction products were visualised with ethidium bromide on 1% agarose gels. Enrichment of K16 gene

Sequencing of K16 gene Polymerase chain reaction product was treated with Shrimp Alkaline Phosphatase (Amersham) and Exonuclease 1 (Amersham) to remove unused primers and nucleotides in the PCR reaction. Eighty microlitres of this product was then bound to 20 (il of streptavidin Dynabeads M-280 (Dynal Inc.) in lOXTnsbuffered saline (TBS; 500 mM Tris, pH 7.5, 1 M NaCl). The resulting ssDNA bound streptavidin-coated magnetic beads were resuspended in 14 \i\ of DEPC-waler, sufficient for two sequencing reactions. Sequencing reactions were performed by the dideoxy termination method using Sequenase Version 2.0 DNA Sequencing Kit (Amersham). Reaction buffer (2 |xl) was added to 7 pi each template resuspension along with 0.5 pmol of BQ6 primer (described above) and 1 (il DMSO. The labelling and termination reactions were performed according to protocol supplied with the Sequenase DNA Sequencing Kit. Samples were run on an 8% denaturing polyacrylamide gel and autoradiographed for 1-2 days. RFLP Twenty microlitres of PCR product amplified from cDNA or enriched genomic DNA of 30 unaffected control samples and affected members of Pedigree 1 was restricted using Acil restriction endonulease. The cDNA of the other Pedigree was screened with Ddel. The fragments obtained were analysed with ethidium bromide staining on a 3% metaphor agarose (Flowgen Ltd) in 1 XTris acetate (TAE)EDTA buffer.

ACKNOWLEDGEMENTS We would like to acknowledge Miss Karen L.Price for extracting DNA. This work was performed with support from the Medical Research Council, the Wellcome Trust and The Special Trustees of the Royal Free Hospital.

ABBREVIATIONS DEPC, diethylpyrocarbonate; PCR, polymerase chain reaction; PPK, palmoplantar keratoderma; EPPK, epidermolytic palmoplantar keratoderma; NEPPK, non-epidermolytic palmoplantar keratoderma; EBS, epidermolysis bullosa simplex.

REFERENCES 1. Lucker de Kerkhof P.C.M. and Steijlen P.M. (1994) The hereditary palmoplantar keratodermas: An updated review and classification. Br. J. Dermatoi, 131, 1-14. 2. Kuster W. and Becker A. Indication for the identity of palmoplantar keratoderma type Unna-Thost with type Vorner. (1992) Thost's family revisited 110 years later. Acta Dermatoi VenereoL, 72, 120-122. 3 Moll R., Moll I. and Weist W. (1982) Changes in the pattern of cytokeratin polypeptides in epidermis and hair follicles during skin development in human fetuses. Differentiation, 23, 722-736.

23. Langbein L., Heid H.W., Moll I. and Franke W.W. (1994) Molecular characterization of the body site-specific human epidermal cytokeratin 9: cDNA cloning, amino acid sequence, and tissue specificity of gene expression. Differentiation, 55, 57—72. 24. Reis A., Kuster W., Eckhardt R. and Sperling K. (1992) Mapping of a gene for epidermolytic palmoplantar keratoderma to the region of the acidic keratin gene cluster at 17ql2-21. Hum. Genet., 90, 113-116. 25. Reis A., Hennies H., Langbein L., Digwecd M., Mischke D., Drechsler M., SchrOck E., Royer-Pokora B., Franke W.W., Sperling K. and Kuster W. (1994) Keratin 9 gene mutations in epidermolytic palmoplantar keratoderma. Nature Genet., 6, 174-179. 26. Torchard D., Blanchet-Bardon C , Serova O., Langbein L., Narod S., Janin N., Goguel A.F., Bernheim A., Franke W.W., Lenoir G.M. and Feunteun. (1994) Epidermolytic palmoplantar keratoderma cosegregates with a keratin 9 mutation in a pedigree with breast and ovarian cancer. Nature Genet.. 6, 106-109. 27. Moll I., Heid H., Franke W.W. and Moll R. (1987) Distribution of a special subset of keratinocytes characterised by the expression of cytokeratin 9


One microgram of genomic DNA obtained from patients was digested with Ddel restriction enzyme in a 20 \i\ reaction with the intention of restricting the K16 pseudogene. These samples were then amplified for the 1A region by PCR with K16P5B and BQ6 primers then digested once more with Ddel enzyme, to ensure complete restriction of the pseudogene. The whole PCR product was electrophoresed in a 1% low melt agarose gel and visualised with ethidium bromide with minimal exposure to UV. All bands corresponding to the 203 bp product were excised from the gel and purified using Wizard PCR columns (Promega Ltd). The product obtained was eluted in 10 fj.1 distilled water and used in RFLP analysis.

4. Albers K. and Fuchs E (1992) The molecular biology of intermediate filament proteins. Int. Rev. Cytol., 134, 243-279. 5. Fuchs E. (1990) Epidermal differentiation. Curr. Opin. Cell Bioi, 2, 1028-1035. 6. Moll R., Franke W.W., Schiller D.L., Geiger B.and Krepler R. (1982) The catalog of human cytokeratins: patterns of expression in normal epitheha, tumors, and cultured cells. Cell, 31, 11-24. 7. Marchuk D., McCroon S. and Fuchs E. (1985) Complete sequence of a gene encoding a human type 1 keratin: sequence homologous to enhancer elements in the regulatory region of the gene. Proc. Nail Acad. Sci. USA, 82, 1609-1613. 8. Popescu N.C., Bowden P.E. and di Paolo J.A. (1989) Two types II keratins are localised on human chromosome 12. Hum. Genet., 82, 109-112. 9. Steinert P.M. (1993) Structure, function and dynamics of keratin intermediate filaments. / Invest. Dermatoi., 100, 729-734. 10. Albers K. and Fuchs E. (1987) The expression of mutant epidermal keratin cDNAs transfected in simple epithelial and squamous cell carcinoma lines. J. Cell. Bioi, 105, 791-806. 11. Albers K. and Fuchs E. (1989) Expression of mutant keratin cDNAs in epithelial cells reveals possible mechanisms for initiation and assembly of intermediate filaments. /. Cell Bioi., 108, 1477-1493. 12. Vassar R., Coulombe P.A., Degenstein L., Albers K. and Fuchs E. (1991) Mutant keratin expression in transgenic mice causes marked abnormalities resembling a human genetic skin disease. Cell, 64, 365-380. 13. Fuchs E., Esteves R.A. and Coulombe P.A. (1992) Transgenic mice expressing a mutant keratin 10 gene reveal the likely genetic basis for epidermolytic hyperkeratosis. Proc. Natl Acad. Sci. USA, 89, 6906-6910. 14 Cheng J., Syder AJ., Yu Q.-C, Letai A., Paller A.S. and Fuchs E. (1992) The genetic basis of epidermolytic hyperkeratosis: a disorder of differentiation-specific epidermal keratin genes. Cell, 70, 811-820. 15. Chipev C.C., Korge B.P., Markova N., et at. (1992) A leucine-proline mutation in the HI subdomain of keratin 1 causes epidermolytic hyperkeratosis. Cell, 70, 821-828. 16. Yang J.-M., Chipev C.C., DiGiovanna JJ., et al. (1994) Mutations in the HI and 1A domains in the keratin 1 gene in epidermolytic hyperkeratosis. J. Invest. Dermatoi, 102, 17-23. 17. Coulombe P.A., Hutton M.E., Vassar R. and Fuchs E.A (1991) Function for keratins and a common thread among different types of epidermolysis bullosa simplex diseases. J. Cell Bioi., 115, 1661-1674. 18. Ishida-Yamamoto A., McGrath J.A., Chapman S J., Leigh I.M., Lane E.B. and Eady R.A.J. (1991) Epidermolysis bullosa simplex (Dowling-Meara type) is a genetic disease characterized by an abnormal keratin-filament network involving keratins K5 and K14. / Invest. Dermatoi., 97,959-968. 19. Coulombe P.A., Hutton M.E., Letai A., Herbert A., Paller A.S. and Fuchs E. (1991) Point mutations in human keratin 14 genes of EBS patients: genetic and functional analyses. Cell, 66, 1301-1311. 20. Lane E.B., Rugg E.L., Navsaria H., Leigh I.M., Heagerty A.H.M., IshidaYamamoto A. and Eady R.AJ. (1992) A mutation in the conserved helix termination peptide of keratin 5 in hereditary skin blistering. Nature, 356, 244-246. 21. McLean W.H.I., Eady R.AJ., Dopping-Hepenstal PJ.C, et at. (1994) Mutations in the rod domain of keratins 1 and 10 in bullous congenital ichthyosiform erythroderma (BCIE). J. Invest. Dermatoi, 102, 24-30. 22. McLean W.H.I., Moriey S.M., Lane E.B., et al. (1994) Ichthyosis bullosa of Siemens {IBS)—A disease of keratin 2e. J. Invest. Dermatoi, 103, 277-281.


28.

29.

30. 31.

33. 34. 35. 36.

37. 38.

39.

40.

41. 42. 43. 44.

45.

46. 47.


32.

in adult and fetal epidermis of various body sites. Differentiation, 33, 254-265. Rogaev E.I., Rogaev E.A., Ginter E.K., Korovaitseva G.I.,Farrer L.A., Shlensky A.B., Pritkov A.N., Mordovtsev V.M. and St George-Hyslop P.H. (1993) Identification of the genetic locus for keratosis palmaris et plantaris on chromosome 17 near the RARA and keratin type I genes. Nature Genet., 5, 158-162. Sun T.-T., Eichner R., Schermer A., Cooper D., Nelson W.G. and Weiss R.A. Classification, expression and possible mechanisms of evolution of mammalian epithelial keratins: A unifying model. In Levine A.J., Van de Woude G.F., Topp W.C. and Watson J.D., (eds) The Transformed Phenotype. Cold Spring Harbor Laboratory, New York, pp. 169—176. Moll R., Franke W.W., Schiller D.L., Geiger B. and Krepler R. (1982) The catalog of human cytokeratins: patterns of expression in normal epithelia, tumors, and cultured cells. Cell, 231, 11-24. Stevens H.P., Kelsell D.P., Spurr N., et al. (1994) Keratin staining and linkage of non-epidermolytic focal palmoplantar keratodermas (PPK) to 17q. Br. J. Dermatol., 131, 425. Rosenberg M., Ray Chaudhury A., Shows T.B., Le Beau M.M. and Fuchs E.A. (1988) Group of type 1 keratins on chromosome 17: characterization and expression. Mol. Cell Biol., 8, 722-736. McLean W.H.I., Rugg E.L., Lunny D.P., et al. (1995) Keratin 16 and keratin 17 mutations cause pachyonychia congenita. Nature Genet., 9, 273-278. Howel-Evans W., McConnel R.B., Clarke C.A. and Sheppard P.M. (1958) Carcinoma of the oesophagus with keratosis palmaris et plantaris (tylosis). A study of two families. Q. J. Med., 11, 413-429. Risk J.M., Field E.A., Held J.K., Whittaker J., Fryer A., Ellis A., Shaw J.M., , Leigh I.M., Bodmer J. and Friedmann P.S. (1994) Tylosis— oesophageal cancer mapped. Nature Genet., 8, 319—321. Ellis A., Field J.K., Field E.A., Friedmann P.S., Fryer A., Howard P., Leigh I.M., Risk J., Shaw J.M. and Whittaker J. (1990) Tylosis associated with carcinoma of the oesophagus and oral leukoplakia in a large Liverpool family—a review of six generations. Oral OncoL Ear. J. Cancer, 30, 102-112. Cooper D.N. and Youssoufian H. (1988) The CpG dinucleotide and human genetic disease. Hum. Genet., 78, 151-155. Lind L., Lundstrom A., Hofer P.A. and Holmgren G. (1994) The gene for diffuse palmoplantar keratoderma of the type found in Northern Sweden is localised to chromosome 12qll-ql3. Hum. Mol Genet., 3, 1789-1793. Kimonis V., DiGiovanna JJ., Yang J.-M., Doyle S.Z., Bale SJ. and Compton J.G. A mutation in the VI end domain of keratin 1 causes nonepidermolytic palmar-plantar keratoderma. J. Invest. Dermatol., 103, 764-769. Rugg E. L, Morley S.M, Smith F.J.D., Boxer M., Tidman M. J., Navsaria H., Leigh I.M. and Lane E.B. (1993) Missing links, keratin mutations in Weber-Cockayne EBS families implicate the central L12 linker domain in effective cytoskeleton function. Nature Genet., 5, 294-300. Rugg E.L., McLean W.H.I., Lane E.B., Pitera R., McMillan J.R., DoppingHepenstal PJ.C, Navsaria H.A., Leigh I.M. and Eady R.AJ. (1994) A functional 'knock out' of keratin 14. Genes Dev., 8, 2563-2573. Eady, R.AJ. (1985) Transmission electron microscopy. In Skerrow,D. and Skerrow.C. (eds) Methods in skin research. J. Wiley, Chichester. pp. 1-36. Rheinwald J.G. and Green H. (1975) Serial cultivation of strains of human epidermal keratinocytes: the formation of keratinization colonies from single cells. Cell, 6, 331-344. Sexton CJ., Proby CM., Banks L,. Stables J.N., Powell K., Navsaria H. and Leigh I.M. (1991) Characterization of factors involved in human papillomavirus type 16-mediated immortalization of oral keratinocytes. J. Gen. Virol., 1r4, 755-761. Wu Y.-J., Parker L., Binder N., Beckett M., Sinard J., Griffiths C.T. and Rheinwald J. (1985) The mesothelial keratins: A new family of cytoskeletal proteins identified in cultured mesothelial cells and nonkeratinizing epithelia. Cell, 31, 693-703. Storey A., Pirn D., Murray A., Osbome K., Banks L. and Crawford L. (1988) Comparison of the in vitro transforming activities of human papillomavirus types. EMBO J., 1, 1815-1820. Millar S.A., Dykes D.D. and Polesky H.F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res., 16, 1215-1218.

1881