Diabetes Volume 63, February 2014
645
Jun Wang,1,2 Bing Gong,1 Wei Zhao,1 Cheuk Tang,3 Merina Varghese,1 Tuyen Nguyen,3 Weina Bi,1 Amanda Bilski,1 Shimul Begum,1 Prashant Vempati,1 Lindsay Knable,1 Lap Ho,1 and Giulio M. Pasinetti1,2
Epigenetic Mechanisms Linking Diabetes and Synaptic Impairments
1Department
Corresponding author: Giulio M. Pasinetti,
[email protected].
of Neurology, Mount Sinai School of Medicine, New York, NY Research, Education and Clinical Center, James J. Peters Veterans Affairs Medical Center, Bronx, NY 3Department of Radiology, Mount Sinai School of Medicine, New York, NY 2Geriatric
Received 5 July 2013 and accepted 15 October 2013. © 2014 by the American Diabetes Association. See http://creativecommons .org/licenses/by-nc-nd/3.0/ for details.
PATHOPHYSIOLOGY
Diabetes 2014;63:645–654 | DOI: 10.2337/db13-1063
The prevalence of dementia increases with age. It is estimated that .36 million people worldwide are currently living with this devastating disease, and the prevalence is expected to increase to 66 million by 2030 and 115 million by 2050 (1). Dementia can be caused by a number of progressive diseases such as Alzheimer disease (AD) and vascular dementia. Mounting evidence suggests that cognitive impairments associated with dementia may be traced back to neuropathological conditions initiated several decades before clinical onset. Therefore, clinical development of novel interventions for dementia is now based on mechanisms associated with primary or secondary prevention. Diabetes increases the risk of both AD dementia and vascular dementia (2–9). Based on the National Diabetes Health Fact Sheet, ~8.3% of Americans have diabetes and, as with dementia, the prevalence of diabetes increases with age; currently, 26.9% of people $65 years old have diabetes (10). Despite national and international campaign efforts to counter type 2 diabetes (T2D), its prevalence is still rising. T2D and hyperglycemia are associated with cognitive dysfunction and an increased risk for dementia, including AD-type dementia. Three longitudinal studies conducted by Yaffe et al. (11), Komulainen et al. (12), and Dik et al. (13) independently showed that T2D is related to a higher risk of cognitive decline. A meta-analysis performed by Profenno, Porsteinsson, and Faraone (14) reviewed thirteen longitudinal epidemiological studies that examined the association between diabetes and dementia and found
Diabetes is one of the major risk factors for dementia. However, the molecular mechanism underlying the risk of diabetes for dementia is largely unknown. Recent studies revealed that epigenetic modifications may play a role in the pathogenesis of diabetes. We hypothesized that diabetes may cause epigenetic changes in the brain that may adversely affect synaptic function. We found significant elevation in the expression of histone deacetylases (HDACs) class IIa in the brains of diabetic subjects compared with control subjects, and these changes coincide with altered expression of synaptic proteins. In a mouse model of diet-induced type 2 diabetes (T2D), we found that, similar to humans, T2D mice also showed increased expression of HDAC IIa in the brain, and these alterations were associated with increased susceptibility to oligomeric Ab-induced synaptic impairments in the hippocampal formation and eventually led to synaptic dysfunction. Pharmacological inhibition of HDAC IIa restored synaptic plasticity. Our study demonstrates that diabetes may induce epigenetic modifications affecting neuropathological mechanisms in the brain leading to increased susceptibility to insults associated with neurodegenerative or vascular impairments. Our study provides, for the first time, an epigenetic explanation for the increased risk of diabetic patients developing dementia.
646
Diabetes and Synaptic Dysfunction
that diabetes significantly and independently increases one’s risk for dementia. Emerging evidence has demonstrated that diabetesassociated chromatin modifications pertinent to epigenetic mechanisms may play an important role in the pathogenesis of diabetes (15,16). For example, epigenetic alterations of histone deacetylases (HDACs) cause decreases in H3 and H4 acetylation at the proximal promoter of pancreatic and duodenal homeobox factor 1 (Pdx-1) in pancreatic b-cells, leading to defects in glucose homeostasis and insulin resistance and eventually leading to T2D (17). Similarly, histone modifications of glut4 mediated by DNA methyltransferase (Dnmt) and HDACs result in reduced transcription of GLUT4 in skeleton muscle in intrauterine growth–restricted offspring (18). Epigenetic mechanisms have also been widely studied in the brain. Histone methylation and histone acetylation in the hippocampal formation play an important role in modulating synaptic strength after neuronal activation (19–26). Mice that lack both Dnmt1 and Dnmt3a exhibited abnormalities in long-term potentiation (LTP) and long-term depression after stimulations in CA1 synapses, and these dysfunctions were associated with impaired learning and memory (19). HDAC2 has emerged as a major histone modification enzyme in modulating synaptic plasticity and long-term memory. Overexpression of HDAC2 is associated with structural dysfunction including reduced number of dendritic spine and synapses as well as functional deficits such as impaired synaptic plasticity and memory function (27). Moreover, pharmacological inhibition of HDACs by HDAC inhibitors such as trichostatin A resulted in increased LTP responses, further confirming the role of histone acetylation in brain function (23). In the current study, we tested whether the diabetic condition might alter the epigenetic mechanisms in the brain, which may lead to structural or functional changes that ultimately influence the ability of the brain to cope with conditions associated with neurological disorders, such as AD.
Diabetes Volume 63, February 2014
with T2D. Detailed demographic information is presented in Table 1. The Clinical Dementia Rating scale was used to assess cognitive and functional impairments associated with dementia. The cohort used in this study was devoid of any significantly cerebrovascular disease neuropathology. Assessment of Gene Expression
Total RNA from brain tissues (hippocampus) was isolated using an RNeasy Mini Kit (Qiagen, Valencia, CA) and reverse transcribed using SuperScript III first-strand synthesis supermix for qRT-PCR (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Epigenetic chromatin modification enzyme PCR array for human or mouse (Qiagen) was used to evaluate the levels of gene expression. Expression of synaptic plasticity gene PSD95 and synaptophysin in the brains of T2D mice was measured in four replicates by quantitative RT-PCR using Maxima SYBR Green master mix (Fermentas) in ABI Prism 7900HT with primers amplifying the target genes: PSD95 (forward, CGGGAGAAAATGGAGAAGGAC, and reverse, GCATTGGCTGAGACATCAAG) and synaptophysin (forward, AGTGCCCTCAACATCGAAG, and reverse, GCCACGGTGACAAAGAATTC). Mouse hypoxanthine phosphoribosyltransferase (forward, CCCCAAAATGGT TAAGGTTGC, and reverse, AACAAAGTCTGGCCTG TATCC) expression level was used as an internal control. Data were normalized using the 22DDCt method (29). Levels of target gene mRNAs were expressed relative to those in control groups and plotted in GraphPad Prism. Assessment of Protein Expression by Western Blotting Analysis
Brain samples (the same hippocampal tissue as used in the gene expression studies) were extracted with radio
Table 1—Demographic information of control and diabetes cohorts for this study n
RESEARCH DESIGN AND METHODS
Age at death (years)
Brain Specimen
Sex (% female)
Human postmortem brain specimens from T2D and agematched nondiabetic (control) case subjects were obtained from the Department of Psychiatry Brain Bank, Icahn School of Medicine at Mount Sinai. The brains were donated by deceased residents of the Jewish Home and Hospital (Manhattan, NY, and Bronx, NY). Diabetic or nondiabetic case subjects were identified using criteria previously described (28). Specifically, patients were diagnosed with diabetes either by a geriatrician or by an internist based on the American Diabetes Association criteria symptoms of diabetes plus casual plasma glucose concentration .200 mg/dL, fasting plasma glucose .126 mg/dL, and 2-h plasma glucose .200 mg/dL during an oral glucose tolerance test. We only included the subjects
Race (% white; black; Hispanic) CDR CERAD
Nondiabetes
Diabetes
24
24
87 6 8
85 6 8.1
75
62.5
91.7; 8.3; 0
66.7; 20.8; 12.5
1.9 6 2.2
1.9 6 2.2
1.65 6 0.86
1.70 6 0.91
CVD (%)*
0
0
Medication for diabetes (%)
0
62.5
Data are means 6 SD unless otherwise indicated. A total of 48 cases, comprising 24 nondiabetic control subjects and 24 diabetic subjects, were obtained from the brain bank. CDR, Clinical Dementia Rating; CERAD, Consortium to Establish a Registry for Alzheimer’s Disease; CVD, cerebrovascular disease. *Cerebrovascular disease as primary or secondary Consortium to Establish a Registry for Alzheimer’s Disease diagnosis.
diabetes.diabetesjournals.org
immunoprecipitation assay buffer and boiled in Laemmli sample buffer for 5 min. Proteins were separated by gel electrophoresis using 10% sodium dodecyl sulfate– polyacrylamide gels and electrotransferred onto nitrocellulose membranes, blocking with 5% nonfat dried milk (Sigma-Aldrich, St. Louis, MO) in Tris-buffered saline. Membranes were probed with primary antibodies antiPSD95 (1:2,500; Millipore, Billerica, MA) or antisynaptophysin (1:5,000; Sigma-Aldrich) at 4°C overnight, followed by horseradish peroxidase–conjugated secondary antibodies. Specific protein signals were detected using an enhanced chemiluminescence system (ECL plus; PerkinElmer LAS, Inc., Boston, MA), and signals were quantified by densitometric scanning (GS-800; Bio-Rad, Hercules, CA) and analyzed using Quantity One software (Bio-Rad). b-Actin (1:3,000; Sigma-Aldrich) was served as the loading control. Mouse Model and Treatment
Female C57BL/6J mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and housed in the centralized animal care facility of the Center for Comparative Medicine and Surgery at Icahn School of Medicine at Mount Sinai. The C57BL/6J mouse develops hyperinsulinemia and hyperglycemia when fed a high-fat diet (30). Mice were randomly grouped into two groups and received the following treatment starting at ;2 months of age: control mice were treated with a regular diet (CTRL group) (10% kcal fat, cat. no. D12450B; Research Diets), T2D mice were treated with a high-fat diet (T2D group) (60% kcal fat, D12492; Research Diets). All animals were maintained on a 12:12-h light:dark cycle with lights on at 0700 h in a temperature-controlled (20 6 2°C) vivarium, and all procedures were approved by the Mount Sinai School of Medicine Institutional Animal Care and Use Committee.
Wang and Associates
647
cerebrospinal fluid in the presence or absence of 60 nmol/L oligomeric Ab (oAb) at 32°C. For extracellular recordings: CA1 field excitatory postsynaptic potentials (fEPSPs) were recorded by placing stimulating and recording electrodes in CA1 stratum radiatum. Basal synaptic transmission was assayed by plotting the stimulus voltages against slopes of fEPSP. For LTP experiments, a 15-min baseline was recorded every min at an intensity that evokes a response ;35% of the maximum evoked response. LTP was induced using u-burst stimulation (4 pulses at 100 Hz, with the bursts repeated at 5 Hz and each tetanus including three 10-burst trains separated by 15 s), and fEPSPs were monitored for 60 min to assess the magnitude of potentiation. Functional Magnetic Resonance Imaging Imaging
The Bruker Biospec 70/30 system, a 7T micro-magnetic resonance imaging (MRI) scanner, was used. Prior to scanning, mice were anesthetized with 2% isofluorane in NO2 (75%) and O2 (23%). They were then positioned onto the scanner bed. Anesthesia was maintained at 1.5% isofluorane throughout the scan time. Data acquisition was done using a four-channel mouse braindedicated phased array coil as follows: after a localizer, we manually shimmed the brain region for optimal signal and signal distortion. The resting state functional magnetic resonance imaging (fMRI) was acquired using an echo planar imaging blood oxygen level–dependent sequence with the following protocol: segmented echo planar imaging (34), repetition time 1,500 ms, echo time 18.9 ms, matrix 96 3 96, field of view 12.8 mm, slice thickness 1.1 mm, 11 slices. Total acquisition time was ~5 min per scan; three scans were acquired for each mouse. Analysis
Intraperitoneal Glucose Tolerance Test and Fasting Insulin Measurements
Intraperitoneal glucose tolerance test was performed as previously reported (31,32). Specifically, mice were given a single dose of glucose (2 g/kg body wt i.p.) postprandially, and blood was collected from the tail vein periodically over a 3-h period. Blood glucose content was assessed using the CONTOUR blood glucose system (Bayer, Mishawaka, IN). Insulin was measured using the mouse serum adipokine multiplex MAP kit from Millipore (Billerica, MA). Electrophysiological Recordings
Mice were killed by decapitation, and the brains were quickly removed. Hippocampal slices (350 mm) were placed into oxygenated artificial cerebrospinal fluid at 29°C for a minimum of 90 min to acclimatize. Slices were then transferred to a recording chamber and perfused continuously with oxygenated artificial
Preprocessing of the functional images began by excluding scans where there was movement. Manual brain extraction was then performed on the mean functional image. A study-specific template was created based on all the mean functional images using the FMRIB software library (FSL). Independent component analysis was used to identify unique networks of resting-state activity using MELODIC (33) as implemented in FSL. We visually identified the default mode network (DMN) from the networks produced by FSL. The DMN was defined as containing orbital cortex, cingulate cortex, and hippocampal regions according to the literature (34). Group independent component analysis was performed, and the DMN and sensory motor were visually identified for dual regression analysis. General linear modeling and permutationbased inference testing (RANDOMIZE) were used to test for group differences and symptom severity correlates of the DMN (35,36).
648
Diabetes and Synaptic Dysfunction
Primary Neuron Culture and MC1568 Treatment
Embryonic-day 16 cortico-hippocampal neuronal cultures were prepared from C57BL/6J mice as previously described (32). Neurons were seeded on poly-D-lysine– coated sixwell plates and cultured in Neurobasal medium supplemented with 2% B27, 0.5 mmol/L L-glutamine, and 1% penicillin streptomycin (Gibco-BRL) in the tissue culture incubator at 37°C with 5% CO2. After 5 days in vitro culturing, the neurons were treated either with 200 nmol/L MC1568 (Selleckchem) or with vehicle for 16–18 h. Cells were washed once with cold PBS before RNA isolation. Overall Statistics
In these studies, all values are expressed as mean 6 SEM. Differences between means were analyzed using either two-way repeated-measures ANOVAs or two-tailed Student t test. In all analyses, the null hypothesis was rejected at the 0.05 level. All statistical analyses were
Diabetes Volume 63, February 2014
performed using the Prism Stat program (GraphPad Software, Inc.). RESULTS Differential Regulation of HDAC IIa Is Associated With Impaired Synaptic Integrity in the Brains of Diabetic Subjects
To test whether there are epigenetic changes in the brains of diabetic patients, we measured the expressions of epigenetic chromatin modification enzymes in the brains of diabetic patients and normal control subjects using a PCR-based array. We found that there are significant changes in the expression of select chromatin modification enzymes, particularly HDAC class IIa (Fig. 1A), while there are no changes with regard to the expression of HDAC class I (Fig. 1B). Specifically, .50% upregulation of HDAC4, -7, and -9 was observed in the brains of diabetic subjects, as well as an almost twofold increase in HDAC5 expression compared with the nondiabetic control subjects.
Figure 1—Differential expression of class IIa HDACs in the brains of control (□) vs. T2D (■) subjects and measurements of protein levels of synaptic structure proteins in the same brains. A and B: Messenger RNA expression of class IIa HDACs (HDAC4, HDAC5, HDAC7, and HDAC9) (A) and class I HDACs (HDAC1, HDAC2, HDAC3, and HDAC8) (B) in the brains of control and T2D subjects. C: Protein levels of PSD-95 (left panel) and synaptophysin (right panel) in the membrane fraction of brain tissues from the control and T2D subjects assessed by Western blot analysis. Inset: Representative Western blot. D: Correlation of HDAC5 with PSD-95 (left, P = 0.032) and synaptophysin (right, P = 0.0074). For A and C: *P < 0.05, **P < 0.01, ***P < 0.001; n = 21–24 per group.
diabetes.diabetesjournals.org
We next tested whether diabetes-induced epigenetic modifications in the brain might be associated with the modulation of neuronal activity at the level of synapse. We examined the levels of proteins involved in synaptic plasticity in the pre- and postsynaptic compartments as indices for synaptic integrity in the control and T2D subjects. Western blot was used to examine the levels of synaptophysin, an important presynaptic protein responsible for synaptic vesicle biogenesis and recycling, and postsynaptic density protein (PSD)-95, the most abundant scaffolding protein involved in recruiting and anchoring glutamate receptor subunits in PSD. We found that the levels of synaptophysin and PSD-95 were both significantly lower in postmortem brain specimens from the T2D subjects compared with the control subjects (Fig. 1C [inset]). Moreover, correlation studies showed that the expression of HDAC5 was significantly reverse correlated with PSD-95 (P , 0.05) and synaptophysin (P , 0.01) (Fig. 1D). The expression of HDAC7 was significantly reverse correlated with synaptophysin (P , 0.05) but had no correlation with PSD-95. We also found that the expression of HDAC9 showed nonsignificant reverse correlations with the expression of PSD-95 (P = 0.085) and synaptophysin (P = 0.084). We did not find any correlation between HDAC4 and the expression of synaptic proteins. Elevated HDAC IIa in the Brain of a Mouse Model of Diabetes
Based on the specific HDAC changes observed in the postmortem brains from diabetic subjects, we tested
Wang and Associates
649
whether diabetic conditions can causally induce HDAC IIa alteration in the brain. We used the C57BL/6J mouse as a model of human T2D because it develops hyperinsulinemia and hyperglycemia when fed a diabetogenic diet but remains physically normal when fed low-fat chow (30). We treated mice with a regular low-fat diet or the diabetogenic diet starting at 2 months of age. After 6 months of chronic diet treatment, the T2D mice developed severe diabetes including increased baseline fasting glucose and impaired insulin sensitivity and glucose tolerance compared with the CTRL mice (Fig. 2A–C). Examination of chromatin modification enzyme expressions in the brains after 6 months of the diabetogenic diet treatment revealed that, similar to the human data, two of the class IIa HDACs are upregulated in the brains of T2D mice. Most notably, HDAC5 was significantly upregulated, fourfold, and HDAC9 was upregulated twofold (Fig. 2D). We did not find any changes in the expression of class I HDACs including HDAC1, -2, -3, and -8 in the brain. HDAC10, which belongs to HDAC IIb, was significantly reduced in the T2D mouse brains, while there was no change in the expression of HDAC6 and HDAC11. Diabetes-Induced HDAC IIa Upregulation Is Associated With Increased Synaptic Susceptibility to oAb Insults
We next tested whether the epigenetic changes in the brain of T2D mice coincide with synaptic impairments. Electrophysiological studies were performed on the
Figure 2—Increased expression of class IIa HDAC5 and -9 in the brains of diabetogenic-induced T2D C57BL/6J mice. A: Postprandial plasma glucose level. B: Fasting insulin level. C: Intraperitoneal glucose tolerance test. D: Expression of HDAC IIa in the brain of mice after 6 months diabetogenic diet treatment. **P < 0.01, ***P < 0.001; n = 7 for A–C, and n = 5 for D.
650
Diabetes and Synaptic Dysfunction
hippocampal slices isolated from the T2D mice. We found that hippocampal slices derived from the T2D mice after 6 months of diabetogenic diet treatment had normal electrophysiological responses after tetanus stimulation (data not shown). However, these hippocampal slices had a much lower threshold to oAb1–42–induced LTP deficits. Normally, healthy hippocampal slices show compromised LTP when exposed to 200 nmol/L oAb (data not shown). However, hippocampal slices derived from T2D mice showed limited potentiation after tetanic stimulation in the presence of 60 nmol/L oAb, while slices from strain-, age-, and sex-matched mice on the control diet showed robust LTP under the same conditions (Fig. 3A). Consistent with previous observations, oAb had no effect on basal synaptic transmission (37) (Fig. 3B). Synaptic deficits were exacerbated with prolonged diabetes conditions. While hippocampal slices isolated from T2D mice, after 6 months of diabetogenic diet treatment, showed normal LTP response in the absence of oAb, slices isolated from mice after 10 months of treatment showed compromised LTP responses (Fig. 3C). In the diabetic mice, the LTP responses were 153.48 6 5.05% 60 min after the u-burst stimulus, while in the CTRL mice the responses were 233.97 6 14.82% (P , 0.01), further stressing that diabetes conditions might
Diabetes Volume 63, February 2014
adversely influence brain synaptic function and may eventually lead to cognitive impairments. LTP Deficits Coincide With Abnormal Brain Connectivity in T2D Mice
To test whether diabetes condition–induced epigenetic alterations/synaptic impairments in the brain might be associated with brain biology changes, we used MRI imaging to objectively measure the biological effects of the diabetic condition on the brain. We used fMRI with blood oxygen level–dependent contrast to examine the brain connectivity in T2D and control mice, following 10 months treatment. We found significant difference between the CTRL and T2D mice in the DMN. Compared with CTRL mice, T2D mice had significantly stronger signal intensities in the DMN (Fig. 4A) as well as in the sensory/motor cortex regions (Fig. 4B). The green color represents the group resting-state network and the dark blue color (red arrows) represents significant difference between CTRL and T2D. Inhibition of HDAC Class IIa Restores LTP Response in Brain Slices Isolated From T2D Mice and Increases the Expression of Synaptic Structure Proteins in Primary Neurons
To confirm whether HDAC IIa might be responsible for the synaptic impairment we observed in the
Figure 3—Increased susceptibility to oAb-induced synaptic impairments in hippocampal slices isolated from T2D mice. A and B: The fEPSPs of LTP (A) and basal synaptic transmission (B) were recorded from the CA1 region of hippocampal slices from CTRL or T2D mice after 6 months dietary treatment and exposed to 60 nmol/L of oAb for 1 h. LTP (C) and basal synaptic transmission (D) recorded from hippocampal slices from CTRL or T2D mice after 10 months treatment. The arrows indicate the beginning of tetanus to induce LTP.
diabetes.diabetesjournals.org
Wang and Associates
651
Figure 4—Voxel-by-voxel statistics of the DMN superimposed on anatomical resting-state fMRI. Two networks were analyzed: DMN (arrows indicate cingulate gyrus and part of the hippocampus) (A) and sensory/motor network (B) (arrows indicate the bilateral sensory motor cortices). Green represents group resting-state network. Blue represents significantly stronger signals in T2D mice compared to the control mice; n = 8 per group.
electrophysiology study on the T2D mice treated with diabetogenic diet for 10 months (Fig. 3C), we treated hippocampal slices isolated from these mice with an HDAC IIa–specific inhibitor, MC1568 (38,39), and recorded the LTP responses. We found that ex vivo treatment with MC1568 significantly improved LTP responses compared with the vehicle-treated slices. In the vehicle-treated diabetic brain slices, 60 min after the u-burst stimulus, the LTP responses were 151.85 6 8.64% while in the MC1568-treated diabetic slices, the responses were 202.51 6 12.08% (P , 0.01) (Fig. 5A, left
panel). There was no difference in basal synaptic transmission (Fig. 5A, right panel). Similarly, we also found that ex vivo MC1568 treatment promoted the LTP in brain slices from T2D mice following 6 months diabetogenic diet treatment when challenged with 60 nmol/L of oAb (from 156.58 6 4.48 to 198.02 6 10.28%, P , 0.01). In control studies, we found that 200 nmol/L MC1568 treatment did not affect LTP responses in hippocampal slices from mice treated with regular diet. We also tested whether pharmacological inhibition of HDAC IIa could influence some of the indices of neuronal
Figure 5—Inhibition of HDAC class IIa restores LTP in the hippocampal slices from T2D mice and increases expression of synaptic proteins in primary neurons. A: Hippocampal slices from T2D mice were treated with 200 nmol/L MC1568 for 2 h, and LTP (left panel) and basal synaptic transmission (right panel) were recorded. B: Primary neurons derived from C57BL/6J mice were cultured for 5 days before treatment with vehicle or 5 mmol/L MC1568 for 16 h. Transcription levels of PSD-95 (left panel), synaptophysin (middle panel), and brainderived neurotrophic factor (BDNF) (right panel) were normalized with hypoxanthine phosphoribosyltransferase (HPRT). *P < 0.05, **P < 0.01; n = 4 per group.
652
Diabetes and Synaptic Dysfunction
activity. In primary neurons derived from C57BL/6J mice, treatment with MC1568 significantly increased the transcription level of the synaptic structure proteins PSD-95, synaptophysin, and brain-derived neurotrophic factor (Fig. 5B), which are important molecules for learning and memory, thus confirming the role of HDAC IIa in the regulation of synaptic activity. DISCUSSION
Diabetes mellitus has become an epidemic, and the prevalence in the U.S. is projected to reach 39 million in 2050. As one of the major causes of functional disability, this disease poses tremendous burden on the health system including medical expenses, costs for caregivers, and reduced productivity. Diabetes is one of the major causes of morbidity and mortality and is associated with long-term complications that affect the peripheral as well as the central nervous system. Diabetes has been linked to cognitive impairment and an increased risk factor for dementia, including AD-type dementia. Hyperglycemia-induced metabolic and vascular disturbances are well acknowledged, however, the exact mechanisms underlying cognitive dysfunction in diabetes are unclear. We found that select chromatin modification enzymes, specifically HDAC class IIa, were upregulated in the brains of diabetic patients and this increase was associated with reduced expression of synaptic proteins that are important for synaptic structural integrity and function. Using an animal model of T2D, we found similar HDAC IIa changes in the brains and these alterations coincided with increased susceptibility of synaptic function to amyloid toxicity. In addition, prolonged diabetic condition exacerbated the observed synaptic dysfunction. Since MRI has been widely used to assess hemodynamic responses related to neural activity in the brain, we used resting-state fMRI to investigate the regionally connected functional networks, e.g., motor/ sensory cortex, hippocampus, amygdala, striatum, visual, etc., in the T2D mouse brains. We found that T2D mice exhibited increased signal intensity both in the hippocampal formation and the sensory motor in the cortex, suggesting that T2D brain might not be functioning efficiently and requires much more energy to accomplish a task compared with the normal efficient brain (40,41). It is also possible that a T2D brain may not be signaling coherently and the increase in signaling is a result of haphazard signaling. Our findings are consistent with the human imaging and epidemiology studies demonstrating that progressive cerebral atrophy is associated with prolonged diabetes condition (42–46) and diabetic individuals have an increased risk of developing cognitive dysfunction, including mild cognitive impairment and dementia (6–8,47). HDACs are a family of enzymes that remove the acetyl moiety of lysine residues from the N-terminus of histone proteins, leading to chromatin compaction and thus transcription repression. Both class I and class II HDACs
Diabetes Volume 63, February 2014
are abundantly expressed in the brains and have been shown to regulate neuronal activity that is essential for synaptic function, as well as for learning and memory. Our study for the first time demonstrates that the diabetes condition can causally induce changes in HDAC levels in the brain, which, in turn, trigger a detrimental molecular cascade that leads to compromised neuronal structure integrity and synaptic plasticity. Our study also demonstrates that diabetic brains are more susceptible to oAb-induced synaptic toxicity. oAb is increasingly accepted as one of the major culprits for AD dementia. Cognitive deterioration in AD is directly linked to the brain accumulation of extracellular soluble oAb species rather than amyloid plaque deposition (48,49). Previous epidemiological studies showed that the age of onset, duration, and severity of diabetes can influence the incidence of mild cognitive impairment (50). This is consistent with our findings that a 6-month diabetogenic diet treatment resulted in increased susceptibility to oAb, while prolonging the diabetic condition for an additional 4 months resulted in reduced synaptic response in the absence of exogenous insults. Thus, our results may provide mechanistic explanations of the epidemiological observation that diabetic subjects have an increased risk of developing AD dementia. Notably, HDACs are capable of regulating many cellular and molecular pathways involved in synaptic function and learning and memory. It is possible that modulation of other molecular mechanisms, such as brain-derived neurotrophic factor, cAMP response element–binding (CREB) signaling, and protein kinase–mediated hyperphosphorylation of microtubule-binding protein tau, can all contribute to the phenomenon observed in our study. These mechanisms need to be further investigated. Diabetes is a multifaceted metabolic disorder that affects both the peripheral and the central nervous system. Based on our findings, it is plausible that the epigenetic alterations in diabetic brains may make the brain not only more susceptible to oAb but also to other insults such as aberrantly aggregated neurofibrillary tangles made of hyperphosphorylated tau, the other pathological hallmark of AD. It is also possible that these changes make the brains more vulnerable to infarction and small-vessel disease, which may lead to vascular dementia and other insults such as inflammation and advanced glycation end products that are prevalent in diabetes. Future research on the relationship of diabetesinduced alteration of epigenetic mechanisms and the susceptibility to these potential diabetes-associated pathologic changes will further elucidate the molecular mechanisms underlying the increased risk of diabetic patients developing dementia.
Acknowledgments. The authors thank Dr. Vahram Haroutunian, Department of Psychiatry and Neurology from Mount Sinai School of Medicine, for providing the samples from the brain bank. The authors acknowledge the
diabetes.diabetesjournals.org
Wang and Associates
653
editorial assistance of Samara Levine of the Department of Neurology at the Icahn School of Medicine for help preparing the manuscript.
16. Pinney SE, Simmons RA. Epigenetic mechanisms in the development of type 2 diabetes. Trends Endocrinol Metab 2010;21:223–229
Funding. This study was supported by discretionary funding to G.M.P.
17. Park JH, Stoffers DA, Nicholls RD, Simmons RA. Development of type 2 diabetes following intrauterine growth retardation in rats is associated with progressive epigenetic silencing of Pdx1. J Clin Invest 2008;118:2316– 2324
Duality of Interest. No potential conflicts of interest relevant to this article were reported.
Author Contributions. J.W. designed the studies, wrote the manuscript, and performed experiments. B.G., W.Z., C.T., M.V., T.N., W.B., A.B., S.B., P.V., and L.K. performed experiments. C.T. and L.H. designed the studies. G.M.P. designed the studies and wrote the manuscript. G.M.P. is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. References 1. Alzheimer’s Disease International. World Alzheimer Report 2009. London, Alzheimer’s Disease International, 2009 2. Arvanitakis Z, Wilson RS, Bienias JL, Evans DA, Bennett DA. Diabetes mellitus and risk of Alzheimer disease and decline in cognitive function. Arch Neurol 2004;61:661–666 3. Luchsinger JA, Tang MX, Shea S, Mayeux R. Hyperinsulinemia and risk of Alzheimer disease. Neurology 2004;63:1187–1192 4. Hassing LB, Grant MD, Hofer SM, et al. Type 2 diabetes mellitus contributes to cognitive decline in old age: a longitudinal population-based study. J Int Neuropsychol Soc 2004;10:599–607 5. Leibson CL, Rocca WA, Hanson VA, et al. Risk of dementia among persons with diabetes mellitus: a population-based cohort study. Am J Epidemiol 1997;145:301–308 6. Xu WL, Qiu CX, Wahlin A, Winblad B, Fratiglioni L. Diabetes mellitus and risk of dementia in the Kungsholmen project: a 6-year follow-up study. Neurology 2004;63:1181–1186 7. Ott A, Stolk RP, van Harskamp F, Pols HA, Hofman A, Breteler MM. Diabetes mellitus and the risk of dementia: The Rotterdam Study. Neurology 1999;53:1937–1942 8. MacKnight C, Rockwood K, Awalt E, McDowell I. Diabetes mellitus and the risk of dementia, Alzheimer’s disease and vascular cognitive impairment in the Canadian Study of Health and Aging. Dement Geriatr Cogn Disord 2002;14:77–83
18. Raychaudhuri N, Raychaudhuri S, Thamotharan M, Devaskar SU. Histone code modifications repress glucose transporter 4 expression in the intrauterine growth-restricted offspring. J Biol Chem 2008;283:13611– 13626 19. Feng J, Zhou Y, Campbell SL, et al. Dnmt1 and Dnmt3a maintain DNA methylation and regulate synaptic function in adult forebrain neurons. Nat Neurosci 2010;13:423–430 20. Levenson JM, Roth TL, Lubin FD, et al. Evidence that DNA (cytosine-5) methyltransferase regulates synaptic plasticity in the hippocampus. J Biol Chem 2006;281:15763–15773 21. Nelson ED, Kavalali ET, Monteggia LM. Activity-dependent suppression of miniature neurotransmission through the regulation of DNA methylation. J Neurosci 2008;28:395–406 22. Zhao X, Ueba T, Christie BR, et al. Mice lacking methyl-CpG binding protein 1 have deficits in adult neurogenesis and hippocampal function. Proc Natl Acad Sci USA 2003;100:6777–6782 23. Vecsey CG, Hawk JD, Lattal KM, et al. Histone deacetylase inhibitors enhance memory and synaptic plasticity via CREB:CBP-dependent transcriptional activation. J Neurosci 2007;27:6128–6140 24. Fischer A, Sananbenesi F, Wang X, Dobbin M, Tsai LH. Recovery of learning and memory is associated with chromatin remodelling. Nature 2007;447:178–182 25. Levenson JM, O’Riordan KJ, Brown KD, Trinh MA, Molfese DL, Sweatt JD. Regulation of histone acetylation during memory formation in the hippocampus. J Biol Chem 2004;279:40545–40559 26. Peleg S, Sananbenesi F, Zovoilis A, et al. Altered histone acetylation is associated with age-dependent memory impairment in mice. Science 2010;328:753–756 27. Guan JS, Haggarty SJ, Giacometti E, et al. HDAC2 negatively regulates memory formation and synaptic plasticity. Nature 2009;459:55–60
9. Peila R, Rodriguez BL, Launer LJ; Honolulu-Asia Aging Study. Type 2 diabetes, APOE gene, and the risk for dementia and related pathologies: The Honolulu-Asia Aging Study. Diabetes 2002;51:1256–1262
28. Beeri MS, Silverman JM, Davis KL, et al. Type 2 diabetes is negatively associated with Alzheimer’s disease neuropathology. J Gerontol A Biol Sci Med Sci 2005;60:471–475
10. Steinman MA, Lee SJ, John Boscardin W, et al. Patterns of multimorbidity in elderly veterans. J Am Geriatr Soc 2012;60:1872–1880
29. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402–408
11. Yaffe K, Haan M, Blackwell T, Cherkasova E, Whitmer RA, West N. Metabolic syndrome and cognitive decline in elderly Latinos: findings from the Sacramento Area Latino Study of Aging study. J Am Geriatr Soc 2007;55:758–762
30. Surwit RS, Feinglos MN, Rodin J, et al. Differential effects of fat and sucrose on the development of obesity and diabetes in C57BL/6J and A/J mice. Metabolism 1995;44:645–651
12. Komulainen P, Lakka TA, Kivipelto M, et al. Metabolic syndrome and cognitive function: a population-based follow-up study in elderly women. Dement Geriatr Cogn Disord 2007;23:29–34
31. Wang J, Ho L, Qin W, et al. Caloric restriction attenuates beta-amyloid neuropathology in a mouse model of Alzheimer’s disease. FASEB J 2005; 19:659–661
13. Dik MG, Jonker C, Comijs HC, et al. Contribution of metabolic syndrome components to cognition in older individuals. Diabetes Care 2007;30: 2655–2660
32. Wang J, Ho L, Chen L, et al. Valsartan lowers brain beta-amyloid protein levels and improves spatial learning in a mouse model of Alzheimer disease. J Clin Invest 2007;117:3393–3402
14. Profenno LA, Porsteinsson AP, Faraone SV. Meta-analysis of Alzheimer’s disease risk with obesity, diabetes, and related disorders. Biol Psychiatry 2010;67:505–512
33. Beckmann CF, Smith SM. Probabilistic independent component analysis for functional magnetic resonance imaging. IEEE Trans Med Imaging 2004; 23:137–152
15. Gray SG, De Meyts P. Role of histone and transcription factor acetylation in diabetes pathogenesis. Diabetes Metab Res Rev 2005;21:416– 433
34. Lu H, Zou Q, Gu H, Raichle ME, Stein EA, Yang Y. Rat brains also have a default mode network. Proc Natl Acad Sci USA 2012;109:3979– 3984
654
Diabetes and Synaptic Dysfunction
Diabetes Volume 63, February 2014
35. Beckmann CF, DeLuca M, Devlin JT, Smith SM. Investigations into restingstate connectivity using independent component analysis. Philos Trans R Soc Lond B Biol Sci 2005;360:1001–1013
43. Tiehuis AM, van der Graaf Y, Visseren FL, et al.; SMART Study Group. Diabetes increases atrophy and vascular lesions on brain MRI in patients with symptomatic arterial disease. Stroke 2008;39:1600–1603
36. Zuo XN, Kelly C, Adelstein JS, Klein DF, Castellanos FX, Milham MP. Reliable intrinsic connectivity networks: test-retest evaluation using ICA and dual regression approach. Neuroimage 2010;49:2163–2177
44. Khan G, Khan N, Aziz A. Detection of cerebral atrophy in type-II diabetes mellitus by magnetic resonance imaging of brain. J Ayub Med Coll Abbottabad 2010;22:67–70
37. Wang HW, Pasternak JF, Kuo H, et al. Soluble oligomers of beta amyloid (1-42) inhibit long-term potentiation but not long-term depression in rat dentate gyrus. Brain Res 2002;924:133–140
45. van Elderen SG, de Roos A, de Craen AJ, et al. Progression of brain atrophy and cognitive decline in diabetes mellitus: a 3-year follow-up. Neurology 2010;75:997–1002
38. Mai A, Rotili D, Tarantino D, et al. Small-molecule inhibitors of histone acetyltransferase activity: identification and biological properties. J Med Chem 2006;49:6897–6907
46. van Harten B, Oosterman J, Muslimovic D, van Loon BJ, Scheltens P, Weinstein HC; van. Cognitive impairment and MRI correlates in the elderly patients with type 2 diabetes mellitus. Age Ageing 2007;36: 164–170
39. Itoh Y, Suzuki T, Miyata N. Isoform-selective histone deacetylase inhibitors. Curr Pharm Des 2008;14:529–544 40. Haier RJ, Siegel BV Jr, MacLachlan A, Soderling E, Lottenberg S, Buchsbaum MS. Regional glucose metabolic changes after learning a complex visuospatial/motor task: a positron emission tomographic study. Brain Res 1992;570:134–143
47. Luchsinger JA, Reitz C, Patel B, Tang MX, Manly JJ, Mayeux R. Relation of diabetes to mild cognitive impairment. Arch Neurol 2007;64:570–575 48. Cleary JP, Walsh DM, Hofmeister JJ, et al. Natural oligomers of the amyloid-beta protein specifically disrupt cognitive function. Nat Neurosci 2005;8:79–84
41. Tang CY, Eaves EL, Ng JC, et al. Brain networks for working memory and factors of intelligence assessed in males and females with fMRI and DTI. Intelligence 2011;38:293–303
49. Klyubin I, Walsh DM, Lemere CA, et al. Amyloid beta protein immunotherapy neutralizes Abeta oligomers that disrupt synaptic plasticity in vivo. Nat Med 2005;11:556–561
42. den Heijer T, Vermeer SE, van Dijk EJ, et al. Type 2 diabetes and atrophy of medial temporal lobe structures on brain MRI. Diabetologia 2003;46: 1604–1610
50. Roberts RO, Geda YE, Knopman DS, et al. Association of duration and severity of diabetes mellitus with mild cognitive impairment. Arch Neurol 2008;65:1066–1073