ERAP1 Gene Expression Is Influenced by ... - Wiley Online Library

ARTHRITIS & RHEUMATOLOGY Vol. 67, No. 6, June 2015, pp 1525–1534 DOI 10.1002/art.39072 C 2015, American College of Rheumatology V

ERAP1 Gene Expression Is Influenced by Nonsynonymous Polymorphisms Associated With Predisposition to Spondyloarthritis Felicie Costantino,1 Alice Talpin,2 Irini Evnouchidou,3 Amir Kadi,2 Ariane Leboime,4 Roula Said-Nahal,4 Nelly Bonilla,2 Franck Letourneur,5 Tifenn Leturcq,2 Zeyna Ka,2 Peter van Endert,3 Henri-Jean Garchon,1 Gilles Chiocchia,2 and Maxime Breban1 Objective. Several polymorphisms in ERAP1 are strongly associated with susceptibility to spondyloarthritis (SpA). The combination of rs17482078, rs10050860, and rs30187 results in the construction of 3 major haplotypes that are associated with SpA (the “protective” haplotype T/T/C, the “neutral” haplotype C/C/C, and the “susceptibility” haplotype C/C/T). The aim of the present study was to determine whether such haplotypes might affect endoplasmic reticulum aminopeptidase 1 (ERAP-1) messenger RNA (mRNA) expression, protein

level, and/or enzymatic activity in antigen-presenting cells, a type of cell that is potentially relevant to disease pathogenesis. Methods. Monocyte-derived dendritic cells (DCs) were generated in 2 cohorts (a discovery cohort and a replication cohort) comprising a total of 23 SpA patients and 44 healthy controls. Lymphoblastoid B cell lines were established from individuals who were homozygous for the risk, the neutral, or the protective ERAP1 haplotype, respectively. In those samples, we investigated the relationship between ERAP1 haplotypes and mRNA expression level. We also used Western blot analysis to measure the relative protein expression of ERAP-1 and a fluorogenic assay to measure its enzymatic activity. Results. In monocyte-derived DCs, there was a strong association between ERAP1 haplotypes and the ERAP-1 mRNA expression level, with higher levels in subjects harboring the susceptibility haplotype (P 5 0.001 and P 5 5.6 3 1027 in the discovery and replication cohorts, respectively). In lymphoblastoid B cell lines, we observed a significant correlation between haplotype risk score and ERAP1 transcript or protein level (P 5 0.003, r 5 0.92 for both). Enzymatic activity followed a similar trend both in monocyte-derived DCs and in lymphoblastoid B cell lines. Conclusion. These data provide strong evidence that SpA-associated ERAP1 polymorphisms affect the level of gene expression in antigen-presenting cells. How increased production/activity of ERAP-1 may influence susceptibility to SpA remains to be determined.

Supported by the Agence Nationale de la Recherche (GEnetics, Microbiota, Inflammation and Spondyloarthritis [GEMISA] grant ANR 2010 and Programme Investissements d’Avenir grant ANR-11-IDEX0005-02, Sorbonne Paris Cite, Laboratoire d’Excellence INFLAMEX). Dr. Costantino’s work was supported by a grant from the Societ e Franc ¸aise de Rhumatologie. Dr. Talpin’s work was supported by a grant from Arthritis Fondation Courtin. Dr. Evnouchidou’s work was supported by a grant from the Thyssen Foundation. Additional support for laboratory equipment was provided by the Communaute d’Agglomeration de St. Quentin-en-Yvelines (CASQY), and Conseil General des Yvelines. 1 Felicie Costantino, MD, PhD, Henri-Jean Garchon, MD, PhD, Maxime Breban, MD, PhD: INSERM U1173, Universit e de Versailles St. Quentin-en-Yvelines, and Laboratoire d’Excellence INFLAMEX, Paris, France, and H^ opital Ambroise Pare, AP-HP, Boulogne-Billancourt, France; 2Alice Talpin, PhD, Amir Kadi, PhD, Nelly Bonilla, MS, Tifenn Leturcq, MD, Zeyna Ka, MS, Gilles Chiocchia, PhD: INSERM U1173, Universite de Versailles St. Quentin-en-Yvelines, and Laboratoire d’Excellence INFLAMEX, Paris, France; 3Irini Evnouchidou, PhD, Peter van Endert, MD: INSERM U1151, CNRS (UMR 8253), Universite Paris Descartes, Sorbonne Paris Cite, Paris, opital France; 4Ariane Leboime, MD, Roula Said-Nahal, MD: H^ Ambroise Pare, AP-HP, Boulogne-Billancourt, France; 5Franck Letourneur, MS: Institut Cochin, INSERM U1016, CNRS (UMR8104), and Universite Paris Descartes, Paris, France Drs. Costantino and Talpin contributed equally to this work. Address correspondence to Maxime Breban, MD, PhD, Service de Rheumatologie, H^ opital Ambroise Pare, 9 Avenue Charles de Gaulle, 92100 Boulogne-Billancourt, France. E-mail: [email protected]. Submitted for publication September 24, 2014; accepted in revised form February 10, 2015.

Spondyloarthritis (SpA) is a frequent form of chronic inflammatory arthritis, with an estimated lifetime risk of ;0.43% in adult Caucasian populations (1). It comprises several closely related disorders that 1525

1526

share clinical and imaging features as well as genetic predisposition (2,3). Familial aggregation and heritability of SpA are high and involve multiple genetic factors, including the HLA–B27 allele, which plays a prominent role (4). The first genome-wide association study of ankylosing spondylitis (AS), the prototypical form of SpA, revealed significant associations of the disease with several nonsynonymous single-nucleotide polymorphisms (SNPs) situated in the gene for endoplasmic reticulum aminopeptidase 1 (ERAP-1) (5). Such associations were subsequently confirmed in independent Caucasian and Asian cohorts of AS (6–8), as well as in the spondyloarthritides as a whole (9,10). Interestingly, the association between ERAP1 polymorphisms and SpA seems to be restricted to HLA–B27–positive disease (10–12). More recently, new associations between AS and 3 other aminopeptidases (ERAP2, LNPEPP, and NPEPPS) have been described (12). The ERAP1 gene located on chromosome 5q15 encodes an aminopeptidase expressed in the endoplasmic reticulum. Its main documented function is to trim peptides to the optimal length for binding to major histocompatibility complex (MHC) class I molecules (13,14). It has also been reported to be involved in the shedding of cell surface proinflammatory cytokine receptors (tumor necrosis factor receptor type I [TNFRI], interleukin-6 receptor [IL-6R], and IL-1R type II [IL-1RII]) (15–17). However, such sheddase activity remains debated, since Erap-knockout mice exhibit levels of soluble TNFR and IL-6R similar to those in wild-type animals (11). Moreover, AS-associated ERAP1 polymorphisms do not seem to influence the serum levels of soluble cytokine receptors among patients with AS (18). These results, together with a restriction of the association of ERAP1 to HLA–B27– positive disease, suggest that the pathologic effects of ERAP1 in AS could be related to its function of trimming peptides in the endoplasmic reticulum, with potential consequences on antigen presentation by MHC class I molecules. Due to extensive linkage disequilibrium existing within and surrounding the ERAP1 gene locus, it appears difficult to identify causal polymorphism(s) with certainty (19). A 2-mutations model has been proposed by Evans et al, with a primary effect due to rs30187 and a secondary effect due to either rs10050860 or rs17482078 (11). This model is fully consistent with studies showing a strongly significant association of a haplotype combining those 3 polymorphisms with AS in Canada and Portugal and with SpA in France and Belgium (6,9,20). However, the functional consequences of bearing this haplotype and their relevance to SpA susceptibility remain to be elucidated.

COSTANTINO ET AL

Several studies using recombinant ERAP-1 mutants and synthetic peptides showed decreased enzymatic activity of ERAP-1 in the presence of the AS-protective alleles rs30187 and rs17482078 (11,21–25). It has been suggested that the reduced activity observed with the rs30187 protective allele (K528R) was linked to modifications in the structure of ERAP-1 (21,26). Another hypothesis is that ERAP1 polymorphisms could affect gene expression level (19). In the present study, we investigated the influence of ERAP-1 genetic makeup on its quantitative expression, at both the messenger RNA (mRNA) and protein levels, as well as enzymatic activity in monocyte-derived dendritic cells (DCs), antigen-presenting cells relevant to the study of ERAP1 function and potentially involved in SpA pathogenesis (27–32). We also accounted for the marked linkage disequilibrium. We identified a close relationship between ERAP-1 quantitative expression and the ERAP-1 locus– associated genetic risk. PATIENTS AND METHODS Recruitment of patients and controls. All study participants provided written informed consent, and the study was approved by the local ethics committee of Ile de France XI, Poissy-St. Germain Hospital (St. Germain-en-Laye, France). All patients satisfied the Assessment of SpondyloArthritis international Society classification criteria for SpA (33,34). Detailed clinical characteristics of the enrolled patients are provided in Table 1. The control populations consisted of sex- and agematched independent healthy donors divided among the 2 cohorts (a discovery cohort and a replication cohort), as well as unaffected siblings of patients (included in the replication cohort only). Cell isolation and culture. Peripheral blood monocyte isolation. Peripheral blood mononuclear cells were isolated from 50 ml of freshly drawn blood by Ficoll densitygradient centrifugation (StemCell Technologies). Monocytes were obtained by magnetic cell sorting using anti-CD14 monoclonal antibody (mAb)–coated beads (BD Biosciences). Sorted monocytes were morphologically homogeneous, with 99% CD141 cells, as determined by flow cytometry (32). Monocyte-derived DC generation and stimulation. To obtain monocyte-derived DCs, monocytes were further cultured for 6 days in RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum, penicillin (100 units/ ml), streptomycin (100 mg/ml), recombinant human granulocyte– macrophage colony-stimulating factor (500 units/ml), and recombinant human IL-4 (500 units/ml) (AbCys). Then, the monocyte-derived DCs were assessed without stimulation or after stimulation with lipopolysaccharide (LPS) from Escherichia coli (Sigma-Aldrich) at a concentration of 100 ng/ml for the last 6 hours of culture or the last 24 hours of culture. Lymphoblastoid B cell line generation. Lymphoblastoid B cell lines were established from Epstein-Barr virus (EBV)– transformed lymphocytes according to standard protocol, and grown at 37 C in RPMI 1640 medium supplemented with 10%

INFLUENCE OF NONSYNONYMOUS POLYMORPHISMS ASSOCIATED WITH SpA ON ERAP1

heat-inactivated fetal bovine serum, penicillin (100 units/ml), and streptomycin (100 mg/ml). Genotyping of rs30187, rs17482078, and rs10050860. Genotypes of rs30187, rs17482078, and rs10050860 were determined through sequencing. Briefly, 3 amplicons (1 for each SNP) were amplified from 200 ng of genomic DNA. Approximately 10–30 ng of the purified product was sequenced on an ABI 3730xl capillary sequencer (Applied Biosystems), and the resulting sequences were analyzed using SeqScape software version 2.5 (Applied Biosystems). Linkage disequilibrium assessment. Genotype data were obtained through Immunochip custom array (Illumina) as part of the International Genetics of AS Consortium (IGAS) study (12). We used a subset of 126 SNPs selected based on the following criteria: located within 95.999–96.387 Mb (GRCh37) of the chromosome 5p telomere (spanning the CAST, ERAP1, ERAP2, and LNPEP gene region), a minor allele frequency of .0.2, and pairwise r2 . 0.8. Linkage disequilibrium for reconstructed haplotypes was determined using Haploview version 4.2 (35). ERAP-1 mRNA expression. Total RNA was isolated with an RNeasy Mini kit according to the instructions of the manufacturer. ERAP-1 mRNA expression levels were then evaluated by microarray hybridization. Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) of monocyte-derived DC samples was also performed in the discovery cohort for technical validation. Gene expression microarray. For microarray hybridization, RNA was reverse transcribed, converted to biotinylated complementary RNA using standard Affymetrix protocol, and hybridized to an Affymetrix GeneChip Human Gene 1.0 ST array. Raw data were then transformed by Robust Multichip Analysis (36). Table 1.

1527

Quantitative RT-PCR. For qRT-PCR, RNA was reverse transcribed using SuperScript II (Invitrogen). A 147-bp region common to all the known protein-coding ERAP1 transcripts was amplified with primers (forward TTTGAACTTGGCTCATCTTCC and reverse AATTGTCTGTTGGACACAACG) and then quantified using SYBR Green PCR Master Mix (Applied Biosystems) and a 7300 Real-Time PCR System (Applied Biosystems). Gene expression data were computed with the DDCq method, using 3 housekeeping genes: for RPL30, CCTAAGGCAGGAAGATGGTG (forward) and AATGACCAATTTCGCTTTGC (reverse); for ACTB, GGACTTCGAGCAAGAGATGG (forward) and AGGAAGGAAGGCTGGAAGAG (reverse); and for GAPDH, CCTCAACGACCACTTTGTCA (forward) and GAGGGTCTCTCTCTTCCTCTTGT (reverse). ERAP-1 protein expression (Western blot analysis). Cells were lysed on ice in lysis buffer. Cell lysates were centrifuged at 12,000 revolutions per minute for 15 minutes. Protein (28 mg as determined using a Pierce BCA protein assay kit) (Thermo Scientific), was suspended in 23 reducing Laemmli buffer and heated at 95 C for 5 minutes. Proteins were separated on a 7.5% sodium dodecyl sulfate polyacrylamide gel (Bio-Rad) and transferred to PVDF membrane. Blocking was performed at room temperature for 1 hour with 13 phosphate buffered saline (PBS) and 0.01% Tween 20 containing 5% dry milk, followed by incubation at room temperature with an anti–ERAP-1 mAb (Abcam) diluted at 1:2,000 for 2 hours and horseradish peroxidase–conjugated secondary antibody (goat anti-rabbit IgG; Dako) diluted at 1:10,000 for 1 hour. Immunostaining of the blot with an anti–b-actin mAb (Santa Cruz Biotechnology) served as a loading control. Labeled proteins were detected using an enhanced chemiluminescence reagent (Amersham Biosciences), and the signal was read with a Fusion FX7 system (Vilber

Clinical characteristics of the spondyloarthritis patients*

Characteristic† Age, mean 6 SD years Disease duration, mean 6 SD years Sex, men/women (% men) HLA–B27 positivity, % Axial manifestations, % Inflammatory back pain Radiographic sacroiliitis§ Peripheral manifestations, % Peripheral arthritis Peripheral enthesitis Extraarticular manifestations, % Uveitis Psoriasis Inflammatory bowel disease¶ Current treatment, % NSAID Anti-TNF therapy None

Discovery cohort (n 5 9)

Replication cohort (n 5 14)

Lymphoblastoid B cell line group (n 5 7)‡

AS Immunochip study (n 5 354)

48.1 6 7.9 15.1 6 5.2 5/4 (55.6) 100

47.1 6 7.6 22.4 6 7.3 8/6 (57.1) 100

48.1 6 16.2 21.2 6 15.0 4/3 (57.1) 100

48.1 6 14.2 24.5 6 13.2 219/135 (61.9) 91.2

100 89

100 64.3

100 100

100 100

22.2 66.7

42.9 85.7

66.7 50

45.3 73.7

33.3 33.3 0

28.6 7.1 0

66.7 0 0

41.1 26.0 8.6

55.6 22.2 22.2

75.0# 0# 25.0#

NA NA NA

NA NA NA

* AS 5 ankylosing spondylitis; NSAID 5 nonsteroidal antiinflammatory drug; NA 5 not available; anti-TNF 5 anti–tumor necrosis factor. † Present at the time of examination or ascertained from medical record. ‡ Clinical data available for 6 patients. § Greater than or equal to grade II bilateral radiographic sacroiliitis or grade III unilateral radiographic sacroiliitis. ¶ Crohn’s disease or ulcerative colitis. # Of 12 patients

1528

COSTANTINO ET AL

Lourmat). Band intensities were quantified by densitometry analysis using ImageJ software (National Institutes of Health). ERAP-1 enzymatic assay. ERAP-1 immunoprecipitation. Cell pellets (25 3 106 cells for lymphoblastoid B cell lines or 2 3 106 cells for monocyte-derived DCs) were lysed in lysis buffer (125 ml or 50 ml, respectively) and left on ice for 30 minutes. The lysate (supernatant) was recovered by centrifugation at 14,000 rpm for 10 minutes at 4 C. Before immunoprecipitation, the total protein content was quantified via Bradford assay. The lysate was then precleared by incubation for 1 hour with glycine Sepharose beads before incubation for at least 2 hours with ERAP-specific 4D2 mAb conjugated to Sepharose beads. The beads were then washed 3 times in buffer (50 mM Tris, 150 mM NaCl, pH 7.4) and resuspended in buffer (500 ml) before being used in an activity assay. ERAP-1 enzymatic activity measurement. The fluorogenic substrate leucine–7-amido-4-methyl-coumarin (leucine– AMC) (50 ml of leucine–AMC at 100 mM in 50 mM Tris, pH 7.4, 150 mM NaCl) was incubated with immunoprecipitated ERAP-1 (50 ml) at 25 C, and the fluorescence signal was measured for 15 minutes on a Mithras LB 940 plate reader (Berthold Technologies) with excitation set at 355 nm and emission at 460 nm. The hydrolysis rate of the substrate was calculated via the resulting time slope. MHC class I and HLA–B27 surface expression. For assessment of MHC class I and HLA–B27 cell surface expression, monocyte-derived DCs were incubated with fluorescein isothiocyanate–labeled anti–HLA class I or anti–HLA–B27 IgG mAb (BD Biosciences) for 20 minutes at 4 C. Then, cells were washed with 13 PBS and fixed with 2% formaldehyde. The analyses were performed by flow cytometry on a FACSCanto II apparatus (BD Biosciences). Statistical analysis. The association between haplotype score and SpA susceptibility was assessed using logistic regression analysis. Multivariate analysis of variance was used to examine the association between ERAP1 gene expression in monocytederived DC samples and ERAP1 genotypes/haplotypes, disease status, and HLA–B27 positivity without stimulation and after stimulation for the last 6 hours of culture or the last 24 hours of culture. P values less than 0.05 were considered significant. When statistical significance was found, post hoc one-way analysis of variance was performed at each stimulation time point. The correlation between ERAP1 expression levels in sibling pairs was tested using a linear model with mixed effects, followed by a likelihood ratio test comparing the full model and the null model to assess the significance of the correlation. Nonparametric Spearman’s test was used to test the correlation between haplotype risk score and ERAP-1 transcript or protein levels in lymphoblastoid B cell lines.

RESULTS Association between rs30187 genotype and ERAP1 gene expression. The primary signal of association of ERAP1 with AS susceptibility is assumed to be borne by rs30187 (11). Thus, we first studied the influence of this SNP on ERAP1 gene expression in two independent case–control cohorts. The discovery cohort included 9 HLA–B27–positive patients with axial SpA (8 of whom had AS) and 10 unrelated healthy donor

controls (32). The replication cohort consisted of 14 HLA–B27–positive SpA patients (9 of whom had AS) and 34 healthy controls (13 HLA–B27–positive siblings of patients and 21 additional independent controls [10 of whom were HLA–B27 positive and 11 of whom were HLA–B27 negative]). In the discovery cohort, rs30187 genotypes were significantly associated with ERAP1 expression in monocyte-derived DCs at each stimulation time point, as determined by microarray analysis, with an additive effect (combined P 5 9.0 3 1024). Indeed, expression levels increased as the number of AS susceptibility T alleles increased (Figure 1A). This result was confirmed by qRT-PCR of the same samples (combined P 5 2.0 3 1024) (Figure 1C) and further reproduced in the replication cohort (Figure 1B), where this association was observed in both circulating monocytes (P 5 0.001) and monocyte-derived DCs (combined P 5 7.4 3 10210). The association was independent of disease or HLA–B27 status (data not shown). No such association between rs30187 genotypes and either ERAP2 or LNPEP expression levels was observed in the discovery cohort (P 5 0.54 and P 5 0.24, respectively). Moreover, we did not find any association between the 2 other SpA-associated ERAP1 polymorphisms studied (i.e., rs17482078 or rs10050860) and ERAP1 transcript levels (P 5 0.28 for both SNPs, which were in perfect linkage disequilibrium with each other). Extended linkage disequilibrium around the ERAP1 locus. The major protective nonancestral allele of rs30187 results in the substitution of a lysine for an arginine (K528R). As regulatory variants are rarely located in coding regions, rs30187 may be in linkage disequilibrium with one or several other variants located in regulatory elements. To assess the extent of the linkage disequilibrium, we used genotype data from a French collection of 354 AS patients and 346 healthy controls included in the IGAS Immunochip study (12). We extracted a set of 126 tag SNPs covering the region surrounding ERAP1, from CAST to LNPEP. High linkage disequilibrium was observed throughout this region with 2 major blocks, one including ERAP1 and the other including ERAP2 and LNPEP (Figure 2A). Consequently, numerous variants could be responsible for variations in ERAP1 gene expression. Results of ERAP1 genetic studies have suggested that there is a secondary association signal associated with AS, due either to rs10050860 or to rs17482078. The combination of these 3 SNPs resulted in 3 major rs17482078/ rs10050860/rs30187 haplotypes: T/T/C (20.1%), C/C/C (40.1%), and C/C/T (39.0%) (Figure 2B). Thus, studying


1529

Figure 2. A, Haploview linkage disequilibrium plot showing the region surrounding ERAP1. Triangle in black shows the rs17482078/ rs10050860/rs30187 haplotype. B, Higher-magnification view of the area outlined in A. Numbers inside the diamonds represent |D0 |. The shading of the boxes corresponds to the strength of the linkage disequilibrium, with the darkest red indicating the strongest linkage disequilibrium.

Figure 1. Correlation of ERAP1 gene expression with the rs30187 genotype in monocyte-derived dendritic cells (MDDCs) and circulating monocytes (Mo). Endoplasmic reticulum aminopeptidase 1 mRNA levels were evaluated by microarray in the discovery cohort (A) and the replication cohort (B) and by quantitative real-time polymerase chain reaction in the discovery cohort (C). The x-axis indicates the rs30187 genotype (C/C, C/T, or T/T) of individuals without stimulation of monocyte-derived DCs or monocytes (H0) or after stimulation with lipopolysaccharide for the last 6 hours of culture (H6) or the last 24 hours of culture (H24). The y-axis shows the log2 ERAP1 fluorescence intensity as a measure of gene expression in A and B, and the DDCq in C. Circles represent individual samples; horizontal lines show the mean. * 5 P , 0.05; ** 5 P , 0.01; *** 5 P , 0.001.

rs17482078/rs10050860/rs30187 haplotypes rather than rs30187 alone could improve the detection of gene expression variation depending on genetic sequence.

Association between rs17482078/rs10050860/rs30187 haplotypes and ERAP1 gene expression. We have previously reported that rs17482078/rs10050860/rs30187 haplotypes were not equally distributed between SpA patients and controls: the C/C/T haplotype was more frequent in patients and the T/T/C haplotype was overrepresented in controls, whereas C/C/C was evenly distributed (9). Accordingly, we attributed a score to each haplotype corresponding to its level of association with SpA (a score of 21 was assigned to the protective haplotype T/T/C, a score of 0 was assigned to the neutral haplotype C/C/C, and a score of 1 was assigned to the susceptibility haplotype C/C/T). We thus determined a score for each of the 700 French subjects included in the IGAS Immunochip study (12), corresponding to the sum of a subject’s 2 haplotype scores. We found a significant association between the score and SpA susceptibility, allowing us to consider this method of scoring indicative of a risk score (odds ratio 1.27 [95% confidence interval 1.1–1.48], P 5 0.002) (data available upon request from the corresponding author).

1530

COSTANTINO ET AL

at the transcription and protein levels, we studied 7 HLA–B27–positive patients who were homozygous for 1 of the 3 haplotypes: 3 carrying the C/C/T susceptibility haplotype, 3 carrying the C/C/C neutral haplotype, and 1 carrying the T/T/C protective haplotype. Lymphoblastoid B cell lines from those patients were immortalized with EBV. One additional HLA–B27–positive healthy control who was homozygous for the T/T/C haplotype was included in the enzymatic activity assay. In those cell lines, we observed a significant correlation between the rs17482078/rs10050860/rs30187 haplotype risk score and ERAP1 transcript levels (P 5 0.003, r 5 0.92) (Figure 5A), as in the abovedescribed studies on monocytes and monocyte-derived DCs. A similar correlation was also observed between

Figure 3. ERAP1 gene expression assessed by microarray analysis, according to haplotype risk score in the discovery cohort (A) and the replication cohort (B). The x-axis indicates the haplotype risk score (from 21 to 2) without stimulation of monocyte-derived dendritic cells (MDDCs) or monocytes (Mo) (H0) or after stimulation with lipopolysaccharide for the last 6 hours of culture (H6) or the last 24 hours of culture (H24). The y-axis shows the log2 ERAP1 fluorescence intensity as a measure of gene expression. Circles represent individual samples; horizontal lines show the mean. * 5 P , 0.05; ** 5 P , 0.01; *** 5 P , 0.001.

In both cohorts, we observed a highly significant positive correlation between the haplotype risk score and ERAP1 expression level (Figures 3A and B). This result was consistently observed in monocyte-derived DCs whether they were stimulated or not (combined P 5 0.001 and combined P 5 5.6 3 1027 in the discovery and replication cohorts, respectively) and monocytes (P 5 9.9 3 1026 in the replication cohort) (Figure 3B); no detectable influence of disease or HLA–B27 status was observed. Transcript abundances are known to be largely heritable (37). In the 13 sibling-pairs included in the replication cohort, we observed a significant correlation of ERAP1 expression between siblings (P 5 1.2 3 1024). Interestingly, in the 6 sibling pairs haploidentical for rs17482078/rs10050860/rs30187 haplotypes, the correlation was dramatically high (P 5 4 3 1027, r2 5 0.84) (Figure 4A), whereas it was of borderline significance in the 7 sibling pairs carrying divergent haplotypes (P 5 0.05, r2 5 0.11) (Figure 4B). Association between the ERAP1 rs17482078/ rs10050860/rs30187 haplotype, mRNA level, protein level, and enzymatic activity in EBV cell lines. To further investigate the functional role of ERAP1 haplotypes

Figure 4. Correlation of ERAP1 expression levels between patients with spondyloarthritis and their unaffected siblings, in haploidentical (A) and haplodivergent (B) sibling pairs. The log2 ERAP1 fluorescence intensity as a measure of gene expression (assessed by microarray analysis) was determined in monocyte-derived dendritic cells (MDDCs) and monocytes (Mo) without stimulation (H0) or after stimulation with lipopolysaccharide for the last 6 hours of culture (H6) or the last 24 hours of culture (H24).


1531

Figure 5. Correlation between ERAP1 haplotype risk score and gene expression, protein expression, and enzymatic activity in lymphoblastoid B cell lines and monocyte-derived dendritic cells (DCs). The x-axis indicates the haplotype risk score. The y-axis shows ERAP1 gene expression assessed by DDCq in lymphoblastoid B cell lines (A) and monocyte-derived DCs (B), endoplasmic reticulum aminopeptidase 1 (ERAP-1) protein level (assessed by Western blot) as the intensity ratio of ERAP-1 to b-actin in lymphoblastoid B cell lines (C) and monocyte-derived DCs (D), and ERAP-1 enzymatic activity assessed via leucine–7-amido-4-methyl-coumarin hydrolysis in lymphoblastoid B cell lines (E) and monocytederived DCs (F). Each symbol represents a lymphoblastoid B cell line sample (A, C, and D) or a monocyte-derived DC sample (B, D, and F) from a single patient. Each individual patient is represented by the same symbol in B, D, and F.

haplotype risk score and ERAP-1 protein level (P 5 0.003, r 5 0.92) (Figure 5C). Although there was no significant correlation between haplotype risk score and ERAP-1 enzymatic activity, the low-risk haplotype cell lines had lower activity than other lymphoblastoid B cell lines (Figure 5E). We observed a similar trend in unstimulated monocyte-derived DC samples generated from 8 patients in the discovery and replication cohorts, from whom blood was drawn again for this purpose (Figures 5B, D, and F). Consequences of ERAP1 expression on MHC class I surface expression. To investigate putative consequences of ERAP1 expression changes on antigen presentation, we measured MHC class I and HLA–B27 expression at the surface of the monocyte-derived DCs. No

correlation was observed between ERAP1 expression level and either whole MHC class I or HLA–B27 expression, whatever the stimulation time point (data not shown). DISCUSSION Genetic association studies have highlighted the importance of ERAP1 in SpA susceptibility. However, few mechanisms have been hypothesized to explain the consequences of SpA-associated ERAP1 polymorphisms. Herein we provide, for the first time, strong evidence that ERAP1 expression is increased at the mRNA level in subjects with SpA susceptibility polymorphisms. Except for several recent studies (24,25,38), all others have investigated the functional consequences of

1532

individual SpA-associated SNPs in the ERAP1 gene (11,21–23,39). Using a large case–control cohort from the Immunochip study, we identified strong linkage disequilibrium in the ERAP1 region, as previously described (19). Moreover, Evans et al have suggested that the pattern of association with AS was not fully captured by studying a single SNP (11), as confirmed by other studies demonstrating an association between ERAP1 haplotypes and SpA (6,7,9). In particular, our group has identified 3 distinct rs17482078/rs10050860/rs30187 haplotypes that were differentially associated with SpA: the T/T/C haplotype was associated with a low risk of disease, C/C/C with a neutral risk, and C/C/T with an increased risk (9). Thus, we decided to study haplotype effects to better understand the consequences of polymorphism on disease susceptibility. Results obtained after analysis of peripheral blood monocytes and monocyte-derived DCs demonstrated the presence of a cis-expression quantitative trait locus controlling ERAP1 expression associated with the rs17482078/rs10050860/rs30187 haplotype. Similarly to the SpA genetic association, most of the ERAP1 expression association signal seemed to be borne by rs30187, as we found no correlation between levels of mRNA for ERAP-1 and the 2 other polymorphisms examined, rs10050860 and rs17482078. However, our results also suggested that rs17482078/rs10050860/rs30187 haplotypes more accurately captured ERAP-1 mRNA level variations than isolated SNPs, a finding that is consistent with the results of previous genetic studies discussed above (9,11) and with the high correlation we found between haplotype risk score and ERAP-1 expression. Interestingly, haplotype risk score was also found to be associated with disease predisposition, linking together haplotype, gene expression, and SpA susceptibility. Such mRNA-expression control has already been suggested for several ERAP1 SNPs in cell lines (40) and in skin biopsy samples (41), but never in primary monocytes or monocyte-derived DCs. Recently, Seregin et al obtained different results, finding no difference in ERAP1 gene expression between the T/T/C and C/C/T rs17482078/rs10050860/rs30187 haplotypes (25). However, those results were obtained in transfected cell lines overexpressing ERAP1 and thus may not reflect physiologic conditions. Our results were also quite different from those of Fairfax and al in their study of primary monocytes (42). Indeed, they identified rs30187 as a SNP associated with ERAP2 expression, whereas in our study we observed no such association. Due to the high linkage disequilibrium observed throughout the ERAP1 region, it is very difficult to identify with certainty the polymorphism(s) responsible for

COSTANTINO ET AL

gene expression variations. The fact that rs17482078/ rs10050860/rs30187 seemed to better correlate with ERAP-1 mRNA expression than did rs30187 alone suggested a haplotype effect on gene expression regulation. Such an effect has recently been demonstrated in a study investigating cis-expression quantitative trait loci in monocytes, where the expression of a substantial proportion of genes was associated with several SNPs exerting interactive effects (43). Furthermore, we found that ERAP1 haplotypes affected protein abundance and enzymatic activity. Thus, ERAP1 can also be considered a protein quantitative trait locus under the cis-regulatory control of the rs17482078/rs10050860/rs30187 haplotype. Increased expression of ERAP-1 in AS patients (as compared to controls) has been previously reported (44). This observation could presumably be related to an imbalanced distribution of ERAP1 haplotypes between cases and controls in that study, since we did not find any correlation between disease status and ERAP1 expression, independently of ERAP1 genotypes. Interestingly, ERAP1 gene expression seemed to be well correlated with SpA predisposition. Indeed, expression was low in low-risk haplotype carriers and high in high-risk haplotype carriers. Several hypotheses explain why ERAP1 overexpression might increase SpA susceptibility. First, our results suggested that increased expression of the ERAP1 transcript may lead to increased enzymatic activity. This increased enzymatic activity has potential consequences on the HLA–B27 peptidome, as discussed below. Second, Goto et al have highlighted another function of ERAP-1 outside the endoplasmic reticulum. They showed in a murine model that ERAP-1 was secreted from macrophages in response to activation initiated by treatment with LPS and interferon-g, resulting in heightened phagocytic activity of macrophages (45). The ERAP1 association with AS is restricted to HLA–B27–positive patients, suggesting a functional interaction between SpA-associated polymorphisms of ERAP1 and HLA–B27. At variance with results of other studies, we did not find any correlation, either positive or negative, between HLA class I or HLA–B27 cell surface expression and ERAP1 expression levels (46). However, SpA-associated SNPs may bear “qualitative” consequences rather than quantitative ones and may affect the HLA–B27 peptidome. Consistent with this hypothesis, several studies have demonstrated that ERAP1 polymorphisms could affect the HLA–B27 peptidome through their influence on ERAP-1 enzymatic activity (25,38,47,48). Higher enzymatic activity leads to an increased destruction of some


HLA–B27–restricted epitopes, whereas other epitopes are preferentially generated (38,48). Peptidome modifications may in turn bear consequences relevant for SpA susceptibility, such as skewing an HLA–B27– restricted immune response toward a particular antigen (49) or influencing HLA–B27 folding and stability with potential consequences on misfolding or on cell surface expression of heavy-chain homodimers (50). In conclusion, our results demonstrate a strong correlation between SpA susceptibility conferred by the rs17482078/rs10050860/rs30187 haplotypes and ERAP1 expression levels. Increased gene expression observed in high-risk haplotype carriers was correlated with increased protein expression. Enzymatic activity seemed to also be at least partly influenced by gene expression, together with other putative mechanisms such as structural modifications. Nevertheless, the consequences of ERAP-1 enzymatic activity variations on disease susceptibility remain to be fully elucidated.

10.

AUTHOR CONTRIBUTIONS

14.

All authors were involved in drafting the article or revising it critically for important intellectual content, and all authors approved the final version to be published. Dr. Breban had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. Study conception and design. Costantino, Talpin, Evnouchidou, Kadi, Leboime, Said-Nahal, Ka, Garchon, Chiocchia, Breban. Acquisition of data. Costantino, Talpin, Evnouchidou, Kadi, Leboime, Said-Nahal, Bonilla, Letourneur, Leturcq, Ka. Analysis and interpretation of data. Costantino, Talpin, Evnouchidou, Kadi, Leturcq, Ka, van Endert, Garchon, Chiocchia, Breban.

REFERENCES 1. Costantino F, Talpin A, Said-Nahal R, Goldberg M, Henny J, Chiocchia G, et al. Prevalence of spondyloarthritis in reference to HLA-B27 in the French population: results of the GAZEL cohort. Ann Rheum Dis 2015;74:689–93. 2. Said-Nahal R, Miceli-Richard C, Berthelot JM, Duche A, Dernis-Labous E, Le Blevec G, et al, on behalf of Groupe Franc ¸ais d’Etude G enetique des Spondylarthropathies. The familial form of spondylarthropathy: a clinical study of 115 multiplex families [published erratum appears in Arthritis Rheum 2000; 43:2140]. Arthritis Rheum 2000;43:1356–65. 3. Said-Nahal R, Miceli-Richard C, D’Agostino MA, DernisLabous E, Berthelot JM, Duche A, et al, on behalf of Groupe Franc ¸ais d’Etude Gen etique des Spondylarthropathies. Phenotypic diversity is not determined by independent genetic factors in familial spondylarthropathy. Arthritis Rheum 2001;45:478–84. 4. Breban M, Miceli-Richard C, Zinovieva E, Monnet D, SaidNahal R. The genetics of spondyloarthropathies. Joint Bone Spine 2006;73:355–62. 5. Burton PR, Clayton DG, Cardon LR, Craddock N, Deloukas P, Duncanson A, et al. Association scan of 14,500 nonsynonymous SNPs in four diseases identifies autoimmunity variants. Nat Genet 2007;39:1329–37. 6. Maksymowych WP, Inman RD, Gladman DD, Reeve JP, Pope A, Rahman P. Association of a specific ERAP1/ARTS1 haplo-

7. 8. 9.

11.

12.

13.

15.

16. 17.

18.

19. 20.

21.

22.

23.

1533

type with disease susceptibility in ankylosing spondylitis. Arthritis Rheum 2009;60:1317–23. Tsui FW, Haroon N, Reveille JD, Rahman P, Chiu B, Tsui HW, et al. Association of an ERAP1 ERAP2 haplotype with familial ankylosing spondylitis. Ann Rheum Dis 2010;69:733–6. Davidson SI, Wu X, Liu Y, Wei M, Danoy PA, Thomas G, et al. Association of ERAP1, but not IL23R, with ankylosing spondylitis in a Han Chinese population. Arthritis Rheum 2009;60:3263–8. Kadi A, Izac B, Said-Nahal R, Leboime A, van Praet L, de Vlam K, et al. Investigating the genetic association between ERAP1 and spondyloarthritis. Ann Rheum Dis 2013;72:608– 13. Cherciu M, Popa LO, Bojinca M, Dutescu MI, Bojinca V, Bara C, et al. Functional variants of ERAP1 gene are associated with HLAB27 positive spondyloarthritis. Tissue Antigens 2013;82:192–6. Evans DM, Spencer CC, Pointon JJ, Su Z, Harvey D, Kochan G, et al. Interaction between ERAP1 and HLA-B27 in ankylosing spondylitis implicates peptide handling in the mechanism for HLA-B27 in disease susceptibility. Nat Genet 2011;43:761–7. International Genetics of Ankylosing Spondylitis Consortium (IGAS), Cortes A, Hadler J, Pointon JP, Robinson PC, Karaderi T, et al. Identification of multiple risk variants for ankylosing spondylitis through high-density genotyping of immune-related loci. Nat Genet 2013;45:730–8. Saric T, Chang SC, Hattori A, York IA, Markant S, Rock KL, et al. An IFN-g-induced aminopeptidase in the ER, ERAP1, trims precursors to MHC class I-presented peptides. Nat Immunol 2002;3: 1169–76. York IA, Chang SC, Saric T, Keys JA, Favreau JM, Goldberg AL, et al. The ER aminopeptidase ERAP1 enhances or limits antigen presentation by trimming epitopes to 8-9 residues. Nat Immunol 2002;3:1177–84. Cui X, Hawari F, Alsaaty S, Lawrence M, Combs CA, Geng W, et al. Identification of ARTS-1 as a novel TNFR1-binding protein that promotes TNFR1 ectodomain shedding. J Clin Invest 2002;110:515–26. Cui X, Rouhani FN, Hawari F, Levine SJ. An aminopeptidase, ARTS-1, is required for interleukin-6 receptor shedding. J Biol Chem 2003;278:28677–85. Cui X, Rouhani FN, Hawari F, Levine SJ. Shedding of the type II IL-1 decoy receptor requires a multifunctional aminopeptidase, aminopeptidase regulator of TNF receptor type 1 shedding. J Immunol 2003;171:6814–9. Haroon N, Tsui FW, Chiu B, Tsui HW, Inman RD. Serum cytokine receptors in ankylosing spondylitis: relationship to inflammatory markers and endoplasmic reticulum aminopeptidase polymorphisms. J Rheumatol 2010;37:1907–10. Harvey D, Pointon JJ, Evans DM, Karaderi T, Farrar C, Appleton LH, et al. Investigating the genetic association between ERAP1 and ankylosing spondylitis. Hum Mol Genet 2009;18:4204–12. Bettencourt BF, Rocha FL, Alves H, Amorim R, Caetano-Lopes J, Vieira-Sousa E, et al. Protective effect of an ERAP1 haplotype in ankylosing spondylitis: investigating non-MHC genes in HLA-B27-positive individuals. Rheumatology (Oxford) 2013;52: 2168–76. Kochan G, Krojer T, Harvey D, Fischer R, Chen L, Vollmar M, et al. Crystal structures of the endoplasmic reticulum aminopeptidase-1 (ERAP1) reveal the molecular basis for Nterminal peptide trimming. Proc Natl Acad Sci U S A 2011;108: 7745–50. Goto Y, Hattori A, Ishii Y, Tsujimoto M. Reduced activity of the hypertension-associated Lys528Arg mutant of human adipocyte-derived leucine aminopeptidase (A-LAP)/ER-aminopeptidase-1. FEBS Lett 2006;580:1833–8. Evnouchidou I, Kamal RP, Seregin SS, Goto Y, Tsujimoto M, Hattori A, et al. Coding single nucleotide polymorphisms of endoplasmic reticulum aminopeptidase 1 can affect antigenic peptide generation in vitro by influencing basic enzymatic properties of the enzyme. J Immunol 2011;186:1909–13.

1534

24. Reeves E, Edwards CJ, Elliott T, James E. Naturally occurring ERAP1 haplotypes encode functionally distinct alleles with fine substrate specificity. J Immunol 2013;191:35–43. 25. Seregin SS, Rastall DP, Evnouchidou I, Aylsworth CF, Quiroga D, Kamal RP, et al. Endoplasmic reticulum aminopeptidase-1 alleles associated with increased risk of ankylosing spondylitis reduce HLA-B27 mediated presentation of multiple antigens. Autoimmunity 2013;46:497–508. 26. Nguyen TT, Chang SC, Evnouchidou I, York IA, Zikos C, Rock KL, et al. Structural basis for antigenic peptide precursor processing by the endoplasmic reticulum aminopeptidase ERAP1. Nat Struct Mol Biol 2011;18:604–13. 27. Hacquard-Bouder C, Falgarone G, Bosquet A, Smaoui F, Monnet D, Ittah M, et al. Defective costimulatory function is a striking feature of antigen-presenting cells in an HLA–B27–transgenic rat model of spondylarthropathy. Arthritis Rheum 2004;50:1624–35. 28. Hacquard-Bouder C, Chimenti MS, Giquel B, Donnadieu E, Fert I, Schmitt A, et al. Alteration of antigen-independent immunologic synapse formation between dendritic cells from HLA–B27–transgenic rats and CD41 T cells: selective impairment of costimulatory molecule engagement by mature HLA– B27. Arthritis Rheum 2007;56:1478–89. 29. Glatigny S, Fert I, Blaton MA, Lories RJ, Araujo LM, Chiocchia G, et al. Proinflammatory Th17 cells are expanded and induced by dendritic cells in spondylarthritis-prone HLA– B27–transgenic rats. Arthritis Rheum 2012;64:110–20. 30. Utriainen L, Firmin D, Wright P, Cerovic V, Breban M, McInnes I, et al. Expression of HLA–B27 causes loss of migratory dendritic cells in a rat model of spondylarthritis. Arthritis Rheum 2012;64:3199–209. 31. Araujo LM, Fert I, Jouhault Q, Labroquere K, Andrieu M, Chiocchia G, et al. Increased production of interleukin-17 over interleukin-10 by Treg cells implicates inducible costimulator molecule in experimental spondyloarthritis. Arthritis Rheumatol 2014;66:2412–22. 32. Talpin A, Costantino F, Bonilla N, Leboime A, Letourneur F, Jacques S, et al. Monocyte-derived dendritic cells from HLAB271 axial spondyloarthritis (SpA) patients display altered functional capacity and deregulated gene expression. Arthritis Res Ther 2014;16:417. 33. Rudwaleit M, van der Heijde D, Landewe R, Listing J, Akkoc N, Brandt J, et al. The development of Assessment of SpondyloArthritis international Society classification criteria for axial spondyloarthritis (part II): validation and final selection. Ann Rheum Dis 2009;68:777–83. 34. Rudwaleit M, van der Heijde D, Landewe R, Akkoc N, Brandt J, Chou CT, et al. The Assessment of SpondyloArthritis International Society classification criteria for peripheral spondyloarthritis and for spondyloarthritis in general. Ann Rheum Dis 2011;70: 25–31. 35. Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 2005;21: 263–5. 36. Gautier L, Cope L, Bolstad BM, Irizarry RA. affy–analysis of Affymetrix GeneChip data at the probe level. Bioinformatics 2004;20:307–15.

COSTANTINO ET AL

37. Monks SA, Leonardson A, Zhu H, Cundiff P, Pietrusiak P, Edwards S, et al. Genetic inheritance of gene expression in human cell lines. Am J Hum Genet 2004;75:1094–105. 38. Martin-Esteban A, Gomez-Molina P, Sanz-Bravo A, Lopez de Castro JA. Combined effects of ankylosing spondylitis-associated ERAP1 polymorphisms outside the catalytic and peptide-binding sites on the processing of natural HLA-B27 ligands. J Biol Chem 2014;289:3978–90. 39. Haroon N, Tsui FW, Uchanska-Ziegler B, Ziegler A, Inman RD. Endoplasmic reticulum aminopeptidase 1 (ERAP1) exhibits functionally significant interaction with HLA-B27 and relates to subtype specificity in ankylosing spondylitis. Ann Rheum Dis 2012;71:589–95. 40. Dixon AL, Liang L, Moffatt MF, Chen W, Heath S, Wong KC, et al. A genome-wide association study of global gene expression. Nat Genet 2007;39:1202–7. 41. Ding J, Gudjonsson JE, Liang L, Stuart PE, Li Y, Chen W, et al. Gene expression in skin and lymphoblastoid cells: refined statistical method reveals extensive overlap in cis-eQTL signals. Am J Hum Genet 2010;87:779–89. 42. Fairfax BP, Makino S, Radhakrishnan J, Plant K, Leslie S, Dilthey A, et al. Genetics of gene expression in primary immune cells identifies cell type-specific master regulators and roles of HLA alleles. Nat Genet 2012;44:502–10. 43. Garnier S, Truong V, Brocheton J, Zeller T, Rovital M, Wild PS, et al. Genome-wide haplotype analysis of cis expression quantitative trait loci in monocytes. PLoS Genet 2013;9:e1003240. 44. Campbell EC, Fettke F, Bhat S, Morley KD, Powis SJ. Expression of MHC class I dimers and ERAP1 in an ankylosing spondylitis patient cohort. Immunology 2011;133:379–85. 45. Goto Y, Ogawa K, Hattori A, Tsujimoto M. Secretion of endoplasmic reticulum aminopeptidase 1 is involved in the activation of macrophages induced by lipopolysaccharide and interferon-g. J Biol Chem 2011;286:21906–14. 46. Fruci D, Ferracuti S, Limongi MZ, Cunsolo V, Giorda E, Fraioli R, et al. Expression of endoplasmic reticulum aminopeptidases in EBV-B cell lines from healthy donors and in leukemia/ lymphoma, carcinoma, and melanoma cell lines. J Immunol 2006;176:4869–79. 47. Garcia-Medel N, Sanz-Bravo A, van Nguyen D, Galocha B, Gomez-Molina P, Martin-Esteban A, et al. Functional interaction of the ankylosing spondylitis-associated endoplasmic reticulum aminopeptidase 1 polymorphism and HLA-B27 in vivo. Mol Cell Proteomics 2012;11:1416–29. 48. Garcia-Medel N, Sanz-Bravo A, Alvarez-Navarro C, GomezMolina P, Barnea E, Marcilla M, et al. Peptide handling by HLA-B27 subtypes influences their biological behavior, association with ankylosing spondylitis and susceptibility to endoplasmic reticulum aminopeptidase 1 (ERAP1). Mol Cell Proteomics 2014;13:3367–80. 49. Akram A, Lin A, Gracey E, Streutker CJ, Inman RD. HLAB27, but not HLA-B7, immunodominance to influenza is ERAP dependent. J Immunol 2014;192:5520–8. 50. Marcilla M, Lopez de Castro JA. Peptides: the cornerstone of HLA-B27 biology and pathogenetic role in spondyloarthritis. Tissue Antigens 2008;71:495–506.