ES cell transdifferentiation to TS-like cells

Comparative analysis of ES cell transdifferentiation to TS-like cells

Francesco Cambuli Homerton College The Babraham Institute University of Cambridge

This dissertation is submitted for the degree of Doctor of Philosophy September 2013

ii

Declaration of Originality This dissertation is the result of my own work and includes nothing which is the outcome of work done in collaboration except where specifically indicated in the text. Statement of Length This dissertation does not exceed the limit of 60 000 words as prescribed by the Biology Degree Committee.

iv

To the people of Babraham, who shared five years of life with me, five years full of life.

“Le seul véritable voyage, . . . , ce ne serait pas d’aller vers de noveaux paysages, mais d’avoir d’autres yeux . . . ” “The true voyage of discovery, . . . , consists not in seeking new lands, but in having new eyes . . . ” (a quote from Marcel Proust, read a long time ago, before my research journey begun, on the European Research Mobility website)

vi

Acknowledgments The research work described in this dissertation has been carried out under the supervision of Dr Myriam Hemberger. I would like to express to her my profound gratitude. I thank Dr Claire Senner, who has been my mentor during my PhD training, and Dr Anne Corcoran, who has independently assessed my progresses. The members of the Hemberger’s research group – Dr Paulina Latos, Steven Roper, Alex Murray and Dominika Dudzinska – for sharing the daily laboratory life and for their help. Also Maya Mistri, Stefano Gnan and Eleonora Zucchelli, who visited our laboratory. Dr Simon Cook and its entire research group for their precious collaboration. Dr Peter Rugg-Gunn for insightful discussions and practical training. Dr Michael Wakelam – director of the Babraham Institute – and Dr Wolf Reik – director of the Epigenetics Programme – as well as all members of our department – and in particular Dr Wendy Dean and Dr Fatima Santos – for creating a stimulating research environment, rich of ideas, open to internal and external collaborations and equipped with state-of-art research facilities. The people of the Flow Cytometry & FACS (Geoff Morgan, Arthur Davis and Rachel Walker), Epigenomics (Kristina Tabbada and Michelle King), Bioinformatics (Simon Andrews and Felix Krueger) and Imaging (Simon Walker) facilities for their dedicated training and technical support. Emilia Dimitrova and Natasha Carli for discussions and reagents. Dr Penny Barton of the Homerton College for tutoring. The Babraham Institute, the Cambridge European Trust and the Center for Trophoblast Research have generously funded my PhD scholarship.

vii

viii

Contributions provided by other researchers to this dissertation

Name

Rolea

Contribution

Myriam Hemberger

S

General supervision; dissertation revisionb

Claire Senner

M

General mentoring; MeDIP-Seq datasetsc

Anne Corcoran

A

Critical assessment of this research project

Simon Cook

C

Discussion and WB equipment/reagents

Peter Rugg-Gunn

C

Discussion and flow cytometry training

Rebecca Gilley

C

WB training

Kathy Balmanno

C

control WB samples; WB training

Geoff Morgan

C

Flow cytometry training and FACS

Arthur Davis

C


Rachel Walker

C


Michelle King

C

Sequenom MassArray analysis

Kristina Tabbada

C

DNA high-throughput sequencing

Felix Krueger

C

MeDIP-Seq data pre-processing and training

Simon Andrews

C

Bioinformatics training

Alex Murray

C

Gene expression microarray data analysis

Simon Walker

C

BD Pathway microscope analysis and training

Paulina Latos

C

TC training

Wendy Dean

C

Microscopy training

Fatima Santos

C

Microscopy training

Emilia Dimitrova

C

Discussion and TC reagents

Natasha Carli

C

DNA bisulphite-sequencing training

S=supervisor; M=mentor; A=assessor; C=collaborator. Additionally, M.H. directly contributed to some of the research work described here, in particular for molecular cloning, derivation of genetically modified ES cell lines and immunofluorescence experiments. c MeDIP-Seq datasets for J1 ES, E14 ES, EGFP TS and Rs26 TS were published [Senner et al., 2012]. WB=Western blot; FACS=Fluorescence activated cell sorting; MeDIP-Seq= Methylated-DNA immuno-precipitation coupled with high-throughput sequencing; TC=Tissue culture

a

b

ix

x

Comparative analysis of ES cell transdifferentiation to TS-like cells Francesco Cambuli

During mouse embryogenesis, the first differentiation events specify three cell lineages – Trophectoderm (TE), Epiblast (Epi) and Primitive Endoderm (PrE) – with distinct developmental potentials – mainly contributing to the formation of the embryo proper, the placenta and the yolk sac, respectively. Stem cells can be derived from the Epi (ES cells), the TE (TS cells) and the PrE (XEN cells), retaining the cell fate restriction of their lineage of origin. The characterization of events of ES cell transdifferentiation to TS-like cells has become an informative in vitro model to study the molecular mechanisms able to enforce or override cell fate restriction. Using this approach, DNA methylation (5mC) was proved to limit ES cell developmental potential and forced regulation of the transcription factors Oct4 or Cdx2 was shown to override this restriction. Recently, Ras/Erk signalling was proposed to be capable of resetting cell fate stability mechanisms, leading to the irreversible conversion of ES into TS-like cells. However, it is unclear to what extent ES cell-derived TS-like cells resemble genuine TE lineage-derived TS cells. In particular, scarce information is available on the epigenetic status of these presumptive TS-like cells. Here, a comparative analysis of ES cell transdifferentiation to TS-like cells was performed, evaluating two established systems (conditional Oct4 knockout or Cdx2 knockin) and two newly derived ones (iRAS or iRAF) with inducible Erk signalling, versus TE lineage-derived TS cells. The data revealed that transdifferentiation occurs unidirectionally towards TS-like cells; yet, this process remains incomplete, being stalled at more advanced stages in cells relying on controlled Oct4/Cdx2 expression than in those dependent on inducible Erk activity. Combined activation of Cdx2/Erk does not significantly enhance transdifferentiation, demonstrating that – in this context – Erk activity is primarily mediated by Cdx2. Underlying these events, a group of gene promoters, differentially methylated in genuine ES vs TS cells, is subject to DNA methylation reprogramming; yet, in particular at this epigenetic level, lineage conversion remains incomplete. Remarkably, global DNA hypomethylation – induced by 2i inhibition of Erk/Gsk3β signalling – prior to transdifferentiation, neither favours this process, nor alters the genome-wide 5mC profile of transdifferentiating cells. Therefore, even in these conditions, an ES cell-specific epigenetic memory is retained, presumably enforced by 2i-resistant 5mC at key cell fate gatekeeper genes and/or by parallel repressive epigenetic mechanisms.

xii

Table of Contents Acknowledgments

vii

Contributions provided by other researchers to this dissertation . . . . . Abstract

ix xi

Table of Contents

xiii

List of Tables

xvii

List of Figures

xix

1 Introduction 1.1

Mouse pre-implantation development . . . . . . . . . . . . . . . . . 1.1.1

1.2

1 2

Compaction and polarization – introducing the first cell fate bias . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2

1.1.2

The 1st lineage choice: TE versus ICM . . . . . . . . . . . .

2

1.1.3

The 2

lineage choice: Epi versus PrE . . . . . . . . . . . .

4

Stem cells from the peri-implantation embryo . . . . . . . . . . . .

8

1.2.1

8

nd

Embryonic Stem (ES) cells . . . . . . . . . . . . . . . . . . .

Self-renewal by inhibition of pro-differentiation stimuli . . . 10 The pluripotency and self-renewal transcriptional network . 1.2.2

11

Trophoblast Stem (TS) cells . . . . . . . . . . . . . . . . . . 15 Fgf/Erk and Tgfβ/Smad signallings – plus undefined serum factors – promote self-renewal . . . . . . . . . . . . 16 Key TS cell transcription factors . . . . . . . . . . . . . . . 18

1.2.3

Extra-embryonic Endoderm (XEN) cells . . . . . . . . . . . 23 Self-renewal by undefined serum factors . . . . . . . . . . . . 23 Key XEN cell transcription factors . . . . . . . . . . . . . . 23 xiii

1.3

Epigenetic restriction of ES cell lineage fate . . . . . . . . . . . . . 25 1.3.1

Waddington’s model . . . . . . . . . . . . . . . . . . . . . . 25

1.3.2

DNA methylation . . . . . . . . . . . . . . . . . . . . . . . . 25 CpG, CGI and 5mC genomic distribution . . . . . . . . . . . 26 Pre-implantation genome-wide 5mC reprogramming . . . . . 27 DNA methylation, demethylation and recognition . . . . . . 28 5mC-dependent restriction of ES cell fate . . . . . . . . . . . 29

1.3.3

H3K9 methylation . . . . . . . . . . . . . . . . . . . . . . . 30 H3K9me-dependent restriction of ES cell fate . . . . . . . . 32

1.3.4

The NuRD epigenetic repressor complex . . . . . . . . . . . 32 NuRD-dependent restriction of ES cell fate . . . . . . . . . . 32

1.4

ES cell transdifferentiation to TS-like cells . . . . . . . . . . . . . . 34 1.4.1

Cell differentiation and transdifferentiation . . . . . . . . . . 34

1.4.2

ES cell transdifferentiation to TS-like cells . . . . . . . . . . 35 TS-like cells by forced regulation of Oct4/Cdx2 activity . . . 36 TS-like cells by transient Ras/Erk hyperactivity . . . . . . . 37 Trophoblast fate in 5mC-deficient ES cells . . . . . . . . . . 38

1.4.3 1.5

Are ES⇒TS-like cells equivalent to genuine TS cells? . . . . 40

Aims of the research project . . . . . . . . . . . . . . . . . . . . 43

2 Materials and Methods

45

2.1

Cell cultures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46

2.2

DNA plasmids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48

2.3

Transient transfection of HEK293 cells with episomal DNA . . . . .

2.4

Derivation of genetically modified ES cell lines . . . . . . . . . . . . 52

2.5

ES cell transdifferentiation to TS-like cells . . . . . . . . . . . . . . 53

2.6

Phase-contrast microscopy . . . . . . . . . . . . . . . . . . . . . . . 54

2.7

Immunofluorescence microscopy . . . . . . . . . . . . . . . . . . . . 54

2.8

Flow cytometry analysis for ES, TS and XEN cells . . . . . . . . . 55

2.9

Fluorescence Activated Cell Sorting (FACS) . . . . . . . . . . . . . 58

51

2.10 Alkaline Phosphatase (AP) assay . . . . . . . . . . . . . . . . . . . 60 2.11 Western Blot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60 2.12 Quantitative PCR (qPCR) . . . . . . . . . . . . . . . . . . . . . . . 63 xiv

2.13 2.14 2.15 2.16 2.17

Genomic DNA extraction . . . . . . . . Bisulphite conversion of genomic DNA . Bisulphite-converted DNA sequencing for Sequenom EpiTyper analysis . . . . . . . MeDIP-Sequencing . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . candidate loci . . . . . . . . . . . . . . . . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

. . . . .

68 68 69 71 73

3 Results 81 3.1 Phospho-Erk is insufficient for ES cell transdifferentiation to TS-like cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82 3.1.1 Inducible Erk signalling in iRAS and iRAF ES cells . . . . . 82 3.1.2 iRAF ES cell transdifferentiation to TS-like cells . . . . . . . 84 3.1.3 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86 3.2 Comparative analysis of ES cell transdifferentiation to TS-like cells 94 3.2.1 Microscopical observations and cell counts . . . . . . . . . . 94 3.2.2 Flow cytometry analysis and alkaline phosphatase assay . . 97 3.2.3 Gene expression analysis for key transcription factors . . . . 101 3.2.4 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103 3.3 Genome-wide analysis of 5mC reprogramming in ES ⇒TS-like cells 108 3.3.1 Comparative analysis of MeDIP-Seq datasets . . . . . . . . . 108 3.3.2 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117 3.4 Attempts to improve ES cell transdifferentiation to TS-like cells . . 123 3.4.1 5mC depletion by 2i does not facilitate ES ⇒to TS-like cells 123 3.4.2 pErk/Cdx2 coinduction does not favour ES ⇒to TS-like cells 125 3.4.3 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . 135 4 General Discussion 4.1 Assessing identity and stability of ES cell-derived TS-like cells . 4.2 Dynamics and mechanisms of transdifferentiation to TS-like cells 4.3 The role of Erk in the establishment of the TE/TS lineage . . . 4.4 A developmentally regulated 5mC signature of TS cell identity .

. . . .

137 . 138 . 142 . 143 . 146

Appendix

153

Bibliography

177 xv

xvi

List of Tables Introduction 1.1 ES cell-derived TS-like cell fate in vivo: a literature review . . . . . 42 Materials and methods 2.1 ES cell-derived TS-like cell models . . . . . . . . . . . . . . 2.2 Antibodies used for immunofluorescence microscopy . . . . 2.3 Stainings used for flow cytometry of ES, TS and XEN cells 2.4 Antibodies used for flow cytometry . . . . . . . . . . . . . 2.5 Antibodies used for Western Blot . . . . . . . . . . . . . . 2.6 Primer sequences used for qPCR . . . . . . . . . . . . . . 2.7 PCR primers for amplication of bisulphite-converted DNA 2.8 Paired-end adaptors for MeDIP-Seq libraries . . . . . . . . 2.9 Primers for MeDIP-Seq library amplification . . . . . . . . Appendix Promoters hypermethylated in 1 demethylation in ES⇒TS cells 2 Promoters hypermethylated in methylation in ES⇒TS cells .

ES vs TS cells and . . . . . . . . . . . TS vs ES cells and . . . . . . . . . . .

xvii

. . . . . . . . .

subject to . . . . . . subject to . . . . . .

. . . . . . . . .

. . . . . . . . .

. . . . . . . . .

. . . . . . . . .

47 55 57 58 62 67 70 74 77

DNA . . . . 154 DNA . . . . 155

xviii

List of Figures Introduction 1.1 The first 3 cell lineages (TE, Epi and PrE) and their stem cells derivatives (TS, ES, XEN) . . . . . . . . . . . . . . . . . . . . . . 1.2 The pluripotency and self-renewal transcriptional network . . . . 1.3 Key TS cell signalling pathways and transcription factors . . . . . 1.4 ES cell models of transdifferentiation to TS-like cells . . . . . . .

. 9 . 12 . 19 . 39

Materials and methods 2.1 DNA plasmid feature maps . . . . . . . . . . . . . . . . . . . . . . 50 2.2 An example of flow cytometry data analysis/FACS purification . . . 59 Results Phospho-Erk is insufficient for ES cell transdifferentiation to TS-like cells 3.1 Derivation of iRAS and iRAF ES cells . . . . . . . . . . . . . . . 3.2 Inducible Erk signalling in iRAS and iRAF ES cells . . . . . . . . 3.3 iRAF ES cells initiate transdifferentiation to TS-like cells . . . . . 3.4 Partial iRAF ES cell transdifferentiation to TS-like cells (d7) . . . 3.5 Incomplete iRAF ES cell transdifferentiation to TS-like cells (d15)

. . . . .

83 90 91 92 93

Comparative analysis of ES cell transdifferentiation to TS-like cells 3.6 Experimental scheme . . . . . . . . . . . . . . . . . . . . . 3.7 Phase/contrast microscopy . . . . . . . . . . . . . . . . . 3.8 Cell counts . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.9 Immunofluorescence microscopy for Cdx2 and Elf5 . . . . . 3.10 CD40 is a specific marker for TS cells . . . . . . . . . . . . 3.11 CD40 flow cytometry analysis . . . . . . . . . . . . . . . . 3.12 Alkaline phosphatase assay . . . . . . . . . . . . . . . . . . 3.13 Gene expression analysis for key transcription factors . . .

. . . . . . . .

95 96 97 98 100 101 102 104

xix

. . . . . . . .

. . . . . . . .

. . . . . . . .

. . . . . . . .

Genome-wide analysis of 5mC reprogramming in ES cell-derived TS-like cells 3.14 Comparative analysis of genome-wide MeDIP-Seq datasets . . . . . 110 3.15 MeDIP-Seq dataset screen for differentially enriched promoters in ES vs TS cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 112 3.16 MeDIP-Seq read count profiles at Elf5 and Oct4 promoters . . . . . 113 3.17 MeDIP-Seq dataset validation at Elf5 promoter . . . . . . . . . . . 114 3.18 A DNA methylation signature of TS cell identity . . . . . . . . . . 116 3.19 MeDIP-Seq dataset hierarchical clustering analysis . . . . . . . . . . 118 3.20 Functional annotation of promoter subgroups undergoing DNA methylation in ES⇒TS cells . . . . . . . . . . . . . . . . . . . . . . 119 Attempts to improve ES cell transdifferentiation to TS-like cells 3.21 5mC depletion by 2i does not facilitate wtES cell⇒to TS-like cells . 126 3.22 5mC depletion by 2i does not facilitate iRAF ES⇒to TS-like cells . 127 3.23 iCDX2:ER and iRAF/iCDX2:ER ES cells . . . . . . . . . . . . . . 129 3.24 iCDX2:ER & iRAF/iCDX2:ER ES cell transdiff. to TS-like cells . . 131 3.25 Instability of iCDX2:ER & iRAF/iCDX2:ER ES⇒TS-like cell identity132 3.26 MeDIP-Seq analysis: iCDX2:ER & iRAF/iCDX2 ES⇒TS-like cells 133 3.27 Heat map of 5mC enrichment across all ES cell-derived TS-like cells 134 Appendix 1 IF microscopy: single stainings for Cdx2/Elf5/DAPI . . . . . . . . . 171 2 CD31/Pecam1 flow cytometry analysis . . . . . . . . . . . . . . . . 175 3 CD140a/Pdgfrα flow cytometry analysis . . . . . . . . . . . . . . . 176

xx

Chapter 1 Introduction

1

2

1.1 1.1.1

CHAPTER 1. INTRODUCTION

Mouse pre-implantation development Compaction and polarization – introducing the first cell fate bias

Within 2.5 days from fertilization (E2.5), the mouse zygote undergoes three rounds of symmetric cell divisions to form an 8-cell embryo. Until this stage, blastomeres are considered capable of contributing to all future cell lineages [reviewed by Gardner, 1985; Johnson & McConnell, 2004], albeit some reports have suggested that individual cells can already show a bias in their developmental potential [e.g., Piotrowska-Nitsche et al., 2005]. Starting at the 8-cell stage, blastomeres begin to loose their original symmetry, as a consequence of the processes of compaction and polarization [e.g., Ducibella et al., 1977]. At this stage, cells gradually increase their contacts and polarize along the radial axis of the embryo, progressively acquiring specialized apical and baso-lateral subcellular domains. Compaction and polarization are strictly interconnected events, triggered at the post-transcriptional level and coordinated by multiple signalling pathways [reviewed by Yamanaka et al., 2006].

1.1.2

The first lineage specification event: TE versus ICM

During the fourth and fifth round of cell division (from 8 to 32 cells), blastomeres divide in two different ways: asymmetrically or symmetrically – according to the orientation of the cleavage plane [Johnson & Ziomek, 1981]. In the majority of cells, cleavage plane and polarization axis are perpendicular, resulting in the formation of an inner apolar cell and an outer polar cell. In contrast, in a minority of blastomeres, the cleavage plane is parallel to the polarization axis, leading to the generation of two outer polar cells. Hence, for the first time during embryogenesis, two distinct cell populations can be observed: an inner cluster of apolar cells surronded by an outer layer of polar cells, which are the precursors of the pluripotent Inner Cell Mass (ICM) and the multipotent Trophectoderm (TE), respectively [e.g., Pedersen et al., 1986]. What are the molecular mechanisms leading to the first lineage specification event?

1.1. Mouse pre-implantation development

3

The transcription factors Cdx2 and Oct4 are considered to be the key determinants of this developmental choice based on their respective mutant phenotypes, gene expression patterns and functional characterization at the molecular level. Gene inactivation studies showed that Oct4-/- conceptuses give rise to blastocystlike structures completely devoid of pluripotent cells and entirely consisting of blastomeres committed to the trophoblast lineage [Nichols et al., 1998]. Cdx2-/embryos initiate lineage commitment and develop normally up to the stage in which a compacted blastocyst is formed. However, at this point, outer cells fail to acquire both epithelial identity and multipotent trophoblast potential; as a consequence, mutant blastocysts arrest their development [Strumpf et al., 2005]. Importantly, Cdx2 depletion does not affect formation of a pluripotent ICM. Gene expression studies revealed that initially both Cdx2 and Oct4 are present in all blastomeres. Approximately, during the transition from the 16- to 32-cell stage, Cdx2 expression is gradually restricted to outer cells, and later, during the transition from 32- to 64-cell stage, Oct4 expression becomes confined to inner cells [Dietrich & Hiiragi, 2007; Ralston & Rossant, 2008]. Using ES cells as a model for studying gene function during early embryonic development, it was shown that suppression of Oct4 leads to Cdx2 upregulation; conversely, induction of Cdx2 results in Oct4 downregulation. Crucially, either Oct4 suppression or Cdx2 induction leads to ES cell transdifferentiation to TS-like cells [Niwa et al., 2005] (see Section 1.4). From a mechanistic point of view, both Oct4 and Cdx2 positively auto-regulate their own transcription and they can mutually inhibit each others’ function [Niwa et al., 2005]. Hence, TE and ICM specification is thought to originate from an imbalance between the expression levels of these two key transcription factors, which initially occurs in outer cells, favouring Cdx2 versus Oct4 expression. In the last few years, a number of studies have shed light on the mechanisms that may first trigger Cdx2 upregulation in outer cells. Genetic ablation of the transcription factor Tead4 leads to blastocyst-like structures exclusively made of ICM cells and lacking any trophoblast developmental potential [Yagi et al., 2007; Nishioka et al., 2008]; thus, they present a phenotype which is exactly the reverse of that observed in Oct4 -null mutants. During early embryonic development, Tead4 is ubiquitously expressed, but its function is spatially controlled by Hippo signalling [Nishioka et al., 2009]. This pathway is activated in response to cell-cell contacts –

4


potentially transduced via junction-associated proteins or the Nf2/Merlin receptor [Hirate et al., 2013; Cockburn et al., 2013] – and leads to phosphorylation and nuclear exclusion of Yap, a co-factor necessary for Tead4 activity, in inner but not in outer cells. Hence, the current model of the first lineage specification event considers Tead4 at the top of the transcriptional network regulating the choice between TE and ICM cell fate. In summary, asymmetric divisions of polarized blastomeres generate two populations of cells, characterized by different frequencies of intercellular contacts: in outer cells – connected by relatively fewer cell-cell contacts – the Tead4:Yap transcriptional complex initiates Cdx2 expression, which is then positively autoregulated; conversely, in inner cells – which establish relatively more contacts between cells – the Hippo pathway inhibits Yap nuclear translocation and Tead4 function, so that Oct4 activity is dominant. Thus, Cdx2 and Oct4 expression gradually become mutually exclusive, and cell fate progressively diverges towards either the TE or the ICM, respectively. Recently, it was proposed that the transcription factor Gata3 – downstream of Tead4 – may promote TE specification, in parallel with Cdx2 [Home et al., 2009; Ralston et al., 2010]. Following initial specification, trophoblast expansion requires Fgf signalling [Feldman et al., 1995; Arman et al., 1998; Nichols et al., 1998; Tanaka et al., 1998; Saba-El-Leil et al., 2003; Goldin & Papaioannou, 2003; Nichols et al., 2009] – mediated by the Ras/Erk pathway – and the sequential induction of multiple transcription factors, including Eomes [Russ et al., 2000; Strumpf et al., 2005; Niwa et al., 2005; Ralston et al., 2010] and – upon implantation – Elf5, Tcfap2c and Ets2 [Donnison et al., 2005; Auman et al., 2002; Kuckenberg et al., 2010; Yamamoto et al., 1998] Once formed, the TE epithelium actively promotes the expansion of the blastocoel and, consequently, the ICM becomes situated at one pole of the blastocyst (≈E3.5) [reviewed by Cockburn & Rossant, 2010].

1.1.3

The second lineage specification event: Epi versus PrE

From approximately E3.0 to 4.5, the ICM undergoes the second lineage specification event, separating into the pluripotent Epiblast (Epi) and the multipotent


5

Primitive Endoderm (PrE), an epithelial layer in contact with the blastocoelic cavity. Epi and PrE precursors – initially morphologically indistinguishable – can be identified at the early-blastocyst stage (around E3.5) based on the mutually exclusive expression of the transcription factors Nanog and Gata6, respectively [Chazaud et al., 2006]. Nanog is essential for Epi formation and, cooperating with Oct4 and Sox2, orchestrates the pluripotency gene regulatory network [Chambers et al., 2003; Mitsui et al., 2003; Boyer et al., 2005; Chambers et al., 2007; Silva et al., 2009]. Gata6 is the first to be expressed of a group of key transcription factors – including Sox17, Gata4 and Sox7 – which are sequentially activated during PrE specification [Morrisey et al., 1998; Soudais et al., 1995; Fujikura et al., 2002; Kanai-Azuma et al., 2002; Niakan et al., 2010; Morris et al., 2010; Artus et al., 2011]. Mouse knockout models for individual genes display post-implantation defects in visceral endoderm differentiation, but an earlier PrE phenotype is thought to be masked, due to redundancy between members of the same protein-family (e.g., Gata6 and Gata4, Sox17 and Sox7). Initially co-expressed in the entire ICM, Nanog and Gata6 gradually diverge, until they become localized into distinct group of cells, distributed in a position-independent "salt and pepper" pattern [Chazaud et al., 2006]. Upon their initial specification, Epi and PrE precursors progressively segregate towards either the interior or the exterior of the ICM, respectively. Cell sorting is thought to be the consequence of specialized cell-surface and motility properties between different progenitors [Plusa et al., 2008]. A minority of cells, which fail to reach their appropriate localization, undergo apoptosis or, more rarely, switch gene expression programme [Plusa et al., 2008; Yamanaka et al., 2010; Morris et al., 2010]. PrE precursors – downstream of Gata6 – progressively upregulate Sox17 and Gata4; the induction of Sox7 coincides with the moment in which cells reach the blastocoelic side and acquire epithelial features [Artus et al., 2011]. The mechanisms that initially lead to the mutually exclusive expression of Nanog and Gata6 have recently been investigated. Fgf signalling – mediated intracellularly by the Ras/Erk pathway – crucially controls PrE specification: inhibiting this pathway – via genetic modification or pharmacological treatment – prevents the emergence of PrE precursors [Cheng et al., 1998; Chazaud et al., 2006; Nichols et al., 2009; Frankenberg et al., 2011]; conversely, enhancing this signalling turns all ICM cells into PrE progenitors [Yamanaka et al., 2010]. In agreement with these

6


reports, single-cell gene expression profiling during pre-implantation development identified the inverted correlation between the expression of the Fgf4 ligand Fgf4 – upregulated in nascent Epi cells – and that one of the Fgf receptor 2 (Fgfr2 ) – upregulated in nascent PrE cells – as the first sign of lineage specification within the ICM [Guo et al., 2010]. Slightly later, the expression of Nanog and Gata6 begins to be confined to different cells, in an apparently position-independent manner. These data indicate that Fgf signalling regulates – in an opposite fashion – the expression of these two genes, encoding for key transcription factors. Importantly, this Fgf signalling activity is not dependent on positional cues and it is currently unclear how the differential sensitivity of neighbouring ICM cells to Fgf4 is controlled, which – at this stage – are considered to form a homogenous population exposed to similar concentrations of this growth factor [Yamanaka et al., 2010; Morris et al., 2010; Frankenberg et al., 2011]. Upon lineage specification, Fgf signalling appears to be dispensable for PrE expansion [Kunath et al., 2005; Artus et al., 2010]. In contrast, Pdgf signalling – acting via both the Ras/Erk and the Pkc pathway – is required for PrE proliferation, but not for its initial specification [Artus et al., 2010]. It is noteworthy that Pdgf receptor α (Pdgfrα) expression is dependent on Gata6 and represents one of the earliest markers of this lineage [Plusa et al., 2008; Artus et al., 2010]. The role of Nanog, in the developing ICM, has been recently shown to be more complex than previously thought. Originally, Nanog was characterized as a transcription factor cell-autonomously required for Epi formation, by promoting the expression of pluripotency genes and by repressing PrE genes, possibly indirectly via inhibition of Gata6 transcription [Chambers et al., 2003; Mitsui et al., 2003; Singh et al., 2007]. Several years later, in-depth characterization of transgenic mouse models and cell lines has revealed an additional non-cell-autonomous role for Nanog during PrE formation. Nanog-null ICMs entirely consist of Gata6+ cells but, in this model, PrE development cannot progress further – as demonstrated by the fact that little, if any, expression of Sox17 and Gata4 is observed [Silva et al., 2009; Frankenberg et al., 2011]. However, Nanog-/- ICM cells can form a normal PrE layer, if they are complemented with wild-type ICM cells (Nanog+/+ ), which where found to provide an essential non-cell-autonomous factor; this factor was demonstrated to be Fgf4 [Messerschmidt & Kemler, 2010; Frankenberg et al.,


7

2011]. Paracrine Fgf signalling from Epi precusors to neighbouring PrE precursors is thought to promote PrE specification via two mechanisms sequentially activated: initially, by downregulating Nanog and consequently releasing Gata6 repression; subsequently, by upregulating Sox17 and Gata4 expression, which – together with Gata6 – instruct PrE specification [Frankenberg et al., 2011]. In summary, starting from a population of equipotent blastomeres, signalling pathways (e.g., Hippo and Fgf signalling) – dynamically integrating cell-position dependent and independent cues – coordinate the specification of the first three cell lineages, by influencing the localization of a cohort of key transcription factors (e.g., Cdx2, Oct4, Nanog, Gata6) – whose expression patterns, originally overlapping, become mutually exclusive. A number of embryological studies have demonstrated that, around the time of blastocyst implantation (≈ E4.5), the developmental fate of TE, Epi and PrE become restricted to distinct lineages [reviewed by Gardner, 1985; Johnson & McConnell, 2004; see also Kwon et al., 2008; Grabarek et al., 2012].

8

1.2


Stem cells from the peri-implantation embryo

Stem cells are developmental progenitor cells defined by the ability to self-renew and differentiate into multiple definitive cell types, in response to environmental stimuli. In mammals, they are found, most abudantly, within niches in those adult tissues retaining regenerative potential (e.g., blood, skin, gut) [reviewed by Morrison & Spradling, 2008]. In mouse embryonic development, the first three cell lineages – Epiblast (Epi), Trophectoderm (TE) and Primitive Endoderm (PrE) – are specified as transient pluri- or multipotent progenitors, with limited self-renewing capacity. They are established at the blastocyst stage, around the time of implantation (≈ E4.5), and soon afterwards, they progress towards differentiation. However, in the mouse, it has become possible to ex vivo derive stem cells from the first three lineages (Figure 1.1). These three stem cell types can indefinitely self-renew – under appropriate tissue culture conditions – and they can be induced to differentiate in vitro or – upon reintroduction into animals – in vivo. Crucially, stem cells from the peri-implantation embryo retain the developmental restrictions of their lineage of origin [reviewed by Rossant, 2008; Artus et al., 2012].

1.2.1

Embryonic Stem (ES) cells

Embryonic stem (ES) cells are routinely derived from the Epi compartment of the Inner Cell Mass (ICM)[Evans & Kaufman, 1981; Martin, 1981; Brook & Gardner, 1997; Nichols et al., 2009]. They are relatively small cells (≈ 10µm of diameter), presenting a high nuclear/cytoplasmic volume ratio, which preferentially form compacted spherical colonies. This morphology – reminiscent of the ICM in vivo– is prevalent in culture conditions that enhance self-renewal and minimize spontaneous differentiation (e.g., Lif+2i, as described later). Studies – involving injections of ES cells into blastocysts, in order to generate chimaeric mice – showed that these cells are pluripotent, predominantly contributing to all somatic tissues and the gametes [Bradley et al., 1984; Beddington & Robertson, 1989]. At low frequency, they were also observed in the yolk sac and, very rarely, in the placenta [Beddington & Robertson, 1989]; it is noteworthy that cell tracing studies suggest that ES

1.2. Stem cells from the peri-implantation embryo

Uterinewall (mother)

Decidua (mother)

TE

9

Placenta

Embryo

Epi PrE

(E4.5)

ES cells

Yolk Sac

(E13.5)

XEN cells

TS cells

Figure 1.1: The first three cell lineages during mouse embryogenesis – TE, Epi, PrE – and their stem cell derivatives – TS, ES and XEN cells. Around the time of blastocyst implantation (≈E4.5) the developmental potential of the Trophectoderm (TE), the Epiblast (Epi) and the Primitive Endoderm (PrE) becomes restricted towards distinct fates – mainly contributing to the formation of the somatic tissues and the gametes, the trophoblast layers of the placenta and the extra-embryonic endoderm layers of the yolk sac, respectively. Stem cells can be derived from the first three cell lineages – Embryonic Stem (ES), Trophoblast Stem (TS) and Extra-embryonic endoderm (XEN) cells – which retain the developmental restriction of their lineage of origin.

cells are not capable of functionally contributing to the trophoblast cell types of the placenta [Hadjantonakis et al., 1998]. However, recent reports – still to be independently confirmed – support the hypothesis that a small fraction of ES cells in culture (≈ 1%) may oscillate in-and-out of a cell state – which has been likened to the early embryonic 2-cell stage – characterized by the potential to develop into both embryonic and extra-embryonic lineages [Cho et al., 2012; Macfarlan et al., 2012; Morgani et al., 2013].

10


Remarkably, induced Pluripotent Stem (iPS) cells – nearly indistinguishable from ES cells – can now be established via reprogramming of somatic cells by defined factors [Takahashi & Yamanaka, 2006].

Self-renewal by inhibition of stimuli that promote differentiation ES cells were originally derived by explanting blastocysts on a layer of feeder cells – mitotically-inactive mouse embryonic fibroblasts (MEFs) – in serum-containing medium [Evans & Kaufman, 1981; Martin, 1981]. However, in these conditions, ES cell derivation has been commonly found to be restricted to few permissive strains of mice and, ES cells show a relatively high tendency to spontaneously differentiate. Since then, culture conditions have been progressively refined, leading to improved derivation efficiency, reduced frequency of spontaneous differentiation and better understanding of the environmental requirements for self-renewal and differentiation [reviewed by Nichols & Smith, 2012]. The first progress was achieved by replacing feeder cells with the cytokine Lif [Smith et al., 1988; Williams et al., 1988]; this was followed – about fifthteen years later – by the replacement of serum with the growth factor Bmp4 [Ying et al., 2003]. At the molecular level, while Lif stimulates both Stat3 and Erk pathways [Niwa et al., 1998], Bmp4 induces Smad signalling [Ying et al., 2003]. Yet, Stat3 is dispensable for blastocyst formation [Takeda et al., 1997], and paradoxically, both Erk and Smad activities induce epiblast differentiation [reviewed by Arnold & Robertson, 2009]. In the Epi in vivo and in ES cells in vitro, Erk is predominantly activated by Fgf, in an autocrine manner [Kunath et al., 2007]. Inhibition of Fgf/Erk signalling impairs ES cell differentiation and favours self-renewal [Burdon et al., 1999; Kunath et al., 2007; Stavridis et al., 2007]. In parallel, it was reported that inhibition of Gsk3β – a kinase acting at the crossroad of multiple signalling, metabolic and nuclear pathways [reviewed by Doble & Woodgett, 2003] – sustains proliferation of undifferentiatied ES cells [Sato et al., 2004; Ogawa et al., 2006]. It was later clarified that Gsk3β inhibition promotes self-renewal by, primarily, stimulating the canonical Wnt/βcatenin pathway [reviewed by Clevers, 2006], which in turn abrogates the activity of Tcf3, a transcriptional repressor of the pluripotency gene regulatory network [Cole et al., 2008; Wray et al., 2011]. Combination of Erk and Gsk3β inhibitors –


11

termed 2 inhibitors (2i) conditions – has extended efficient ES cell derivation to several mouse and – for the first time – rat strains [Ying et al., 2008; Buehr et al., 2008]. Although Lif is dispensable for indefinite expansion of pluripotent ES cells cultured in 2i conditions, supplementation of this cytokine enhances derivation efficiency and supports maximal self-renewal [Ying et al., 2008; Nichols et al., 2009]. Interestingly, ES cells cultured in medium supplemented with Lif and serum oscillate between cell states, characterized by fluctuating gene expression levels (e.g., Nanog) and heterogeneous propensity to exit pluripotency [Chambers et al., 2007]; in contrast, in 2i conditions, Nanog and other key transcription factors present more homogeneous high levels of expression, and spontaneous differentiation is minimized [Nichols et al., 2009]. Taken together, these findings led to the hypothesis that the gene expression programme of self-renewing ES cells represents a "ground-state" of developmental potency that can be cell-automously maintained when autocrine and paracrine differentiation-promoting stimuli are inhibited [Ying et al., 2008].

The pluripotency and self-renewal transcriptional network Genetic studies in combination with high-throughput molecular analyses have revealed that a small number of transcription factors are master regulators of ES cell self-renewal and, in combination with co-factors – including epigenetic factors and chromatin remodellers – they are also essential for pluripotency [reviewed by Young, 2011; Nichols & Smith, 2012]. At least four signalling pathways – Lif/Stat3, Bmp4/Smad, Fgf/Erk and Wnt/Tcf3 – converge on some of these transcriptional regulators, influencing self-renewal and differentiation (Figure 1.2) [Niwa et al., 1998; Ying et al., 2003, 2008; Cole et al., 2008; Wray et al., 2011; Mullen et al., 2011]. A network model has been proposed in which these key transcription factors are classified in an "inner" and "outer" core circuitry of master regulators [Nichols & Smith, 2012]. The inner core is constituted by Oct4 and Sox2, which are essential for both derivation and maintenance of pluripotent ES cells. The outer core circuitry – including at least Nanog, Klf2 and Klf4, Essrb and Tbx3 – is made up of transcription factors with partially redundant activities. The full inner core circuitry (Oct4 and Sox2) – in combination with, at least, a minimal section of the

12


Figure 1.2: The pluripotency and self-renewal transcriptional network. ES cell self-renewal and pluripotency require the functions of the transcription factors Oct4 and Sox2 – forming the inner core of this transcriptional network – and of Nanog, Esrrb, Klf2, Klf4 and additional factors (X), which perform partially overlapping activities – therefore representing the outer core of this model. Among the latter, Nanog function is regarded as prominent. When autocrine and paracrine pro-differentiation stimuli are inhibited (e.g., PD+CH=2 inhibitors), the ES cell gene expression programme is considered to be cell-autonomously maintained via feedforward interactions. Nevertheless, extracellular signalling – in particular Lif signalling – can further reinforce this transcriptional network.

outer core circuitry – is required for ES cell self-renewal. The transcription factor Oct4 is considered at the top of this hierarchy of master regulators. Oct4 expression marks all pluripotent tissues and their stem cell


13

derivatives; in particular, it is indispensable for Epi specification in the early embryo and for ES cell culture in vitro [Nichols et al., 1998]. Both ES cell self-renewal and developmental potential are highly sensitive to changes in Oct4 concentration in either direction. Oct4 levels oscillate between approximately 100 and 20% of maximal biallelic expression – as observed in individual ES cells within wildtype populations – and these values are permissive for normal self-renewal and signalling-induced differentiation towards embryonic lineages. Notably, within this range, Oct4high cells are reported to be more prone to exit self-renewal in response to differentiation cues than Oct4low cells [Karwacki-Neisius et al., 2013; Radzisheuskaya et al., 2013]. Crucially, altering Oct4 expression, above or below this interval, leads to aberrant transdifferentiation towards the PrE or the TE lineage, respectively [Niwa et al., 2000]. At the molecular level, increasing or decreasing Oct4 concentration, beyond its wild-type expression range, causes rapid and profound perturbations of the pluripotency gene expression programme (e.g., acute Oct4 depletion results in about 15-25% of genes being significantly misregulated – at least 1.5 fold expression change – within 6 hours from induction) [Hall et al., 2009; Nishiyama et al., 2009]. From a mechanistic point of view, Oct4 is thought to regulate the equilibrium between self-renewal and alternative differentiation fates, by binding to distinct sets of DNA regulatory elements and/or by interacting with different protein partners, in a dose-dependent manner [e.g., Pardo et al., 2010; van den Berg et al., 2010]. Among the group of Oct4 interactors, Sox2 is the best characterized. During the transition from the 8- to the 32-cell stage, Sox2 is the first key transcription factor to become specifically upregulated in inner versus outer cells – which are the precursors of pluripotent ICM and TE, respectively [Guo et al., 2010]. After blastocyst implantation, Sox2 is certainly essential for epiblast expansion, but its requirement at earlier stages of embryogenesis is still to be clarified, as oocyte-inherited Sox2 protein is thought to mask Sox2-deficiency in the zygotic knockout mouse model [Avilion et al., 2003]. Nevertheless, similar to Oct4, Sox2-deficient ES cells cannot self-renew and they transdifferentiate to the TE lineage [Masui et al., 2007]. In ES cells, Oct4 and Sox2 are mutually required to sustain each others’ expression and they bind in close proximity at the majority of active enhancers [Boyer et al., 2005; Marson et al., 2008]; they can form heterodimers, at least at some specific loci [Ambrosetti et al., 1997].

14


As in the case of Oct4, changing Sox2 expression levels has profound impact on the ES cell transcriptome [Nishiyama et al., 2009]. It is noteworthy that ectopic expression of both factors is currently necessary for somatic cell reprogramming to iPS cells (unless endogenous Sox2 is highly expressed in the somatic cells) [Nakagawa et al., 2008; Kim et al., 2009]. These findings support the hypothesis of an essential synergistic role for Oct4 and Sox2 in the specification and maintenance of pluripotency. Within the outer core circuitry of key transcriptional regulators, the role of Nanog is regarded as prominent. This is based on at least three distinct lines of evidence. First, Nanog is the only one – among this group of factors – to be specifically expressed in pluripotent tissues – epiblast and germ cells – and to be required for their specification [Chambers et al., 2003; Mitsui et al., 2003; Chambers et al., 2007; Silva et al., 2009]. Second, single-cell studies of ES cell populations have shown that Nanog concentration levels are directly correlated with self-renewal efficiency [Chambers et al., 2007]. Third, genome-wide analyses found that Nanog, Oct4 and Sox2 binding sites are largely overlapping [Boyer et al., 2005; Marson et al., 2008]. In common with other outer core factors (e.g., Esrrb, Klf2), Nanog-forced expression protects ES cells from stimuli promoting exit from self-renewal [Hall et al., 2009; Festuccia et al., 2012]. Yet, conditional Nanog-null ES cells – although highly susceptible to differentiation cues – can self-renew and, upon injection into wild-type blastocysts, widely contribute to somatic tissues – but not the gametes – of chimaeric animals [Chambers et al., 2007]. Altering Nanog expression – in comparison with changing Oct4 or Sox2 concentration levels – leads to relatively small short-term changes to the ES transcriptional profile (e.g., acute Nanog depletion results in approximately 0.75-0.5% of genes being significantly misregulated – at least 1.5 fold change – within 5 hours from induction) [Festuccia et al., 2012]. Importantly, other outer core factors (e.g., Esrrb) can largely – but not entirely – compensate for the loss of Nanog [Festuccia et al., 2012; Martello et al., 2012]. Thus, a cohort of key transcription factors with overlapping functions – and among them, in particular Nanog – cooperates with Oct4 and Sox2, to sustain self-renewal. In ES cells, Oct4/Sox2/Nanog binding sites are also found closely located at enhancers of genes which are repressed in self-renewal conditions, but poised for


15

rapid activation, upon differentiation [Boyer et al., 2005; Marson et al., 2008]. Many of these genes encode for crucial regulators – like those belonging to the Fox, Hox, Pax and Sox families of homeobox domain transcription factors – involved in the specification of the first three embryonic lineages – mesoderm, endoderm and ectoderm (also known as germ layers). Poised enhancers are marked by a particular pattern of histone modifications, which are most commonly associated with either gene activity – e.g., Histone-3-Lysine-4 tri-methylation (H3K4me3 )– or silencing – e.g., Histone-3-Lysine-27 tri-methylation (H3K27me3) and Histone2A-Lysine-119mono-ubiquitination (H2AK119ub) – but found in combination at these specific regulatory regions; they are catalyzed by the Tritorax group (TrxG) and Polycomb group (PcG) complexes, respectively. In response to differentiation stimuli, these so-called bivalent chromatin domains are resolved, in a lineage specific manner: they either retain H3K4me3 and loose H3K27me3/H2AK119ub, when they are induced, or vice versa, they loose H3K4me3 but retain H3K27me3/H2AK119ub when they become repressed. Loss of key components of either TrxG or PcG complexes disrupts germ layer formation during embryogenesis and ES cell differentiation in vitro [reviewed by Aloia et al., 2013; Voigt et al., 2013]. In summary – Oct4, Sox2 and Nanog orchestrate a transcriptional regulatory network, regulating ES cell self-renewal and pluripotency via three main mechanisms: first, they sustain their own gene expression via feedforward loops; second, they directly promote transcription of the majority of active genes; third – interacting with epigenetic complexes (PcG and TrxG) – they hold a group of genes, which govern the specification of the embryonic germ layers, in a poised state, repressed but with the potential of being rapidly induced in response to differentiation stimuli.

1.2.2

Trophoblast Stem (TS) cells

Trophoblast Stem (TS) cells can be derived from the polar Trophectoderm (TE) of the blastocyst and – after implantation – from the Extra-embryonic Ectoderm (ExE) and its derivatives in the Chorionic Ectoderm (ChE) – until approximately E8.5 [Tanaka et al., 1998; Uy et al., 2002]. Upon injection into blastocysts, to generate mouse chimaeras, they were observed to differentiate into all the trophoblast cell types, which are found in the extra-embryonic tissues and, in particular, in the

16


placenta. TS cells have a relatively large diameter (≈ 20µm) and present a low nuclear/cytoplasmic ratio; they grow as flat colonies, characterized by epithelial features, like a continuous colony margin and extended cell-cell contacts.

Fgf/Erk and Tgfβ/Smad signallings – plus undefined serum factors – promote self-renewal TS cells were originally derived by either blastocyst or ExE/ChE explants on a layer of feeder cells, in medium supplemented with serum and Fgf4 – plus its co-activator heparin [Tanaka et al., 1998; Uy et al., 2002]. Feeder cell conditioned medium (CM) – that is, medium enriched for soluble factors released by feeder cells – was found to be sufficient to replace MEFs and allowed for the proliferation of undifferentiated TS cells in the continued presence of Fgf4. Further work demonstrated that the members of the transforming growth factor β (Tgfβ) superfamily – Tgfβ and Activin – were the essential factors provided by CM [Erlebacher et al., 2004]. Apart from TgfβActivin, TS self-renewal necessitates of additional – as yet unidentified – extracellular stimuli, provided by the serum (which made up 20% of the medium)[reviewed by Simmons & Cross, 2005]. A number of knockout mouse models for genes encoding for components of the Fgf/Ras/Raf/Erk pathway – e.g., Fgfr2, Frs2α, Shp2 and Erk2 – have demonstrated that this signalling is required for expansion of the trophoblast lineage upon blastocyst implantation, as well as for TS cell self-renewal in vitro [Arman et al., 1998; Gotoh et al., 2005; Yang et al., 2006; Saba-El-Leil et al., 2003]. This signal transduction – at least at peri-implantation stages – relies on Fgf4 secretion by the epiblast [Nichols et al., 1998; Tanaka et al., 1998; Goldin & Papaioannou, 2003]; at later stages, it has been speculated that Fgf family members (e.g., Fgf8) – potentially released by extra-embryonic tissues and whose activity appears to be influenced by the local concentration of heparan sulfate (HS) proteoglycans – may sustain trophoblast growth [e.g., Uy et al., 2002; Shimokawa et al., 2011]. Upon binding Fgf/HS, the receptor-tyrosine-kinase Fgfr2 dimerizes, triggering selfphosphorylation of its intracellular domains. Phospho-tyrosines act as docking sites for the assembly of a complex of signalling mediators, including the scaffold protein Frs2α and the Ras family of small GTPases, which in turn activate the downstream


17

three-tier hierarchical cascade of Raf/Mek/Erk protein kinases [reviewed by Dorey & Amaya, 2010; Little et al., 2012]. Erk activity has been linked – in a contextdependent manner – to the regulation of a broad spectrum of cytosolic and nuclear proteins, including cell cycle regulators (e.g., Cdk1; Ullah et al., 2008), proteins involved in the control of apoptosis (e.g., Bim; Yang et al., 2006), transcription factors (e.g., Ets2; Man et al., 2003) and to mediate auto-regulatory feedback loops (e.g., via the Dusp family of phosphatases; Li et al., 2012). Current evidence indicates that Erk2 contributes to TS cell maintenance by mediating at least three functions: first, activating TS cell specific transcription factors (e.g., Cdx2, Ets2 and Elf5) [Tanaka et al., 1998; Man et al., 2003; Krueger et al., 2009]; second, inhibiting negative cell-cycle regulators (e.g., p57) [Ullah et al., 2008]; and third, suppressing Bim-dependent apoptosis [Yang et al., 2006]. While it is well documented that – following embryo implantation – Erk signalling sustains the expansion of the trophoblast compartment, it is currently unclear whether this pathway is also involved in the initial specification of the TE lineage during pre-implantation development. It was reported that pharmacological inhibition of Erk signalling – starting at the 8-cell stage – reduces the expression of the key TE/TS transcription factor Cdx2 and, consequently, compromises blastocyst formation [Lu et al., 2008]; in contrast, other authors observed that TE specification was not affected, albeit TE proliferation was markedly reduced [Nichols et al., 2009]. Perhaps, the best support, to the hypothesis of an instructive role for Erk signalling in this process, comes from the report that transient hyper-activity of the Ras/Erk pathway leads to efficient ES cell transdifferentiation to TS-like cells, as discussed in Section 1.4 [Lu et al., 2008]. The role of Tgfβ signalling in sustaining self-renewal emerged when it was demonstrated that Tgfβ and Activin are required for indefinite TS cell proliferation [Erlebacher et al., 2004], as well as following the observation that Nodal ligand – which, in complex with Cripto, can signal through Activin receptors [Schier, 2003] – is necessary for preserving explanted ExE tissues from precocius differentiation in culture [Guzman-Ayala et al., 2004]. Furthermore, this view is consistent with the phenotypic characterization of mouse models deficient for mediators of Nodal signalling – e.g., Nodal; Furin and Pace4 (two proteases which cleave pro-Nodal to release the active form of Nodal); and the Activin receptors genes ActR1B(Alk4) and

18


ActR2a/2b – which present defective trophoblast development at post-implantation stages – approximately between E7.5-9.5 [Ma et al., 2001; Guzman-Ayala et al., 2004; Gu et al., 1998; Song et al., 1999]. Tgfβ superfamily ligands – including Tgfβ, Activin, Nodal and Bone morphogenetic proteins (Bmps) – bind a group of transmembrane serine-threonine kinases – further classified in type I (Alk1-7) and type II receptors [reviewed by Oshimori & Fuchs, 2012]. Upon ligand binding, a type I and a type II receptor come together, triggering auto-phosporylation. Phospho-residues activates intracellular Smad proteins that, in specific combinations, deliver this signal to the chromatin. Signal transduction occurs via two main branches. Tgfβ, Activin and Nodal are recognized by Alk4 or Alk5 or Alk7 type I receptor, leading to downstream activation of Smad2/3. In contrast, Bmp factors bind to Alk1/2/3/6 type I receptors and stimulate Smad 1/5/8. Both subgroups of phospho-Smad proteins – either Smad2/3 or Smad1/5/8 – interact with co-Smad4 and translocate into the nucleus to regulate transcription. Recently, it was shown that master transcription factors – like Oct4 – can recruit phospho-Smad2/3/4 complexes to distinct sets of chromatin loci, in a cell type-specific manner [Mullen et al., 2011]. Hence – in combination with some, as yet unidentified, serum factors – paracrine Fgf/Erk and Tgfβ/Smad signalling are necessary for TS cell self-renewal and multipotency. The expression levels of some key TS cell genes (e.g., Eomes) appear to be directly dependent on either one or the other of these two pathways, whereas Cdx2 transcription presumably relies on the transduction of both signals (Figure 1.3) [Erlebacher et al., 2004; Guzman-Ayala et al., 2004].

Key TS cell transcription factors A group of key transcription factors – including, at least, Tead4, Cdx2, Gata3, Eomes, Elf5, Tcfap2c and Ets2 – is considered to promote the formation of multipotent progenitors of the trophoblast lineage during embryogenesis – from the initial specification, starting at the 8- to 16-cell stage transition, to the post-implantation phase of expansion, occurring until approximately E8.5 – and to sustain TS cell self-renewal in vitro [reviewed by Senner & Hemberger, 2010; Artus & Hadjantonakis, 2012]. This group can be further classified in three subgroups of transcription


19

Figure 1.3: Signalling pathways and transcription factors sustaining TS cell self-renewal and multipotency. In TS cells, the Fgf/Erk and the Tgfβ/Smad signalling pathways – together with extracellular stimuli provided by, as yet unidentified, serum factors – sustain the expression of a group of key transcription factors – including Tead4, Cdx2, Gata3, Eomes, Elf5, Tcfap2c and Ets2 – whose combined activity is essential for self-renewal and multipotency.

factors which appear to predominantly be involved in the early specification (Tead4, Cdx2 and Gata3), intermediate reinforcement (Eomes, Elf5 and Tcfap2c) and late maintenance (Ets2) of multipotent TE/ExE cells, according to the timing of their induction during development, as well as on the characterization of their respective

20


loss-of-function phenotype, in vivo, and of gain-of-function experiments, in ES cells in vitro. The latter type of studies, involving ES cell transdifferentiation towards the trophoblast lineage, will be discussed in more detail in section 1.4. Within the subgroup of early specifying transcription factors, Cdx2 has been regarded – for approximately a decade – as the earliest known key transcriptional regulator of TE specification [Beck et al., 1995; Chawengsaksophak et al., 1997], but more recently Tead4 was shown to be at the top of this hierarchy (see Section 1.1.2). Tead4 zygotic deletion entirely prevents TE formation and Cdx2 expression [Yagi et al., 2007; Nishioka et al., 2008]. In Cdx2 -null conceptuses, TE development is initiated but rapidly interrupted, so that blastocysts cannot implant [Strumpf et al., 2005]. Gata3 – although dispensable until mid-gestation (≈ E11.5) – becomes expressed – in a Tead4-dependent and Cdx2-independent manner – specifically in TE progenitors, during the transition from the morula to the blastocyst stage; also, in vitro studies demonstrated its capacity to instruct a TS cell-like gene expression profile, upon forced expression in ES cells. The requirement for Gata3, during the pre-implantation period, is thought to be masked by the expression of the highly related transcription factor Gata2 [Pandolfi et al., 1995; Ma et al., 1997; Ralston et al., 2010]. Therefore, at the onset of TE specification, Tead4 induces Cdx2 and Gata3, which – acting via either parallel or sequential mechanisms – crucially contribute to the establishment of this lineage. Eomes and Elf5 are targets of this trio of early-specifying factors [Niwa et al., 2005; Ng et al., 2008; Nishioka et al., 2009; Ralston et al., 2010] and knockout mouse models have revelead that Eomes-null embryos start but do not complete implantation [Russ et al., 2000], whereas in the absence of Elf5, the ExE does form, but cannot be maintained after E6.5 [Donnison et al., 2005]. Notably, Elf5 induction – occurring around the time of implantation (≈ E4.5) – approximately coincides with the moment in which the developmental potential of trophoblast progenitors become irreversibly restricted to their lineage. Tcfap2c is expressed from the onset of TE specification but its function is seemingly redundant until the late stage of ExE expansion (≈ E7.5); its crucial role in reinforcing TS cell identity was revealed by ES cell overexpression experiments, showing its ability to upregulate a number of key TS cell transcription factor genes (e.g., Gata3, Eomes, Elf5 ), primarily via Cdx2-dependent mechanisms [Auman et al., 2002; Kuckenberg


21

et al., 2010]. Ets2 transcription factor – which becomes expressed at peri-implantation stages – is necessary for the maintenance of multipotency in the last phase of ExE expansion (≈ E7.5-E8.5) [Yamamoto et al., 1998; Wen et al., 2007]. With the exception of Gata3 – for which this experiment has not yet been reported – all members of this group of transcription factors are essential for ex vivo derivation of TS cells [Strumpf et al., 2005; Donnison et al., 2005; Yagi et al., 2007; Wen et al., 2007; Nishioka et al., 2008; Kuckenberg et al., 2010]. Additionally, it is noteworthy that Sox2 and Esrrb transcription factors are indispensable for both ES and TS cell maintenance, albeit – at the mechanistic level – their functions are much better understood in the former stem cell type than in the latter [Avilion et al., 2003; Luo et al., 1997]. In contrast to ES cells, the expression of transcription factors associated with trophoblast self-renewal is dependent on signalling pathways; in the case of Tead4 and Ets2, external stimuli also crucially regulate protein activity at the posttranslational level [Nishioka et al., 2009; Man et al., 2003]. Notably – Tead4, Gata3, Elf5, Tcfap2c and Ets2 remain expressed in trophoblast cells undergoing terminal differentiation, both in vivo– within the Ectoplacental cone (EPC) – and in vitro. Over-expression experiments in TS and/or ES cells suggest that the precise expression levels of some of these transcription factors – e.g., Gata3 and Elf5 – are crucial for the balance between self-renewal and differentiation. At the molecular level, these transcription factors were shown to mutually sustain each others’ expression, via positive circuits, like that one observed among Cdx2, Eomes and Elf5 [Niwa et al., 2005; Ng et al., 2008; Ralston et al., 2010]. This supports the hypothesis that they may represents the core factors of the TS cell transcriptional network. However, limited data are currently available on a genomic scale. Very recently, a genome-wide chromatin-immunoprecipitation (ChIP) analysis revealed that Cdx2, Eomes and Elf5 bind a common set of enhancers [Chuong et al., 2013]. Interestingly, a significant subset of these enhancer sequences arose as a consequence of genomic integration of species-specific retroviruses – a phenomenon considered to be crucial for the evolution of the placenta in mammals [reviewed by Rawn & Cross, 2008]. In TS cells, the role of specific epigenetic modifications and the interactions

22


between transcriptional and epigenetic factors is poorly understood. The only mechanism – confirmed by multiple independent studies – links Histone-3-Lysine-4 tri-methylation (H3K4me3) and Histone-3-Lysine-27 acetylation (H3K27ac) with active gene regulatory elements, as commonly observed in a variety of cell types [Rugg-Gunn et al., 2010; Chuong et al., 2013]. Of note, a genome-wide promoter ChIP study found that Eomes, Tcfap2c and Smarca4 – which is a key component of the chromatin-remodeller and H3K4-methyl-transferase TrxG complexes – bound in close proximity to a set of active promoters [Kidder & Palmer, 2010]. Less clear is the genomic distribution and function of Histone-3-Lysine-27 tri-methylation (H3K27me3) and Histone-3-Lysine-9 tri-methylation (H3K9me3), two histone marks consistently associated with distinct repressive mechanisms, in the majority of mammalian cell types. In TS cells, recent genome-wide analyses found that neither H3K27me3, nor H3K9me3, are located at promoters or enhancers [Rugg-Gunn et al., 2010; Chuong et al., 2013]. However, these chromatin modifications were observed, in combination with H3K4me3, at specific DNA regulatory elements, which are associated with genes encoding for factors controlling differentiation of embryonic or trophoblast lineages [Rugg-Gunn et al., 2010; Alder et al., 2010]. It has been speculated that, at these sites, H3K27me3 and H3K9me3 may cooperate to repress transcription, by antagonizing the active mark H3K4me3, and therefore protecting TS cell self-renewal and multipotency. Currently, it is not clear, whether discrepancies among these studies may arise from differences in the micro-environment between in vivo and in vitro conditions, or whether these loci represent a small subset of DNA elements, potentially requiring genome-wide analyses, at higher resolution, in order to be detected.

Hence, a group of key transcription factors – including Tead4, Cdx2, Gata3, Eomes, Elf5, Tcfap2c and Ets2 – cooperatively regulate the TS cell gene expression programme. They mutually sustain each others’ expression and promote transcription by interacting with TrxG complexes. In contrast, in this lineage, the epigenetic mechanisms controlling gene repression are currently poorly understood.


1.2.3

23

Extra-embryonic Endoderm (XEN) cells

Extra-embryonic endoderm (XEN) cells are derived from the Primitive Endoderm (PrE) of blastocyst-stage embryos (E4.5) [Kunath et al., 2005]. Upon injection into blastocysts to form chimaera, XEN cells have been reported to contribute to the extra-embryonic endoderm layers, but not to the epiblast or the trophoblast [Kunath et al., 2005]. Self-renewal by undefined serum factors Extra-embryonic Endoderm (XEN) cells were originally derived by explanting blastocysts on a layer of feeder cells, in medium supplemented with serum [Kunath et al., 2005]. The fibroblast growth factor (Fgf) – although essential for PrE specification during pre-implantation development [Chazaud et al., 2006] – is reported to be dispensable for XEN cell derivation. Upon initial culture passages, XEN cells can be maintained on gelatin-coated plastics, in serum-containing medium, without MEF feeder layer and/or MEF-conditioned medium. When XEN cells are cultured on uncoated plastics, differentiation towards large and vacuolated cells is observed. The serum components required for XEN cell maintenance are currently unknown [reviewed by Artus & Hadjantonakis, 2012]. Key XEN cell transcription factors Limited information is available on the transcriptional mechanisms sustaining XEN cell self-renewal. Based on gene expression patterns during embryogenesis, characterization of gene knockout mouse models and in vitro experiments – involving forced expression in ES cells – a quartet of transcription factors – including Gata6 and Gata4, Sox17 and Sox7 – was shown to play a key role during PrE specification. Although each single factor appears to be dispensable for the initial phase of PrE specification – but it is necessary at slightly later stages of development [Morrisey et al., 1998; Soudais et al., 1995; Kanai-Azuma et al., 2002] – embryological investigations have revealed their crucial role in this process [e.g., Frankenberg et al., 2011; Artus et al., 2012]. Over-expression experiments, performed in ES cells, support this view [e.g., Fujikura et al., 2002; Niakan et al., 2010]. Loss

24


of one of these factors – during pre-implantation development – is thought to be compensated by the expression of the correspondingly highly related protein family member (e.g., Gata6 for Gata4 and vice versa; Sox17 for Sox7 and vice versa). Detailed in vivo observations, carried out during blastocyst formation – based on pharmacological inhibition of Fgf/Erk signalling and/or experimentally controlled expression of key transcription factors – have recently demonstrated that Gata6 is induced at the onset of PrE specification, leading to Gata4 and Sox17 activation; Sox7 expression approximately coincides with the moment in which the developmental potential of PrE progenitors becomes irreversibly restricted towards this lineage (see Section 1.1.3) [Silva et al., 2009; Nichols et al., 2009; Messerschmidt & Kemler, 2010; Morris et al., 2010; Yamanaka et al., 2010; Frankenberg et al., 2011; Artus et al., 2011]. Thus, a quartet of transcription factors – including the highly related Gata6 and Gata4, Sox17 and Sox7, respectively – promotes PrE specification during embryogenesis and sustains XEN cell self-renewal – by mediating partially overlapping activities.

1.3. Epigenetic restriction of ES cell lineage fate

1.3 1.3.1

25

Epigenetic restriction of ES cell lineage fate Waddington’s model

Mammalian embryogenesis is a temporally dynamic process. The specification of a cell lineage is not simply the result of the signals received, and the transcription factor repertoire expressed, by a cell population, at a given time; it is also influenced by the molecular events previously experienced by cell progenitors. Therefore, these past events leave a "memory" that affects signal transduction and transcriptional regulation during subsequent developmental stages. This memory is not encoded in the DNA, but it is superimposed on it: that is "epigenetic". The concept of epigenetic memory during development was best described by C.H. Waddington who used the metaphor of a ball rolling down a landscape of branched valleys to describe the progressive epigenetic restriction of developmental potential, occurring during embryogenesis [Waddington, 1957; see also an historical perspective by Goldberg et al., 2007]. The molecular nature of these epigenetic mechanisms – ensuring stable separation of cell lineage fates – is becoming progressively clearer [reviewed by Hemberger et al., 2009; Watanabe et al., 2013]. In particular, loss-of-function experiments in mouse models and cell lines have demonstrated that DNA methylation is essential for restricting Epiblast/ES cell lineage developmental fate. Additionally, loss of specific histone marks – as Histone-3-Lysine-9 methylation (H3K9me) – or chromatin-remodellers – like the NuRD complex – has revealed that these mechanisms also contribute to the stability of this lineage fate, via both shared and independent mechanisms.

1.3.2

DNA methylation

DNA methylation (5-methyl-cytosine; 5mC) refers to the enzymatic transfer of a methyl group to cytosines, at position 5 of their carboxyl ring. In mammals, this reaction occurs mainly within the context of the dinucleotide sequence 5’-CpG-3’ and is catalyzed by the DNA methyltransferase family of enzymes – including Dnmt1, Dnmt3a and Dnmt3b [reviewed by Allis et al., 2007, chapter 18].

26


Genomic distribution of CpG dinucleotides, CpG islands and 5-methylcytosines CpG dinucleotides (CpGs) are not randomly distributed in the genome, and their localization is considered to have been evolutionary selected [reviewed by Suzuki & Bird, 2008]. In the vast majority of the genetic sequence(≈ 99%), CpGs are dispersed at relatively low density and are found predominantly methylated; in the remaining 1% of the genome, they are highly concentrated in short domains (average length ≈ 1’000 nucleotides) termed "CpG islands" (CGIs)[reviewed by Deaton & Bird, 2011]. A genome-wide biochemical assay identified approximately 23’000 CGIs, with around half of them overlapping with known gene promoters – corresponding to about 23 of the total number of known promoters – and the other half – termed "orphan" CGIs – localized at unannotated intragenic and intergenic regions [Illingworth et al., 2010]. It has been speculated that the latter may represent promoter sequences not yet functionally annotated. The majority of CGIs (≈ 90%) are devoid of DNA methylation and characterized by a chromatin state permissive for transcriptional initiation (e.g., accessible to RNA Polymerase II); they are associated with genes expressed in all cell types, generally encoding for essential metabolic pathways. In contrast, about 10% of CGIs – on average characterized by lower CpG density – are found methylated, but in a lineage-specific manner; remarkably, CGI methylation is associated with transcriptional repression [e.g., Farthing et al., 2008; Mohn et al., 2008]. In vivo and in vitro studies showed that lineage-specific methylated CGIs undergo DNA methylation in a developmentally regulated manner (e.g., during embryogenesis or ES cell in vitro differentiation); they also revealed that 6 1% of CGIs are subject to developmentally regulated DNA demethylation [e.g., Mohn et al., 2008; Borgel et al., 2010]. It follows that, overall, DNA methylation levels and patterns are stably maintained through cell divisions. Notably, in somatic cell types, around 75% of CpG dinucleotides are commonly found to be methylated and their genome-wide patterns are generally observed to be faithfully inherited [Meissner et al., 2008; Popp et al., 2010]. However, two phases of genome-wide DNA methylation reprogramming occurs – during pre-implantation development and precursor germ cell (PGC) specification – in which DNA methylation levels


27

and patterns are erased and then de novo established on a global scale [reviewed by Morgan et al., 2005; Surani et al., 2007; Saitou et al., 2012].

Genome-wide 5mC reprogramming during pre-implantation development The pre-implantation phase of genome-wide DNA reprogramming is approximately concomitant with the specification of the first three cell lineages: Epiblast (Epi), Trophectoderm (TE) and Primitive Endoderm (PrE). Pioneering studies – aimed at investigating DNA methylation dynamics during early embryogenesis, using anti-5mC immunofluorescence microscopy – showed that, upon fertilization, the paternal and maternal pronucleus are subject to loss of 5mC with distinct kinetics [Mayer et al., 2000; Santos et al., 2002]. The paternal genome undergoes rapid DNA demethylation prior to the start of the first cell cycle; in contrast, gradual loss of 5mC is observed on the maternal genome and, after pronuclear fusion, in the newly formed genome throughout cleavage divisions. The lowest 5mC levels are detected during the morula to the blastocyst stage transition. Then, de novo DNA methylation occurs in a lineage-specific fashion. Of note, anti-5mC antibody staining appears to be stronger in ICM nuclei in comparison with TE nuclei. Studies focused on repetitive DNA elements – which collectively constitute about half of the mouse genome sequence – revelead that distinct repeat families are either susceptible (e.g., long interspersed nuclear elements; LINE) or resistant (intracisternal α particles; IAP) to demethylation during early cleavage divisions [Lane et al., 2003]. They also confirmed that, at the blastocyst stage, repetitive elements were generally less methylated in the extra-embryonic tissues than in the embryo proper [Chapman et al., 1984]. At the single-locus level, it was found that differentially methylated regions (DMRs), controlling the monoallelic parent-of-origin expression of imprinted genes, were escaping post-fertilization DNA demethylation [Oswald et al., 2000]. Genome-wide maps of 5mC levels, in the gametes and across early embryonic stages, have recently become available [Popp et al., 2010; Borgel et al., 2010; Smallwood et al., 2011; Smith et al., 2012; Seisenberger et al., 2012]. Dataset comparison confirmed that DNA-methylation reprogramming occurs in two steps on a genomewide scale, with a phase of demethylation – from fertilization to early blastocyst

28


stage – followed by a phase of de novo methylation – which is apparently completed soon after implantation. Afterwards, throughout embryogenesis and adult life – with the important exception of PGC development – 5mC levels and patterns are reported to be generally stable.

Mechanisms of DNA methylation, demethylation and recognition From a mechanistic point of view, Dnmt3A and Dnmt3B catalyze de novo DNA methylation, with the latter primarily involved in the establishment of lineagespecific 5mC patterns, during blastocyst formation [Okano et al., 1999; Borgel et al., 2010; Smallwood et al., 2011]. DNA methyltransferase recruitment has been linked, in a variety of contexts, to several mechanisms – including H3K9 methylation, H3K4 demethylation and transcriptional elongation across CGIs [e.g., Feldman et al., 2006; Ooi et al., 2007; Chotalia et al., 2009]; nevertheless, it remains to be elucidated how Dnmt3b is targeted, in different lineages, to specific genomic loci. Once DNA methylation is established, its maintenance is primarily due to Dnmt1, which – in the S phase of the cell cycle, upon DNA replication – is recruited to hemimethylated sequences, by the co-factor Np95/Uhrf1 [Li et al., 1992; Lei et al., 1996; Sharif et al., 2007]. DNA demethylation presumably occurs via both passive – involving DNA replication in the absence of maintenance methylation – and active mechanisms – mediated by enzymatic activities [reviewed by Branco et al., 2012]. In certain developmental contexts, one or the other class of mechanisms appears to be predominant. For example, the initial rapid demethylation of the paternal pronucleus has been interpreted as active; in contrast, the subsequent gradual loss of 5mC is considered to be caused by the progressive dilution of methyl marks, as suggested by the observation that Dnmt1 is excluded from the nucleus during the first three rounds of cleavage divisions [Howell et al., 2001]. Two enzymatic pathways have been proposed to contribute to active DNA demethylation. Genetic evidence supports a role for a multi-step process, initiated by cytosine deamination – that is, conversion of 5-methyl cytosine to uracil (5mC → U), catalyzed by Aid – followed by mismatched-base removal – involving Tdg/Mbd4 – and subsequent DNA repair – mediated by the base/nucleotide excision repair (BER/NER) pathways


29

[Popp et al., 2010; Cortázar et al., 2011; Cortellino et al., 2011]. Recently, it was discovered that the Tet family of enzymes catalyzes hydroxymethylation of 5mC to generate 5-hydroxy-methyl-cytosine (5hmC)[Tahiliani et al., 2009; Kriaucionis & Heintz, 2009]. This modification and its downstream turnover products, notably formyl- and carboxyl-cytosine, may constitute targets for BER/NER-mediated demethylation; alternatively, 5hmC may represent a novel epigenetic modification. During the phase of DNA methylation reprogramming underlying PGC specification, passive and active mechanisms have been recently proposed to act in concert [Seisenberger et al., 2012; Hackett et al., 2013]. It has been speculated that, in ES and somatic cells, specific loci may undergo continuous cycles of DNA methylation, hydroxymethylation and demethylation [Métivier et al., 2008; Kangaspeska et al., 2008; Ficz et al., 2011]. Hence, today, the 5mC metabolism appears to be more dynamic than previously thought. In a number of biological contexts, DNA methylation is considered a stable epigenetic mark, whose loss causes functional consequences (see below). At least two mechanisms have been reported to explain its functions: 5mC may inhibit recruitment of transcription factors [e.g., Perini et al., 2005]; or alternatively, it may attract methyl-CpG-binding domain (MBD) proteins (like MeCP2, e.g., Skene et al., 2010) – which directly or indirectly can modify chromatin accessibility. Nevertheless, it remains to be understood how this modification precisely influences the structure and function of chromatin [reviewed by Klose & Bird, 2006; Schubeler, 2012].

Restriction of ES cell lineage fate by DNA methylation DNA methylation has been recognized as a key mechanism in several biological processes, including X-chromosome inactivation [reviewed by Wutz, 2011], genomewide repression of retrotransposable elements and their derivative sequences [e.g., Lei et al., 1996; Walsh et al., 1998], and genomic parent-of-origin imprinting [reviewed by Bartolomei & Ferguson-Smith, 2011]. Remarkably, genetic inactivation of Dnmt1 or combined loss of Dnmt3a and Dnmt3b results in disrupted embryogenesis around midgestation (E9.5-11.5) [Lei et al., 1996; Okano et al., 1999]. Detailed embryological studies have shown that

30


large polyploid cells (giant cells) – characteristic of the extra-embryonic trophoblast layers – were included in embryonic tissues. Similarly, multiple models of 5mCdeficient ES cells become sensitive to external stimuli promoting transdifferentation towards the TE lineage [Jackson et al., 2004; Ng et al., 2008]. Genome-wide DNA-methylation maps of ES, TS and XEN cells have recently been produced [Senner et al., 2012]. Data mining and validation revealed that a relatively small group of promoters (≈ 1% of the total number of annotated promoters) – with some of them associated with genes with known trophoblast function – is methylated and silenced in ES cells and unmethylated and expressed in TS cells. Of note, among these, there is the gene enconding for the key TS cell transcription factor Elf5. The study of the 5mC-dependent transcriptional control of the Elf5 promoter – described in section 1.4 – has provided a molecular rationale for the restriction of ES cell developmental potential by DNA methylation [Ng et al., 2008]. Evidence for parallel mechanisms of developmental fate restriction of extraembryonic lineages has also been reported [Senner et al., 2012]. A relatively large group of CGIs – including promoters controlling the expression of many embryonic developmental regulators (e.g., Fox, Hox, Pax and Sox families of transcription factors) – were found to be significantly more methylated and repressed in TS and XEN cells in comparison to ES cells. Also, the Elf5 promoter is hypermethylated in XEN cells versus TS cells and – conversely – promoters encoding for key XEN cell transcription factors (e.g., Gata6, Sox17) present the opposite pattern.

1.3.3

H3K9 methylation

Microscopical observations reveal that – in the majority of mammalian cells – two types of chromatin can be distinguished within the nucleus at interphase, termed heterochromatin and euchromatin, respectively [reviewed by Allis et al., 2007, chapter 3 and 10]. Heterochromatin appears as densely associated chromatin fibers, predominantly made up of pericentromeric DNA sequences, devoid of genes. In contrast, euchromatin is defined as relatively dispersed chromatin fibers and is made up of gene-rich DNA sequences. A distinctive feature of heterochromatin is Histone-3-Lysine-9 methylation (H3K9me), catalyzed by the Histone-Lysine-


31

Methyl Transferase (HKMT) family Suv39h. H3K9me is also found in euchromatin at specific loci, usually corresponding with repressed DNA regulatory elements. Although Suv39h family proteins can be recruited to euchromatin, a distinct set of HKMTs – including G9a, Glp and Eset/Setdb1 – is thought to be primarily responsible for H3K9 methylation at gene-rich DNA sequences. It is currently not well understood to which extent and how this epigenetic mark is copied at mitosis [reviewed by Beisel & Paro, 2011]. H3K9 demethylation was demonstrated to be catalyzed by the JmjC-domain-family of enzymes. In somatic cell types, repetitive elements – representing approximately 50% of the genome – are generally highly enriched for both H3K9 and DNA methylation. A mechanistic link between these two epigenetic marks has been demonstrated at pericentromeric repeats, where Np95/Uhrf1 can recruit Dnmt1 to DNA replication foci, via either its SRA or Tudor domain, which recognizes hemimethylated CpG or H3K9me2/3, respectively [Liu et al., 2013]. At single-copy genes, H3K9 methylation is observed as an early event during developmentally regulated gene silencing – e.g., during ES cell differentiation – followed by DNA methylation, which occurs with delayed kinetics – as shown for Oct4 [Feldman et al., 2006]. At these euchromatic loci, MBD proteins may couple these modifications [Klose & Bird, 2006]. In contrast, in pluripotent cells, H3K9me and 5mC appear to have more distinct roles. Silencing of endogenous retroviruses (ERVs) – retrovirus-like elements with long terminal repeats, which made up about 10% of the genome and are overrepresented within euchromatic domains – is primarily dependent on H3K9me3, mediated by Eset/Setdb1, whereas DNA methylation is seemingly dispensable for this function [Matsui et al., 2010; Rowe et al., 2010]. Interestingly, the transcriptional control of these DNA regulatory elements is considered to have crucially influenced the evolution of the placenta [reviewed by Rawn & Cross, 2008]; furthermore, these regions are repressed by H3K9 methylation in TS cells [Chuong et al., 2013]. In contrast, IAP sequences, which represent the most recently acquired class of these elements, require both modifications for their silencing [Sharif et al., 2007; Matsui et al., 2010]. In ES cells, H3K9 and DNA methylation were shown to repress largely distinct subsets of single-copy genes [Bilodeau et al., 2009; Yuan et al., 2009; Yeap et al., 2009; Lohmann et al., 2010; Karimi et al., 2011].

32


Restriction of ES cell lineage fate by H3K9 methylation Zygotic inactivation of the, predominantly euchromatic, HKMT Eset/Setdb1 blocks embryogenesis at peri-implantation stages (≈ E5.5) [Dodge et al., 2004]. Setdb1-/blastocysts were reported to be normal, but they can neither develop upon implantation, nor can ES cell lines be derived from them. Large scale molecular screens showed that Setdb1-dependent H3K9 methylation contributes to the repression of genes enconding for developmental regulators, including key TE lineage transcription factors (e.g., Cdx2 and Tcfap2c) [Yuan et al., 2009; Yeap et al., 2009; Lohmann et al., 2010]. These molecular mechanisms appear to be relevant for the restriction of ES cell lineage fate, as supported by the observation that Setdb1depleted blastomeres, injected into 4- or 8-cell stage embryos, are preferentially incorporated into the trophectoderm [Yuan et al., 2009].

1.3.4

The NuRD epigenetic repressor complex

NuRD is a large protein complex, made up of histone deacetylase enzymes (e.g., Hdac1/2) and chromatin-remodellers (e.g., Mi-2), assembled around the key scaffold protein Mbd3. This complex has been associated with DNA methylation and gene silencing in several cell types and conditions, albeit the molecular mechanisms underlying these reported interactions and functions largely remain to be elucidated [reviewed by McDonel et al., 2009]. Interestingly, Mbd3 was recently shown to be capable of recognizing 5hmC in self-renewing ES cells [Yildirim et al., 2011] and to mediate inactivation of DNA enhancer elements during ES cell in vitro differentiation [Whyte et al., 2012]. Restriction of ES cell lineage fate mediated by NuRD In the absence of the core scaffold protein Mbd3, the histone-de-acetylase and chromatin-remodelling NuRD complex cannot assemble, and development is interrupted shortly after blastocyst implantation (≈ E5.5) [Kaji et al., 2006]. Careful embryological characterization revealed that blastocyst formation proceeds normally, but following implantation, expansion and differentiation of embryonic and extra-embryonic lineages is disrupted. ES cells cannot be derived from Mbd3-/- blas-


33

tocysts, but in vitro conditional inactivation revelead that this epigenetic complex is dispensable for self-renewal. However, Mbd3-/- ES cells do not respond to many stimuli promoting differentiation towards embryonic lineages; in contrast, they have increased sensitivity to external stimuli promoting conversion towards the TE lineage. At the chromatin level, the Elf5 promoter – normally tightly repressed in ES cells – was observed to be activated in response to these cues and this was associated with loss of 5mC, at this regulatory element [Latos et al., 2012]. In summary, ES cells deficient for DNA methylation, H3K9 methylation and the NuRD epigenetic complex, respectively, were reported to be aberrantly sensitive to extracellular signals promoting transdifferentiation towards a trophoblast fate. Remarkably, at the molecular level, these epigenetic mechanisms were observed to mediate transcriptional repression of genes encoding for key TS cell transcription factors, including Elf5 , Cdx2 and Tcfap2c [Ng et al., 2008; Yuan et al., 2009; Latos et al., 2012]. These findings, although limited to a small number of genes, suggest that two molecular pathways – one involving DNA methylation and NuRDdependent chromatin remodelling, and the other mediated by H3K9 methylation – act in concert – via transcriptional repression – to enforce the restriction of ES cell lineage fate.

34

1.4 1.4.1


ES cell transdifferentiation to TS-like cells Cell differentiation and transdifferentiation

In mammals, cell differentiation is a unidirectional process, irreversibly proceeding from common lineage progenitors – via stages of gradual restriction of developmental potential – to a multitude of distinct definitive cell types. Examples of cell transdifferentiation – that is, conversion of cells from one lineage to another – are observed in some invertebrates (e.g., imaginal disc transformation in D. Melanogaster) or in pathological conditions (e.g., cancer-associated metaplasia) [reviewed by Slack, 2007], but these events appear to occur very rarely during normal mammalian development and adult tissue homeostasis [reviewed by Wagers & Weissman, 2004]. However, during embryogenesis, the fate of a small group of differentiating cells is reversed in order to form the gametes which – passing through two phases of genome-wide epigenetic reprogramming – have the potential to acquire totipotency [reviewed by Feng et al., 2010; Saitou et al., 2012]. Nowadays, it has become possible to reprogramme cell fate in vitro, in order to obtain specific cell types [reviewed by Zhou & Melton, 2008; Graf & Enver, 2009; Yamanaka et al., 2010; see also an historical perspective by Graf, 2011]. Pioneering experiments demonstrated reprogramming of cellular identity upon nuclear transfer [Gurdon et al., 1958] or cell fusion [Blau et al., 1983]. Initial steps towards the understanding of the underlying molecular mechanisms indicated that a change in the gene expression programme was necessary for the switch from one cell type to another, and that individual master transcription factors can instruct this change [Davis et al., 1987]. The breakthrough discovery that somatic cell types can be reprogrammed to induced Pluripotent Stem (iPS) cells by a small number of transcription factors (e.g., originally by the ectopic expression of Oct4, Sox2, Klf4 and Myc) likely represents the strongest proof of this concept [Takahashi & Yamanaka, 2006]. During embryogenesis, key transcription factors – performing mutually antagonistic activities – compete to resolve developmental choices between alternative cell fates – as described for Oct4 and Cdx2, which compete to specify the ICM or TE lineage, respectively [Niwa et al., 2005]. Signalling pathways can bias the

1.4. ES cell transdifferentiation to TS-like cells

35

differentiation path at key developmental crossroads [e.g., Nichols et al., 2009; Morris et al., 2010; Frankenberg et al., 2011]. Epigenetic mechanisms – mediating transcriptional repression – contribute to the observed gradual restriction of cell developmental potential [e.g., Ng et al., 2008; Yuan et al., 2009; Latos et al., 2012]. Consistently, two main strategies have been found to promote in vitro conversion from one cell lineage to another [reviewed by Zhou & Melton, 2008; Graf & Enver, 2009; Papp & Plath, 2013]. On the one hand, activation of signalling pathways and, in particular, transcription factors, can potentially overcome lineage restrictions; on the other hand, inactivation of epigenetic mechanisms enforcing these restrictions can facilitate lineage conversion.

1.4.2

ES cell transdifferentiation to TS-like cells

The transdifferentiation of ES cells towards a trophoblast lineage fate represents an informative in vitro model for the investigation of the mechanisms underlying the first cell lineage specification event, leading to the formation of the ICM and TE, respectively [reviewed by Roper & Hemberger, 2009]. Furthermore, these studies have the potential to reveal epigenetic changes which may influence subsequent cell lineage choices, occurring at later developmental stages. These experiments have generally relied on ES cell lines, genetically modified in order to experimentally control either the induction of signalling pathways/transcription factors – capable of overriding cell lineage restrictions – or the suppression of epigenetic mechanisms that enforce these restrictions. A number of morphological and molecular marker analyses have been used to investigate cellular fate in these experimental models. The extent and depth of characterization is variable among different publications. In a minority of experiments – including those relying on continuos regulation of Oct4 or Cdx2 transcription factor activity and those involving transient hyperactivation of the Ras/Erk signalling – ES cell transdifferentiation has been described to lead to cells – termed TS-like cells – reported to be highly similar to genuine multipotent TS cells – which are derived from the TE/ExE compartment [Niwa et al., 2005; Lu et al., 2008]. In contrast, 5mC-deficient ES cells were shown to transdifferentiate – in response to external cues – towards a trophoblast fate, but without the ability to retain multipotency

36


and self-renewal, giving rise to terminally differentiated cell types (Figure 1.4)[Ng et al., 2008].

Transdifferentiation to TS-like cells by continuous regulation of Oct4 or Cdx2 transcription factor activity Hitoshi Niwa and colleagues described that, in ES cells, either continuous repression of the transcription factor Oct4 or continuous induction of the transcription factor Cdx2 resulted in transdifferentiation to TS-like cells [Niwa et al., 2000, 2005], which were capable of self-renewal, if cultured on a feeder layer – provided by murine embryonic fibroblasts (MEFs) – in TS cell culture medium (FGF+serum) supplemented with the appropriate inductive compound (doxycycline or 4-hydroxytamoxifen). The two distinct cell models of transdifferentiation were reported to form very similar TS cell-like colonies, within ten days from induction, via nearly equivalent mechanisms. The identity of these ES cell-derived TS-like cells was assessed by morphological observations and expression analysis of TS cell genes – including the transcription factors Cdx2 and Eomes and the Fgf receptor 2 (Fgfr2). Upregulation of these three key TS cell regulators was assumed to direct this lineage switch. Remarkably, TS-like cells induced via forced Cdx2 activity were capable, upon injection into host blastocysts, of contributing to the placenta of chimaeric embryos, as shown at E12.5. Oct4 and Cdx2 were reported to mutually antagonize each other, via two distinct mechanisms. At the transcriptional level, Oct4 was shown to directly repress Cdx2 transcription, as subsequently confirmed [Boyer et al., 2005; Marson et al., 2008]. The formation of a reciprocally inhibitory Oct4:Cdx2 complex was also described, even though the details around the physical interactions of these proteins are not well understood and may be mediated by other interactors, like the transcription factor Sall4 or the multisubunit chromatin remodeller NuRD [Nishiyama et al., 2009]. This landmark study has crucially contributed to the understanding of the mechanisms underlying the first differentiation event. Nevertheless, as discussed in section 1.4.3, it remains unclear to what extent these ES cell-derived TS-like cells resemble genuine TE/ExE-derived TS cells.


37

Transdifferentiation to TS-like cells by transient hyperactivation of Ras/Erk signalling

George Q. Daley and colleagues reported that transient hyperactivation of the Ras/Erk signalling – in iRAS ES cells, expressing an inducible, constitutively active HRasQ61L transgene – leads to irreversible transdifferentiation to TS-like cells, able to retain their acquired identity in the absence of the inductive signal [Lu et al., 2008]. Photographic evidence of lineage conversion up to 5 days from induction was provided, and molecular analyses were presented relative to the first 24 hours of this process. Increased levels of phosporylated Erk2 were associated with concomitant Cdx2 upregulation – possibly mediated by Tcfap2c – and Nanog downregulation, suggesting that Ras signalling may be an upstream regulator of these two key lineage-specific transcription factors. Furthermore, based on the reported stability of the acquired cell identity, it was speculated that the mechanisms ensuring epigenetic restriction of developmental potential were reset. These ES cell-derived TS-like cells, upon injections into host blastocysts, were shown to contribute to the placenta of E13.5 chimaeric conceptuses. On the basis of these data, as well as on experiments carried out on blastocysts cultured in vitro, proposed that Ras/Erk signalling – via Cdx2 induction – is necessary for TE formation during the first lineage specification event, in vivo. Other researchers have not confirmed the proposed link between this signalling and Cdx2 expression, albeit they have noticed that Ras/Erk signalling inhibition markedly impaired TE proliferation during pre-implantation development [Nichols et al., 2009]. Hence – confirming multiple reports on mouse models deficient for mediators of the Fgf/Ras/Erk pathway [Arman et al., 1998; Gotoh et al., 2005; Yang et al., 2006; Saba-El-Leil et al., 2003] – Erk2 phosphorylation is certainly necessary for the self-renewal of multipotent trophoblast cells, whereas its requirement for TE specification remains to be understood. The acquired identity of these ES cell-derived TS cells was primarily demonstrated on the basis of a limited contribution to the placenta of chimaeric mice; as discussed in section 1.4.3, it remains unclear whether these presumptive TS-like cells can be considered equivalent to bona fide TS cells.

38


Transdifferentiation towards a trophoblast fate in DNA methylation deficient ES cells Early studies, aimed to investigate the effect of the DNA-methylation inhibitor 5-azacytidine on cultured cell lines, were the first to report a link between 5mC and the stability of cell identity [Jones & Taylor, 1980]. Several years later, multiple models of DNA methylation-deficient ES cells were observed to aberrantly transdifferentiate towards a TE-lineage fate, in response to extracellular stimuli [Jackson et al., 2004; Ng et al., 2008]. Detailed morphological and molecular marker analyses revealed that hypomethylated ES cells, cultured in TS cell medium, frequently undergo an ordered lineage conversion, transiting through an unstable multipotent trophoblast state, prior to giving rise to terminally differentiated cells – which are, predominantly, polyploid trophoblast giant-like cells. Large scale DNA methylation screens, and subsequent experiments, discovered that the promoter of the transcription factor Elf5 was methylated and repressed in ES cells and unmethylated and active in TS cells [Farthing et al., 2008; Ng et al., 2008]. Elf5 was the only gene, among those enconding for known essential regulators of trophoblast multipotency and self-renewal, whose expression levels were found to correlate with its promoter methylation levels. In hypomethylated ES cells, Elf5 promoter – presenting reduced 5mC levels – is readily induced upon exposure to the TS cell culture micro-environment. This rapidly leads to the establishment of a feedforward transcriptional network including Cdx2 , Eomes and Fgfr2, which is considered to cause the observed transdifferentiation towards a trophoblast fate. Recently, a genome-wide DNA methylation analysis, with improved resolution and coverage, revealed an additional group of gene promoters – some of which encoding for genes with known trophoblast function – whose methylation pattern is similar to Elf5 , and may potentially represent novel TS cell lineage gatekeepers, like Elf5 [Senner et al., 2012]. Thus, the investigation of ES cell transdifferentiation events towards a trophoblast fate has provided evidence that key transcription factors (Cdx2) and potentially signalling pathways (Ras/Erk) can override the epigenetic restriction of ES cell fate; DNA methylation crucially contributes to the enforcement of this restriction.


A

39

TScells WT

EScells WT

RAS/ERKsignalling OCT4 CDX2 transcription factors

EScells

DNA methylation

Experimental models

B

3

RAS RAF MEK

P ERK

P

2

Cdx2

4

CDX2 Oct4

Elf5

OCT4

1

Figure 1.4: ES cell models of transdifferentiation to TS-like cells. (A, B) Wild-type ES and TS cells retain the developmental restriction of their lineage of origin – mainly contributing to the somatic cells and the gametes, and to the trophoblast layers of the placenta, respectively (see Figure 1.1). Genetically modified ES cells, with controlled Oct4 repression (1) or Cdx2 (2) induction, were shown to override their cell fate restriction, transdifferentiating towards TS-like cells [Niwa et al., 2005]; forced Ras/Erk hyperactivity (3) was proposed to lead to ES cell-derived TS-like cells, capable of retaining their identity in the absence of the inductive stimulus [Lu et al., 2008]. DNA-methylation deficient ES cells (4) frequently switch to a trophoblast fate – in response to the TS cell micro-environment – but without the ability to self-renew, therefore giving rise to terminally differentiated cells (e.g., trophoblast giant-like cells) [Ng et al., 2008].

40


1.4.3

Are the published models of ES cell-derived TS-like cells equivalent to genuine TE/ExE-derived TS cells?

It is noteworthy that the definition of "TS-like" cell in the published literature has been generally assigned without referring to a common set of parameters, and in particular without direct comparison with genuine TS cells, which are derived from the TE/ExE lineage. This is in contrast, for example, with the standard assays routinely performed to identify haematopoietic or pluripotent stem cells [e.g., Chambers et al., 2003]. Indirect comparison between ES cell-derived TS-like cells and bona fide TS cells, based on the data published in the literature, suggests the existence of dissimilarities. ES cell-derived TS-like cells – dependent either on forced repression of Oct4 (originally termed ZHBTc4, but here renamed Oct4-cKO, for clarity) or forced induction of Cdx2 (originally termed 4CER1 or 5ECER4G20, but here renamed iCDX2:ER, for clarity) – cannot be maintained in standard TS cell culture conditions (FGF+CM/serum), but require continuous supplementation of the inductive molecule (4HT or dox) and provision of a MEF feeder layer for indefinite selfrenewal [Niwa et al., 2005]. This is indicative of lack of stability of the acquired cell identity. TE/ExE-derived TS cell populations – similar to ES cells [reviewed by White & Dalton, 2005, see in particular Figure 1] – are characterized by a high proportion of cells in S phase – approximately 50% – and a short cell cycle [Ullah et al., 2008,(Figure 2); Tanaka et al., 1998, (Figure 1C); Erlebacher et al., 2004, (Figure 3C)]. Notably, Oct4-cKO or iCDX2:ER TS like cells appear to have a cell cycle profile more similar to somatic cells [Niwa et al., 2005, (Figure 2H)], featuring a smaller proportion of cells in S phase (≈ 15-30%) and a longer cell cycle. It follows that these cells may not be capable of indefinite self-renewal. The transcription factor Esrrb is required for self-renewal of both ES and TS cells [Luo et al., 1997]. In wild-type ES cells, Esrrb expression is approximatively comparable to 20-80% of TS cell mRNA levels; however, Oct4-cKO ES cells, upon induction of transdifferentiation, markedly downregulated the expression of this factor [Niwa et al., 2005, (Figure 2G)]. Although iCDX2:ER ES cell-derived TS-like cells are capable of integrating into


41

the trophoblast layers of the placenta, upon injection into host blastocysts, their fate is not restricted to this lineage and the extent of their contribution appears to be limited in comparison to that of genuine TS cells (see Table 1.1) [see Tanaka et al., 1998, (Figure 3) and Niwa et al., 2005, (Figure 2J), for comparison]. The molecular characterization of iRAS ES cell-derived TS-like cells was limited in terms of markers analyzed and period of observations (0-24 hours from induction) [Lu et al., 2008]. Notably, within this time frame of analysis, the amplitude of Cdx2 upregulation was markedly smaller than that observed in Oct4-cKO or iCDX2:ER ES cell-derived TS-like cells, and in particular, did not lead to the induction of Eomes, a key direct target gene encoding for an essential TS cell transcription factor [see Lu et al., 2008 (Supplementary Figure 1) and Niwa et al., 2005 (Figure 2G), for comparison]. iRAS ES cell-derived TS-like cells were shown to colonize the trophoblast layers of the placenta, upon blastocyst injection; however, the frequency of their observed cell fate restriction towards the trophoblast lineage was not reported, and the extent of their contribution appears to be limited (see Table 1.1) [Lu et al., 2008, (Figures 2K&L)]. In conclusion, some of the published models of ES cell-derived TS-like cells, and in particular those dependent on forced regulation of either Oct4 or Cdx2 (Oct4cKO or iCDX2:ER) are certainly characterized by an expanded developmental potential, being capable of contributing at high frequency to the trophoblast lineage. Nevertheless, a review of the published literature suggests that they may not be equivalent to genuine TS cells, derived from the TE/ExE tissues.

42


Cell type

Pre-culture

Restriction towards trophoblast fate Frequencyb

Contributionc

Observationsd

8

56/56 (100%)

wide

E6.5-E18.5

iCdx2:ER TS-likef

1

2/4 (50%)

limited

E12.5

iRAS TS-like

?

2/? (?)

limited

E13.5

0/5 (0%)

none

E12.5/13.5

(weeks)a EGFP TSe g

control ES cellsh

Table 1.1: Comparative analysis of ES cell-derived TS-like cell fate in vivo– based on a review of the published literature a In vitro culture prior to blastocyst injections. b # chimaeric embryos with ES cell-derived TS-like cell fate restricted to the trophoblast lineage vs total # of chimaeric embryos. c Relative contribution to the trophoblast lineage based on qualitative comparison of published photographs. d Reported period of observation. e EGFP TSE3.5 or EGFP TSE6.5 [Tanaka et al., 1998]. f 5ECER4G20 ES cell-derived TS-like cells – which are Oct4+/Bsd , Cdx2:ERiTG(+4HT) – were transdifferentiated by culture in FGF+serum+4HT on a MEF feeder layer [Niwa et al., 2005]. g iRAS ES cell-derived TS-like cells – which are HRAS(Q61L)iTG(+dox) – were transdifferentiated by culture in FGF+serum+dox on a MEF feeder layer [Lu et al., 2008]. h Contribution of uninduced 5ECER4G20 (4) and iRAS (1) ES cells [Niwa et al., 2005; Lu et al., 2008]. iTG = inducible transgene; 4HT= 4-hydroxy-tamoxifen; dox = doxycycline; Bsd = blasticidin.

1.5. Aims of the research project

1.5

43

Aims of the research project

Cell lineage transdifferentiation studies have significantly improved the understanding of the molecular mechanisms governing developmental decisions [reviewed by Graf & Enver, 2009; Papp & Plath, 2013], and – in a long-term perspective – they hold great promises for clinical applications, such as disease modelling, drug screening and regenerative therapies [reviewed by Yamanaka & Blau, 2010; Cherry & Daley, 2012]. In particular, the investigation of conditions, promoting Embryonic Stem (ES) cell transdifferentiation towards a trophoblast lineage fate, has become an informative in vitro model for the study of the first differentiation event during embryogenesis; this knowledge can be used to guide the design of strategies for inducing cellular reprogramming, especially towards Trophoblast Stem (TS)-like cells. Using this experimental approach, the mutually antagonistic roles of the transcription factors Oct4 and Cdx2 in specifying epiblast (Epi) and Trophectoderm (TE) cell fate, respectively, were revealed [Niwa et al., 2005], and DNA methylation was demonstrated to subsequently restrict embryonic lineage fate [Ng et al., 2008]. Remarkably, it was recently proposed that transient activation of the Ras/Erk signalling pathway was capable to reset the epigenetic mechanisms enforcing ES cell developmental potential, enabling the conversion to stable TS-like cells, even upon withdrawal of the inductive stimulus [Lu et al., 2008]. The evidence provided to support this hypothesis can be considered limited (see Section 1.4.3), but – if confirmed – this would represent the first report of a cytosolic signal capable of reverting the earliest restriction of developmental potential occurring during embryogenesis – an event observed to be irreversible in physiological conditions. However, it is noteworthy that while models of ES cell-derived TS-like cells have been described, it is currently unclear to what extent they resemble genuine TS cells, derived from the TE/Extra-embryonic ectoderm (ExE) lineage. In particular, scarce information is available on the epigenetic status of these presumptive TS-like cells, albeit the resetting of chromatin structure appears to be crucial to ensure the stability of the acquired lineage. Notably, in this and also in different contexts of induced cellular reprogramming – as somatic cell reprogramming to induced pluripotent stem (iPS) cells – lineage conversion/reversion is observed to proceed

44


at low efficiency and to result in unstable cell identities; additionally, even those cells, which are considered to be successfully converted, frequently retain epigenetic features of their origin [e.g., Zwaka, 2010; Papp & Plath, 2013]. This suggests that current transdifferentiation protocols rely on rare stochastic events, likely to be different from the mechanisms that – during embryogenesis – efficiently give rise to all cell types necessary for adult life. These considerations prompted me to study the events of ES cell transdifferentiation to TS-like cells in order to assess efficiency, extent and stability of this lineage conversion and to potentially improve this process. Here, I set out to investigate whether ES cells reprogrammed towards the trophoblast lineage by regulatable expression of either Oct4 or Cdx2 transcription factor, or by forced activation of Erk signalling are equivalent to genuine TE/ExEderived TS cells. In particular, the specific aims of my research project have been: 1. To derive two genetically modified ES cell lines with conditional Erk signalling – induced via activation of either Ras GTPase (iRAS) or the downstream Raf kinase (iRAF), respectively – and to characterize their developmental potential upon forced transduction of these signals. 2. To undertake a comprehensive comparative analysis of ES cell transdifferentiation to TS-like cells, evaluating two models previously established – with either Oct4-conditional knockout (Oct4-cKO) or Cdx2-inducible knockin (iCdx2) – and the two newly derived – with inducible Erk signalling (iRAS and iRAF) – versus TE/ExE-derived TS-like cells, based on the investigation of multiple morphological and molecular features. 3. To evaluate whether, and to which extent, the genome-wide DNA methylation profile of ES cell-derived TS-like cells is reset in order to reproduce that of TE/ExE derived TS-like cells. 4. To attempt to improve this lineage conversion by globally reducing DNA methylation levels – via inhibition of Erk and Gsk3 signalling (2i conditions; Ying et al., 2008) – prior of inducing transdifferentiation; or alternatively, by combining activation of Raf/Erk signalling and Cdx2 transcription factor.

Chapter 2 Materials and Methods

45

46

2.1

CHAPTER 2. MATERIALS AND METHODS

Cell cultures

Embryonic stem (ES) cells and trophoblast stem (TS) cell lines are described in Table 2.1; additionally, IM8A1 extra-embryonic endoderm (XEN) cells [Kunath et al., 2005] and human embryonic kidney 293 (HEK293) cells were cultured. ES cells were routinely grown on a feeder layer of UV-irradiated murine embryonic fibroblasts (MEFs) in gelatin-coated (1g/L) tissue-culture plastics (Fisher Nunc); occasionally – if necessary for downstream analyses – they were cultured, without feeder layer, directly on gelatin-coated plastics. DMEM culture medium (Gibco 41965) was supplemented with: 15% fetal bovine serum (Gibco 10270-106), 1X Antimytotic/Antibiotic (Invitrogen 15240-062), 1mM Na-pyruvate (Invitrogen 11360-036), 50µM 2-mercaptoethanol (Invitrogen 31350-010), 1X MEM nonessential amino acids (Invitrogen 11140-035), 1000 U/ml LIF (ESGRO, Millipore) or equivalent concentration of custom made LIF. Where specified, PD0325901 (1µM; Stemgent 04-0006) and CHIR99021(3µM; Stemgent 04-0004) – together termed 2 inhibitors (2i) [Ying et al., 2008] – were added in cultures. Before reaching confluency, cell colonies were dissociated to a single-cell solution by incubation in 0.05% Trypsin/EDTA (Invitrogen 25300-054) supplemented with 2% chicken serum and passaged with an appropriate ratio to fresh plastics; medium was replaced daily. TS cells were cultured directly on tissue-culture plastics (Fisher Nunc) in medium prepared by combining 30% of fresh medium with 70% of conditioned medium (CM) – which is medium enriched for soluble factors secreted by MEFs; briefly, in order to prepare CM, MEFs were cultured over a 8 day period and medium was collected and 0.45 µM-filtered every 2-3 days. RPMI 1640 medium (Gibco 21875-091) was supplemented with: 20% fetal bovine serum (Gibco 10270106),1X Anti-mitotic/Antibiotic (Invitrogen 15240-062), 1mM Na-pyruvate (Invitrogen 11360-036), 50µM 2-mercaptoethanol (Invitrogen 31350-010), 1X MEM non-essential amino acids (Invitrogen 11140-035), bFGF (either 25ng/ml, Sigma F0291 or 50ng/ml, Peprotech 100-18B) and 1µg/ml heparin (Sigma H3149). Before reaching confluency, cell colonies were dissociated to small clumps of cells by incubation in 0.05% Trypsin/EDTA (Invitrogen 25300-054) supplemented with 2% chicken serum and passaged with an appropriate ratio to fresh plastics; medium was replaced every two days.

2.1. Cell cultures

47

Name

Original name

Description

Rs26 TS

Rosa26 TSa

| TEE3.5 /ExEE6.5 ; ROSA26 (129Sv) mice

EGFP TS

EGFP TSa

~ TEE3.5 /ExEE6.5 ; B5/EGFP (ICR) mice

E14 ES

E14 Tg2a ESb

| ICME3.5 ; 129/Ola mice

J1 ES

J1 ESc

| ICME3.5 ; 129S4/SvJae mice

control ES

EGFP ESd

iRAS ES

ER:HRAS(G12V) ESd

ER:HRAS(G12V)iTG(+4HT) E14 Tg2a ES

iRAF ES

ΔRAF1:ER ESd

ΔRAF1:ERiTG(+4HT) E14 Tg2a ES

Oct4-cKO ES

ZHBTc4 ESe

Oct4-/- ,Oct4rTG(+dox) CGR8 ES (129)

iCdx2 ES

iCdx2 ESf

Cdx2iTG(+dox) KH2 ES (129/B6)

iCDX2:ER ES

Cdx2:ER ESd, g

Cdx2:ERiTG(+4HT) E14 Tg2a ES

iRAF/iCDX2:ER ES

ΔRAF1:ER/Cdx2:ER ESd

ΔRAF1:ER, Cdx2:ERiTG(+4HT) E14 ES

EGFPTG E14 Tg2a ES

Table 2.1: ES cell-derived TS-like cell models subject to analysis (plus control ES and TS cell lines) a TS cells were derived by the Janet Rossant’s laboratory (Toronto, Canada) from either Rosa26 or B5/EGFP mouse lines [Tanaka et al., 1998]. Rosa26 mice ubiquitously express a proviral trangene (reverse orientation splice acceptor βgeo, line 26) – encoding for an engineered protein, termed βgeo, with both β-galactosidase (β-gal) and neomycin phosphotransferase (neo) activities – integrated, in single-copy, into a locus located on chromosome 6; trangene integration interferes with the expression of 3 non-coding transcripts. Hetero- and homo-zygous animals do not show any overt phenotype and are fertile; however, homozygotes are obtained at reduced ratio from heterozygotes intercrosses [Friedrich & Soriano, 1991; Zambrowicz et al., 1997]. B5/EGFP mice ubiquitously express a marker trangene – encoding for enhanced green fluorescent protein (EGFP) – randomly integrated into the genome [Hadjantonakis et al., 1998]. b [Hooper et al., 1987]. c Rudolph Jaenisch’s laboratory (Cambridge, USA) [Li et al., 1992]. d Derived for this research project (see Section 2.2 & 2.4). e Austin Smith’s laboratory (Cambridge, UK) [Niwa et al., 2000]; of note, a single copy of Oct4rTG(+dox) is randomly integrated into the genome. f Hubert Schorle’s laboratory (Bonn, Germany) [Kuckenberg et al., 2010]; of note, a single copy of Cdx2iTG(+dox) is integrated into the ColA1 locus [Beard et al., 2006]. g Originally described in [Niwa et al., 2005]; of note, in contrast to this research project, H.Niwa and colleagues integrated Cdx2:ERiTG(+4HT) not into E14 Tg2a ES cells, but into Oct4-cKO (ZHBTc4) ES cells (to generate 4ECER1 ES cells) or into Oct4+/Bsd EB5 ES cells (to generate 5ECER4G20 ES cells). iTG = inducible transgene; rTG = repressible transgene; 4HT = 4-hydroxy-tamoxifen; dox = doxycycline; Bsd = blasticidin.

48


XEN cells were cultured on gelatin-coated (1g/L) tissue-culture plastics (Fisher Nunc) in RPMI 1640 medium (Gibco 21875-091) supplemented with: 10% fetal bovine serum (Invitrogen Gibco 10270-106),1X Anti-mitotic/Antibiotic (Invitrogen 15240-062), 1mM Na-pyruvate (Invitrogen 11360-036), 50µM 2-mercaptoethanol (Invitrogen 31350-010), 1X MEM non-essential amino acids (Invitrogen 11140035). XEN cells grow as clusters of individual cells; before cells came into contact, they were detached by incubation in 0.05% Trypsin/EDTA (Invitrogen 25300-054) supplemented with 2% chicken serum and passaged with an appropriate ratio to fresh plastics; medium was replaced daily. HEK293 cells were cultured directly on tissue-culture plastics (Fisher Nunc) in DMEM medium (Gibco 41965) supplemented with: 10% fetal bovine serum (Gibco 10270-106), 1X Penicillin/Streptomycin (Invitrogen), 200 mM Glutamine (Invitrogen 31985-047). Where indicated, 4-hydroxy-tamoxifen (4HT, Sigma H7904) and doxycycline (dox, Sigma D3891) were added to culture at the final concentration of 1µM (unless, otherwise specified).

2.2

DNA plasmids

Plasmid maps are displayed in Figure 2.1. The pCAG-ΔRAF1:ER-IRES-EGFP plasmid was prepared via a two-step cloning strategy. The ΔRAF1:ER coding sequence segment (BamHI-BamHI) was cut out from the original pBabe-Puro-ΔRAF1:ER plasmid (courtesy of S.Cook, The Babraham Institute, Cambridge, UK; Samuels et al., 1993; Boughan et al., 2006) and introduced into the multiple cloning site (MCS) of the pGEM-T Easy plasmid (Promega 1360); subsequently, it was excised as three fragments – flanked by EcoRI-SalI, SalI-XbaI, XbaI-EcoRI restriction sites, respectevely (ΔRAF1:ER contains an internal EcoRI site) – and inserted, in the correct orientation, into a unique EcoRI site of the pIRES-EGFP plasmid (courtesy of A.Nagy, Toronto, Canada). The pCAG-HRASG12V -IRES-EGFP plasmid was prepared via a two-step cloning strategy. The HRASG12V coding sequence segment (HindIII-HindIII) was cut out from the original pLNCX2-HRASG12V (courtesy of M.Narita, CRI-CRUK,

2.2. DNA plasmids

49

Cambridge, UK; Narita et al., 2011) and introduced into the MCS of the pGEM-T Easy plasmid (Promega 1360); subsequently, it was excised as three fragments – flanked by EcoRI-XhoI, XhoI-AleI, AleI-EcoRI restriction sites, respectively (the HRASG12V sequence contains an internal EcoRI site) – and inserted, in the correct orientation, into a unique EcoRI site of the pIRES-EGFP plasmid (courtesy of A.Nagy, Toronto, Canada). The sequence of these newly derived plasmids was validated by Sanger sequencing of the inserted fragments and of the flanking regions, in the recipient plasmid backbone. pCdx2-IRES-EGFP is a gift of H.Niwa (RIKEN, Kobe, Japan). Plasmids were prepared using standard methods, including DNA digestion by restriction enzymes, DNA agarose-gel electrophoresis, DNA ligation, bacterial transformation with plasmids, solid and liquid bacterial cultures, isolation of plasmidic DNA from bacterial cells. DNA digestions with restriction enzymes were performed according to manufacturer’s instructions. Digestion products were resolved by agarose gel electrophoresis and visualized with SYBR Safe DNA staining (Invitrogen) under a transilluminator; size of molecules was determined by loading, in parallel, a DNA molecular weight marker (1Kb or 100bp DNA ladder, Invitrogen). Gel bands containing fragments of interest were cut out and DNA was purified using the QIAquick Gel extraction kit (Qiagen). Ligation of DNA backbone plasmids and inserts was performed overnight, at 4℃, as shown in the table. Ligation products were transformed into E.Coli DH5α competent cells (Invitrogen 18265-17). Bacteria (50µl/reaction) were defrosted, gently mixed with 5 µl of ligated DNA, and kept on ice for 30 minutes, before being heat-shock for 20 seconds at 37℃ and immediately returned on ice for further 2 minutes. Pre-warmed Luria broth (LB) medium (950 µl) was added into the test tubes and bacteria were incubated for 1 hour, at 37℃, with continuous shaking, prior to be spread on LB/agar plates containing 100µg/ml ampicillin (Amp); if required, plates were also supplemented with X-gal 50µg/ml and IPTG 0.001M for white/blue colony screening. Upon overnight incubation, resistant colonies were picked and expanded into LB/Amp liquid cultures. Plasmidic DNA was extracted using the DNA Midi-Prep kit (Qiagen).

50

CHAPTER 2. MATERIALS AND METHODS Polyoma Ori 273..457

Amp R 6983..7642

hCMV enh 740..1098 ColE1 ori 6203..6885 CAG pro 1113..2354

pCAG-ERHRAS(G12V)-IRES-EGFP 7857 bp bGH pA 5553..5764

EGFP 4734..5453 (hb)ER 2505..3456 IRES 4158..4730

HRAS(G12V) 3484..4058

Polyoma Ori 273..457

Amp R 7435..8094


pCAG-RAF1ER-IRES-EGFP 8309 bp bGH pA 6005..6216

EGFP 5186..5905 (delta)RAF1 2493..3545 IRES 4610..5182 (hb) ER 3546..4505

Polyoma Ori 273..457

Amp R 7123..7782


pCAG-Cdx2ER-IRES-Puro 7997 bp bGH pA 5693..5904

Puro R 4994..5593 Cdx2 2468..3406 IRES 4418..4990 (hb) ER 3407..4366

Figure 2.1: DNA plasmid feature maps Plasmid maps show main functional DNA elements: HRAS(G12V) = full length coding sequence (CDS) of the human HRASG12V , oncogenic isoform; (hb)ER = hormone binding domain CDS (nucleotides 1022-1972) of mouse estrogen receptor 1(α), with modified binding specificity for 4-hydroxy-tamoxifen(4HT); (delta)RAF1 = kinase domain CDS of human RAF1 ; CAG pro = chicken α-globin promoter; hCMV enh = human cytomegalovirus VI enhancer; IRES = internal ribosomal entry site; bGH pA = rabbit β-globin polyA signal; ColE1 ori = E.Coli replication origin; Polyoma Ori = SV40 polyoma virus replication origin; Amp R = ampicillin resistance; Puro R = puromycin resistance.

2.3. Transient transfection of HEK293 cells with episomal DNA

51

DNA ligation, overnight (4℃) insert

control

background

2x buffer

5.0

5.0

5.0

plasmid backbonea

1.0

1.0

1.0

insert

3.0

a

control T4 DNA ligase (3u/µl)b

2.0 1.0

deionized water 10.0

1.0

1.0

1.0

3.0

10.0

10.0

Different ratio of backbone:insert number of molecules were routinely tested (ranging from 1:2 to 1:10); relative volumes varied according to the size of the molecules. b pGEM-T Easy ligation kit (Promega 1360) a

2.3

Transient transfection of HEK293 cells with episomal DNA

HEK 293 cells were transiently transfected with circular pCAG-HRASG12V -IRESEGFP, pCAG-ΔRAF1:ER-IRES-EGFP or the parental plasmid, using Lipofectamine 2000 (Invitrogen 11668-019) according to manufacturer’s instructions. Briefly, in parallel, 5µg of plasmid DNA (1µg/µl) and 10µl of Lipofectamine 2000 were dissolved in two distinct 500 µl aliquots of DMEM (Invitrogen 41965). After 5 minutes of incubation, aliquots were combined and incubated for additional 20 minutes. The resulting solution was homogenously distributed on a culture of HEK293 cells (at ≈ 60% of confluency), grown in a 6cm plastic dish, in medium devoid of antibiotics. Medium was replaced with standard HEK293 medium (containing antibiotics) following 5 hours of incubation. Efficiency of transfection was assessed by observation with a Nikon TS100 epifluorescence microscope and found to be approximately 30% after 24 hours.

52

2.4


Derivation of genetically modified ES cell lines

iRAS, iRAF and control ES cells were derived via transfection of E14 Tg2a ES cells with linearized pCAG-HRASG12V -IRES-EGFP, pCAG-ΔRAF1:ER-IRES-EGFP or the parental plasmid, respectively, using Lipofectamine 2000 (Invitrogen 11668-019), in order to promote random integration of these DNA vectors into the genome. Briefly, in parallel, 30µg of linearized plasmid DNA (1µg/µl; digested with the ScaI restriction enzyme, which performs a single cut into the AmpR sequence) and 60µl of Lipofectamine 2000 were dissolved in two distinct 1.5ml aliquots of DMEM (Invitrogen 41965). After 5 minutes of incubation, aliquots were combined and incubated for additional 20 minutes. In the meanwhile, an ES cell culture – grown in a gelatin-coated 10cm plastic TC-dish (at ≈ 80% of confluency), without feeder cells – was harvested as single-cell suspension – by incubation in a solution of 0.05% Trypsin/EDTA (Invitrogen 25300-054) and 2% chicken serum, followed by inactivation, washing and gentle pipetting – and passaged into an equivalent fresh gelatin-coated TC-dish (without feeder cells) in medium contained a reduced serum concentration (10%, instead of the standard 15%) and devoid of antibiotics. At the end of the incubation period, the solution of DNA/Lipofectamine 2000 was homogeneously distributed across the TC-dish, containing the freshly passaged ES cell culture. Upon 6 hours on incubation, the medium was replaced with standard ES cell medium. Hence, transfection occurred in the period in which the single-cell suspension gradually attached to the bottom of the dish, in order to maximize the cell surface area exposed to the transfection reagent. ES cell colonies stably expressing either pCAG-HRASG12V -IRES-EGFP or pCAG-ΔRAF1:ER-IRES-EGFP or the parental plasmid, were isolated via a twostep strategy. After 48-72 hours, ES cells subject to transfection, were harvested as single-cell suspensions and filtered through a 40µM cell strainer in a solution of 1X PBS/2% fetal bovine serum; EGFP+ cells – representing approximately 1-10% of the total cell number – were collected by Fluorescence Activated Cell Sorting (FACS; see Section 2.9) and plated in standard ES cell conditions on a layer of feeder cells. A second round of selection was performed by manually picking individual ES cell colonies showing a high and homogeneous EGFP expression, as observed with a Nikon TS100 epifluorescence microscope. Selected ES cell clones were expanded


53

and cultured in the presence/absence of 4-hydroxy-tamoxifen (4HT), in order to induce the activity of either HRASG12V small GTPase or ΔRAF1:ER kinase domain. Functional validation was performed by Western blot for phosphorylated-ERK1/2 and EGFP. iRAS ES cell clone 12, iRAF ES cell clone D8 and control ES cell clone A3 were chosen as experimental models. iCDX2:ER and iRAF/iCDX2:ER ES cells were derived via transfection of either E14 Tg2a or iRAF ES cells, respectively, with linearized pCdx2:ER-IRES-Puro (courtesy of H.Niwa, RIKEN, Kobe, Japan), as described above. E14 and iRAF ES cell colonies stably expressing pCdx2:ER-IRES-Puro were isolated via antibiotic selection (puromycin, final concentration of 1µg/µl) for a period of 12 days. Resistant ES cell clones were expanded and cultured in the presence/absence of 4HT, in order to induce stabilization, nuclear translocation and transcriptional activity of Cdx2:ER. Functional validation was performed by anti-Cdx2 immunofluorescence staining (see Section 2.7), followed by automatic imaging with the Becton Dickinson Pathway microscope. Briefly, this microscope automatically acquires the nuclear/cytoplasmic ratio of anti-Cdx2 intensity signal (with the nuclear area defined according to the DAPI counterstaining signal) of ≥300 cells, across four different image fields. iCDX2:ER and iRAF/iCDX2:ER ES cell clones presenting comparable low levels of nuclear anti-Cdx2 staining, in basal conditions, and high nuclear levels, upon 4HT treatment (24h), were selected, as shown in figure 3.23, A & B. iCDX2:ER ES cell clone C2 and iRAF/iCDX2:ER ES cell clone D1 were chosen as experimental models. Of note, both genetically modified ES cell lines – in basal conditions – express low levels of Cdx2, which is a potent inducer of differentiation; thus, in order to minimize the risk of spontaneus exit from self-renewal, cells were cultured in the presence of 2i (see section 2.1).

2.5

ES cell transdifferentiation to TS-like cells

ES cell models of transdifferentiation to TS-like cells – in the unstimulated state – were routinely maintained by culture on a layer of feeder cells in standard ES cell medium (LIF+serum), unless otherwise stated. Prior of inducing transdifferentiation, cell cultures were depleted of feeder cells – by incubating single-cell suspensions for 20-30 minutes on uncoated tissue-culture (TC) plastics, which

54


results in preferential attachment of feeder cells to the plastic, leaving ES cells in suspension – and transferred on gelatin-coated TC plastics, without feeder layer. At the start of the transdifferentiation course, ES cell cultures were harvested, counted by using the automatic Casy Counter and plated at clonal density (1x104 cells/25cm2 ) on a layer of feeder cells, in TS cell medium (see section 2.1), supplemented with compounds (4HT or dox, at the final concentration of 1µg/ml; see Section 2.1), as appropriate for each distinct inducible system. Medium was changed every two days. Cell cultures were harvested by treatment with 0.05% trypsin/EDTA in 2% chicken serum, either as small clumps of cells or as single-cell suspension: in the former case, cultures were split according to defined ratios (e.g., 1/10 of the original culture) and passaged to fresh dishes/plates; in the latter case (e.g., for proliferation studies), cells were counted using Casy Counter and defined cell numbers were plated into fresh TC-plastics, at clonal density (e.g., 1x104 cells/25cm2 ). TS cells were cultured in parallel – as reference – under identical conditions, at reduced density (1x103 cells/25cm2 ); this was because they were observed to proliferate at least 10 times faster than transdifferentiating cells (see Figure 3.8). Therefore, plating TS cells at reduced density, allowed to passage test and reference cultures with the same frequency, without reaching overconfluency.

2.6

Phase-contrast microscopy

ES cells undergoing transdifferentiation to TS-like cells were observed with a Nikon TS100 inverted microscope. Images were recorded digitally, as TIFF files, with a CCD camera, using the Adobe Photoshop CS2 software (QImaging plug-in).

2.7

Immunofluorescence microscopy

Cell colonies undergoing ES cell transdifferentiation to TS-like cells, and control cell lines, were grown on plastic coverslips, fixed with 4% paraformaldehyde in PBS for 10 minutes (min) and permeabilized with 0.2% Triton X-100 in PBS for 30 min, at room temperature. Blocking was performed with 0.25% bovine serum albumin, 0.1% Tween-20 in PBS (PBT/BSA) for 15min, at room temperature.

2.8. Flow cytometry analysis for ES, TS and XEN cells Antibody

IF dilution

55

Catalogue reference

Primary antibodies mouse anti-Cdx2

1:500

Biogenex MU392-UC

goat anti-Elf5

1:200

Santa Cruz sc-9645

Secondary antibodies donkey AF488 anti-mouse IgG

1:500

Invitrogen A21202

donkey AF568 anti-goat IgG

1:500

Invitrogen A11057

Table 2.2: Antibodies used for immunofluorescence microscopy

Cells were immunostained with dilutions of primary antibodies (see Table 2.2), in PBT/BSA, for 1 hour (1h), at room temperature. After three washes (3x5min) with PBT/BSA to remove the excess of primary antibodies, cells were incubated with fluorochrome-conjugated secondary antibodies (either AlexaFluor 488 or 568, Invitrogen) for 1h, at room temperature. After three washes (3x5min) with PBS to remove the excess of secondary antibodies, cell nuclei were counterstained with 3 µg/ml of 4,6-diamidino-2-phenylindole (DAPI) for 5min, at room temperature. After two washes (2x5min) with PBS, cells were mounted in 50% glycerol in PBS, on standard glass microscope slides. Stainings were observed using an Olympus BX41 epifluorescence microscope. Digital photographs were taken with a high-resolution CCD camera (F-view) by using the Cell-F software. Grey scale images (TIFF files) were captured using separate filter sets for green (AF488), red (AF568) and blue (DAPI) light; subsequently they were pseudo-coloured, merged in RGB mode and saved as PSD files by using Adobe Photoshop CS4 software.

2.8

Flow cytometry analysis for ES, TS and XEN cells

ES cells undergoing transdifferentiation towards TS-like cells, and control cell lines, were collected and analysed at regular intervals of time for the expression of surface antigens specific for ES cells (CD31/Pecam1), TS cells (CD40) and XEN cells (CD140a/Pdgfrα), respectively. Protocol was adapted from Rugg-Gunn et al., 2012

56


Transdifferentiation requires a feeder layer of murine embryonic fibroblasts (MEFs), which express CD40 at intermediate levels. Therefore, in order to exclude MEFs from the flow citometry data analysis or to sort out this cell population by FACS-purification (see Section 2.9), a proprietary anti-MEFs antibody (antigen identity has not been disclosed by the supplier) was employed. Of note, this antibody was originally selected, by the producer, for the purpose to distinguish between MEFs and ES cells; the corresponding antigen is also present at intermediate concentration levels on the surface of TS cells. Hence, MEFs are characterized by anti-MEFshigh /CD40medium signal intensity and, TS cells – conversely – by antiMEFsmedium /CD40high . On the basis of this differential expression pattern, MEFs were distinguished from TS cells and excluded from data analysis or sort out for downstream experimental applications (Figure 2.2). Dead cells were discriminated based on the incorporation of the DNA dye 7-amino-actinomycin D (7AAD; eBioscience 00-6993-50), which cannot permeate into live cell membranes. Cells were harvested by treatment with a solution of 0.05% trypsin/EDTA (Invitrogen 25300-054) plus 2% chicken serum, for 5-10 minutes (min), at room temperature; afterwards, they were washed, gently resuspended by pipetting (until a single-cell solution was obtained), filtered through a 40µM cell strainer and resuspended in 2% fetal bovine serum in PBS (PBS/2%FBS). Approximately 250’000 cells were immunostained for each cell type/condition, in a final volume of 100 µl in PBS/2%FBS. Two alternative immunostainings for multiple antigens were performed in order to measure the expression of either EGFP/Cd140a/CD40/anti-MEFs or EGFP/CD31/CD40/anti-MEFs (see Table 2.3). Antibodies used are listed (see Table 2.4). Sequential stainings were performed at 4°C, by incubation with primary antibodies – for 30 min – followed by incubation with secondary antibodies – for additional 30 min. After each round of staining, a washing step was performed with 1ml of PBS – to remove the excess of unbound antibodies. Cells were resuspend in a final volume of 500 µl of PBS/2%FCS (supplemented with 1% 7AAD) and analysed with a Becton Dickinson LSRII flow cytometer. At least 10’000 live cells were measured for each sample/condition. Raw datasets were elaborated using FlowJo software and graphically displayed as dot plots or histograms.

2.8. Flow cytometry analysis for ES, TS and XEN cells

Ex. λ(nm)

Em. λ(nm)

Marker

57

Cell type (rel.expr.)

Staining 5A 488

510/21

EGFP

ER:HRASG12V , 4RAF1:ER

488

575/26

CD140a-PE

XEN (high)

488

670/14

7AAD

dead cells

633

660/20

CD40+APC

TS (high), MEF (medium)

633

780/60

anti-MEFs+APC/eF780

MEF (high), TS (medium)

Staining 5B 488

510/21

EGFP

ER:HRASG12V , 4RAF1:ER

488

670/14

7AAD

dead cells

488

660/20

CD40-PE/Cy7

TS (high), MEF (medium)

633

660/20

CD31-APC

ES (high)

633

780/60

anti-MEFs+APC/eF780

MEF (high), TS (med)

Table 2.3: Stainings used for flow cytometry of ES, TS and XEN cells Ex. λ= Excitation wavelength; Em. λ= Emission wavelength, defined as median/range of the wavelength interval selected by the bandpass filter positioned on the emission light path; rel.expr. = relative expression levels. Text colours represent approximation of wavelength colours.

58

CHAPTER 2. MATERIALS AND METHODS Antibody

FC dilution

Catalogue reference

Unconjugated primary antibodies goat anti-CD40

1:50

R&D AF440

anti-CD31-APC

1:50

BD 551262

anti-CD40-PE-Cy7

1:50

custom-made*

anti-CD140a-PE

1:200

eBioscience 12-1401-81

anti-MEFs-biotin

1:100

Miltenyi Biotech 130-096-095

Conjugated primary antibodies

Flurochrome-conjugated secondary antibodies anti-goat-AF647

1:500

Invitrogen A21447

streptavidin-APC-eF780

1:500

eBioscience 47-4317-82

Table 2.4: Antibodies used for flow cytometry analysis and sorting APC = allophycocyanin; PE = phycoerytrocyanin; Cy7= cyanin 7. *CD40-PE-Cy7 was prepared using the proprietary conjugation kit Innova Biosciences 762-0005.

2.9

Fluorescence Activated Cell Sorting (FACS)

FACS was employed to select genetically modified EGFP+ ES cells , for the purpose to establish clonally-derived cell lines (see Section 2.4). It was also used, to separate ES cell populations undergoing transdifferentiation to TS-like cells from MEFs – which provide a feeder layer, supportive for this type of culture – in order to obtain a pure cell population for DNA methylation analysis. Sorting strategy is described in section 2.8 and shown in figure 2.2. FACS was performed using a Becton Dickinson FACSAria instrument by Geoff Morgan, Arthus Davis and Rachel Walker (The Babraham Institute, Flow cytometry and FACS facility).

2.9. Fluorescence Activated Cell Sorting (FACS)

59

Figure 2.2: An example of flow cytometry data analysis/FACS purification. The strategy followed to exclude MEFs from flow cytomety data analysis or FACS-based purification is shown. Representative flow cytometry plots are for iRAF ES cells – stably expressing ΔRAF1:ER-IRES-EGFP transgene – during transdifferentiation to TS-like cells (day 3). (A) Forward scatter vs Side scatter plot for total counted events; gate excludes cell doublets and very large MEFs. (B) Forward scatter/7-AAD plot for FSC/SSC selected cells (gate A); new gate excludes a small fraction of dead cells present in the population. (C) Anti-CD40/anti-MEFs plot for selected live cells (gate B); transdifferentiating iRAF ES cells (post-feeder removal gate) were distinguished from MEFs (feeders gate) based on the expression levels for both markers. (D) EGFP/antiCD140a and anti-CD140a/anti-CD40 plots for selected transdifferentiating iRAF ES cells (post feeder-removal gate). The majority of cells are EGFPhigh indicating that MEFs were efficiently excluded.

60

2.10


Alkaline Phosphatase (AP) assay

Alkaline phosphatase assay was performed using a commercial kit (Sigma 86R-1KT). ES cell transdifferentiation to TS-like cells was set up in 6-well tissue culture plates and cells were subjected to analysis every 6 days. Fixative solution (1.25ml citrate, 3.25ml acetone, 0.4ml 37% formaldehyde; volumes are for 10 wells) and staining solution were prepared in advance and stored at room temperature, protected from light. To prepare the latter, 0.1ml sodium nitrite and 0.1ml FRV-Alkaline solution were mixed and incubated for 2 minutes (min), then 4.5ml PBS and 0.1ml Napthol AS-BI alkaline solution were combined. After washing with PBS, 0.5ml of fixative solution were added to each well, left in incubation for 30 seconds (sec) and aspirated. This was followed by the addition of 1ml of PBS, left for 45 sec and then aspirated. Afterwards, 0.5ml of staining solution per well was aliquoted and incubated for 15 min, protected from light. Finally, two rounds of washes were performed with PBS and fresh PBS was left on the stained wells for long term storage. All procedures were carried out at room temperature. Digital images were acquired at low resolution with a standard HP office scanner (JPG files); and at high resolution, using a CCD camera connected to a Nikon TS100 microscope (TIFF files), using Adobe Photoshop CS2 software. Images were trimmed for illustration using Inkscape vector graphics software.

2.11

Western Blot

Whole cell extracts were prepared – on ice and upon a preliminary culture wash with PBS – by directly lysing cultured cells in TG buffer (20mM Tris-HCl pH 7.5, 137 mM NaCl, 1mM EGTA, 1% Triton X-100, 10% glycerol, 1.5 mM MgCl2) supplemented with protease inhibitor cocktail (Sigma P2714) and phosphatase inhibitors (50mM NaF and 1mM Na3 VO4 ). Lysing solutions were mechanically homogenized by repeated scraping and pipetting. Insoluble material was removed by centrifugation (12’000 g, 10min, 4°C). The protein concentration of the soluble fraction was determined by performing the Bradford assay (Biorad), quantified by spectrophotometry (λ=595nm). Extracts were diluted in 2X Laemmli buffer (4% SDS, 10% 2-mercaptoethanol, 20% glycerol, 0.004% bromophenol blue, 0.125M Tris HCl pH 7.5) and boiled for 10 minutes (min).

2.11. Western Blot

61 Separating gel a

Stacking gel b

10%

12%

deionized water

24.0

19.8

10.6

30% Acrylamide mixc

19.8

24.0

4.0

1.5 M Tris (pH 8.8)

15.0

15.0

1.0 M Tris (pH 6.8) 20% SDS

d

10% APS TEMEDf

e

6%

5.0 0.6

0.6

0.2

0.6

0.6

0.2

0.06

0.06

0.05

Solutions for SDS poly-acrylamide gel electrophoresis (SDS-PAGE) a, b Volumes are given for a total of 60ml (10 or 12%) and 20ml (6%), respectively, which are necessary to cast 4 complete gels; c 29.2% acrylamide and 0.8% N,N’methylene-bis-acrylamide; d Sodium dodecyl sulfate; f Ammonium persulfate; g N,N,N’,N’Tetramethylethylenediamine.

Proteins (20 µg/sample) were resolved by sodium dodecyl sulfate poly-acrylamide gel electrophoresis (SDS-PAGE). Separating (10/12%) and stacking (6%) gels were manually casted and electrophoresis was carried out with the Hoefer SE260 apparatus (migration buffer: 25mM Tris, 190mM glycine, 0.1% SDS, in water). The progress of the electrophoretic run was monitored by loading a molecular weigth marker (Biorad 161-0374). Resolved proteins were wet-transferred – using the Biorad Mini Trans Blot system 170-3930, at 300mA costant for ≈ 90min (transfer buffer: 48mM Tris, 39mM glycine, 0.04% SDS, 10% methanol, in water) – onto polyvinylidene difluoride (PVDF) membranes (Immobilion-P, Millipore). Membranes were blocked – with 5% Marvel milk powder or bovine serum albumine (BSA), 0.1% Tween-20 in Tris-buffered solution (TBS; 20 mM TrisHCl, pH 7.5) – and incubated with specific primary antibodies overnight at 4°C. Following 3 washes (0.1% Tween-20 in TBS), membranes were incubated with specific horseradish peroxidise (HRP)-conjugated secondary antibodies, for 1 hour, at room temperature. After a new round of 3 washes, specific secondary antibodybounding was quantified by HRP catalyzed enhanced chemilumiscence (ECL) reaction (GE Healthcare RPN2209), with the light signal detected on standard X-ray films. Antibodies used are listed (see Table 2.5).

62


Antibody

WB dilution

Catalogue reference

Primary antibodies mouse anti-Cdx2

1:1000

Biogenex MU392-UC

goat anti-Elf5

1:1000

Santa Cruz sc-9645

rabbit anti-Eomes

1:1000

Abcam 23345

mouse anti-Oct4

1:1000

Santa Cruz 5269

rabbit anti-Fgfr2

1:1000

Santa Cruz 122

rabbit anti-Parp1

1:1000

Cell Signal. 9542

rabbit anti-Er

1:1000

Santa Cruz 543

mouse anti-Erk1

1:3000

BD 610031

mouse anti-phospho Erk1/2

1:1000

Cell Signal. 9106

rabbit anti-phospho Frs2α

1:1000

Cell Signal. 3864

rabbit anti-phospho Jnk

1:1000

Cell Signal. 9251

rabbit anti-phospho p38

1:1000

Cell Signal. 9211

mouse anti-GFP

1:1000

Boehringer M. 1 814 168

rat anti-tubulin

1:2000

Abcam 6160

Horseradish peroxidase-conjugated secondary antibodies anti-rabbit

1:3000

Biorad 170-6515

anti-rat

1:3000

Amersham NA935r

anti-mouse

1:3000

Biorad 170-6516

anti-goat

1:3000

Abcam AB6885

Table 2.5: Antibodies used for Western Blot All antibodies were diluted into 5% Marvel milk powder/0.1% Tween-20 in TBS, with the exception of anti-phospho-Frs2α, anti-phospho Jnk, anti-phospho p38, anti-GFP antibodies which were diluted in 5% BSA/0.1% Tween-20 in TBS.

2.12. Quantitative PCR (qPCR)

2.12

63

Quantitative polymerase chain reaction (qPCR)

Total RNA extracts were prepared via cellular lysis in TRI reagent (Sigma T9424), followed by phenol/chloroform extraction and 2-propanol/75% ethanol precipitation. Upon a preliminary wash with PBS, 1ml of TRI reagent was directly added to a 10cm2 cell culture area; extracts were homogenized by repeated pipetting and transferred to test tubes. After a 5 minutes (min) incubation at room temperature, 0.2ml of chloroform were vigorously mixed by inversion and tubes were allowed to stands for 5-15 min. Aftewards, mixtures were separated in three phases – acqueous (top), intermediate, and organic (bottom) phase – by centrifugation at 12’000 g, for 15 min, at 4℃. Upper phase was transferred to a fresh test tube, combined with 0.5 ml 2-propanol and – after mixing – incubated for 5-15 min. RNA was precipitated by centrifugation at 12’000 g, for 15 min, at 4℃. Supernatant was replaced with 75% ethanol in diethyl pyrocarbonate (DEPC)- treated distilled water and subject to a further round of centrifugation, as above. RNA pellets were air-dried, resuspended in 30 µl of DEPC-water. Potential contaminant DNA was degraded via DNAseI (NEB M0303) treatment in the presence of RNAse inhibitors (Fermentas EO0381). Afterwards, RNA was purified via 2-propanol/75% ethanol (DEPC-water) precipitation – as described above – and air-dried pellets were dissolved in a small amount of DEPC-water (30-50 µl), quantified by Nanodrop (Thermo Scientific) spectrophotometric measure, and diluted to to the standard concentration of 100ng/µl.

DNAse I treatment volume (µl) RNA

30.0

10x buffer

4.0

RNAse inhibitors (40U/µl)

1.0

DNAse I (2U/µl)

2.0

DEPC-water

3.0 40.0

time (min)

temp. (℃)

60

37

step digestion

64

CHAPTER 2. MATERIALS AND METHODS First strand cDNA synthesis volume (µl)

RNA/examers 5x buffer RNAse inhibitors dNTP mixb

a

time (min)

temp. (℃)

step

12.5

10

25

annealing

4.0

90

42

cDNA synthesis

0.5

10

70

RT inactivation

2.0

M-MuLV RT

c

3.0 20.0

RNAse inhibitors are 40U/µl. b deoxyribonucleotide triphosphates (ATP, TTP, CTP, GTP) are 10mM each. c RevertAid H-minus M-MuLV Revert Transcriptase (Fermentas EP0451; 200U/µl) a

RNA molecules were converted into DNA (cDNA), via first strand cDNA synthesis performed with RevertAid H-minus M-MuLV Revert Transcriptase (Fermentas EP0451), primed by random examers (Promega C118A), in the presence of RNA inhibitors. No-retro-transcriptase controls were prepared to assess potential DNA contaminations. For each sample, 1µg of total RNA was combined with 0.2 µg of random examers in DEPC-water – in a final volume of 12.5 µl – and incubated at 65℃, for 5 min, in order to remove potential secondary structures; then, transferred on ice. RNA-dependent DNA synthesis (retrotranscription) was set up as described in the table. cDNA reaction products were diluted to 400 µl in EB buffer; 5 µl were used for each qPCR reaction. Quantitative PCR was performed with the SYBR Green Jump Start Taq Ready Mix (Sigma S4438), on a Biorad CFX96 thermocycler – with the potential to perform real-time fluorescence measures for up to 96 PCRs, in parallel. For each cell type/time point, the cDNA produced from three independent cell cultures were analysed (biological replicates); each PCR was repeated twice (technical replicates). Intro-spanning primer pair sequences were designed, according to standard criteria, using Primer BLAST software, accessible via the NCBI website www.ncbi.nlm. nih.gov. At the end of each thermocycler run, raw real-time fluorescence intensity measures were automatically elaborated by the CFX96 manager software and


65

Quantitative PCR volume (µl)

time (sec)

temp. (℃)

5.0

120

95

qPCR mixa

6.0

15

95

denaturation

primers

0.24

45

65

40

ann./synth.e

dd waterc

0.76

cDNA b

65→95

cycles

step denat./act.d

melting curve

12.0 SYBR Green Jump Start Taq Ready Mix (Sigma S4438);b Fw/Rv primers (10 mM each); c deionized water d cDNA denaturation/Taq Polymerase activation; e primer annealing/cDNA synthesis. a

released in the form of an organized dataset including, in particular, an amplification curve – expressing relative fluorescence unit (RFU) versus cycle number – and a melting curve – d(RFU)/d(temperature) – for each PCR reaction. Quality control and the calculation of normalized gene expression levels was performed by data mining and further elaboration using a spreadsheet calculator software (e.g., Microsoft Office Excel and Libre Office Calc). Data quantification was based on the cycle threshold (Ct) values, generated by the CFX96 software. Briefly, Ct values represent the number of PCR cycles necessary to reach the threshold level of fluorescence intensity – which is determined by the software in order to be within the interval of exponential growth of PCR products. Inside this range, Ct values can be assumed to be directly proportional to the number of input cDNA molecules present at the start of the reaction. Primer pair specificity was confirmed based on the observation of a single peak in the melting curve, approximately corresponding to the melting temperature expected for a 100-200 base pair amplicon. A series of cDNA dilutions was analysed for each primer pair in order to build a standard curve, which display the degree of correlation (R) between Ct values and the starting amount of cDNA, used as template. Primer pairs presenting a standard curve with R ≈ 1, were selected. Primer sequences are listed in Table 2.6. For every gene of interest, the mRNA expression levels – defined as average

66


± standard deviation (avg ± sd) – corresponding to each distinct cell type/time point under analysis, were calculated based on a six-step data processing: 1. From the two technical replicates of each PCR, the average Ct value (avgCt) was calculated. 2. The avgCt value was transformed into a raw expression value (rawX ): X = (avgCt − b)/a and rawX = 2X where a = slope and b = intercept of the standard curve of the corresponding primer pair. 3. The rawX value was corrected for the total amount of input RNA, based on the raw expression values of Sdha and Tbp, which are two genes expressed at very similar levels in ES, TS, XEN cells and during ES or TS in vitro differentiation [Veazey & Golding, 2011]. Sdha and Tbp transcription is supposed not to be affected during ES cell transdifferentiation to TS-like cells and therefore Sdha and Tpb concentration levels can considered to be directly proportional to the total amount of RNA and can be used for normalization. normX = rawX/avg(rawSdha, rawT bp) 4. The normX value was corrected for the amount of input MEF RNA, that is, the amount of RNA extracted from the murine embryonic fibroblast (MEFs), which provide a feeder layer for ES cells undergoing transdifferentiation to TS-like cells. Actn1 is a gene highly expressed in MEFs in comparison to ES, TS and XEN cells and differentiatied TS cells (data not shown). Therefore, Actn1 levels can be considered an estimate of the amount of input MEF RNA and can be used for normalization. M EF normX = normX ∗ normActn1


67

Gene

Forward primer

Reverse primer

Cdx2

AGTGAGCTGGCTGCCACACT

GCTGCTGCTGCTTCTTCTTGA

Elf5

ATTCGCTCGCAAGGTTACTCC

GGATGCCACAGTTCTCTTCAGG

Eomes

TCGCTGTGACGGCCTACCAA

AGGGGAATCCGTGGGAGATGGA

Oct4

GAAGCCGACAACAATGAGAACC

CTCCAGACTCCACCTCACACG

Gata6

TCTACACAAGCGACCACCTCAG

GCCAGAGCACACCAAGAATCC

Gata4

TAGCAGCAGCAGCAGCAGTG

GCATAGCCTTGTGGGGACAG

Sox17

GATACAATGAGCAGCACCTCCAGAC

CTGGTCGTCACTGGCGTATCC

Fgf5

TGTGTCTCAGGGGATTGTAGGAA

CTGTCTTTTCAGTTCTGTGGATCG

Gata3

AGGCAACCACGTCCCGTCCT

CGGTGTGGTGGCTGCTCAGG

Tfpa2c GCCGGACGCCATGTTGTGGA

ACCCCGGTGTGCGAGAGAGG

Ets2

GACCAAGTGGCCCCTGTCGC

GGCCCGTGGGCACTTCTTGG

Pl1

TTATCTTGGCCGCAGATGTGT

GGAGTATGGATGGAAGCAGTATGAC

Tpbpa

ACTGGAGTGCCCAGCACAGC

GCAGTTCAGCATCCAACTGCG

SynA

CCTCACCTCCCAGGCCCCTC

GGCAGGGAGTTTGCCCACGA

Sdha

TGGTGAGAACAAGAAGGCATCA

CGCCTACAACCACAGCATCA

Tbp

CGGTCGCGTCATTTTCTCCGC

GTGGGGAGGCCAAGCCCTGA

Actn1

ATCCAGCTCCTAGCACGCACG

GTCCCCGCTTTGCGCAGGTG

Table 2.6: Primer sequences used for quantitative PCR. Primers sequences are given in the 5’-3’ orientation.

5. From the MEFnormX values, corresponding to the three biological replicates of each distinct cell type/time point, the average value and its standard deviation avg ± sd was calculated.

6. Finally, the avg ± sd for each distinct cell type/time point were plotted as percentage of the expression observed in the reference cell type (e.g.,% of TS ).

68

2.13


Genomic DNA extraction

ES cells undergoing transdifferentiation to TS-like cells were purified by FACS (see Section 2.9), in order to exclude the MEF feeder layer from downstream analysis. Genomic DNA was isolated by phenol-chlorofom extraction, followed by 2-propanol/75% ethanol purification. Transdifferentiating cells (6 100’000) were collected in 200µl Tail lysis buffer (Tris 100mM pH 8.5, EDTA 5mM pH 8.0, SDS 0.2%, NaCl 200mM in deionized water), supplemented with 200µg/ml Proteinase K, and incubated at 65℃ overnight. Afterwards, one volume (200µl) of Phenol:Chloroform:Isoamyl alcohol 25:24:1 solution (Sigma P3803) was mixed by inversion, and cell extracts were separated in three phases – acqueous (top), intermediate, and organic (bottom) phase – by centrifugation at 12’000g, for 5 minutes (min), at room temperature. The upper phase was transferred to a fresh test tube and vigorously mixed with 200µl 2-propanol and 75µg/ml of blue glycogen co-precipitant tracer (GlycoBlue, Ambion AM9515). DNA was precipitated by centrifugation at 12’000g, for 15 min, at 4℃. Afterwards supernatants were discarded and 1ml of 75% ethanol in deionized water was added; tubes were centrifugated at 12’000g for 5 min at room temperature. DNA pellets were air-dried and resuspended in 100 µl of EB buffer (10mM Tris-HCl, pH 8.5), respectively. DNA concentration and purity was assessed based on spectrophotometric measurements performed with Nanodrop instrument(λ=260/280 nm) and samples were diluted to the standard concentration of 30ng/µl.

2.14

Bisulphite conversion of genomic DNA

The purpose of sodium bisulphite conversion of genomic DNA is to allow the discrimination between 5-methyl-cytosines (5mC) and unmethylated cytosines. Sodium bisulphite treatment converts unmethylated cytosine to uracil, leaving 5mC unconverted. After conversion, different downstream methods can be employed to distinguish between uracil (converted unmethylated cytosine) and cytosine (5mC) bases, like standard Sanger sequencing (see Section 2.15) or the Sequenom Epityper analysis (see Section 2.16). Bisulphite conversion was performed using the EpiTect bisulphite kit (Qiagen 59104) according to manufacturer’s instruction.

2.15. Bisulphite-converted DNA sequencing for candidate loci

69

Sodium bisulphite conversion of genomic DNA volume (µl)

time (min)

temp.(℃)

5

95

denaturation

25

60

incubation

85.0

5

95

denaturation

15.0

85

60

incubation

140.0

5

95

denaturation

175

60

incubation

DNAa DEPC-waterb reaction mix

c

DNA Protect bufferc

step

Approximately 500ng of DNA were processed for each sample; volumes varied according to the specific concentration, quantified by Nanodrop, prior to setting-up reactions. b Diethyl pyrocarbonate-treated water; volumes varied according to the specific DNA concentration. c EpiTect bisulphite kit (Qiagen 59104). a

At the end of the reaction, DNA was column-captured – together with 10µg/ml of carrier RNA – and subject to desulfonation, followed by multi-step purification. Bisulphite converted DNA samples were eluted in 20µl of EB buffer (pre-warmed at 55℃).

2.15

Bisulphite-converted DNA sequencing for candidate loci

Genomic regions of interest (e.g., Elf5 promoter region -673/-273 nt from TSS) were amplified from bisulphite-converted DNA via two consecutive rounds of PCR. Secondary primers were designed within the region amplified by primary primers; also, they contained 5’ extensions, so that the same PCR product could be used for both DNA sequencing and Sequenom EpiTyper analysis (see Section 2.16). Primers used are listed (see Table 2.7). PCR products were resolved by 2% agarose gel electrophoresis and visualized with SYBR Safe DNA staining (Invitrogen) under a transilluminator. Gel bands containing the specific PCR product were cut out and DNA was purified using the QIAquick Gel extraction kit (Qiagen), with final elution performed in 15µl of EB buffer.

70


Locus

PCR

Elf5a

Forward primer

Reverse primer

1ry

GTGGAAAGGTTAGTGAAAGTATTG

AAAAAATTCAAACCTAATATCTA

2ry

b

TGATTTTTTTTTTGTTTTTTGAT

c

CCTAATATCTATTCATTACAACCT

Table 2.7: PCR primers used for amplification of bisulphite-converted genomic DNA. Primers sequences are given in the 5’-3’ orientation. a Elf5 promoter region -673/-273 from TSS (see Figure 3.16). Secondary primers sequences are synthesized with additional 5’ extensions, required for downstream Sequenom EpiTyper analysis: b AGGAAGAGAG-5’-forward primer-3’; c CAGTAATACGACTCACTATGGGAGAAGGCT-5’-reverse primer-3’.

1ry & 2ry PCR for Elf5 promoter from bisulphite-converted DNA volume (µl)

time (sec)

temp.(℃)g

DNAa

2.0

60

94

10x buffer

2.5

15

94

Taq Pol.b

0.3

30

48/50

MgCl2

3.0

40

72

15

synthesis

primersd

0.5

15

94

denaturation

dNTPse

0.5

30

49/52

16.2

40

72

15

synthesis

25.0

15

94

denaturation

30

49/52

40

72

c

dd waterf

cycles

step denaturation

denaturation annealing

annealing

annealing 15

synthesis

Bisulphite-converted DNA. b High-Fidelity Taq Polymerase (Roche 11 732641 001). c MgCl2 (25mM). d Fw/Rv primers (10µM each). e dNTPs (ATP,TTP,GTP,CTP; 10 mM each). f Deionized water. g 1ry PCR/2ry PCR. a

2.16. Sequenom EpiTyper analysis

71

DNA plasmid rolling circle amplification volume (µl)

temp.(℃)

step

3 minutes

95

denaturation

2.0

pause

4

0.08

10-16 hours

30

amplification

10 minutes

65

inactivation

1 bacterial colonya reaction buffer TempliPhi Pol.

b c

time

Individual resistant white bacterial colonies were manually picked from LB/agar/XGal/IPTG culture plates and directly dissolved in the reaction buffer. b Reaction buffer contains random examer primers; it is permissive for both bacterial lysis and subsequent DNA plasmid enzymatic amplification. c Templi Phi Polymerase (TempliPhi kit GE 25-6400-10) is added after reaction temperature reaches 4℃. a

Purified PCR products were ligated into the pGEM-T Easy plasmid backbone (Promega 1360), followed by transformation into E.Coli DH5α competent cells (Invitrogen 18265-17), which were subsequently cultured overnight on LB/agar/Amp/XGal/IPTG plates, as described in section 2.2. Resistant bacterial colonies (6 10) were lysed and DNA plasmid was subject to rolling circle amplification (TempliPhi kit GE 25-6400-10). Reactions products were diluted with 10µl of EB buffer (10mM Tris-HCl, pH8.5) and 5µl were analysed by standard Sanger DNA sequencing – which was performed, as commercial service, by the company Beckman Coulter Genomics (Primer Extension service, M13R universal primer). Chromatographs (AB1 files) were compared with the corresponding Elf5 promoter reference sequence (NCBI Mouse 37 assembly) and methylated cytosines were identified using the QUMA software (http://quma.cdb.riken.jp).

2.16

Sequenom EpiTyper analysis

The proprietary Sequenom EpiTyper assay [Sequenom, 2011] allows to quantify the frequency of cytosine methylation in a population of genomic DNA molecules. Briefly, using as template bisulphite-converted genomic DNA, a region of interest is amplified by PCR and is subject to in vitro RNA transcription, followed

72

CHAPTER 2. MATERIALS AND METHODS Shrimp Alkaline Phosphatase treatment PCR product

a

volume (µl)

time (min)

5.0

SAP enzyme

b

0.3

MilliQ water

c

1.7

temp.(℃)

step

20

37

dephosphorylation

5

85

denaturation

7.0 For each region of interest, PCR products were analysed in triplicates b Complete EpiTyper reagent set (Sequenom 10247) c MilliQ (Millipore)-purified water. a

by a base-specific cleavage reaction. The cleavage pattern is dependent on the presence/absence of 5mC in the original unconverted DNA template. Using a proprietary mass spectrometry instrument (MassArray system) and computational analyses – based on the original reference sequence (NCBI Mouse 37 assembly) – cleaved fragments are identified and quantified. Quantified cleavage patterns can be correlated to the frequency of cytosine methylation in the DNA molecule under analysis. Genomic regions of interest (e.g., Elf5 promoter region -673/-273 nt from TSS) were amplified from bisulphite-converted DNA via two consecutive rounds of PCR (see Section 2.15) – performed in triplicates (technical replicates). PCR products underwent Shrimp Alkaline Phosphatase (SAP) treatment and in vitro Transcription → Cleavage reaction, followed by resin-mediated purification. Purified reaction products were spotted on a proprietary SpectroCHIP array using a MassArray Nanodispenser (Sequenom). Mass spectrometry analysis – using the MassArray instrument – was performed by Michelle King (The Babraham Institute, Epigenomics facility). The output dataset was further elaborated using a standard spreadsheet calculator software (Microsoft Office Excel or Libre Office Calc). Results were graphically displayed as bar charts.

2.17. MeDIP-Sequencing

73

In vitro RNA transcription/cleavage reaction volume (µl)

time (min)

temp. (℃)

SAP product

5.00

180

37

MilliQ water

3.21

5x buffer

0.89

a

Cleavage mixa DTT (100 mM)

0.22

T7 Pol.

0.40

RNase Aa

transcription & cleavage

0.22 b

a

step

0.06 12.0

a Complete

2.17

EpiTyper reagent set (Sequenom 10247).

b

Dithiothreitol.

MeDIP-Sequencing

Methylated DNA Immuno-Precipitation coupled with high-throughput Sequencing (MeDIP-Seq) was performed according to the original protocol developed by Michael Weber, Dirk Schubeler and colleagues, and subsequent improvements [Weber et al., 2005; Ficz et al., 2011]. ES cell-derived TS-like cells (iRAS, iRAF, Oct4-cKO, iCdx2, iCDX2:ER and iRAF/iCDX2:ER) – at day 12 of transdifferentation – ES cells, control ES cells (ctrl ES, 2i pre-treated ES) and TS cells (Rs26), were collected by FACS, in order to exclude MEF cells – which provide a feeder layer supportive for this type of culture – from downstream analysis (see Section 2.9).

Preparation of genomic DNA libraries Genomic DNA was extracted – as described in Section 2.13 – and sheared by sonication in order to obtain a population of fragments, with a 200-700 nucleotide (nt) size range. Genomic DNA samples (3µg/cell type) were diluted in 100µl of EB buffer (10mM Tris-HCl, pH 8.5) and sonicated, using Diagenode Bioruptor UCD-200 – at high power, for 17 minutes (min) with 30 seconds (sec) on/off

74

CHAPTER 2. MATERIALS AND METHODS Name

Sequence

PE 1.0

5’-P GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG-3’

PE 2.0

5’-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3’

Table 2.8: Paired-end adaptors for MeDIP-Seq library generation. Adaptors (synthesized by Sigma; HPLC purified) were mixed (50µM, each) in high salt conditions, and annealed prior to ligation, by heating the mixed adaptor solution to 99℃ and let it naturally return to room temperature. p Phosphate group. * Phosphorothioate group. Oligonucleotide sequences © 2007-2012 Illumina, Inc. All rights reserved.

intervals, in a ice bath – with 3 samples being processed in parallel. Sonicated DNA samples were modified by ligation of paired-end adaptors (see Table 2.8), in order to produce libraries of molecules, suitable for downstream DNA paired-end high-throughput sequencing. This method, involved three subsequent enzymatic reactions– DNA-end repair, dA single-nucleotide extension (dA-tailing) and adapter ligation – performed in series – in a single-test tube for each library – using the NEB Next DNA Library Prep Master Mix set (NEB E6040) and Agencourt AMPure XP SPRI beads (Beckman Coulter, A63881), for magnetic capture-based purification of reaction products, after each step. At the end of the adaptor ligation reaction, 30 µl of EB buffer (pre-warmed at 55℃) were added to DNA/SPRI beads complexes and – upon a 5 min incubation at room temperature (r.t.) – DNA libraries were eluted; this step was repeated twice, resulting in a total elution volume of 60µl.

Methylated-DNA Immuno-Precipitation Immunoprecipations were performed in triplicates for each cell type. DNA libraries (500 ng/sample) were resuspended in 180µl of TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0) and denaturated at 99℃ for 10min, then transferred on ice for further 10min. Afterwards, 20µl of 10X Immuno-Precipitation (IP) buffer (1M Na-Phosphate, 5M NaCl, 10% Triton X-100 in MilliQ water) and 1.25µl of anti 5-methylcytidine antibody (Eurogentec BI-MECY-0100) were combined – resulting in a final IP volume of 200µl – and incubated for 2 hours at 4℃ with continuous rotation. In parallel, for each IP sample, 10µl of Dynabeads M-280 coated with


75

DNA-end repair volume (µl) DNA (2.5µg)a

83.0

10x buffer

10.0

b

End Repair enzyme mixb

5.0

MilliQ water

2.0

c

time (min)

temp.(℃)

step

30

20

end repair

10

r.t.

clean-upe

100.0 SPRI beadsd

180.0

Sonicated DNA concentration was approximately 30ng/µl; volumes varied across samples, according to the specific concentration, quantified by Nanodrop prior to settingup reactions. b NEB Next DNA Library Prep Master Mix set (NEB E6040).c MilliQ (Millipore)-purified water.d SPRI beads are resuspended into 20% PEG 8000 in 1.35 M NaCl (PEG/NaCl). e After 10 min of incubation at room temperature (r.t.), test tubes were placed on a magnetic rack for capturing beads/DNA complexes and solutions were discarded. After two washes with 500µl 70% ethanol in MilliQ water, complexes were air-dried for 5 min, before proceeding to dA-tailing reaction. a

DNA dA-tailing volume (µl) DNA/beads complexesa MilliQ water 10x buffer

time (min)

temp.(℃)

step

30

37

dA-tailing

10

r.t.

clean-upd

42.0 5.0

b

Klenow fragment

b

3.0 50.0

PEG/NaCld

90.0

Dried DNA/beads complexes from end repair reaction b NEB Next DNA Library Prep Master Mix set (NEB E6040).c PEG/NaCl (20% PEG 8000 in 1.35M NaCl) is required for performing magnetic capture-based clean-up. d After 10 min of incubation at room temperature (r.t.), test tubes were placed on a magnetic rack for capturing beads/DNA complexes and solutions were discarded. After two washes with 500µl 70% ethanol in MilliQ water, complexes were air-dried for 5 min, before proceeding to adapter ligation reaction. a

76

CHAPTER 2. MATERIALS AND METHODS DNA adaptor ligation volume (µl) DNA/beads complexesa MilliQ water 5x buffer

time (min)

temp.(℃)

step

15

20

ligation

10

r.t.

clean-upd

32.5 1.0

b

Pair-end adptorsc

2.5

T4 DNA ligase

3.0

b

50.0 PEG/NaCl

90.0

Dried DNA/beads complexes from dA-tailing reaction. b NEB Next DNA Library Prep Master Mix set (NEB E6040).c Pre-annealed pair-end adaptors (50 µM, each). d After 10 min of incubation at room temperature (r.t.), test tubes were placed on a magnetic rack for capturing beads/DNA complexes and solutions were discarded. After two washes with 500µl 70% ethanol in MilliQ water, complexes were air-dried for 5 min, before proceeding to elution. a

sheep anti-mouse IgG antibodies (anti-IgG/Dynabeads; Invitrogen 112-01D) were blocked with 0.1% Bovine Serum Albumine (BSA, NEB B9001S) in PBS, for 2 hours, at 4℃ with continuous rotation. After 2 hours, pre-blocked IgG-Dynabeads were added to IP samples and incubated for further 2 hours. At the end of this incubation period, methylated DNA/anti-5mC/anti-IgG/Dynabeads complexes (bound DNA fraction) were magnetically captured and IP solutions containing the unbound DNA fraction, were collected and stored for later use, as controls. Bound DNA fractions were washed three times with 500µl of 1X IP buffer (10 min, 4℃, with continuos rotation) and resuspended in 125µl of digestion buffer (1M Tris-HCl pH 8.0, 0.5M EDTA pH 8.0, 20% SDS in MilliQ water), supplemented with 1.75µl of Proteinase K (20mg/ml stock). Digestion of immunocomplexes was carried out at 55℃, for 30 min, with continuous shaking. IP triplicates –prepared for each cell type – were pooled and MeDIP DNA libraries were column-purified (MinElute, Qiagen) and eluted in 17µl of EB buffer (pre-warmed at 55℃). DNA unbound fractions were processed in parallel.

2.17. MeDIP-Sequencing Name

Sequence

PE 1.0 (Fw)

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT

PE 2.0 (Rv)

CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCC TGCTGAACCGCTCTTCCGATCT

iPCR tag6 (Rv)

CAAGCAGAAGACGGCATACGAGATACATTGGCGAGA TCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC

iPCR tag7 (Rv)

CAAGCAGAAGACGGCATACGAGATCAGATCTGGAGA TCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC

iPCR tag8 (Rv)

CAAGCAGAAGACGGCATACGAGATCATCAAGTGAGA TCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC

77

Table 2.9: Primers for MeDIP-Seq library amplification E14 ES, ctrl ES, iRAS TS-like, iRAF TS-like, Oct4-cKO TS-like, iCdx2 TS-like and Rs26 TS MeDIP libraries were amplified using PE 1.0 (Fw) and PE 2.0 (Rv) primer pair and sequenced on individual lanes of an Illumina Genome Analyzer GAIIX instrument. 2i pre-treated ES, iCDX2:ER and iRAF/iCDX2:ER MeDIP libraries were amplified using different primer pairs, resulting from the combination between a common forward primer – PE 1.0 – with unique reverse primers – iPCR tag6, tag7, tag8, respectively. The last three libraries were pooled and sequenced on a single lane of an Illumina HiSeq2000 instrument. Primers sequences are given in 5’-3’ orientation; unique barcode sequences are highlighted in bold. Oligonucleotide sequences © 2007-2012 Illumina, Inc. All rights reserved.

MeDIP library amplification and size-selection MeDIP libraries (and unbound DNA fractions, as control) were amplified by PCR using distinct combinations of primers, according to the downstream DNA high-throughput sequencing strategy employed (see Table 2.9). Amplified MeDIP libraries (and unbound DNA fractions, as control) were resolved by 2% agarose gel electrophoresis and visualized by ethidium bromide staining, under a UV transilluminator. Gel bands containing DNA fragments within the 300-500 nt range were cut out and DNA was purified using the Qiagen Gel extraction kit, according to manufacturer’s instructions – with the exception that gel bands were dissolved at room temperature, without heating, to avoid potential DNA damage – and eluted in 30 µl of EB buffer (pre-warmed at 55℃). 5mC immuno-precipitation efficiency was confirmed by analysing ES and TS cell MeDIP pre- and post-amplification libraries by quantitative PCR for candidate

78

CHAPTER 2. MATERIALS AND METHODS MeDIP library amplification PCR volume (µl)

time (sec)

temp.(℃)

15.0

30

98

Fw primer (PE1.0)b

5.0

10

98

Rv primer

5.0

30

65

15.0

30

72

40.0

300

72

MeDIP librarya b

2X reaction mixc

cycles

step denaturation

denaturation annealing

12

synthesis synthesis

Purified MeDIP library (or unbound DNA fraction, as control).b Primers are 10µM each; reverse primer varied according to Table 2.9.c Phusion High-Fidelity PCR master mix (ThermoFisher/Finnzymes F-531). a

genomic loci – e.g.,Nanog and Elf5 promoter elements – whose methylation status has been previously well characterized (data not shown).

High-throughput DNA sequencing and bioinformatic analysis DNA concentration of amplified MeDIP-libraries was quantified based on both a quantitative-PCR and a Bioanalyzer assay, prior to proceed to DNA highthroughput sequencing, performed on either an Illumina Genome Analyzer GAIIX – employed for E14 ES, control ES, iRAS TS-like, iRAF TS-like, Oct4-cKO TS-like, iCdx2 TS-like and Rs26 TS libraries – or an Illumina HiSeq2000 instrument – for subsequent analysis of 2i pre-treated ES, iCDX2:ER TS-like and iRAF/iCDX2:ER libraries. MeDIP-libraries quantification and DNA high-throughput sequencing was performed by Kristina Tabbada (The Babraham Institute, Epigenomics facility). The number of paired-end sequencing reads (50nt), obtained for each MeDIP library, ranged from, approximately, 15 to 35x106 , with about %50 of them being uniquely mappable to the reference genome (NCBI Mouse 37 assembly) and the rest being assigned to distinct classes of repetitive DNA elements. Raw sequencing reads were processed and aligned to the reference genome by Felix Krueger (The Babraham Institute, Bioinformatics facility). Processed datasets were analysed using the SeqMonk software (www.bioinformatics.babraham.ac.uk).


79

Data analysis focused on specific classes of DNA sequences – including mRNA, promoters (Ensembl annotation; www.ensembl.org) and CpG islands [Illingworth et al., 2010] – whose genomic coordinates were used to define list of probes for dataset interrogation. Probe read counts were quantified and subject to multistep normalization – involving corrections for total read count and 75% percentile distribution, followed by forced matching of distributions – prior to proceed to dataset comparison [Andrews, 2012]. Functional annotation of DNA sequences was performed using DAVID bioinformatic online resources [Huang et al., 2009]. Data analysis plots were graphically edited using Inkscape software (www.inkscape.org). Bioinformatic analysis of ES and TS cell gene expression profiles was performed by Alex Murray, by mining publicly available datasets [Rugg-Gunn et al., 2010], in order to identify genes at least 2-fold higher expressed in TS versus ES cells.

80


Chapter 3 Results

81

82

3.1

CHAPTER 3. RESULTS

Erk signalling is insufficient for ES cell transdifferentiation to TS-like cells

3.1.1

Inducible Erk signalling in iRAS and iRAF ES cells

It was recently reported that transient hyper-activation of Ras/Erk signalling leads to efficient transdifferentiation to TS-like cells, described to retain their acquired lineage identity even in the absence of the inductive stimulus [Lu et al., 2008]. Based on these findings, the authors proposed that the epigenetic mechanisms ensuring restriction of ES cell developmental potential – like DNA methylation-dependent gene silencing – e.g., as observed at Elf5 promoter [Ng et al., 2008] – were reset. Importantly, if this ES-to-TS cell conversion was complete, this system would represent a powerful model to decipher the molecular mechanisms that establish lineage-specific DNA methylation patterns. However, the published evidence, in support of this concept, can be considered limited (see Section 1.4.3). Therefore, I set out to test this hypothesis. To this end, I planned to express post-translationally inducible isoforms of either Ras GTPase or Raf kinase [Samuels et al., 1993; Boughan et al., 2006; Narita et al., 2011] in ES cells, under the control of a constitutively active promoter. Protein sequences were designed so that either the full-length oncogenic HrasG12V or the kinase domain of Raf1 (ΔRaf1) are fused in frame to a modified form of the hormone binding domain of the estrogen receptor (ER). Both chimeric proteins are inhibited and rapidly degraded in their native conformation, but upon binding of the small molecule 4-hydroxytamoxifen (4HT), they acquire a more stable and catalytically active state (Figure 3.1, A). Clonal ES cell lines stably expressing either ER:HrasG12V or ΔRaf1:ER, termed iRAS and iRAF ES cell respectively, were isolated upon random genomic integration of the corresponding vectors (Figure 3.1, B). A 4HT dose/response course demonstrated that both iRAS and iRAF ES cells can induce Erk phosphorylation, up to levels approaching those observed in TS cells (Figure 3.2, A). The specificity of this 4HT-dependent intracellular signalling was investigated by monitoring the activation of Frs2α scaffold protein, as well as

3.1. Phospho-Erk is insufficient for ES cell transdifferentiation to TS-like cells 83

AV

HEK293

KDa

p-ERK1/2

37

ERK1/2

37 100 75 50

ER ΔRAF1:ER ER:HRASG12V EGFP

PhaseVcontrast/ EGFP

BV

iRASVES

FP V ΔR AF EG 1:ER FP ER :HR EG AS G12V FP -

EG

mo ck

-VVV+VVV-VVV+VV-VVV+VVV-VVV+

25 4HT

iRAFVES

100ϻM

Figure 3.1: Derivation of iRAS and iRAF ES cells (A) HEK293 cells were transiently transfected with either EGFP or ΔRAF1:ER-IRES-EGFP or ER:HRASG12V IRES-EGFP DNA plasmid vector. Upon 4HT treatment (1µM, 24h), improved protein stability of either ΔRAF1:ER or ER:HRASG12V is associated with increased levels of phospho-ERK, as shown by Western blot. Anti-ER-domain antibody recognizes both endogenous and transfected ER-domain proteins, which are distinguishable based on their predicted molecular weight. (B) Representative micrographs of clonally derived ES cell colonies stably expressing either ER:HRASG12V -IRES-EGFP (iRAS ES) or ΔRAF1:ERIRES-EGFP (iRAF ES). EGFP expression was used as marker for assessing the level of trangene expression, by live cell fluorescence microscopy.

84

CHAPTER 3. RESULTS

of Jnk and p38 kinases. Frs2α is assembled to the Fgf:Fgfr complex and, in TS cells, it is required for signal transduction upstream of the Ras/Erk pathway (see Section 1.2.2); also, in different cell types (e.g., fibroblasts) the same protein has been shown to mediate Fgf-dependent activation of other intracellular cascades (e.g., PI3K/Akt) [Hadari et al., 2001]. Hence, detection of the phosporylated form of Frs2α can be used to monitor the activation of the transmembrane Fgf receptor – which can occur as feedback response to Ras/Erk activity – potentially leading to the stimulation of other downstream pathways. Jnk and p38 kinases are commonly found to be phosphorylated and activated in response to stress signals; it is known that their regulation can be influenced by the parallel Ras/Erk pathway [e.g., Junttila et al., 2008]. In iRAS and iRAF ES cells, following 4HT treatment, neither Frs2α nor Jnk phosphorylation was detected. A small increment in p38 phosphorylation was observed in iRAF, but not in iRAS ES cells (Figure 3.2). It is not clear why p38 signalling was activated only in the former cell line; however, it can be speculated that differences in protein-protein interactions between the two inducible systems, may underlie this observation. Thus, iRAS and iRAF ES cells – upon 4HT-treatment – can induce Erk signalling up to levels which are close to those observed in TS cells. This inducible Erk signalling, in iRAF – but not iRAS – ES cells, is associated with a modest increase in p38 signalling.

3.1.2

Characterization of iRAF ES cell transdifferentiation to TS-like cells

Next, I characterized iRAF ES cell transdifferentiation to TS-like cells. iRAF ES cells were cultured either in ES cell (LIF+serum) or in TS cell (FGF+CM/serum) medium, in the presence or absence of 4HT, for 7 days. In ES cell culture conditions, as expected, iRAF ES cell colonies proliferate and retain a spherical colony morphology (Figure 3.3, A). Culture in TS cell medium causes a partial loss of these features, with some cell colonies showing signs of differentiation. When TS cell culture conditions were combined with forced activation of Raf/Erk signalling, the majority of cell colonies acquired a flat epithelial-like morphology, which is characteristic of TS cell colonies. It is noteworthy that, in ES cell medium, 4HT

3.1. Phospho-Erk is insufficient for ES cell transdifferentiation to TS-like cells 85 treatment results in high levels of cell death, presumably by caspase-dependent apoptosis, as supported by detection of Parp1 cleavage (Figure 3.3, B), which is a well-characterized marker of this process [Soldani & Scovassi, 2002]. At the molecular level, hyper-activation of Raf/Erk signalling led to downregulation of the ES cell transcription factor Oct4 and – in parallel – to upregulation of the TS cell transcription factor Cdx2, indicating that iRAF ES cells were undergoing transdifferentiation to TS-like cells (Figures 3.3, A & 3.4, A). However, comparison of iRAF ES cell-derived TS-like cells with TE/ExE-derived TS cells, revelead that Cdx2 levels were significantly lower in the former relative to the latter (Figure 3.4, A). Similar observations were made for Eomes, another key TS cell transcription factor, necessary downstream of Cdx2 for trophoblast formation. Furthermore, expression levels of Elf5, a third key TS cell transcription factor that cooperates with Cdx2 and Eomes, and of Fgfr2, a member of the Fgf receptor family required in TS cells for receiving this signalling, was not detectable. Even though a small number of individual cells show high Cdx2 levels, they do not appear to form TS-like colonies (Figure 3.3, A). Gene expression analysis of six transcription factors – Cdx2, Eomes, Elf5, Tcfap2c, Gata3 and Ets2 – which are considered to collectively control the TS cell transcriptional programme, showed that none of them reached expression levels comparable to those observed in bona fide TS cells (Figure 3.4, B). When transdifferentiation experiments were extended up to 15 days, no further upregulation of these key transcription factors was observed (Figure 3.5, A). Tgfβ signalling is transduced via two main parallel pathways, dependent on distinct subgroups of type I receptors – Alk4/5/7 or Alk1/2/3/6 – and mediated intracellularly by Smad2/3 or Smad1/5/8, respectively (see Section 1.2.2). The former pathway is stimulated by Tgfβ, Activin or Nodal ligands – which were demonstrated to be necessary for TS cell self-renewal. Consistently, during iRAF ES cell transdifferentiation, inhibition of Smad signalling by the specific Alk4/5/7 receptor inhibitor SB431542 results in downregulation of TS-cell transcription factors which predominantly sustain self-renewal (Cdx2, Eomes, Elf5 ) and upregulation of those also involved in the initial phase of trophoblast differentiation (Tcfap2c, Gata3, Ets2 ). Notably, Tgfβ and Activin are secreted by MEFs, as well as present at high doses in the serum, so that in culture conditions including CM/serum and a

86

CHAPTER 3. RESULTS

MEF-feeder layer, their combined concentration presumably maximally activates Alk4/5/7 receptors [Erlebacher et al., 2004]. Bmp4 stimulates the parallel Tgfβ signalling branch – relying on Alk1/2/3/6 receptors – and it is known to be present in the serum, as well as being released by genuine TS cells; it can be speculated that this growth factor may contribute to self-renewal and multipotency. Remarkably, Bmp4 treatment – during iRAF ES cell transdifferentiation – led to marked Cdx2 upregulation, but did not result in increased expression of any other member of the TS-cell core transcriptional network (Figure 3.5, A). It is noteworthy that expression of markers for multiple differentiated trophoblast cell types – Pl1, Tpbpa and SynA – was not detected (Figure 3.5, B).

3.1.3

Discussion

Here, I demonstrated that iRAS and iRAF ES cells can be forced – by culture in the presence of 4HT – to induce and sustain relatively high levels of Erk activity (Figures 3.2, A & 3.4, A). In TS cells, Erk phosphorylation relies on paracrine Fgf signalling, but provision of this growth factor to wild-type ES cells is insufficient to robustly transduce this signal, thus revealing a functional disconnection between extracellular Fgf and the intracellular Ras/Erk pathway (Figure 3.4, A). The receptor Fgfr2 – whose expression is markedly upregulated in TS versus ES cells – could represent the missing link (Figure 3.4, A). It is noteworthy that ES cells are sensitive to Fgf, as demonstrated by the fact that this stimulus prompts exit from self-renewal (Figure 3.3, A) [Kunath et al., 2007; Stavridis et al., 2007], and consistently, low level Fgfr2 expression is detected in ES cells (data not shown); yet, signal transduction does not lead to positive auto-regulatory loops, Fgfr2 is continuously repressed and Erk activity remains low (Figures 3.2, A & 3.4, A). Remarkably, it was shown that DNA hypomethylated ES cells respond to Fgf by upregulating the expression of Fgfr2c – which encodes for the critical Fgfr2 receptor isoform in the trophoblast lineage – therefore suggesting that this epigenetic mechanism crucially represses a key component of this signal transduction pathway; notably, this repression is thought to be indirect, possibly via 5mC-dependent silencing of the key TS cell transcription factor Elf5 [Ng et al., 2008]. At least one other mechanism has been proposed to inhibit the Ras/Erk pathway

3.1. Phospho-Erk is insufficient for ES cell transdifferentiation to TS-like cells 87 in ES cells. The growth factor Bmp4 – stimulating the Tgfβ signalling branch, relying on Smad1/5/8 for intracellular transduction – is known to sustain indefinite ES cell proliferation, in combination with the cytokine Lif [Ying et al., 2003]; it was reported that this function is dependent on inhibition of Lif-induced Erk phosphorylation, via the activity of the Dusp9 phosphatase [Li et al., 2012]. Bmp4 is commonly present in the serum preparations used for tissue culture, including TS cell culture. Undefined serum factors are indispensable for self-renewal of multipotent TS cells and Bmp4 may represent one of them. For this reason, iRAF ES cells were grown in the presence of serum for the entire period of transdifferentiation to TS-like cells. Consequently, it remains to be evaluated whether, in particular in the initial phase of transdifferentiation, Bmp4 ligand – contained in the serum – may inhibit Erk signalling, and potentially counteract the conversion to TS-like cells. iRAF ES cells, cultured in TS cell medium and forced to sustain high Erk signalling level – via 4HT treatment – for a period of 7 days, acquire a flat colony morphology, characteristic of epithelial cell colonies, like those formed by TS cells (Figure 3.3, A); this sign is indicative that iRAF ES cells are undergoing transdifferentiation to TS-like cells. It is noteworthy that combination of Lif signalling with forced Erk activity leads to high levels of cell death, presumably by caspase-dependent apoptosis (Figure 3.3, A & B). In these conditions, both the Jak/Stat3 and the Ras/Erk pathways are stimulated, but neither of these two has been found to promote cell death in ES cells. Of note, in iRAF ES cells, 4HT treatment also causes a small increment of phospho-p38 levels (Figure 3.2, B); interestingly, inhibition of this pathway was previously reported to improve viability of self-renewing ES cells [Ying et al., 2003]. It follows that p38 activity may be responsible for the observed phenotype and this hypothesis could be tested in the future, using specific inhibitors. In iRAF ES cells, cultured in TS cell medium for a 7 day period, 4HT-dependent Erk signalling leads to upregulation of Cdx2 transcription factor and downregulation of Oct4 transcription factor (Figure 3.3, A). It is known that forced-regulation of these two key determinants of TE and ICM specification – e.g., Cdx2 induction and Oct4 repression, respectively – causes ES cell transdifferentiation to TS-like cells [Niwa et al., 2005]. It was previously reported that stimulation of Cdx2 expression, and inhibition of Nanog expression – which is essential for pluripotency – occurs

88

CHAPTER 3. RESULTS

within 24 hours of induction of Ras/Erk hyperactivity [Lu et al., 2008]. However, in these two publications, all molecular analyses performed during transdifferentiation are presented as comparisons between inducible models of ES cell-derived TS-like cells and their corresponding parental cell lines; no direct comparison with TE/ExEderived TS cells is shown. Here, this more stringent comparison was performed, revealing that iRAF ES cells, after 7 days of Erk-dependent transdifferentiation, express Cdx2 levels markedly lower than those found in genuine TS cells (Figure 3.4, A & B). These analyses were extended to a group of transcription factors – including Eomes, Elf5, Gata3, Tcfap2c, Ets2 – which are considered to cooperatively control the TS cell gene expression programme (Figure 3.4, A & B) and gave similar results. As previously described, the detection of only very low levels of Fgfr2 expression – visualized by Western blot after prolonged overexposure (Figure 3.4, A and data not shown) indicates that Erk activity remains dependent on 4HT treatment and cannot be sustained by extracellular Fgf, as it is in TS cells. In wild-type ES cells, Elf5 transcription has been linked with demethylation of its DNA cis-acting regulatory elements [Ng et al., 2008; Pearton et al., 2011]. Absence of Elf5 expression, during iRAF ES cell transdifferentiation, argues against the occurrence of epigenetic reprogramming, at least, at this specific locus (Figures 3.4, A & 3.5, A). iRAF ES cells, after 7 days of transdifferentiation, present some features of TS-like cells (e.g., epithelial-like morphology, Cdx2 induction) but lack others (e.g., Elf5 and Fgfr2 expression); therefore, they can be described as being in an intermediate stage of this process, in between ES and TS-like cells. Notably, in iRAF ES cells, 4HT-dependent Erk signalling causes silencing of Oct4 expression, which – according to protein concentration levels (Figure 3.4, A) – appears to precede induction of Cdx2 expression. In ES cells, experiments involving forced Oct4 and Cdx2 regulation led to the concept – mainly based on the reciprocal expression patterns of these two factors – that Oct4 repression is mediated by Cdx2 [Niwa et al., 2005]; differently, in vivo, no direct relationship is observed between Cdx2 and Oct4 expression dynamics during the transition from the morula to the blastocyst stage [Dietrich & Hiiragi, 2007; Guo et al., 2010]. The data presented here support the existence of an Oct4 repressive mechanism, triggered by phospho-Erk, which is at least initially independent of Cdx2.

3.1. Phospho-Erk is insufficient for ES cell transdifferentiation to TS-like cells 89 In order to investigate whether iRAF ES cells can complete conversion to TS-like cells over a longer period of time, I extended my analysis up to 15 days. Remarkably, no further progression was observed, as demonstrated by the finding that the expression of key TS cell transcription factors does not increase during the second week of transdifferentiation (Figure 3.5, A). TS cell self-renewal requires the activation of Fgf/Ras/Erk signalling, Tgfβ signalling – via Smad2/3 – and additional stimuli elicited by undefined serum factors (see Section 1.2.2). As discussed above, culture in CM/serum on a MEF feeder layer likely provides a concentration of Tgfβ/Activin capable to maximally activate the Tgfβ signalling branch transduced by Smad2/3. Bmp4 – which signals through the parallel branch of Tgfβ signalling dependent on Smad1/5/8 – is released by TE/ExE-derived TS cells, as well as generally present in the serum, and it may contribute to self-renewal and multipotency. Notably, when signal transduction through this pathway was enhanced by supplementation of Bmp4 – during iRAF ES cell transdifferentiation – this specifically led to a marked increase in Cdx2 transcription – approaching levels observed in genuine TS cells – without influencing the expression of other TS cell transcription factors. Remarkably, enhancing Cdx2 expression levels does not favour the progression towards TS-like cells. This could be due to the fact that Cdx2 protein concentration does not appear to increase in a manner proportional to Cdx2 mRNA levels (see Figure 3.4, A & B, for comparison), implying that post-transcriptionally regulatory mechanisms – e.g., mediated by miRNAs – may interfere with Cdx2 mRNA translation, or that Cdx2 proteins may be rapidly degraded – e.g., via proteosome-dependent degradation. Alternatively, as previously proposed, Bmp4 may inhibit Erk signalling, in particular during the initial period of transdifferentiation. Yet, individual cells presenting high Cdx2 protein concentrations do not form TS-cell like colonies (Figure 3.3, A), suggesting that upregulation of this single transcription factor may be insufficient to complete this lineage conversion. Hence, iRAF ES cell transdifferentiation to TS-like cells – after day 7 – appears to stall at an intermediate stage. Expression of marker genes for multiple definitive trophoblast cell types was not detected (Figure 3.5, B); this finding excludes the possibility that iRAF transdifferentiating cells may rapidly transit through an unstable TS cell state, eventually proceeding towards terminal differentiation. Taken together, these observations indicate that Erk signalling is sufficient to initiate but not to complete ES cell transdifferentiation to TS-like cells.

TSdiff

ES

A

TS

CHAPTER 3. RESULTS

XEN

90

wt0ES

iRAS0ES

iRAF0ES

KDa

p-ERK1/2

37

ERK1/2 p-FRS2α

37 75

EGFP

25

TUBULIN 0

50 0

1 0

1 0

1

TSdiff

TS

iRAF0CHF

XEN

B

ES

4HT08μM C iRAS0ES

iRAF0ES

KDa

p-JNK854C

50

p-JNK846C/p-ERK1 p-ERK2

37 37

p-P38

50 H 2O2

4HT

-0FBS

TUBULIN

0

1 0

1

4HT08μM C

Figure 3.2: Inducible Erk signalling in iRAS and iRAF ES cells (A) Upregulation of phospho-Erk to levels approaching those observed in TS cells was observed – by Western blot – in iRAS and iRAF ES cells, in response to increasing concentration of 4HT (24h). Inducible Erk phosphorylation, in iRAS and iRAF ES cells, does not elicit positive auto-regulatory feedback upstream of the Ras/Erk pathway, as indicated by absence of Frs2α phosphorylation. (B) Inducible Erk phosphorylation is associated to a modest increase in phospho-p38 levels in iRAF – but not in iRAS – ES cells. No effect is seen on phospho-Jnk levels, in response to 4HT treatment. Chinese Hamster Fibroblast constitutively expressing ΔRAF1:ER (iRAF CHF) were cultured either in the absence of serum (control negative), in the presence of 4HT (phospho-Erk control positive) or in the presence of H2 O2 (phospho-Jnk and phospho-p38 control positive) as references. Note that anti-phospho-Jnk antibody cross-reacts with phospho-Erk.


OCT4/CDX2/DAPI

A

iRAF ES

100 μm LIF+4HT

LIF

day 7

FGF/CM

B

FGF/CM+4HT

control ES

iRAF ES

KDa 150 100

PARP1 p-ERK1/2 ERK1/2 ER ΔRAF:ER

37 37 75

-

+ LIF

-

+

FGF/CM

-

+ LIF

day 2

-

+

4HT

FGF/CM

Figure 3.3: iRAF ES cells initiate transdifferentiation to TS-like cells(A) Representative immunofluorescence images of iRAF ES cells cultured for 7 days in different conditions. In culture medium promoting transdifferentiation to TS-like cells (FGF+CM/serum+4HT), all cells lose Oct4 expression and some of them gain Cdx2 expression. Note that, in LIF+4HT, some dead cells – detached and autofluorescent – are visible. (B) In iRAF ES cells, cultured in ES cells conditions (LIF), forced induction of Erk phosphorylation (+4HT) results in increased level of Parp1 cleavage, an hallmark of capspase-dependent apoptosis.

TS/diff

ES

A

TS

CHAPTER 3. RESULTS

XEN

92

ctrl/ES

iRAF/ES

OCT4

KDa 37

CDX2

37

EOMES

75 25 100

ELF5 FGFR2

37 37 + 4HT

p+ERK1/2 ERK1/2

-

+ LIF

-

+

FGF/CM

+

-

LIF FGF/CM

day/7

B 400

140 120 100 80 60 40 20 0

Elf5 Ets2

Eomes Gata3

TS/diff

TS

XEN

apop

tosis

Cdx2 Tcfap2c

ES

I/of/TS/cells

-

+///////e

+///////e

+///////e

+///////e

LIF

FGF/CM

LIF

FGF/CM

ctrl/ES

4HT

iRAF/ES day/7

Figure 3.4: Partial iRAF ES cell transdifferentiation to TS-like cells (day7) (A)Downregulation of Oct4 and parallel upregulation of Cdx2 was detected – by Western blot – in iRAF ES cells cultured in conditions promoting transdifferentiation to TS-like cells. However, Cdx2 levels were significantly lower than those observed in TE/ExEderived TS cells. Similarly, Eomes, Elf5, Fgfr2 expression, was barely or not detectable.(B) Gene expression levels of six key TS cell transcription factors were measured by qPCR. In transdifferentiation-promoting conditions (FGF+serum/CM+4HT) all genes were upregulated, but not to levels comparable to those observed in genuine TS cells. Data were normalized on Sdha and Tbp expression (total RNA content); mean +/- s.d. are shown (n=3).


A 312

140

Cdx2 Tcfap2c

vsofsTSscells

120

Eomes Gata3

Elf5 Ets2

100 80 60 40 20 0 ES

XEN

vsofsTSsdiffs6d

B

TSsdiff +svehicle +BMP4 +SB43 iRAFsESs FGF/CMs+4HT days15

TS

120 100 80 60 40 20 0

Pl1 Tpbpa SynA

TSs

TSsdiffs iRAFsES FGF/CM 6d +s4HT

days15 Figure 3.5: iRAF ES cell transdifferentiation to TS-like cells is stalled at an intermediate stage (day 15) (A) iRAF ES cells were subjected to transdifferentiation to TS-like cells for 15 days ± either Bmp4 or the Alk4/5/7 inhibitor SB431542. Gene expression levels for six key TS cell transcription factors were measured by qPCR. Bmp4 enhanced Cdx2 transcription, but did not increase the expression levels of other transcription factors. (B) Markers for multiple differentiated trophoblast cell types (Pl1, Tpbpa, SynA) were not detected in iRAF TS-like cells. Data were normalized on Sdha and Tbp expression (total RNA content); mean +/- s.d. are shown (n=3).

94

3.2

CHAPTER 3. RESULTS

Comparative analysis of ES cell transdifferentiation to TS-like cells

The finding that iRAF ES cells initiate but do not complete conversion to TS-like cells prompted me to assess the extent of transdifferentiation in other previously reported ES cell models of this process. ES cells with inducible gene knockout of the transcription factor Oct4 (originally termed ZHBTc4 ES, but here renamed Oct4-cKO ES, for clarity) or with inducible knockin of the transcription factor Cdx2 (iCdx2 ES) are the more in-depth characterized systems of transdifferentiation to TS-like cells [Niwa et al., 2000, 2005; Kuckenberg et al., 2010]. Therefore, a comparative analysis of ES cell transdifferentiation to TS-like cells – including iRAS, iRAF, Oct4-cKO and iCdx2 ES cells (Table 2.1) – was performed, in order to establish how closely these models resemble TE/ExE-derived TS cells. This investigation was based on a comprehensive analysis of morphology and of multiple molecular markers.

3.2.1

Microscopical observations and cell counts

iRAS, iRAF, Oct4-cKO and iCdx2 ES cells were cultured for 18 days in conditions promoting transdifferentiation to TS-like cells – that is, in TS cell culture medium (FGF+CM/serum) on a MEF feeder layer, and supplemented with the small molecule activator appropriate to each inducible system (4-hydroxy-tamoxifen, 4HT 1µM; or doxycycline, dox 1µM) (Figure 3.6). In parallel, a control ES cell line expressing EGFP (ctrl ES) – to assess both the potential unspecific effects of stable transfection and the influence of the culture micro-environment – and two distinct TE/ExE-derived TS cell lines (Rosa26 TS and EGFP TS) were cultured, as references. Note that TS cells were previously derived from transgenic mouse strains [Tanaka et al., 1998], ubiquitously expressing two different marker genes – either βgeo (Rosa26) or EGFP – for the original purpose of lineage tracking studies in chimera (refer to Table 2.1 for further information) [Friedrich & Soriano, 1991; Hadjantonakis et al., 1998]. Initially, I characterized cellular identity via a qualitative analysis based on morphological observations. Representative images, collected at day 18, are shown

3.2. Comparative analysis of ES cell transdifferentiation to TS-like cells

ES cell self-renewal 0 Inducible ES cell models of transdifferentiation LIF + serum to TS-like cells

95

transdifferentiation to TS-like cells 6

12

18

days

FGF+serum/CM on a MEF feeder-layer (+4HT or dox) every 6 days, cells were harvested, analysed and replated

Figure 3.6: Comparative analysis of ES cell transdifferentiation to TS-like cells: experimental scheme

(Figure 3.7). In comparison to control ES cell colonies, which largely retain a three-dimensional round shape – typically associated with pluripotency – iRAS ES cell colonies underwent differentiation. However, these transdifferentiating cells did not acquire the epithelial features characteristic of TE/ExE-derived TS cell colonies, such as extended cell-cell contacts and a continuos colony margin. Some iRAF ES cell colonies were remarkably similar to genuine TS cell colonies, but these cultures were highly hetereogeneous. Notably, both Oct4-cKO and iCdx2 ES cell-derived TS-like colonies consistently showed an epithelial morphology. Nevertheless, I could unequivocally distinguish all models of presumptive TS-like cells from ex vivo derived bona fide TS cells, on the account of the size of individual cells and colonies, and also based on the low number of colonies growing in culture. When similar numbers of TE/ExE-derived TS cells and of ES cells of the four different inducible models (plus control ES cells) were plated at the start of the reprogramming process and cultured under identical conditions, cell counts revelead that the proliferation rate of ES cells, undergoing transdifferentiation to TS-like cells, was at least 10 times lower than that of bona fide TS cells (Figure 3.8). In order to extend my phenotypic characterization, I subjected ES cell-derived TS-like cells (at day 12 of transdifferentiation) to immunofluorescence staining for Cdx2 and Elf5 – which are two key TS cell transcription factors (Figure 3.9 and Appendix, Figure 1). In iRAS or iRAF ES, small numbers of transdifferentiating cells showed high signal intensity for Cdx2, but Elf5 staining was extremely rare. In contrast, in Oct4-cKO and iCdx2 presumptive TS-like cells, Cdx2 and Elf5 were

CHAPTER 3. RESULTS 96

Rosa26 TS

day18

100 μm

EGFP TS

iRAF ES +4HT

control ES

iRAS ES +4HT

Oct4-cKO ES +dox iCdx2 ES +dox

Figure 3.7: Comparative analysis of ES cell transdifferentiation to TS-like cells: phase/contrast microscopy Representative micrographs of cells cultured for 18 days in transdifferentiation culture conditions (FGF+CM/serum on a MEF feeder layer) and supplemented with either 4HT or dox.

Phase contrast


B 10

3

cellncountnx104nulog10g

cellncountnx104nulog10g

A

97

102 101 1

dayn6

104

Rs26nTSn+n4HT/dox EGFPnTSnufilledg

103

controlnESn+n4HT 102

iRASnESn+n4HT iRAFnESn+n4HT

101 1

Oct4-cKOnESn+ndox dayn6

dayn12

dayn18

iCdx2nESn+ndoxn

Figure 3.8: Comparative analysis of ES cell transdifferentiation to TS-like cells: cell counts (A) Equivalent number of cells from two independently TE/ExEderived TS-cell lines (Rs26 and EGFP) were grown for 6 days under identical culture conditions and counted using Casy Counter. (B) Equivalent numbers of cells from each inducible ES model of transdifferentiation to TS-like cells were cultured in identical transdifferentiation conditions; control ES cells and TE/ExE-derived TS cells (Rs26) were included as references. Every 6 days, cell cultures were harvested, counted (using Casy Counter) and equivalent cell numbers were passaged to fresh flasks.

generally co-expressed, even though their expression levels were more heterogeneous than in genuine TS cells. Notably, in the latter models, differentiated cells – characterized by large polyploid nuclei, as visualized by chromatin counterstaining with DAPI – were observed, both in the interior (Oct4-cKO) or in the exterior (iCdx2) of the colonies, at higher frequency than in bona fide TS cell colonies, which generally present only a small number of differentiated cells – if any – at their periphery.

3.2.2

Flow cytometry analysis and alkaline phosphatase assay

A quantitative analysis of ES cell transdifferentiation to TS-like cells was performed by flow cytometry for the surface-antigen CD40, which was recently identified as a specific marker to distinguish TS versus ES and XEN cells [Rugg-Gunn et al., 2012]. Preliminary experiments were carried out to confirm the differential expression of this antigen, in the context of the present study: CD40 was found


iRAF ES +4HT

100 μm

Rosa26 TS

day 12

iRAS ES +4HT

EGFP TS

iCdx2 ES +dox

control ES

Oct4-cKO ES +dox

Figure 3.9: Comparative analysis of ES cell transdifferentiation to TS-like cells: immunofluorescence microscopy for Cdx2 and Elf5 Representative immunofluoscence images – collected at day 12 of transdifferentiation – for Cdx2 and Elf5 transcription factor expression. In iRAS and iRAF transdifferentiation models, Cdx2-positive colonies were rarely observed; of those, only a minority express some level of Elf5, as shown here. Oct4-cKO and iCdx2 presumptive TS-like colonies showed widespread expression of both Cdx2 and Elf5, even though their levels were more heterogeneous than in TE/ExE-derived TS cells. Notably, in the latter models, differentiated cells (arrowheads) – characterized by large polyploid nuclei and Cdx2/Elf5 downregulation – were frequently observed. Separate images for Cdx2, Elf5 and DAPI stainings are presented in Appendix (Figure 1).

CDX2 / ELF5 / DAPI


99

to be expressed at high levels in TS cell lines and downregulated upon in vitro differentiation (Figure 3.10, A-C); conversely, ES cells – including all ES cell models of transdifferentiation – show only low levels of this marker, in self-renewal conditions (LIF+serum) (Figure 3.10, D). ES cell lines were then induced to transdifferentiate during an 18 days time-course and subjected to CD40 flow citometry analysis (Figure 3.11). During the initial phase of this process, iRAS and iRAF ES cells – in which forced Erk signalling is induced by 4HT treatment – progressively upregulated CD40 expression, approaching maximal observed levels at day 6 – which coincides with the timing of the first tissue culture passage (Figure 3.6). Afterwards, CD40 levels were gradually lost by iRAS ES cells, but largely retained in iRAF ES cells, albeit cell populations presented broad distributions of signal intensities, which are indicative of heterogeneity. In contrast, transdifferentiating Oct4-cKO and iCdx2 ES cells rapidly reached maximal CD40 expression by day 3, and steadily maintained these intensity values for the rest of the time-course; they also showed a relatively homogeneous signal distribution within cell populations. Remarkably, Oct4-cKO, iCdx2 and iRAF ES cell-derived TS-like cells – with iRAF cells presenting relatively high hetereogeneity – acquired CD40 expression levels close to those observed in TE/ExE-derived TS cells. Yet, average signal intensities for these presumptive TS-like cell populations remained lower than those observed in genuine TS cells. It is noteworthy that control ES cells, during the first 6 days of the experiment, transiently induce CD40 expression, but this increase was rapidly lost during subsequent culture. In parallel, flow cytometry analyses were also carried out in order to measure the expression of CD31 (Pecam1) and CD140a (Pdgfrα), which are specific markers for ES and XEN cells, respectively [Rugg-Gunn et al., 2012]. In all four inducible ES cell models – undergoing transdifferentiation – CD31 expression was immediately lost at the onset of this process, and CD140a never significantly increased (Appendix, Figures 2 and 3). The initial kinetics of these events of ES cell transdifferentiation to TS-like cells were also monitored using a fluorimetric assay for the detection of alkaline phosphatase (AP) expression, which is a specific marker for pluripotent cells [e.g., Chambers et al., 2003]. This analysis – based on the observation of AP staining

100

CHAPTER 3. RESULTS

A

B

cell count

cell count

Rs26 TS avg

CD40 Rs26 TS IM8A1 XEN E14 ES mix (2ryonly) (dotted lines are no-Ab-ctrl)

CD40 Rs26 TS EGFP TS (dotted lines are 2ry-only-ctrl)

D

LIF/serum

cell count

cell count

C

CD40

CD40 Rs26 TS

1d

differentiation 2d (filled) (dotted line is no-Ab-ctrl)

3d

E14 ES iRAF ES control ES iCdx2 ES iRAS ES Oct4-cKO ES (dotted line is no-Ab-ctrl)

Figure 3.10: CD40 is a specific marker for self-renewing TS cells (A) Flow cytometry analysis for the surface-antigen CD40 in blastocyst-derived stem cells. Rs26 TS cells homogeneously express high levels of CD40. (B) Flow cytometry analysis for CD40 expression in two indepedently TE/ExE-derived TS cell lines (Rs26 and EGFP). CD40 is expressed at similar high levels in both cell lines, in particular when considering that the observed signal intensity difference between Rs26 and EGFP can be largely explained by the different background staining, due to unspecific secondary antibody binding. (C) Flow cytometry analysis for CD40 expression during Rs26 TS cell in vitro differentiation. (D) Flow cytometry analysis for CD40 expression in inducible ES cell models of transdifferentiation to TS-like cells, cultured in self-renewal conditions (LIF+serum), in the absence of the inductive molecule (4HT or dox).


+++iRAS+ES+++4HT

+++iRAF+ES+++4HT

cell+count

+++control+ES+++4HT

101

Rs26+TS avg

CD40 Oct4-cKO+ES+dox

+++iCdx2+ES++dox

day+of+ reprogramming 0+3+6+12+18

Figure 3.11: Comparative analysis of ES cell transdifferentiation to TS-like cells: time-course flow cytometry analysis for the TS cell-marker CD40 Inducible ES cell models were subjected to transdifferentiation towards TS-like cells by culture in FGF+CM/serum on a MEF feeder layer +/- 4HT or dox. Vertical dotted line indicates Rs26 TS cell average signal intensity (see Figure 3.10, A).

loss during the transdifferentiation process – found that Oct4-cKO and iCdx2 transdifferentiating cells more rapidly exited from pluripotency than iRAS and iRAF cells (Figure 3.12).

3.2.3

Gene expression analysis for key stem cell-specific transcription factors

Gene expression levels of key stem cell-specific transcription factors were measured during ES cell transdifferentiation to TS-like cells, for a period of 18 days (Figure 3.13). Following forced induction of Erk signalling, iRAS and iRAF ES cells upregulated Cdx2 and Eomes, reaching a peak in their expression at day 6, but


day 6

day 12

control ES + 4HT iRAS ES + 4HT iRAF ES + 4HT

Oct4-cKO ES + dox

iCdx2 ES + dox

Figure 3.12: Comparative analysis of ES cell transdifferentiation to TS-like cells: alkaline phosphatase assay Inducible ES cell models were subjected to transdifferentiation towards TS-like cells by culture in FGF+CM/serum on a MEF feeder layer +/- 4HT or dox. AP staining was performed at day 6 and 12 of transdifferentiation in order to identify pluripotent cell colonies, which are resistant to lineage conversion. A representative AP+ ES cell colony is shown at higher magnification.


103

afterwards progressively downregulated both genes; only minimal levels of Elf5 transcription were detected. In transdifferentiating Oct4-cKO and iCdx2 cells, the expression all three TS cell transcription factors was markedly increased starting from the day 6 time point, and thereafter maintained. Nevertheless, even in these presumptive TS-like cells, Cdx2 , Elf5 and in particular Eomes transcription was observed to fluctuate, never reaching stable high expression levels, comparable to those observed in TE/ExE-derived TS cells. In all inducible ES cell models, Oct4 was rapidly silenced at the onset of transdifferentiation; a modest increase in the mRNA levels of Gata6 was also observed, but this was not associated with the induction of other key XEN cell transcription factor genes, like Gata4 and Sox17. Expression of Fgf5 – which is a specific post-implantation epiblast marker [Brons et al., 2007; Tesar et al., 2007] – was never detected.

3.2.4

Discussion

A comparative analysis of ES cell transdifferentiation to TS-like cells was presented, evaluating four distinct inducible ES cell models of this process: two with inducible Erk signalling (iRAS and iRAF) and two with regulatable expression of key stem cell-specific transcription factors – either inducible TS cell transcription factor Cdx2 (iCdx2) or repressible ES cell transcription factor Oct4 (Oct4-cKO) (Table 2.1). This investigation included a TS cell line derived from outgrowth of TE/ExE tissues, in order to directly compare presumptive TS-like cells with bona fide TS cells. Transdifferentiation events were characterized as they progressed, by performing – in parallel and at regular intervals of time – morphological observations, cell counts and molecular analyses for multiple markers of stem cell identity; the latter included measures of mRNA and protein expression, either at the level of whole cell populations (e.g., quantitative-PCR and Western Blot) or of individual cells (e.g., immunofluorescence microscopy and flow cytometry). Four main conclusions can be extrapolated from the interpretation of the data provided. First, all the experiments presented – based on a number of different methodologies – gave consistent results, in terms of ranking transdifferentiating ES cell models according to their degree of similarity to TE/ExE-derived TS cells. Thus, though none of the individual parameters is absolute, they can represent – if taken

104

CHAPTER 3. RESULTS

-HofHTSHcells -HofHESHcells

150 125 100 75 50 25 0

-HofHXENHcells

controlHES+4HT iRASHES+4HT iRAFHES+4HT Oct4-cKOHES+dox iCdx2HESH+dox 150 125 100 75 50 25 0

150 125 100 75 50 25 0

Cdx2 Eomes Elf5 3

12

18

3

6

12

18

3

6

12

18

3

6

12

18

3

6

12

18

3

6

12

18

Oct4

3

6

12

18

3

6

12

18

3

6

12

18

3

6

12

18

Gata6 Sox17 Gata4

3

-HofHEBHd7Hcells

6

6

12

18

3

6

12

18

3

6

150 125 100 75 50 25 0

12

18

3

6

12

18

3

6

12

18

3

6

12

18

3

6

12

18

Fgf5

3

6

12

18

3

6

12

18

3

6

12

18

dayHofHreprogramming

Figure 3.13: Comparative analysis of ES cell transdifferention to TS-like cells: gene expression analysis. mRNA expression values for genes encoding for key stem cell-specific transcription factors – Cdx2, Eomes, Elf5 for TS cells; Oct4 for ES cells; Gata6, Gata4, Sox17 for XEN cells – were measured, by quantitative-PCR, during a time-course transdifferentiation experiment. Raw measures were normalized on Sdha and Tbp expression (for total RNA content) and Actn1 expression (for MEF RNA content) and compared to the levels found in the functionally relevant cell type, as stringent reference. At the onset of transdifferentiaton, upregulation of Cdx2 and Eomes and downregulation of Oct4 was observed in all models. However, upon the first tissue-culture passage (d6), only Oct4-cKO and iCdx2 cells maintained Cdx2 and Eomes expression and induced transcriptional reactivation of Elf5, which is subject to 5mC-dependent silencing in wild-type ES cells. Upregulation of XEN cell transcription factors was not observed, with the exception of some levels of Gata6. Fgf5 was included in the analysis, as marker for early somatic differentiation – using embryonic bodies (EB) as reference – and found to be not expressed. Data are mean +/- s.d (n=3).


105

together – a robust estimate of TS cell identity. Second, iRAS, iRAF, Oct4-cKO and iCdx2 ES cells all underwent unidirectional transdifferentiation towards TS-like cells, without any sign of either transdifferentiation to XEN-like cells or normal differentiation towards embryonic lineages. This observation is primarily based on flow cytometry analyses (Figure 3.11 and data not shown) for stem cell-specific surface antigens – CD40 for TS cells and CD140a/Pdgfrα for XEN cells. It is also supported by gene expression profiles of key stem cell transcription factors – Cdx2, Eomes and Elf5 (TS cells); Gata6, Gata4, Sox17 (XEN cells) – and of Fgf5, which is a post-implantation epiblast marker (Figure 3.13). Upon induction, ES cells expressed some levels of Gata6, but they did not upregulate other key determinants of PrE/XEN cell identity (like Pdgfrα , Gata4 and Sox17), whose expression is known to be Gata6-dependent [Artus et al., 2010, 2011; Frankenberg et al., 2011]. Of note, elevated CD40 expression levels mark both ExE/TS cells and post-implantation epiblast/EpiSCs [Rugg-Gunn et al., 2012], yet absence of Fgf5 expression argues against the occurence of differentiation towards embryonic lineages. Recent studies are consistent with these findings. Fgf signalling - which is a crucial instructive stimulus for PrE specification during embryogenesis - was not found to favour signalling-induced ES cell conversion to XEN-like cells, though initially required to prime ES cells for multi-lineage differentiation/transdifferentiation [Cho et al., 2012]. Two reports have shown that ES cells, presenting Oct4 levels approximately within 100 and 20% of maximal biallelic expression, can self-renew and retain pluripotency [Karwacki-Neisius et al., 2013; Radzisheuskaya et al., 2013]. Interestingly, inside this expression range, Oct4low cells are more resistant to differentiation stimuli than Oct4high cells. Outside of this interval, cells transdifferentiate: above its upper limit, towards the PrE/XEN lineage; and below its lower limit, towards TE/TS lineage, respectively [Niwa et al., 2000]. Induced Oct4-cKO and iCdx2 ES cells are known to rapidly silence Oct4 expression [Niwa et al., 2005]; also, iRAS and iRAF transdifferentiating cells appear to rapidly repress Oct4 (Figure 3.13). Hence, these additional observations are in line with the described unidirectional conversion towards the trophoblast lineage. Third, ES cell-derived TS-like cells derived by regulatable expression of key transcription factors (Oct4-cKO and iCdx2) more closely resemble genuine TS cells than those obtained by forced induction of Erk signalling (iRAS and iRAF). The

106

CHAPTER 3. RESULTS

discrepancy between these two groups is particularly evident when considering the dynamics of transdifferentiation (Figures 3.11 & 3.12) and the expression of key TS cell transcription factors (Figure 3.13); in particular, Elf5 transcription – which, in ES cells, has been associated with demethylation of its DNA cisregulatory elements [Ng et al., 2008; Pearton et al., 2011] – is induced only in transdifferentiating Oct4-cKO and iCdx2 cells. According to some parameters – e.g., cell colony morphology and CD40 expression (Figures 3.7 & 3.11) – but not others – e.g., Cdx2, Eomes, Elf5 expression levels (Figure 3.13) – transdifferentiating iRAF cells appear to acquire a status more similar to bona fide TS cells than iRAS cells. Both inducible ES cell models present 4HT-dependent Erk phosphorylation but, in iRAF ES cells, the activation of this pathway showed sligthly higher magnitude and faster kinetics, during a dose/response course experiment (Figure 3.2, A). Another peculiar characteristic of iRAF ES cells is the induction of a small increment in phospho-p38 levels, in response to 4HT (Figure 3.2, B). The Erk pathway has an essential role in sustaining TS cell self-renewal [e.g., Tanaka et al., 1998; Krueger et al., 2009; Nichols et al., 2009] and p38 signalling appears to be preferentially activated in extra-embryonic versus embryonic stem cells (Figure 3.2, B). Therefore, small differences in the activity of these two signalling cascades may underlie the phenotypic features that distinguish transdifferentiating iRAS and iRAF cells, respectively. Fourth, even Oct4-cKO and iCdx2 ES cell-derived TS-like cells – which were characterized as the best transdifferentiation models – appear to be not equivalent to bona fide TS cells. For example, Oct4-cKO and iCdx2 presumptive TS-like cells share some epithelial features with TE/ExE-derived TS cells, yet they were unequivocally distinguishable, based on different cell and colony size (Figure 3.7). Similarly, although TS cell-specific markers – e.g., the surface antigen CD40 (Figure 3.11) and the transcription factors Cdx2, Eomes, Elf5 (Figure 3.13) – were highly expressed in Oct4-cKO and iCdx2 TS-like cells, their levels were, on average, lower than those observed in genuine TS cells and also exhibited temporal fluctuations (Figure 3.13). Remarkably, all transdifferentiating ES cells showed a reduced proliferation rate in comparison with TE/ExE-derived TS cells (Figure 3.8), so that their maintenance was progressively affected, as the number of cell-culture passages increased. It is known that ES cells present an atypical cell


107

cycle configuration [reviewed by White & Dalton, 2005], which, in comparison to somatic cell types, is characterized by a very high proportion of cells in S phase – approximately 50% in ES cells versus 15-30% in somatic cells– and a very short cell cycle – approx. 10 vs. 20-25 hours. At the onset of normal ES differentiation, a switch from ES cell cycle to somatic cell cycle is observed. Genuine TS cells were shown to have a cell cycle profile similar to ES cells [Ullah et al., 2008, Figure 2; Tanaka et al., 1998, Figure 1C; Erlebacher et al., 2004, Figure 3C]. Of note, in ES cells, signal transduction — and in particular Erk activity — appears to be dispensable for cell cycle regulation [Ying et al., 2008]; in contrast, in TS cells, this is dependent on external stimuli – especially on the Fgf/Ras/Erk pathway [Tanaka et al., 1998; Ullah et al., 2008]. I speculate that transdifferentiating cells undergo repression of the signalling-independent ES cell cycle regulatory network, without acquiring the Fgf/Ras/Erk-dependent control system, which is active in bona fide TS cells. It is noteworthy that upon day 15 of transdifferentiation, iCdx2 cells showed evidence of cellular stress (e.g.. loss of cell-cell contacts)(Figure 3.7). Retrospectively, they were found to be contaminated by mycoplasma infection. This finding, in principle, may affect the reliability of the data presented for this cell line, in particular in the final part of the time-course (Figures 3.11 & 3.13). However, experiments carried out with an alternative system of Cdx2 induction (Cdx2:ER) and presented in section 3.4, largely confirmed the observations reported here, albeit iCDX2:ER ES cell-derived TS-like cells proved to be marginally more similar to genuine TS cells. In summary, a comparative analysis of ES cell transdifferentiation to TS-like cells was performed, by evaluating four distinct ES cell models of this process – two with inducible Erk signalling (iRAS and iRAF) and two with regulatable expression of stem cell specific transcription factors (Oct4-cKO and iCdx2) versus TE/ExEderived TS cells. Oct4-cKO and iCdx2 transdifferentiating cells reached a cellular state more closely resembling TS cells than transdifferentiating cells dependent on Erk signalling; yet, significant differences persist between presumptive TS-like cells and bona fide TS cells, leading to the conclusion that the observed cell lineage conversion remains incomplete.

108

3.3

CHAPTER 3. RESULTS

Genome-wide analysis of DNA methylation reprogramming in ES cell-derived TS-like cells

3.3.1

Comparative analysis of MeDIP-Seq datasets

The comparative analysis of ES cell transdifferentiation to TS-like cells, presented in the previous section, indicated that all inducible ES cell models under investigation, initiate but do not complete this lineage conversion. Among them, significant differences are observed: Oct4-cKO and iCdx2 ES-derived TS-like cells – which rely on forced regulation of key stem cell-specific transcription factors – undergo transdifferentiation with faster kinetics and to a greater extent than iRAS and iRAF cells, which are dependent on inducible Erk signalling. Notably, after approximately 12 days from induction, this lineage conversion appears to stall and transdifferentiating cells seemingly retain an intermediate stage of conversion. Until now, an analysis of the epigenetic status of ES cell-derived TS-like cells has not been reported, and consequently it is unclear to which extent transdifferentiating cells reprogramme their original DNA methylation profile. In order to investigate this process, I performed a comparative genome-wide DNA methylation analysis, based on Methylated-DNA Immuno-Precipitation – using a specific anti-5mC antibody – followed by high-throughput Sequencing (MeDIP-Seq) [Weber et al., 2005; Ficz et al., 2011]. Inducible ES cell models – including iRAS, iRAF, Oct4-cKO and iCdx2 – together with reference cell types – control ES and Rs26 TS – were cultured in TS cell conditions (FGF+CM/serum ± 4HT or dox), on a layer of murine embryonic fibroblasts (MEFs), for 12 days; at this point, cell populations were separated from MEFs by FACS (see Section 2.8 & 2.9) and subjected to analysis. In line with recently published experiments, an average of 35 million sequencing reads were obtained for each dataset, of which approximately 50% could be uniquely aligned to the reference genome (NCBI Mouse 37 assembly), with the remaining sequences being assigned to highly repetitive DNA elements [e.g., Ficz et al., 2011]. Bioinformatic analysis included four additional datasets, previously obtained in our laboratory, from J1 and E14 ES cells – cultured in ES cell conditions (LIF+serum)

3.3. Genome-wide analysis of 5mC reprogramming in ES ⇒TS-like cells

109

on gelatin-coated surfaces – and from EGFP and Rs26 TS cells – cultured in TS cell conditions without a MEF feeder layer [Senner et al., 2012]. Dataset comparison was made possible upon multistep normalization (see Section 2.17). Initial interrogation of the 11 MeDIP-Seq datasets available – based on 5kb contiguous sequence segments (or probes) spanning the entire genome – showed similar median and distribution of normalized "per probe read counts" (that is, number of sequencing reads for each sequence segment), as visualized by a boxwhisker plot (Figure 3.14, A). Also, when a Pearson correlation value (R value) was generated for each possible pair of datasets (53 comparisons), the resulting matrix revealed a high level of relatedness across all methylomes (Figure 3.14, A). Similar conclusions could be drawn when the data analysis focused on specific subsets of sequences distributed across the genome (Figure 3.14, B-D), such as CpG islands (CGIs), annotated genes, or promoters of protein-coding mRNAs. This indicates that ES and TS cells, as well as all ES cell-derived TS-like cells, present highly similar DNA methylation profiles when the entire genome is subjected to analysis, or when specific subsets of sequences are considered on a genome-wide scale. This is in agreement with previous studies which reported that differences in 5mC levels, among ES, TS, XEN cells and EpiSCs, are confined to a relatively small number of short regulatory sequences (promoters or CGIs) [Senner et al., 2012]. For this reason, I screened the ES and TS cell MeDIP-Seq datasets searching for differentially enriched promoters of protein-coding mRNAs, with the aim to focus my comparative analysis on this group of regulatory elements. To perform such analysis – using SeqMonk data analysis software [Andrews, 2008, 2012] – I first combined the three ES cell datasets (J1, E14 and E14 on MEF-feeder layer) in a single dataset (or replica-set, created by assigning to each probe the average value among the three datasets). Analogously, I generated a TS cell replica-set, starting from the three TS cell datasets (EGFP, Rs26 and Rs26 on MEF-feeder layer). Comparison of the ES cell replica-set versus the TS cell replica-set – as visualized by a scatter plot (Figure 3.15,A) – showed that MeDIPSeq enrichment, at gene promoters, is overall highly correlated (R value=0.914), as aforementioned. Differentially enriched promoters were identified using a statistical test which takes into account the observed intensity-dependent signal distribution - that is, the observation that probe intensity variance is inversely correlated to

110

CHAPTER 3. RESULTS

B

Whole-genome

20 15 10 5 0

C

CGI 30 20 10 0

R

correlation matrix

per probe read count normalized (log2)

A

R

1.0 0.8 0.6 0.4 0.2 0.0

1.0 0.8 0.6 0.4 0.2 0.0

D Protein-coding mRNA promoters

Genes

20 15 10 5 0

12 8 4 0

R

J1 ES E14 ES E14 ES (on MEF)

1.0 0.8 0.6 0.4 0.2 0.0

control ES iRAS TS-like iRAF TS-like iCdx2 TS-like Oct4-cKO TS-like

R

1.0 0.8 0.6 0.4 0.2 0.0

Rs26 TS (on MEF) Rs26 TS EGFP TS

Figure 3.14: Comparative analysis of genome-wide MeDIP-Seq datasets obtained from ES cell-derived TS-like cells. DNA methylation (5mC) genome-wide enrichment profiles were obtained by MeDIP-sequencing (MeDIP-Seq). (A) Bioinformatic analysis of 11 MeDIP-Seq datasets, on the the entire genome sequence, was based on 5kb contiguous probes. Box-whisker plot show no significant difference in the median or distribution of normalized per-probe read counts across all methylomes. A Pearson’s correlation (R-value) matrix indicates a high level of relatedness among all datasets. (B-D) Similar results were obtained when the data analysis focused on specific subsets of sequences: (B) CpG islands (CGIs) [Illingworth et al., 2010]: one probe per CGI; (C) annotated genes (Ensembl): 5kb contiguous probes; (D) promoters of protein-coding mRNAs (Ensembl): three overlapping 5kb probes - spaced 2.5kb apart - and covering a 10kb region around the transcriptional start site (TSS).


111

the median probe intensity (Figure 3.15, A). Briefly, for each probe, this test first calculates a local intensity distribution based on the 2% of probes with the closest intensity values. Second, this distribution is modelled against a normal distribution. Third, a probability value (p-value) is calculated for estimating the likelihood that the intensity value of the probe under analysis does not differ from the median of the distribution. Probes with a p-value of less than 0.05% were assumed to be differentially enriched (Figure 3.15, A). Applying this statistical test, I found 482 differentially methylated promoters, of which 446 were hypermethylated in TS versus ES cells and 36 had the opposite pattern, being hypermethylated in ES versus TS cells (see Appendix, Tables 2 & 1). Functional classification of these two promoter groups was obtained using DAVID bioinformatic resources [Huang et al., 2009] (Figure 3.15, B & C). The small cluster of promoters hypomethylated in TS versus ES cells was further annotated, by investigating the knockout mouse model phenotype – if available – on the Mouse Genome Informatics (MGI) online database and the relative gene expression levels in TS versus ES cells, by mining a recently published microarray dataset [Rugg-Gunn et al., 2010]. MeDIP-Seq read count profiles for Oct4 and Elf5 promoters - which were chosen as representative of the promoter group hyper- and hypo-methylated in TS versus ES cells, respectively, are shown (Figure 3.16). Data validation performed by Sequenom EpiTyper assay – a mass spectrometrybased DNA methylation assay (see Section 2.16) – and by conventional Sanger bisulphite sequencing (Figure 3.17, A & B) confirmed that normalized MeDIP-Seq read counts are reliable estimates of DNA methylation levels. Thus, I decided to consider this group of differentially methylated promoters – further classified in two subgroups with opposite 5mC patterns – as a molecular signature of cell identity, in order to assess to which extent – at the epigenetic level – ES cell-derived TS-like cells resemble TE/ExE-derived TS cells. When the analysis was focused on these two subgroups of promoters, presumptive TS-like cells presented median numbers of per-probe read counts which were intermediate between ES and TS cell values, with iCdx2 and Oct4-cKO transdifferentiating cells being the closest to genuine TS cells (Figure 3.18, A). A Pearson’s correlation matrix – which estimates the overall level of relatedness between each

CHAPTER 3. RESULTS

Protein-coding mRNA promoters (all probes) Differentially enriched (p-value=0.05) 20 15

TS cells

A

normalized read count (Log2)

112

10

R=0.914

Oct4

5 Elf5

5

ES cells 10

15

20

B Gene promoters hypomethylated in ES versus TS cells (n= 446) DAVID annotation cluster

p-value

Representative genes

Homeobox transcription factors

1.05E-35 / 1.1E-73

Pou5f1, Klf2, Klf4, Sall4, Zscan10, Pax2, Pax6, Foxa1, Foxb1, Sox17, Hoxa2, Hoxb1, Hoxd3, Gsc, Meis1, Tal1,Olig2

Cell fate commitment

1.8E-20 / 6.0E-40

Gli2, Nkx2-1, Prdm14, Tal1, Dll1, Foxa1, Gdnf, Isl2, Neurog2, Otx2, Pitx1, Runx2, Pax2, Pax6, Sall1, Spry2, Wnt3

Embryonic morphogenesis

9.2E-6 /8.2E-46

Bmi1,Gli2, Hnf1b, Lhx1, Nkx6-1, Tbx3, Alx3, Crabp2, Cxcl12, Dll1, Fst, Foxd3, Hoxa2, Hoxa9, Gsc, Lefty1, Mbd3, Rarg, Shh

C Gene promoters hypermethylated in ES versus TS cells (n= 36) DAVID annotation cluster

p-value


Transcriptional regulation

1.1E-1 / 7.7E-3

Elf5, Tead4, Mef2d, Mtf1, Mafk, Zfhx4

Cytoskeleton

1.7E-1 / 3.0E-2

Ezr, Ptp4a2, Plec, Plet1

Proteolysis

2.6E-1 /4.6E-1

Tinagl1, Cbp1, Usp3

Mouse mutants showing defective trophoblast development Genes ≥ 2-fold higher expressed in TS cells versus ES cells

Figure 3.15: MeDIP-Seq dataset screen for differentially 5mC-enriched mRNA promoters in ES versus TS cells. (A) Scatter plot of ES cell replicaset versus TS cell replica-set. Each dot represents a 5kb probe spaced 2.5kb apart, located in a 10kb region centered on the TSS. Blue dots correspond to probe sequences found to be differentially MeDIP-Seq enriched, based on an intensity-dependent statistical test. (B-C) Functional annotation and classification of gene promoters either hypomethylated (B) or hypermethylated (C) in ES vs TS cells performed using DAVID bioinformatic resources [Huang et al., 2009].In red are genes, whose mouse mutants show defective trophoblast development according to the MGI online database. In blue are genes found to be > 2-fold higher expressed in TS vs ES cells [Rugg-Gunn et al., 2010].


A

113

Elf5

normalized read count

J1 ES E14 ES E14 ES (on MEF) control ES iRAS TS-like iRAF TS-like iCdx2 TS-like Oct4-cKO TS-like Rs26 TS (on MEF) Rs26 TS EGFP TS 32 10

00

00

00

0 62

10

32

B

0 66

10

32

0 70

location on chr 2

Pou5f1 (Oct4)

normalized read count

J1 ES E14 ES E14 ES (on MEF) control ES iRAS TS-like iRAF TS-like iCdx2 TS-like Oct4-cKO TS-like Rs26 TS (on MEF) Rs26 TS EGFP TS 00 64 5 3

00 35

6

0 44

00 35

6

0 48

00

location on chr 17

Figure 3.16: MeDIP-Seq read count profiles at Elf5 and Oct4 promoters Representative MeDIP-Seq read count profiles for Elf5 and Oct4 promoters, which are defined as 10kb sequences centered on the corresponding TSS. Upon multistep normalization, number of sequencing reads was expressed as Log2 . Top annotation track shows promoters (arrows) and exons (boxes). (A) Elf5 promoter. Blue segment indicates the Elf5 promoter region [Ng et al., 2008], which was subjected to validation experiments (see Figure 3.17). Green segment marks a recently identified TS cell-specific enhancer element [Pearton et al., 2011] (B) Oct4 promoter.

114

CHAPTER 3. RESULTS

A 5mC (%)

100 80 60 40 20

Elf5 promoter E14 ES control ES iRAS TS-like iRAF TS-like iCdx2 TS-like Oct4-cKO TS-like Rs26 TS

0

B

Elf5 promoter

E14 ES iCdx2 Oct4-cKO Rs26 TS (93.3%) TS-like TS-like (16.0%) (64.0%) (26.5%) Figure 3.17: MeDIP-Seq dataset validation by Sequenom EpiTyper assay and Sanger bisulphite sequencing at Elf5 promoter (A) Bar chart illustrating 5mC levels (% of cytosines) at two CpG dinucleotides within the Elf5 promoter element (-673/-273 from TSS) [Ng et al., 2008], based on Sequenom EpiTyper analysis (see Section 2.16. (B) Graph showing DNA methylation status at five contiguous CpG dinucleotides within the Elf5 promoter element (-673/-273 from TSS) based on conventional Sanger bisulphite sequencing. White and black circles represent unmethylated and methylated CpG, respectively. Each line corresponds to an independent sequencing analysis. Average DNA methylation levels (% of cytosines) are indicated.


115

possible pair of datasets – revealed the presence of three main clusters of datasets – defined as ES, ES cell-derived TS-like cells and TS cells – which are consistent with the biological differences observed among corresponding cell types. Each cluster shows high level of correlation among its constituent datasets and intermediate/low level of correlation when compared to the other two clusters (Figure 3.18, B). Furthermore, inside the ES cell-derived TS-like cluster, two sub-clusters can be distinguished based on the observation that iRAS and iRAF datasets correlate better with the ES cell cluster, whereas iCdx2 and Oct4-cKO datasets have a relatively higher level of correlation with the bona fide TS cell cluster. Subsequently – using SeqMonk data analysis software – an unbiased hierarchical clustering analysis was applied to the list of 482 selected promoters across all 11 MeDIP-Seq datasets, in order to investigate whether subgroups of promoters undergo distinct DNA methylation changes, in response to different transdifferentiation inducing stimuli (e.g., Erk signalling versus Cdx2 induction versus Oct4 repression). Briefly, this algorithm progressively clusters MeDIP-Seq read count profiles – one for each probe, with each profile indepedently normalized according to the median measured intensity value – starting by grouping together the two probes, whose intensity profiles show the highest level of relatedness (each promoter was represented by a maximum of three probes). The analysis proceeds by gradually extending this comparison to all probe profiles. A correlation value of 0.7 – which is generally recommended for this type of analysis [Andrews, 2012] – was applied as cut-off threshold to dictate the choice whether or not include a probe profile within a cluster. The resulting list, represented in a heat map, was divided in two groups – recapitulating the two clusters previously defined – of 446 and 36 promoters, which, during ES cell transdifferentiation to TS-like cells, were subjected to DNA methylation or DNA demethylation, respectively (Figure 3.19). When a further round of hierarchical clustering analysis – using a more stringent cut-off threshold (R=0.9) – was applied to the larger group of methylated elements, two subgroups emerged: subgroup A promoters (n=156, 35%) underwent DNA methylation in all models of ES cell-derived TS-like cells; subgroup B promoters (n=252, 57%) were targeted in Oct4-cKO and iCdx2 models, preferentially (Figure 3.19; Appendix, Table 2). The remaining promoters (subgroup Neither A nor B; n=38, 8%) were found hypermethylated in one or two models, but in a manner not dependent on

116

CHAPTER 3. RESULTS

ES versus TS cells differentially methylated promoters Hyper-methylated in TS cells (n=446) per probe read count normalized (log2)

A

12 10 8 6 4 2

B

8 6 4 2

R

correlation matrix


Hypo-methylated in TS cells (n=36)

J1 ES E14 ES E14 ES (on MEF)

control ES iRAS TS-like iRAF TS-like iCdx2 TS-like Oct4-cKO TS-like

1.0 0.8 0.6 0.4 0.2 0.0

Rs26 TS (on MEF) Rs26 TS EGFP TS

Figure 3.18: ES vs TS cells differentially 5mC enriched promoters define an epigenetic signature of bona fide TS cell identity. MeDIP-Seq dataset analysis focused on ES vs TS cells differentially 5mC enriched promoters (see Figure 3.15) (A) Box-whisker plots displaying median and distribution of per-probe read counts for TS versus ES cells hyper- or hypo-methylated promoter groups, indicate that ES cell-derived TS-like cells have 5mC enrichment levels which are intermediate between ES and TS cells, with Oct4-cKO and iCdx2 presumptive TS-like cell datasets being the closest to genuine TS cell datasets. (B) A Pearson’s correlation (R-value) matrix across all datasets reveals the presence of three main clusters of datasets – defined as ES, ES cell-derived TS-like cells and TS cells – which are consistent with the biological differences observed among the corresponding cell types. The cluster of ES-cell derived TS-like cells can be further subdivided in two subgroups – iRAS and iRAF versus Oct4-cKO and iCdx2 – based on the relative higher similarity to ES cells and TS cells, respectively.


117

either Erk signalling or Oct4/Cdx2 activity. In particular, no element was found to be methylated only in the Oct4-cKO model; a small group of promoters, showed increased 5mC levels specifically in iCdx2 ES cell-derived TS-like cells, but this was not confirmed by the subsequent analysis of the iCDX2:ER model, as described in section 3.4. Thus, in this last subgroup – including promoters with unrelated 5mC profiles – DNA methylation appears to be particularly sensitive to minor differences in cellular conditions, which presumably distinguish each inducible model from the others. Functional annotation of promoter subgroups was elaborated using DAVID bioinformatic resources [Huang et al., 2009]. This did not reveal clear functional differences between subgroups A and B; however, genes encoding for key ES cell-specific (e.g., Pou5f1(Oct4), Klf2, Klf4 ) and XEN cell-specific (e.g., Sox17 ) transcription factors where found in subgroup A, whereas subgroup B was significantly more enriched for regulators of embryonic development, like those belonging to the homeobox transcription factor superfamily (Figure 3.20, A & B). The list with the remaing promoters (Neither A nor B) did not show significant enrichment for any functional category (Figure 3.20, C). When a similar subclustering analysis (R=0.9) was applied to the smaller group of promoters undergoing DNA demethylation, no further categorization was achieved, indicating that all members of this cluster are subject to similar changes in 5mC levels, which overall appear to remain markedly higher than those found in TE/ExE-derived TS cells. No promoter was found to be resistant to DNA methylation reprogramming in all models of ES cell-derived TS-like cells.

3.3.2

Discussion

In order to investigate the extent of DNA methylation reprogramming upon ES cell transdifferentiation to TS-like cells, a comparison of genome-wide 5mC enrichment profiles of ES cells, ES cell-derived TS-like cells and TS cells, was performed. Genome-wide DNA methylation analysis was based on the MeDIP-Seq method [Weber et al., 2005; Ficz et al., 2011], which was chosen for its potential to provide reliable estimates of DNA methylation levels on a genome-wide scale [Senner et al., 2012]), at an affordable economic cost. Recently, DNA bisulphite treatment coupled with high-throughput sequencing (Bis-Seq) was shown to provide direct measures


J1 ES

E14 ES

FGF/CM+serum

control iRAS iRAF iCdx2 Oct4-cKO Rs26 Rs26 TS ES TS-like TS-like TS-like TS-like TS

ES versus TS cells differentially methylated promoters E14 ES

LIF+serum

MEF feeder layer

EGFP TS

446 genes e.g., Oct4, Klf4, Sall4, homeobox TFs

36 genes e.g., Elf5, Tead4, Ezrin

A

B

high

low 5mC enrichment

Figure 3.19: MeDIP-Seq dataset hierarchical clustering analysis across ES-cell derived TS-like cells. Hierarchical clustering analysis (R=0.7) – restricted to the list of 482 promoters differentially methylated in ES vs TS cells – identifies two groups of 446 and 36 promoters, which, upon ES cell transdifferentiation to TS-like cells, are subjected to DNA methylation or DNA demethylation, respectively. These two groups recapitulate the two clusters previously defined (Figure 3.15). A more stringent analysis (R=0.9) found two subgroups (A & B) within the cluster of methylated genes: subgroup A (n=156) underwent DNA methylation in all models of ES cell-derived TS-like cells; subgroup B (n=252) were targeted in Oct4-cKO and iCdx2 models, preferentially. Thirty-eight promoters were excluded from either subgroup (Neither A nor B). For a functional annotation of promoter subgroups see Figure 3.20. Each line represents a single probe (1 promoter ≤ 3 probes).


119

A Gene promoters subjected to DNA methylation in iRAS, iRAF, Oct4-cKO and iCdx2 ES cell-derived TS-like cells (n=156) DAVID annotation cluster

p-value



8.5E-15 / 2.3E-6

Pou5f1, Klf2, Klf4, Sox17, Prdm16, Prdm14, Cbx7, Bmi1,Tbx3, Foxd1, Foxd3, Hoxa2, Hoxa3, Mbd3, Nodal, Pax6, Tdgf1, Mycn


1.4E-11 / 7.7E-6

Pou5f1, Bmi1,Tbx3, Lefty1,Foxd3, Foxp4, Hoxa2, Hoxa3,Hoxb1, Mbd3, Nodal, Pax6, Tdgf1, Fgf4, Dll1, Spry2, Socs3, Wnt5a

Homeobox transcription factors

7.6E-10 / 1.7E-2

Pou5f1, Klf2, Klf4, Tbx3 Bmi1, Foxd1,Foxd3, Foxp4, Hoxa2, Hoxa3, Hoxb1, Pax6, Prdm16, Lhx4, Lhx6, Rara, Mycn, Zscan10

B Gene promoters subjected to DNA methylation preferentially in Oct4-cKO and iCdx2 ES cell-derived TS-like cells (n=252) DAVID annotation cluster Homeobox transcription factors

p-value


Hoxa10, Hoxa11, Hoxb3, Hoxc11, Hoxd11, Pax2, Pax5, Pax7, 4.9E-75 / 2.7E-28 Foxa1,Foxb1,Foxd4,Msx1, Nkx2-1, Nkx3-2, Tal1, Prdm6, Fli1


1.2E-42 / 3.5E-19

Hoxa10, Hoxa11, Hoxb3, Hoxc11, Hoxd11, Pax2, Pax7, Otx1 Fgfr2, Wnt3a, Shh, Tcfap2a, Tbx1, Pitx2 , Cxcl12, Nkx2-1, Lhx2

Cell fate commitment

9.4E-40 / 4.6E-23

Hoxa10, Hoxa11, Hoxb3, Hoxc11, Hoxd11, Pax2, Pax7, Otx1, Otx2, Pdgfra, Msx1, Fgfr2, Pitx1, Runx2, Rarg, Shh, Sp8, Gsc,

C Gene promoters presenting DNA methylation profiles uncorrelated with subgroup A or B (n=38) DAVID annotation cluster

p-value



1.5E-1 / 8.9E-2

Sall4, Hoxd3, Kdm2b

Zinc ion binding

1.9E-1 / 6.4E-2

Cyp1b1, Foxp1, Zfp462

Transmembrane proteins

2.7E-1 / 9.4E-1

Cdh11, Jak3, H2-Q2

Figure 3.20: Functional annotation of promoter subgroups undergoing DNA methylation in ES cell-derived TS-like cells. Functional annotation of subgroup A, subgroup B gene promoters, as well as of the list including the promoters excluded from either subgroup (Neither A nor B) – as defined in Figure 3.19 – was elaborated using DAVID bioinformatic resources [Huang et al., 2009]. Annotation of the first three most significantly overrepresented DAVID annotation categories is shown.

120

CHAPTER 3. RESULTS

of 5mC levels at higher resolutions [e.g., Seisenberger et al., 2012]; however, this technique requires a very high sequencing coverage of the mouse genome, whose cost of generation was beyond the available financial resources. In addition, the Bis-Seq method does not distinguish between 5mC and 5-hydroxymethylation (5hmC) and was therefore a less desired method of choice for the present analysis. Normalized MeDIP-Seq read counts were subjected to validation at specific loci and were confirmed to be reliable indicators of 5mC levels (Figures 3.16 & 3.17). On a genome-wide scale ES cell, ES cell-derived TS-like cell and TS cell datasets were found to be highly similar (Figure 3.14), as previously reported for stem cells derived during peri-implantation stages of embryogenesis (e.g., ES, TS, XEN cells and EpiSCs) [Farthing et al., 2008; Senner et al., 2012]. These studies identified a small number of differentially methylated regulatory regions (about 0.5-2% of the total number of CpG islands or promoters), and some of them were found to be associated with the epigenetic restriction of cell lineage developmental potential, like the Elf5 promoter [Ng et al., 2008; Senner et al., 2012]. For this reason, I screened ES cell and TS cell datasets and found 482 differentially methylated promoters of protein-coding mRNAs – representing 1.5% of the total number of autosomal genes, according to the most recent Ensembl annotation (n=30 591) – of which 446 were hypermethylated in TS versus ES cells and 36 had the opposite trend (Figure 3.15, A; Appendix, Tables 2 & 1). The list of promoters hyper-methylated in TS versus ES cells was highly enriched for genes included in DAVID annotation clusters like "Homeobox transcription factors", "Cell fate commitment" and "Embryonic morphogenesis" (Figure 3.15, B). Among these, there are promoters controlling the expression of key pluripotency transcription factors (e.g., Oct4, Klf2, Klf4 ) and of key regulators of somatic lineage specification (e.g., members of the Pax, Fox, Sox and Hox gene families, belonging to the homeobox domain superfamily of transcription factors). The much smaller list of promoters hypermethylated in ES versus TS cells does not show a similar high enrichment for any DAVID annotation cluster, however the most represented categories – "Transcriptional regulation", "Cytoskeleton" and "Proteolysis" – are reminiscent of gene functions known to be involved in the formation of the trophoblast lineage, which requires extensive cellular and extracellular remodelling (Figure 3.15, C). Of note, this group contains the promoters


121

of key trophoblast transcription factors – e.g., Elf5 andTead4 – and signalling mediators – e.g., Ezr and Ptp4a2 – whose knockout mouse model phenotypes show defective trophoblast development, according to the Mouse Genome Initiative (MGI) database; also, it includes promoters of genes, with yet unknown function in the context of trophoblast biology – as Mef2d, Mtf1, Mafk, Plec, Plet1 and Tinagl1 – but whose expression was found to be significantly upregulated in TS versus ES cells [Rugg-Gunn et al., 2010]. This group of regulatory regions – further classified in two promoter subgroups, either hyper- or hypo-methylated in TS versus ES cells – represents an epigenetic signature of TS cell identity. ES cell-derived TS-like cells presented median and distributions of normalized MeDIP-Seq read counts within the interval defined by ES and TS cell values and intermediate/low level of correlation with either of these two genuine stem cell types (Figure 3.18, A & B). In particular, Oct4-cKO and iCdx2 presumptive TS-like cells were found to be more similar to TE/ExE-derived TS cells, than iRAS and iRAF cell models. Therefore, this particular DNA methylation signature supports the hypothesis that transdifferentiating cells are stalled at an intermediate stage of epigenetic reprogramming, during the transition from the ES cell to the TS cell methylome. This is consistent with the view that these models of ES cell transdifferentiation to TS-like cells do not complete lineage conversion, as assessed at the morphological and gene expression level in section 3.2. A hierarchical clustering algorithm was applied in order to investigate changes in 5mC enrichment, occurring at the class of ES versus TS cells differentially methylated promoters, in distinct types of ES cell-derived TS-like cells (Figure 3.19). An initial analysis – based on a correlation value (R=0.7) commonly recommended for this algorithm [Andrews, 2008, 2012] – recapitulated the classification in two distinct groups of 446 and 36 promoters, which were shown to be target of DNA methylation and DNA demethylation, respectively, in all models of ES cell transdifferentiation to TS-like cells. When a more stringent analysis was performed (R=0.9), within the larger group of methylated promoters, two subgroups – termed subgroup A and B, respectively – emerged, characterized by different extent of DNA methylation according to the type of stimulus inducing transdifferentiation (e.g., Erk signalling versus Oct4 repression versus Cdx2 induction). Subgroup

122

CHAPTER 3. RESULTS

A contains promoters (n=156) which undergo 5mC enrichment in all types of transdifferentiating cells; subgroup B (n=252) includes promoters which are found to be significantly methylated only in Oct4-cKO and iCdx2 ES cell-derived TS-like cells (Appendix; Table 2). Systematic annotation of subgroups A and B - based on DAVID bioinformatic resources [Huang et al., 2009] – did not reveal clear functional differences among these two promoter clusters (Figure 3.20). Nevertheless, it is noteworthy that within the subgroup A of promoters, which are methylated in response to both Erk signalling and Oct4/Cdx2 regulation, there are genes encoding for key pluripotency factors – like Pou5f1(Oct4), Klf2 and Klf4 – as well as for a key XEN cell transcription factor (e.g.,Sox17 ). Furthermore, homeobox transcription factors are significantly more represented within the subgroup B of promoters – whose methylation status is insensitive to Erk activity but sensitive to Oct4 and Cdx2 expression levels – than within subgroup A. Remarkably, these distinctive patterns of DNA methylation correlate with the finding that, in all ES cell models under investigation, lineage conversion occurs unidirectionally towards a trophoblast fate, reaching a more advanced stage in transdifferentiating cells induced by forced Oct4/Cdx2 regulatable expression – Oct4-cKO and iCdx2 – than in those dependent on Erk signalling – iRAS and iRAF. Thirty-eight promoters were excluded from either subgroup, being characterized by 5mC changes not clearly associated with any specific differentiation stimulus – either phospho-Erk or Oct4 or Cdx2 activity (subgroup Neither A nor B). These promoters are appearently highly sensitive to minor variations in cellular conditions between similar models (e.g., iRAS and iRAF or iCdx2 and iCDX2:ER) and may be subject to stochastic DNA methylation. It is noteworthy that this gene list includes Sall4 and Hoxd3 transcription factors, as well as cell-surface proteins like the histocompatibility complex H2-Q2 or cadherin 11 that, when expressed in response to appropriate stimuli, may potentially interfere with trophoblast development. In contrast, no clear distinction emerged within the group of promoters undergoing DNA demethylation, indicating that all members of this small cluster respond in a similar manner to the variety of differentiantion stimuli and, overall, they appear to be largely resistant to epigenetic mechanisms promoting 5mC removal (Figure 3.19). In conclusion, a process of DNA methylation reprogramming occurs during ES cell transdifferentiation to TS-like cells. Yet, this epigenetic conversion from the ES cell to the TS cell methylome – even in Oct4-cKO and iCdx2 ES cell-derived TS-like cells, which more closely resemble genuine TS cells – remains incomplete.

3.4. Attempts to improve ES cell transdifferentiation to TS-like cells

3.4

123

Attempts to improve ES cell transdifferentiation to TS-like cells

The results presented in the previous sections prompted me to consider how the efficiency of ES cell transdifferentiation to TS-like cells could be improved. Two independent strategies were elaborated.

3.4.1

Genome-wide 5mC depletion by 2i does not facilitate ES cell transdifferentiation to TS-like cells

DNA methylation contributes to the epigenetic restriction of ES cell developmental fate [Jackson et al., 2004; Ng et al., 2008; Roper & Hemberger, 2009]. In section 3.2 & 3.3, it was shown that presumptive TS-like cells are stalled at an intermediate stage of this lineage conversion, characterized, at the epigenetic level, by incomplete reprogramming of their DNA methylome. Therefore, I hypothesized that a reduction of 5mC levels, in ES cells, may facilitate DNA methylation reprogramming and consequently transdifferentiation to TS-like cells. DNA hypo-methylated ES cells were previously shown to be prone to transdifferentiation [Jackson et al., 2004; Ng et al., 2008]. In these models, 5mC loss was induced either by treatment with 5-azacytidine - a DNA-methyl-transferase inhibitor - or by deletion of genes encoding for DNA-methyltransferases and co-factor proteins (e.g., Dnmt1-/- , Dnmt3a/b-/- and Np95-/- ES cells). However, in these conditions, transdifferentiation does not generate presumptive TS-like cell colonies but irreversibly proceeds towards terminally differentiated cells, as trophoblast giant-like cells. Inhibitor side-effects and permanent loss of the DNA methylation machinery are suspected to cause these phenomenons [Jones, 1985; Ng et al., 2008]. Also, TE/ExE-derived TS cells deficient for DNA methyltransferases, present a dysregulated gene expression programme [Arima et al., 2006; Sakaue et al., 2010], adding further support to the view that 5mC is necessary for normal TS cell self-renewal and multipotency. Remarkably, it was recently shown that ES cells cultured in the presence of two inhibitors (2i) – which specifically block Erk signalling (PD0325901) and GSK3β

124

CHAPTER 3. RESULTS

signalling (CHIR99021), respectively – undergo a reversible depletion of 5mC, with values being reduced from approximately 70 to 30% of the total number of CpG-dinucleotides [Leitch et al., 2013; Yamaji et al., 2013; Ficz et al., 2013]. Loss of DNA-methylation occurs across the entire genome, with the exception of major satellite elements, intracisternal A particle (IAP) sequences and parent-of-origin imprinted differentially methylated regions (DMRs), which are partially resistant. This epigenetic state is associated with morphological and molecular features, which have led to the concept that ES cells, cultured in 2i, more faithfully resemble their in vivo counterparts, as these are found in the pre-implantation epiblast; this cellular state was termed "naive pluripotency" [Ying et al., 2008; Nichols et al., 2009]. Therefore, I reasoned that in order to reduce 5mC levels, presumably without causing permanent cellular damage, I could treat ES cell models with 2i, prior to inducing transdifferentiation to TS-like cells. Wild-type E14 and iRAF ES cells were cultured for 6 days, in ES cell conditions (LIF+serum), either in the presence or in the absence of 2i; after one day, nearly all 2i-treated ES cell colonies acquired a spherical shape, almost devoid of differentiating cells - which are morphological features generally associated with naive pluripotency (data not shown). At the end of this pre-culture period, cells were passaged on a MEF feeder layer in TS cell medium (FGF+CM/serum) in order to induce transdifferentiation to TS-like cells (iRAF cells were also supplemented with 4HT) for a period of 18 days and analyzed at regular intervals of time (Figure 3.21, A). Wild-type ES cells pre-treated with 2i were found to be indistinguishable from their untreated equivalents. As previously reported for control ES cells, they initially acquired a flat colony morphology and some level of CD40 expression, but both features were lost after the first culture passage (day 6) (Figure 3.21, B & C). Similarly, 2i pre-treated iRAF ES cells did not show any significant difference during the transdifferentiation course, when compared with untreated cells, apart from transiently upregulating CD140a/Pdgfrα – a transmembrane receptor and a XEN cell-specific surface antigen – during the first week of this process (Figure 3.22, A & B). These observations argue against the hypothesis that, in ES cells, genome-wide 5mC depletion, induced by 2i treatment, facilitates transdifferentiation to TS-like


125

cells.

3.4.2

Combined phospho-Erk/Cdx2 induction does not significantly improve ES cell transdifferentiation to TS-like cells

Erk signalling and the transcription factor Cdx2 are required for TS cell self-renewal and multipotency [Saba-El-Leil et al., 2003; Strumpf et al., 2005]. In the previous sections, it was shown that, in ES cells, forced induction of either of these two regulatory mechanisms leads to an intermediate stage of transdifferentiation towards TS-like cells, without proceeding to completion. In particular, on the one hand, iRAF transdifferentiating cells seems to lack Cdx2 protein stability (Figures 3.3 & 3.4); on the other hand, iCdx2 presumptive TS-like cells presumably do not activate any upstream cytosolic pathway, like Shp2-dependent inhibition of apoptosis, which was shown to be essential for TS cell survival [Yang et al., 2006; Ralston & Rossant, 2006]. In order to test whether a combination of Erk signalling activation and Cdx2 forced-expression may favour the progression of this lineage conversion, I generated an ES cell line in which both mechanisms can be concomitantly induced. To this end, a transgene encoding for a 4HT-inducible Cdx2 chimeric protein (Cdx2:ER-IRES-PuroR; courtesy of H. Niwa) - under the control of a promoter constitutively active in ES cells - was randomly integrated in the genome of either wild-type E14 ES cells or iRAF ES cells, which are characterized by 4HT-inducible Raf/Erk signalling - as described in section 3.1. These genetically modified ES cell lines were termed iCDX2:ER and iRAF/iCDX2:ER, respectively. In its native conformation, the Cdx2:ER fusion protein is retained in the cytoplasm where it is rapidly degraded; upon 4HT binding, a conformational change leads to nuclear translocation and improved protein stability (Figure 3.23, A). Based on an automated immunofluorescence microscopy screen, I selected clonally derived iCDX2:ER ES cells and iRAF/iCDX2:ER ES cells with comparable basal and short-term (24h) induced levels of nuclear Cdx2 (Figure 3.23, B). This selection was performed to exclude the possibility that different Cdx2 expression levels, between test and control cell line, could complicate the interpretation of the experimental

126

A

CHAPTER 3. RESULTS

pre-culture -6

transdifferentiation to TS-like cells 0

6

LIF + serum LIF + serum + 2i

FGF/ serum/ CM/ MEF feeder-layer (+ 4HT)

18 days

E14 ES or iRAF ES

pre-culture in 2i day 6

Phase contrast

B

12

100μm

E14 ES

C

Rs26 TS avg

pre-culture in 2i

day of reprogramming 0 6 12

E14 ES CD40 Figure 3.21: 5mC depletion induced by 2i pre-treatment does not facilitate wild-type ES cell transdifferentiation to TS-like cells (A) Experimental scheme. Wild-type E14 and iRAF ES cells were cultured in ES cell conditions ± 2i, prior of induction of transdifferentiation to TS-like cells. (B) Representatives phase-contrast micrographs taken after 6 days from the induction. No clear differences were observed in the cell colony morphology of 2i pre-treated vs untreated wild-type E14 ES cells. (C) Time-course flow cytometry analysis for the surface antigen CD40 - which is a specific TS cell marker - during transdifferentiation to TS-like cells (d0-d12). Comparable CD40 levels were measured in 2i pre-treated and untreated wild-type E14 ES cells.


A

Rs26 TS avg

127

pre-culture in 2i

iRAF ES + 4HT CD40

B

IM8A1 XEN avg

pre-culture in 2i

iRAF ES + 4HT CD140a (Pdgfrα)

day of reprogramming 0 6 12 18

Figure 3.22: 5mC depletion induced by 2i does not facilitate iRAF ES cell transdifferentiation to TS-like cells iRAF ES cells were cultured in ES cell conditions (LIF+serum) ± 2i, prior of inducing transdifferentiation to TS-like cells (see Figure 3.21, A). Time-course flow cytometry analysis was performed for the surface antigen CD40 (TS cell marker) and for CD140a (XEN cell marker). (A) CD40 levels were found to be indistinguishable between 2i pre-treated and untreated transdifferentiating iRAF ES cells. Dotted line represents Rs26 TS average signal intensity. (B) 2i pre-treated iRAF ES cells transiently upregulate CD140a/Pdgfrα expression during the first week of transdifferentiation towards a trophoblast fate. Dotted line represents average signal intensity in blastocyst-derived IM8A1 XEN cell line.

128

CHAPTER 3. RESULTS

results. It is noteworthy that iCDX2:ER and iRAF/iCDX2:ER ES cells present low Cdx2 nuclear levels even in the absence of 4HT, which – over prolonged culture – may potentially lead to loss of self-renewal; therefore, in order to minimize stimuli promoting differentiation, these cell lines were routinely passaged in LIF+serum, supplemented with 2i, prior to inducing lineage conversion. As described above, 2i pre-culture appears not to affect this process. iCDX2:ER and iRAF/iCDX2:ER ES cell transdifferentiation to TS-like cells was induced for a period of 18 days, during which analyses were carried out at regular intervals of time. No significant differences were found in the kinetics and in the extent of lineage conversion between these two models, as judged by morphological observations and expression of key TS cells transcription factors – e.g., Cdx2, Elf5, Eomes – and of the surface antigen CD40 (Figures 3.24 & 3.25, A) Of note, transdifferentiating cells dependent on forced expression of Cdx2:ER – with or without combined Erk activity – appear to reach a slightly more advanced stage of transdifferentiation, if compared with previously analysed iCdx2 cells, in which the transcriptional activation of a single copy of Cdx2 – integrated into the ColA1 locus of KH2 ES cells [Kuckenberg et al., 2010] – is induced by doxycycline treatment (see figures 3.7, 3.9, 3.11 versus figures 3.24 & 3.25, A); cell proliferation rates were seemingly comparable (data not shown). In light of these observations, iCDX2:ER and iRAF/iCDX2:ER ES cell-derived TS-like cells – upon 18 days of forced transdifferentiation – were passaged in standard TS cell culture conditions – that is, in FGF+CM/serum in the absence of a MEF feeder layer and 4HT – in order to test the stability of the acquired lineage identity. Remarkably, in these conditions, both ES cell-derived TS-like cells showed morphological signs of differentiation and downregulated Cdx2 and Elf5 expression (Figure 3.25, A & B). Interestingly, iCDX2:ER TS-like cells differentiated towards cells with fibroblastlike morphology, whereas iRAF/iCDX2 TS-like colonies retained their epithelial integrity somewhat better, giving rise to polyploid cells at their periphery, which are reminiscent of trophoblast giant cells. This may indicate that the developmental


iCDX2:ER ES CDX2 / DAPI

A

129

B

+ vehicle

+ 4HT

100 μm

iCDX2:ER ES (replica 1 and 2) 1500 1250 1000 750 500 250 0

n=300

nuclear anti- CDX2 (rel avg signal)

iRAF/iCDX2:ER ES (replica 1 and 2)

+ vehicle

+ 4HT

Figure 3.23: iCDX2:ER and iRAF/iCDX2:ER ES cells iCDX2:ER and iRAF/iCDX2:ER ES cells were generated by random genomic integration of a Cdx2:ERIRES-Puro plasmid into either wild-type E14 ES cells or iRAF ES cells, with the latter characterized by 4HT-inducible Raf/Erk signalling, as described in section 3.1. In response to 4HT treatment, Cdx2:ER fusion protein is stabilized and translocates into the nucleus; additionally, in iRAF/iCDX2:ER ES, Erk signalling is concomitantly induced (see Figure 3.2, B). (A) Representative immunofluorescence images for Cdx2 transcription factor expression, in iCDX2:ER ES cells cultured in ±4HT (1 µM, 24h). Nuclei were counterstained with DAPI. (B) iCDX2:ER ES and iRAF/iCDX2:ER ES were cultured in ± 4HT conditions for 24h and subjected to anti-Cdx2 immunofluorescence staining and DAPI counterstaining. BD Pathway microscope was used to automatically acquire the nuclear/cytoplasmic anti-Cdx2 signal intensity ratio. At least 300 cells were analysed per cell type/condition, in two independent experiments. Notably, short-term Cdx2 induction levels are comparable between iCDX2:ER and iRAF/iCDX2:ER ES cells.

130

CHAPTER 3. RESULTS

potential of iRAF/iCDX2 ES cell-derived TS-like cells more closely resemble that of TE/ExE-derived TS cells, in comparison to cells induced by forced regulation of Cdx2 only (iCDX2:ER). Nevertheless, lack of stability of the acquired lineage identity clearly distinguishes these presumptive TS-like cells from genuine TS cells.

The genome-wide DNA methylation profile of iCDX2:ER and iRAF/iCDX2:ER ES cell-derived TS-like cells – as well as that of 2i pre-treated wild-type ES cells (collected after 12 days from induction of transdifferentiation), as control – was investigated by performing MeDIP-Seq analyses, as described in section 3.3. Upon normalization, these three additional MeDIP-Seq datasets were compared with the 11 previously analysed. Data analysis focused on the group of 482 promoters, either hyper- (n=446) or hypo-methylated (n=36) in ES versus TS cells. Based on median levels and distribution of MeDIP-Seq read counts, inter-dataset correlation levels and heat map display of per-probe normalized 5mC enrichment levels, iCDX2:ER and iRAF/iCDX2:ER presumptive TS-like cells appear to be slightly more similar to TE/ExE TS cells than Oct4-cKO and iCdx2 transdifferentiating cells. Integration of the three new datasets into the hierarchical clustering analysis of the 482 differentially methylated promoters confirms their classification, as described in section 3.2. As expected, the DNA methylome of 2i pre-treated ES cells, induced to transdifferentiate for 12 days, does not significantly differ from that of their untreated equivalents (control ES cells) (Figures 3.26 & 3.27).

Hence, a number of small differences – observed at the level of morphology, gene expression and DNA methylation – suggests that newly generated iCDX2:ER ES cell-derived TS-like cells better resemble TE/ExE TS cells, than iCdx2 and Oct4-cKO models. However, lack of stability of the acquired cell identity – which necessitates continued forced regulation – clarifies that these potentially enhanced features are not associated with significant functional improvements. The high similarity between iCDX2:ER and iRAF/iCDX2:ER ES cell transdifferentiation, argues against the hypothesis that, in ES cells, combined activation of Erk signalling and Cdx2 activity improves lineage conversion to the TS cell lineage.


131

A

iCDX2:ER ES+4HT iRAF/iCDX2:ER ES+4HT

cell count

day of reprogramming 0 6 12 18

Rs26 TS avg

CD40

% of iCDX2:ER ES

B 150 125 100 75 50 25 0

Cdx2

6

12

200 150 100 50 0

Eomes

6

12

200 150 100 50 0

Elf5

6

12

days of reprogramming

iCDX2:ER ES + 4HT

iRAF/iCDX2:ER ES + 4HT

Figure 3.24: iCDX2:ER and iRAF/iCDX2:ER ES cell transdifferentiation to TS-like cells iCDX2:ER and iRAF/iCDX2:ER ES cells were induced to transdifferentiate towards TS-like cells (FGF+CM/serum+4HT; on a MEF feeder layer) for a period of 18 days. (A) Time-course flow citometry analysis (d0-d18) for CD40 - which is a specific TS-cell surface antigen. Dotted line represents Rs26 TS average signal intensity (see Figure 3.10, A) (B) Time-course gene expression analysis (d6-d12) by quantitative-PCR for Cdx2, Eomes and Elf5. Raw measures were normalized on Sdha and Tbp expression (for total RNA content) and Actn1 expression (for MEF RNA content) and expressed as percentage of iCDX2:ER ES cells. Data are shown as mean +/- s.d (n=3). No significant differences were found between iCDX2:ER and iRAF/iCDX2:ER ES cells.


A

CDX2 /ELF5 /DAPI

50μM

FGF/ CM/ serum on a MEF feeder layer + 4HT day 18

100μM

Phase contrast

B

FGF/ CM/ serum on gelatin coated plastic

day 24

Figure 3.25: Instability of iCDX2:ER and iRAF/iCDX2:ER ES cell-derived TS-like cell identity iCDX2:ER and iRAF/iCDX2:ER ES cell-derived TS-like cells, upon forced transdifferentiation for 18 days, were passaged into standard TS cell culture conditions (FGF+CM/serum) and cultured until day 24. Withdrawal of feeder cells and 4HT caused rapid differentiation. iRAF/iCDX2:ER ES cell-derived TS-like cell colonies partially retained their epithelial integrity and formed polyploid cells at the periphery, which are reminiscent of trophoblast giant cells. (A & B) Representative phase-contrast micrographs, and immunofluorescence images for Elf5 and Cdx2 expression, are shown at day 18 (A) and day 24 (B), which are before and after the passage from transdifferentiation conditions to standard TS cell culture conditions, respectively. Arrowheads point to large polyploid cells.

iRAF/iCDX2:ER ES iCDX2:ER ES


133

ES versus TS cells differentially methylated promoters


A

Hyper-methylated in TS cells (n=446) 14 10 6 2


Hypo-methylated in TS cells (n=36) 8 6 4 2

B correlation matrix

R

J1 ES E14 ES E14 ES (on MEF) control ES E14 ES (2i-pre-treated)

iRAS TS-like iRAF TS-like iCdx2 TS-like Oct4-cKO TS-like

1.0 0.8 0.6 0.4 0.2 0.0

iCDX2:ER TS-like iRAF/iCDX2:ER TS-like Rs26 TS (on MEF) Rs26 TS EGFP TS

Figure 3.26: MeDIP-Seq comparative analysis extended to iCDX2:ER and iRAF/iCDX2:ER ES cell-derived TS-like cells. Data analysis focused on the list of 482 differentially methylated promoters, either hyper- or hypo-methylated in ES vs TS cells. Arrows point to the 3 new MeDIP-Seq dataset: iCDX2:ER, iRAF/iCDX2:ER and 2i pre-treated ES cells (d12 from induction of transdifferentiation). iCDX2:ER and iRAF/iCDX2:ER MeDIP-Seq datasets appear to be slightly more similar to the TE/ExEderived TS dataset cluster, than iCdx2 and Oct4-cKO datasets. (A) Box-whisker plots present median and distribution of normalized MeDIP-Seq read count across all 14 datasets. (B) A Pearson’s correlation (R-value) matrix estimates the level of correlation for each possible pair of datasets.


4E

FGF/CM+serum

36 genes e.g., Elf5, Tead4, Ezrin

B

446 genes e.g., Oct4, Klf4, Sall4, homeobox TFs

high

low 5mC enrichment

Figure 3.27: Heat map of 5mC promoter profile across all ES cell-derived TS-like cells. Heat map visualization of per-probe normalized 5mC enrichment values for the list of 482 differentially methylated promoters in ES vs TS cells. This diagram includes the newly generated MeDIP-Seq datasets: iCDX2:ER, iRAF/iCDX2:ER and 2i-pre-treated ES cells (after 12 days from induction of transdifferentiation) – which are pointed by arrows. Integration of these three new dataset did not affect the results of the promoter hierarchical clustering analysis, as described in Figure 3.19.

MEF feeder layer

A

ES versus TS cells differentially methylated promoters

ro lE co nt

S 4E E1

S E1

LIF+serum

S E1 pr 4 E e-t S re at iRA ed ST ) S-l ike iRA FT S- l ike iCd x2 TS -lik e Oc t4cK O TS iCD -lik X2 e :ER TS iRA -lik F/i e CD TS X2 Rs -like :ER 26 TS Rs 26 TS EG FP TS (2 i-

S J1 E


3.4.3

135

Discussion

Here, two attempts to improve the efficiency of ES cell transdifferentiation to TS-like cells were presented. The first attempt was based on the hypothesis that, in ES cells, genomewide DNA methylation depletion, induced by dual inhibition of Erk and Gsk3β signalling, prior of inducing transdifferentiation to TS-like cells, may facilitate lineage conversion. However, no evidence was found in support of this hypothesis (Figures 3.21 & 3.22). The only observed consequence for ES cells pre-cultured with 2i, was the transient upregulation of the XEN cell-marker CD140a/Pdgfrα upon forced induction of Erk signalling. Of note, the Pdgfrα promoter is unmethylated in ES cells. This indicates that, in this stem cell type, 5mC may repress some other – yet to be identified – Pdgfrα cis-regulatory elements or transfactors, whose function, however, is not dominant on the transdifferentiation fate. In this regard, it is noteworthy that, although transdifferentiating cells express some level of Gata6, they stably repress Gata4 and Sox17, with the latter silenced by DNA methylation (Figures 3.13 & 3.20). The important arising conclusion that 2i treatment, and the consequent genomewide DNA-methylation depletion, does not alter the restriction of ES cell developmental fate will be discussed in chapter 4. The second attempt was based on the combined forced activation of Erk signalling and Cdx2 expression, involving the characterization of two newly derived ES cell models of transdifferentiation to TS-like cells, named iCDX2:ER and iRAF/iCDX2:ER, respectively. Notably, the characterization of iCDX2:ER transdifferentiating cells – with or without combined Erk activity – revealed these as, apparently, the most similar to TE/ExE derived TS-cells (Figures 3.24, A & 3.25 3.27). In particular, iCDX2:ER transdifferentiating cells were seemingly reaching a slightly more advanced stage of lineage conversion, in comparison with iCdx2 ES cell-derived TS like cells. Both models rely on the activation of the transcription factor Cdx2, but this is induced via different mechanisms, as described in subsection 3.4.2. Therefore, iCdx2 and iCDX2:ER ES cells may express Cdx2 at different levels; also Cdx2 protein activity may be different in the native versus chimeric (fused with the ER domain) conformation. Alternatively, as mentioned in section

136

CHAPTER 3. RESULTS

3.2, iCdx2 ES cells were retrospectively found to be contaminated by mycoplasma infection, which could have potentially affected the course of transdifferentiation to TS-like cells. Notably, no significant differences were found between iRAF/iCDX2:ER and iCDX2:ER ES cell-derived TS-like cells, although the latter – upon spontaneous differentiation, caused by the removal of feeder cells and the withdrawal of 4HT – appear to more stably restrict their developmental fate towards putative definitive trophoblast cells type, like trophoblast giant cells (Figures 3.24 & 3.25). It can be speculated that Erk signalling may specifically instruct the epigenetic silencing of some regulator of embryonic differentiation, yet to be identified. Nevertheless, the data presented, if taken together, support the concept that, in ES cells, Erk signalling acts predominantly – if not exclusively – via the transcription factor Cdx2, at least in the context of forced conversion to the TS cell lineage. Therefore, combined activation of both mechanisms does not significantly improve ES cell transdifferentiation to TS-like cells. Finally, although iCDX2:ER ES cell-derived TS-like cells may represent the model better resembling TE/ExE-derived TS cells, the lack of stability of the acquired cell identity – which necessitates continued forced regulation (Figure 3.25) – argues against the view that these reprogrammed TS-like cells are equivalent to genuine TS cells.

Chapter 4 General Discussion

137

138

4.1

CHAPTER 4. GENERAL DISCUSSION

Assessing identity and stability of ES cell-derived TS-like cells

In the mouse, embryonic stem (ES) and trophoblast stem (TS) cells can be derived from the first two lineages specified during embryogenesis, which are the Epiblast (Epi) and the Trophectoderm (TE), respectively [Evans & Kaufman, 1981; Martin, 1981; Brook & Gardner, 1997; Tanaka et al., 1998; Uy et al., 2002]. It is well established that they predominantly – if not exclusively – retain the restriction of developmental fate, characteristic of their lineage of origin, having the potency to widely contribute either to the somatic tissues and the gametes (ES cells) or to the trophoblast layers of the placenta (TS cells) [Bradley et al., 1984; Beddington & Robertson, 1989; Tanaka et al., 1998]. However, the epigenetic mechanisms capable of regulating cell developmental potential are still far from being understood. The investigation of events of ES cell transdifferentiation to TS-like cells has significantly contributed to the understanding of the mechanisms that enforce, or that can override the epigenetic restriction of ES cell lineage fate [reviewed by Roper & Hemberger, 2009]. DNA methylation (5mC)-deficient ES cells were observed – in contrast to their wild-type equivalents – to frequently transdifferentiate towards a trophoblast fate, in response to extracellular stimuli, revealing that this DNA modification is necessary to enforce the restriction of ES cell developmental potential [Jackson et al., 2004; Ng et al., 2008]. Forced regulation of the ES cell-specific transcription factor Oct4 – by continued repression – or of the key TS cell transcription factor Cdx2 – by constant induction – was shown to promote transdifferentiation towards TS-like cells, demonstrating that these master transcriptional regulators are capable of overriding the epigenetic barriers, limiting ES cell lineage fate [Niwa et al., 2005]. Remarkably, it was recently reported that transient hyperactivity of the Ras/Erk signalling – experimentally induced – was sufficient to convert ES cells into TS-like cells, described to retain their acquired lineage identity, even in the absence of the inductive stimulus. Based on these observations, the authors proposed that this signal transduction was able to reset the epigenetic mechanisms ensuring cell

4.1. Assessing identity and stability of ES cell-derived TS-like cells

139

lineage stability [Lu et al., 2008]. However, as described in the introductory section 1.4.3, the definition of "TS-like" cells has been generally assigned without referring to standard assays for testing this cellular identity, and in particular, without direct comparison to TE/Extraembryonic Ectoderm (ExE)-derived TS cells. A review of the published literature suggests that significant differences distinguish ES cell-derived TS-like cells from genuine TS cells (e.g., Table 1.1). Here, a comparative analysis of ES cell transdifferentiation to TS-like cells was performed, evaluating four distinct models of this process – two dependent on inducible Erk signalling (iRAS and iRAF) – and two on the regulatable expression of key transcription factors (Oct4-cKO and iCdx2 or iCDX2:ER) – in comparison with TE/ExE-derived TS cells. This study was based on a comprehensive characterization of cellular morphologies, proliferation rates, expression of multiple marker genes and genome-wide DNA methylation profiles, investigated with a number of different methods, both at the whole-population level – e.g., Western blot, quantitative-PCR, MeDIP-Seq – and at the single-cell level – e.g., immunofluorescence microscopy and flow cytometry (Result sections 3.2 & 3.3). It revelead that transdifferentiation occurs unidirectionally towards TS-like cells, albeit more efficiently and to a greater extent in the models depending on the regulatable expression of Oct4 or Cdx2 transcription factor than in those relying on forced Erk signalling. Yet, in all cases, significant differences – observed at the morphological and molecular level, as well as in the proliferation rates – persist between ES cell-derived TS-like cells and bona fide TS cells, indicating that lineage conversion remains incomplete. These conclusions could be interpreted as being in contrast with the articles of H.Niwa and colleagues [Niwa et al., 2005], and of G.Q. Daley and colleagues [Lu et al., 2008], reporting that iCDX2:ER and iRAS ES cells, respectively, are capable – upon blastocyst injection – of contributing to the trophoblast layers of the placenta. However, several explanations can be offered to reconcile this seeming discrepancy. Of note, the iCDX2:ER ES cell line (termed 5ECER4G20 ES), derived by H.Niwa and co-workers, was established on an Oct4 +/- background [Niwa et al., 2005]. Given that defined Oct4 expression levels have been reported to crucially

140


bias both the propensity and the lineage fate of ES cell differentiation [Niwa et al., 2000; Karwacki-Neisius et al., 2013; Radzisheuskaya et al., 2013], a contribution of this genetic background, to the observed consequences of Cdx2 forced expression, cannot be ruled out. Nevertheless, 5ECER4G20 ES cell-derived TS-like cells – as described in section 1.4.3 – relying on the continuous ectopic regulation of Cdx2, and on a protective TS cell micro-enviroment (provided by a MEF feeder layer), for the in vitro stability of their acquired identity. Notably, their reported in vivo developmental potential – upon blastocyst injection – is not restricted to the trophoblast lineage and, within this lineage, appears to be reduced when compared with that of TE/ExE-derived TS cells (see Table 1.1). The molecular characterization of iRAS ES cell-derived TS-like cells, carried out by G.Q. Daley and co-workers, was limited to the first 24 hours from induction [Lu et al., 2008]. Based on their published data, iRAS transdifferentiation seems to be less efficient than that of 5ECER4G20 ES cells (e.g., lack of Eomes induction), as described in section 1.4.3. Furthermore, the reported stability of the acquired cell identity was exclusively based on morphological observations. The contribution of these iRAS ES cell-derived TS-like cells to the trophoblast layers of the placenta was limited and it is unclear whether they were excluded from the Epi and Primitive Endoderm (PrE) lineage, and whether indeed the placental contribution was made up by Epi-derived extraembryonic mesoderm (which forms the fetal vasculature in the placenta). Hence, although these ES-cell derived TS-like cells, and in particular the 5ECER4G20 model, can contribute to the development of the trophoblast lineage, they also appear – in agreement with the present study – to be not equivalent to genuine TS cells, at least when considered at the whole-population level. In fact, at the single-cell level, it cannot be excluded that a very small cell population acquires genuine TS cell characteristics. In this regard, it has been recently proposed that a small fraction of ES cell populations cultured in vitro (≈ 1%) may oscillate in-and-out a developmental state capable of extra-embryonic developmental potential [Cho et al., 2012; Macfarlan et al., 2012]. Although this hypothesis cannot be ruled out, no distinct subpopulation of transdifferentiating cells, potentially more closely resembling TE/ExE-derived TS cells, was detected in the present study, as judged by morphological observations or single-cell molecular

4.1. Assessing identity and stability of ES cell-derived TS-like cells

141

analyses – e.g., immunofluorescence microscopy and flow cytometry – for a small number of TS cell-specific factors – e.g., Cdx2, Elf5 and CD40 (Figure 3.11). Moreover, if a putative clone of bona fide TS cells was formed during this process, it would have been expected to expand over prolonged culture in TS cell conditions, but no evidence was found to support this hypothesis, when transdifferentiation was extended up to a 48 day period (data not shown).

As an extension of this point, it is possible that following blastocyst injection, some ES cell-derived TS-like cells may complete their transdifferentiation in vivo, upon exposure to the trophoblast microenvironment. This scenario has very recently gained support, as somatic cell reprogramming to induced Pluripotent Stem (iPS) cell performed in vivo was described to produce teratomas, containing induced cells with expanded developmental potential, characterized by totipotent features [Abad et al., 2013]. However, it is noteworthy that testing this hypothesis is technically challenging, as it would presumably require ex vivo isolation of the small number of ES cell-derived TS-like cells that contribute to the ExE in chimaeras, and their subsequent analysis, by single-cell (or very low cell number) transcriptional and epigenetic profiling.

In the present study, iCDX2:ER and iRAF/iCDX2:ER ES cell-derived TS-like cells – with the latter, potentially, only marginally better than the former – were found to be the models more closely resembling genuine TS cells. Yet, when it was attempted to maintain these presumptive TS-like cells in standard TS cell conditions (FGF+CM/serum, on tissue culture plastics) – upon withdrawal of the inductive stimulus (4HT) and of the protective MEF feeder layer – they rapidly lost self-renewal capacity and differentiated.

Thus, the analyses presented support the hypothesis that all models of ES cell-derived TS-like cells – here characterized – are not equivalent to genuine TE/ExE-derived TS cells.

142

4.2


Dynamics and mechanisms of ES cell transdifferentiation to TS-like cells

In all cases under investigation, transdifferentiation occurred unidirectionally towards TS-like cells; yet, this lineage conversion remained incomplete, being stalled at various intermediate stages, in different models. This process progressed more efficiently and reached more advanced stages, in cells relying on controlled regulation of either Oct4 or Cdx2 activity – Oct4-cKO or iCdx2/iCDX2:ER – than in those dependent on experimentally stimulated Erk signalling – iRAS and iRAF. At the molecular level, in the latter models, signal transduction appears to be incapable of promoting the expression of key TS cell regulators (e.g., Fgfr2 and Elf5); in the former models, even though a number of critical TS cell transcription factors were induced, their expression – markedly fluctuating – did not reach stable high levels, comparable to those observed in TE/ExE-derived TS cells and required continuous forced regulation to be sustained (Figures 3.4, 3.13 & 3.25). Importantly, at the onset of TE formation, Cdx2 was demonstrated to act downstream of the transcription factor Tead4 and in parallel with the transcription factor Gata3 [Yagi et al., 2007; Nishioka et al., 2008, 2009; Ralston et al., 2010], in the specification of this lineage. It follows that the establishment of multipotent and self-renewing trophoblast cells may require a hierarchical network of transcription factors. This possibility could be tested in the future by, for example, inducing the expression of this cohort of key TS cell transcription factors (e.g., Cdx2, Tead4 and Gata3), in order to assess whether their combined activity enables full conversion into genuine TS cells. In a different context of experimentally induced cellular conversion/reversion – during somatic cell reprogramming to iPS cells – forced expression of a small number of factors (e.g., Oct4, Sox2, Klf4 and c-Myc as first described by Takahashi & Yamanaka, 2006) for approximately 15 days, has been commonly found to be required for the emergence of an endogenous self-sustaining pluripotency regulatory network, capable of resetting the restriction of somatic cell fate [Stadtfeld et al., 2008; Samavarchi-Tehrani et al., 2010; Polo et al., 2012]. Similar to what was observed in the present study, it has been reported that in the large majority of

4.3. The role of Erk in the establishment of the TE/TS lineage

143

somatic cells (> 99%), reprogramming is arrested at some intermediate stage. Only in a very small minority of cells – originally selected based on a transgenic system for antibiotic resistance – this process progresses towards induced pluripotency. Notably, a defined stoichiometric ratio of exogenous factors was shown to be crucial for improving the kinetics and the efficiency of iPS cell reprogramming, presumably by favouring the assembly of functional multiprotein complexes [Tiemann et al., 2011; Nagamatsu et al., 2012]. In my experiments, ES cell transdifferentiation to TS-like cells appears to stall after 6 days, when relying on forced Erk signalling, or after 12 days, when dependent on controlled regulation of Oct4/Cdx2 activity (Figures 3.11 & 3.13). In these latter models, where the induction of a number of TS cell transcription factors (e.g., Cdx2, Eomes, Elf5) is observed, it can be speculated that these regulators are not expressed with a stochiometric ratio favourable for putative protein-protein interactions. Lack of coordinated activity among these transcription factors may underlie the inability to establish an endogenous self-reinforcing TS cell gene regulatory network. Thus, in analogy with the model of iPS cell reprogramming, the current experimental strategies for promoting ES cell transdifferentiation to TS-like cells appear to mostly rely on rare stochastic events, which presumably differ from the mechanisms that efficiently enforce and reset the restriction of cell lineage fates, during embryogenesis.

4.3

The role of Erk signalling in the establishment of TE/TS cell lineage

It is well established that the expansion of the trophoblast lineage during early embryogenesis, as well as the self-renewal of multipotent TS cells in vitro, requires the activity of the intracellular Ras/Erk pathway, dependent on paracrine Fgf signalling, as demonstrated by the characterization of a number of mouse models deficient for components of this pathway – e.g., Fgfr2-/- ,Fgf4-/- , Frs2α-/- , Erk2-/- [Feldman et al., 1995; Arman et al., 1998; Gotoh et al., 2005; Saba-El-Leil et al., 2003]. However, it is unclear whether this signal transduction is also involved in

144


the initial specification of the TE lineage. It was reported that pharmacological inhibition of Erk activity, starting at the 8-cell stage, leads to Cdx2 downregulation and consequently disrupts TE formation [Lu et al., 2008]. In contrast, other researchers did not confirm this link between the blockage of Erk signalling and Cdx2 expression, albeit a marked reduction in the TE proliferation was observed [Nichols et al., 2009]. Of note, the publication that transient Ras/Erk hyperactivity leads to efficient and irreversible ES cell transdifferentiation to TS-like cells can be considered an important evidence supporting an instructive role for phosphorylated Erk in the specification of this lineage [Lu et al., 2008]. Here, forced Erk signalling in ES cells, activated at the level of either the Ras small GTPase (iRAS) or the downstream Raf kinase (iRAF), was observed to initiate but not to complete transdifferentiation to TS-like cells. Morphological and molecular signs of transdifferentiation (e.g., formation of epithelial-like colonies, expression of the surface antigen CD40) were observed (Figures 3.7 & 3.10), especially in the iRAF model; however, among the cohort of transcription factors known to cooperatively control TS cell self-renewal and multipotency, only Cdx2 expression, and to a smaller extent that of Eomes, was induced (Figure 3.4, B). Remarkably, no further progress was observed after the first tissue culture passage (day 6 from induction), and the expression of TS cell-specific transcription factors was lost during subsequent culture (Figure 3.13). Therefore, this process can be considered to be stalled at an early stage of lineage conversion, in particular when compared with other models of ES cell-derived TS-like cells dependent on the regulatable activity of key lineage transcription factors (e.g., Oct4 or Cdx2). Notably, forced Erk hyperactivity did not stimulate intracellular signalling dependent on extracellular Fgf – present in the medium – as occurring in TS cells. Consistently, the expression of key components of this pathway (e.g., Fgfr2) was kept at the low levels, as normally observed in ES cells (Figure 3.4, A and data not shown). Furthermore, in iRAF transdifferentiating cells, Cdx2 transcription did not seem to be coupled with Cdx2 protein levels (Figure 3.4, A & B). It follows that, in ES cells, post-transcriptionally or post-translationally mechanisms – like those mediated by miRNAs or by ubiquitination-dependent proteasomal degradation, respectively – may interfere with Cdx2 expression, potentially safeguarding ES

4.3. The role of Erk in the establishment of the TE/TS lineage

145

cell self-renewal from the activity of this potent pro-differentiation factor [e.g., Nishiyama et al., 2009]. Similarly, in somatic cells refractory to reprogramming towards iPS cells, a discrepancy between mRNA and protein levels of key transcription factors (e.g., Oct4, Sox2, Klf4, c-Myc) was reported [Polo et al., 2012; Buckley et al., 2012]. Of note is also that Cdx2 is a phosphoprotein, modified in a seemingly differentiation-dependent manner in intestinal cells [Boulanger et al., 2005]. Although phosphorylation of Cdx2 has been linked to nuclear export and proteasomal degradation in this cell type, the functional relevance of its phosphorylation in vivo remains unknown in the gut and even more so in the trophoblast lineage. My experiments did not find evidence for Cdx2 post-translational modifications, in response to increased Erk activity. Erk signalling appears to rapidly silence Oct4 expression, in a manner – at least initially – independent from Cdx2 (Figures 3.3, A; 3.4, A & 3.13). The latter transcription factor was proposed to mediate Oct4 repression in the developing TE lineage [Niwa et al., 2005]. However, during the transition from the morula to the blastocyst stage, Cdx2 upregulation does not directly correlate with Oct4 downregulation, which only occurs upon blastocoel expansion, in TE cells [Dietrich & Hiiragi, 2007; Guo et al., 2010]. Given that in these cells the Ras/Raf/Erk pathway could be potentially activated by Fgf (released by ICM precursors), a role for this signal transduction in the initiation of Oct4 repression in vivo could be hypothesized. Combined forced activation of Raf/Erk signalling and Cdx2 expression resulted only in a marginal improvement – if any – of TS-like cell features, in comparison with activation of Cdx2 only, but to a markedly enhanced phenotype when compared to the induction of Raf/Erk signalling alone (Figures 3.13 & 3.24). Transdifferentiation of iCDX2:ER and iRAF/iCDX2:ER ES cells led, via highly similar dynamics and mechanisms, to the derivation of indistinguishable TS-like colonies, albeit the latter appeared to have a greater propensity to give rise to terminally differentiated trophoblast-like cells (e.g., trophoblast giant-like cells) than the former – upon withdrawal of the inductive stimulus (Figure 3.25). Nevertheless, these differences can be regarded as minor when the overall phenotypic characterization is taken into consideration. Therefore, it can be proposed that Erk signalling acts predominantly, if not exclusively, through Cdx2, at least in this experimental context. This

146


conclusion is also consistent with the original observation that Ras hyperactivity does not lead to Eomes induction [Lu et al., 2008]. Taken together, the experiments presented supports the hypothesis of a crucial role for Erk signalling in the maintenance, but not in the specification, of selfrenewing and multipotent trophoblast (TE/TS) cells.

4.4

A developmentally regulated 5mC signature of TS cell identity

Genome-wide 5mC analyses have been performed on a large variety of mammalian cell types, revealing that each of them is characterized by a unique DNA methylation profile (or methylome) – thus, representing a reliable signature of cell identity [e.g., Ji et al., 2010; Senner et al., 2012]. During early embryogenesis – by the time in which the conceptus implants – Epi, TE and PrE are considered to have acquired distinctive DNA methylation patterns; remarkably, these events approximately coincide with the period in which the developmental potential of the first three cell lineages become restricted [reviewed by Morgan et al., 2005; Hemberger et al., 2009]. ES cell lines characterized by DNA hypomethylation – in contrast with their normally methylated equivalents – frequently transdifferentiate towards a trophoblast fate, upon exposure to the TS cell micro-environment [Jackson et al., 2004; Ng et al., 2008]; the observation that this event is associated with the transcriptional activation of the hypomethylated Elf5 promoter – controlling the expression of a key TS cell transcription factor [Donnison et al., 2005] – provided the first molecular link between DNA methylation and the stability of ES cell fate [Ng et al., 2008]. A recent genome-wide 5mC analysis, reported that ES and TS cell methylomes are highly similar, but they can be distinguished based on a small group of promoters or CpG islands (CGIs) – about 0.5-2.0% of the total number of annotated elements – which are differentially methylated [Senner et al., 2012]. Here, an investigation of the DNA methylation profile of ES cell-derived TS-like cells – including models induced via forced Erk signalling (iRAF and iRAS) or by regulatable expression of Oct4/Cdx2 transcription factors (Oct4-cKO, iCdx2 or iCDX2:ER) – in comparison with TE/ExE-derived TS cells was performed by

4.4. A developmentally regulated 5mC signature of TS cell identity

147

MeDIP-Seq, in order to evaluate whether and to which extent the original ES cell methylome is reprogrammed towards a genuine TS cell methylome. ES cell, TS cell, and ES cell-derived TS-like cell MeDIP-Seq datasets were found to be highly similar on a global scale (Figure 3.14). However, in line with the aforementioned study, a group of 482 promoters – representing 1.5% of the total number, according to the most recent Ensembl annotation – was found to be differentially methylated between the two genuine stem cell types, ES and TS cells (Figure 3.15). This group was further classified in two subgroups of 446 hyperand 36 hypo-methylated promoters in TS versus ES cells, respectively. Functional annotation of the corresponding gene lists, based on the DAVID bioinformartic resources [Huang et al., 2009], found that categories like "Homeobox transcription factors", "Cell fate commitment" and "Embryonic morphogenesis" were highly enriched in the larger group of TS cell methylated promoters, including those controlling the expression of key ES cell transcription factors (e.g., Pou5f1/Oct4, Klf2, Klf4 and Sall4 ), XEN cell transcription factors (e.g., Sox17 ) and regulators of embryonic lineage specification (e.g., Fox, Hox, Pax and Sox gene families of homeobox domain transcription factors). The much smaller list of ES cell methylated promoters did not show significant enrichment for any functional category, but among the most represented there were those termed "Cytoskeleton" and "Proteolysis", associated with enzymatic activities considered to be important for the establishment of the TE lineage, which requires extensive extra-cellular and cellular remodelling; notably, this list contained genes for crucial TS cell transcription factors (e.g., Elf5 and Tead4 ) and signalling mediators (e.g., Ezr and Ptp4a2 ), as well as genes, whose function has not yet been characterized in the context of the trophoblast lineage, but whose expression is known to be significantly upregulated in TS versus ES cells (e.g., Mef2d, Plet1 and Tinagl1 ) [Rugg-Gunn et al., 2010]. Thus, this group of 482 differentially methylated promoters can be considered a DNA methylation signature of genuine TS cell identity. Remarkably, when the methylation status of this promoter group was investigated across ES cell-derived TS-like cells, it was found that the median and the distribution of 5mC levels, as well as the inter-dataset correlation (R) values, were directly related to the extent of transdifferentiation observed in each distinct model, based on morphological and molecular marker analyses (Figure 3.18 & 3.26). In

148


particular, the 5mC profiles of Oct4-cKO and iCdx2/iCDX2:ER ES cell-derived TS-like cells more closely resemble that of bona fide TS cells, than those obtained from iRAS and iRAF transdifferentiating cells, dependent on forced Erk signalling. A hierarchical clustering analysis of promoter 5mC profiles – extended to all ES cell-derived TS -like cell models and based on a correlation (R) cut-off threshold of 0.7 – indicates that, during ES cell transdifferentiation to TS-like cells, all elements identified as being relatively hypermethylated in genuine TS cells (446) or in ES cells (36) are subject to DNA methylation or demethylation, respectively (Figures 3.19 & 3.27). When a more stringent clustering analysis (R=0.9) was performed, two subgroups emerged within the group of TS cell hypermethylated promoters: one including elements sensitive to all transdifferentiation stimuli (subgroup A: n=156; 35%), and another presenting those preferentially methylated in response to changes in either Oct4 or Cdx2 levels (subgroup B: n=252; 57%). These two subgroups present similar gene function annotations (Figure 3.20). However, key pluripotency transcription factors – e.g., Pou5f1(Oct4), Klf2, Klf4 and XEN cell transcription factors – e.g., Sox17 – are found within subgroup A, whereas homeobox transcription factors – like those belonging to the Fox, Hox, Pax and Sox gene families – are markedly more represented within subgroup B. Interestingly, this classification is consistent with the finding that, in all cases under scrutiny, ES cell transdifferentiation occurs unidirectionally towards TS-like cells, with the models dependent on regulatable expression of Oct4/Cdx2 reaching more advanced stages of lineage conversion, in comparison with those relying on forced Erk signalling. Thirty-eight promoters were excluded from the above categorization (subgroup Neither A nor B: 38; 8%) and may be targets of stochastic DNA methylation during lineage conversion. This cluster includes genes encoding for pluripotency and homeobox transcription factors (e.g., Sall4 and Hoxd3 ), as well as for proteins mediating cell-cell interactions (e.g., H2-Q2 and Cadherin11 ), which – if expressed in response to appropriate stimuli – could potentially interfere with normal trophoblast development. No further subclustering was achieved for the small group of promoters undergoing DNA demethylation, suggesting that these elements are similarly affected by the variety of transdifferentiation stimuli; although substantial loss of methylation was observed at specific regulatory regions (Figures 3.16 & 3.17), these promoters appear to be largely resistant to 5mC


149

reprogramming (Figure 3.19). The DNA methylation and demethylation mechanisms active during ES cell transdifferentiation to TS-like cells were not specifically investigated in the present study. Nevertheless some hypotheses on these activities can be drawn from the data provided. DNA demethylation seems to be particularly defective. Recent reports have proposed that both passive and active demethylation mechanisms are responsible for the genome-wide 5mC erasure observed during pre-implantation [Wossidlo et al., 2011; Smallwood et al., 2011] and precursor germ cell (PGC) development [Seisenberger et al., 2012; Hackett et al., 2013]. Passive demethylation is dependent on DNA replication in the absence of maintenance methylation, whereas active mechanisms are thought to be carried out by complex enzymatic pathways (Introduction section 1.3.2). During ES cell transdifferentiation to TS-like cells, it can be speculated that, on the one hand, the low proliferation rate of transdifferentiating cells can potentially represent a limiting factor for passive demethylation (Figure 3.8); on the other hand, key active demethylation factors may not be expressed at the concentration levels required for efficient 5mC metabolism, presumably relying on the integration of multiple enzymatic activities and on sequence-specific targeting instructions, which remain completely unknown to date. DNA methylation is also incomplete, albeit it appears to be carried out more efficiently, at least in response to Oct4/Cdx2 forced regulation (Oct4-cKO and iCdx2/iCDX2:ER ES cell models) (Figure 3.27). In these cases, the majority of promoters – observed to be hypermethylated in genuine TS cells (subgroup A+B=408; 92%) – gain some levels of 5mC during transdifferentiation, indicating that de novo methylation takes place at these loci. For this group of elements, maintenance methylation could be defective or, alternatively, active demethylation may counteract this process, as reported in the literature for a small group of genes [Métivier et al., 2008; Kangaspeska et al., 2008; Ficz et al., 2011]. In contrast, on a small number of promoters (subgroup Neither A nor B=38; 8%), DNA methyltransferases recruitment does not seem to respond to specific stimuli and may occur stochastically. In transdifferentiating cells dependent on Erk hyperactivity, a larger group of promoters is resistant to DNA methylation (subgroup B+nAnB=194; 43%).

150


Notably, it has been recently reported that, in self-renewing ES cells, combined inhibition of Erk and Gsk3β signalling by 2 inhibitors (2i) leads to a marked, genome-wide, reduction in 5mC levels – with a drop from 70 to 30% of total cytosines being methylated [Leitch et al., 2013; Yamaji et al., 2013; Ficz et al., 2013]. This event is dependent on the transcriptional regulator Prdm14 and is considered to be caused by a combination of mechanisms, including repression of de novo DNA methyl transferases (Dnmt3a and Dnmt3b), active 5mC hydroxylation to 5hmC and lack of maintenance methylation. In contrast with the bulk of the genome, specific classes of sequences – e.g., major satellites repeats, intracisternal A particles (IAP) elements, and imprinted differentially methylated regions (DMRs) – partially escape demethylation. In ES cells cultured in vitro, this epigenetic phenomenon is associated with the transition to naive pluripotency, a cellular state likened to that of the pre-implantation epiblast cells in vivo (Introduction section 1.2.1). Some authors have proposed that, in 2i conditions, ES cells expand their developmental potential, acquiring some capacity – upon blastocyst injection – to contribute to extra-embryonic lineages [Morgani et al., 2013]; however, other researchers do not agree with this report [Marks et al., 2012]. Here, wild-type and iRAF ES cells were pre-cultured in 2i conditions, prior to the start of transdifferentiation to TS-like cells – promoted by a switch to TS cell culture conditions, which are FGF+CM/serum ± 4-HT, on a MEF feeder layer (Figure 3.21, A). Remarkably, 2i pre-treatment showed no effect on lineage conversion – as observed by morphological and molecular marker analyses carried out during transdifferentiation – as well as on the DNA methylation profile – obtained by MeDIP-Seq, after 12 days from the start of this process (Figures 3.21, 3.22 & 3.27). At least two hypotheses – not mutually exclusive – may be proposed to explain these findings. Combined Erk and Gsk3β signalling inhibition does not lead to complete erasure of DNA methylation [Leitch et al., 2013; Yamaji et al., 2013; Ficz et al., 2013]; therefore, regulatory elements of key gatekeeper genes – crucially required for the control of ES cell developmental potential, like Elf5 [Ng et al., 2008] – may retain 5mC levels sufficient to ensure their silencing. Alternatively, transcriptional repression may rely on parallel epigenetic repressive mechanisms, including – in particular – Histone-3-Lysine-9 tri-methylation (H3K9me3). It has been shown that, in ES cells, 5mC and H3K9me3 mediate the repression of largely distinct subsets


151

of genes, with the latter modification reported to be necessary for the silencing of a small group of key TS cell transcription factors (e.g., Cdx2 and Tcfap2c), as well as of endogenous retroviruses (ERVs) elements, whose control is considered to be important for the establishment of the TS cell gene expression programme [Yuan et al., 2009; Yeap et al., 2009; Lohmann et al., 2010; Karimi et al., 2011; Chuong et al., 2013]. Importantly, the DNA methylation machinery is presumably required for the maintenance of this epigenetic memory, as demonstrated by the fact that ES cells, deficient for key components of this apparatus, readily switch to a trophoblast fate, in response to the appropriate extracellular stimuli [Jackson et al., 2004; Ng et al., 2008]. In conclusion, a comparative analysis of ES cell transdifferentiation to TS-like cells was performed in order to evaluate four distinct models of this process – dependent on either forced Erk signalling (iRAS and iRAF) or controlled expression of Oct4/Cdx2 transcription factor (Oct4-cKO and iCdx2/iCDX2:ER) – in comparison with TE/ExE-derived TS cells. It revelead that transdifferentiation occurs unidirectionally towards TS-like cells; yet, this process remains incomplete, being stalled at various intermediate stages, in different models. Lineage conversion proceeds more efficiently, and reaches more advanced stages, in cells relying on the regulatable expression of Oct4 or Cdx2 transcription factor than in those induced by Erk hyperactivity; nevertheless, even in the models better resembling bona fide TS cells, the stability of the acquired lineage identity requires continuous forced regulation, not leading to the establishment of a self-sustaining TS cell gene regulatory network. At the epigenetic level, a group of 482 gene promoters – enriched for genes encoding for key regulators of early embryonic and extra-embryonic lineage specification – was observed to undergo developmentally controlled DNA methylation reprogramming. Yet, consistent with morphological and gene expression analyses, this conversion from the ES cell to the TS cell methylome remains incomplete. Both demethylation and de novo methylation were observed to be defective, albeit no single causative region was commonly found to be specifically refractory to reprogramming. iPS cells have also been generally found to retain an epigenetic memory of their somatic cell lineage of origin [e.g., Stadtfeld et al., 2010; Lister et al., 2011; Ohi et al., 2011]. Notably, in this experimental context, cellular conversion was improved by applying rationally designed interventions aimed at the reprogramming of resistant loci (e.g.,

152


use of a histone deacetylase inhibitor in order to reactivate an aberrantly silenced locus; Stadtfeld et al., 2010). Similar strategies – in addition to the previously proposed forced induction of multiple key TS cell transcription factors – could be potentially employed to improve the generation of ES cell-derived TS-like cells. It can be speculated that, in the future, the coupling of high-throughput molecular screens (e.g., based on shRNA or compound libraries) with comprehensive analyses of TS cell identity, like those presented here, could contribute to the identifications of the factors capable of accomplishing a complete epigenetic conversion of ES cells – and potentially of somatic cells – to self-renewing and multipotent trophoblast-like cells, equivalent to genuine TE/ExE-derived TS cells.

Appendix

153

Table 1: Gene promoters hypermethylated in ES versus TS cells and subject to DNA demethylation in ES cell-derived TS-like cells (n=36)

Symbol

Name

1700064H15Rik Aadac Apol10a Apol11a Btnl6 Ccr1l1 Cpb1 Crlf2 Cttnbp2nl Elf5 Ezr Fhl3 Gm10110 Gm12394 Gm4694 Gm5455 Gyg H2-Q6 H2-T10 Hps3 Mafk Mef2d Ms4a14 Mtf1 Plec Plet1 Ptp4a2 Rbm20

RIKEN cDNA 1700064H15 gene arylacetamide deacetylase (esterase) apolipoprotein L 10c; apolipoprotein L 10a apolipoprotein L 11a butyrophilin-like 6 chemokine (C-C motif) receptor 1-like 1 carboxypeptidase B1 (tissue) cytokine receptor-like factor 2 CTTNBP2 N-terminal like E74-like factor 5 ezrin; hypothetical protein LOC100044177 four and a half LIM domains 3 predicted gene 12394 predicted gene 4694 gem (nuclear organelle) associated protein 8 glycogenin histocompatibility 2, Q region locus 1 histocompatibility 2, T region locus 9 Hermansky-Pudlak syndrome 3 homolog (human) v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K (avian)

myocyte enhancer factor 2D membrane-spanning 4-domains, subfamily A, member 14 metal response element binding transcription factor 1 plectin 1 Placenta expressed transcript 1 protein tyrosine phosphatase 4a2 RNA binding motif protein 20

continued... 154

...continued Symbol RP23-108F2.4 Sh3bgr Slc2a2 Tead4 Tinagl1 Tmsb10 Usp13 Zfhx4

Name SH3-binding domain glutamic acid-rich protein solute carrier family 2 (facilitated glucose transporter), member 2

TEA domain family member 4 tubulointerstitial nephritis antigen-like 1 thymosin, beta 10 ubiquitin specific peptidase 13 zinc finger homeodomain 4

Table 2: Gene promoters hypermethylated in TS versus ES cells and subject to DNA methylation in ES cell-derived TS-like cells (subgroup A=156; subgroup B =252; subgroup neither A nor B=38; total=446)

Symbol

Name 1

Subgroup A

2010107G23Rik 6430527G18Rik Abhd8 Acbd4 AI464131 Akap12 Alx4 Amn Apoe Arhgap23 B230217O12Rik B3gnt9-ps Bahcc1

RIKEN cDNA 2010107G23 gene RIKEN cDNA 6430527G18 gene abhydrolase domain containing 8 acyl-Coenzyme A binding domain containing 4 expressed sequence AI464131 A kinase (PRKA) anchor protein (gravin) 12 aristaless-like homeobox 4 amnionless apolipoprotein E RIKEN cDNA 4933428G20 gene RIKEN cDNA B230217O12 gene BAH domain and coiled-coil containing 1

continued... 1

Subject to DNA methylation in iRAF/iRAS/Oct4-cKO/iCdx2 ES⇒TS cells (n=156; 35%)

155

...continued Symbol Barhl1 Bcl6b Bmi1 C1ql3 Cbx7 Ccnd1 Cd24a Cdyl Cilp2 Cnpy1 Comp Cpeb1 Ctu1 Cyp26c1 Dll1 Dlx2 Dppa5a Efnb2 Epas1 Esam Evc Exoc6 Ext1 Fam43a Fgf4 Fgf5 Foxd1 Foxd3 Foxp4 Fzd5

Name BarH-like 1 (Drosophila) B-cell CLL/lymphoma 6, member B Bmi1 polycomb ring finger oncogene C1q-like 3 chromobox homolog 7 cyclin D1 CD24a antigen chromodomain protein, Y chromosome-like cartilage intermediate layer protein 2 canopy 1 homolog (zebrafish) cartilage oligomeric matrix protein cytoplasmic polyadenylation element binding protein 1 ATP binding domain 3 cytochrome P450, family 26, subfamily c, polypeptide 1 delta-like 1 (Drosophila) distal-less homeobox 2 developmental pluripotency associated 5A ephrin B2 endothelial PAS domain protein 1 endothelial cell-specific adhesion molecule Ellis van Creveld gene homolog (human) exocyst complex component 6 exostoses (multiple) 1 family with sequence similarity 43, member A fibroblast growth factor 4 fibroblast growth factor 5 forkhead box D1 forkhead box D3 forkhead box P4 frizzled homolog 5 (Drosophila)

continued... 156

...continued Symbol Fzd7 Fzd8 Galntl6 Galr2 Gdf3 Gfra1 Gm11627 Gm14325 Gm15051 Gm17173 Gm17349 Gm2301 Gng3 Gpx4 Grm8 H2-M5 Hic1 Hoxa2 Hoxa3 Hoxb1 Hs3st2 Igfbp2 Isyna1 Jam2 Klf2 Klf3 Klf4 L1td1 Lass1 Lcmt2

Name frizzled homolog 7 (Drosophila) frizzled homolog 8 (Drosophila) RIKEN cDNA 4930431L04 gene galanin receptor 2 growth differentiation factor 3 glial cell line der. neurotroph. factor family recept. α 1

predicted gene 11627 predicted gene 14325

predicted gene 2301 guanine nucleotide binding protein (G protein), gamma 3 glutathione peroxidase 4 glutamate receptor, metabotropic 8 histocompatibility 2, M region locus 5 hypermethylated in cancer 1 homeo box A2 homeo box A3 homeo box B1 heparan sulfate (glucosamine) 3-O-sulfotransferase 2 insulin-like growth factor binding protein 2 myo-inositol 1-phosphate synthase A1 junction adhesion molecule 2 Kruppel-like factor 2 (lung) Kruppel-like factor 3 (basic); similar to BKLF Kruppel-like factor 4 (gut) LINE-1 type transposase domain containing 1 LAG1 homolog, ceramide synthase 1 leucine carboxyl methyltransferase 2

continued... 157

...continued Symbol Lefty1 Lhx4 Lhx6 Lrch4 Ltbp4 Mark4 Mbd3 Mdga1 Mex3b Mir1900 Mmp11 Moap1 Mrpl52 Msh4 Mtss1 Mtx1 Mycn Myo10 Necab3 Nespas Nhlh2 Nodal Nr5a2 Nt5c2 Ntn1 Panx2 Pax6 Pcdha11 Pcdhgc5 Pcolce

Name left right determination factor 1 LIM homeobox protein 4 LIM homeobox protein 6 leucine-rich repeats and calponin homology (CH) 4

latent Tgfβ binding protein 4 MAP/microtubule affinity-regulating kinase 4 methyl-CpG binding domain protein 3 MAM domain glycosylphosphatidylinositol anchor 1

mex3 homolog B (C. elegans) matrix metallopeptidase 11 modulator of apoptosis 1 mitochondrial ribosomal protein L52 mutS homolog 4 (E. coli) metastasis suppressor 1 metaxin 1 v-myc myelocytomatosis viral related oncogene myosin X N-terminal EF-hand calcium binding protein 3 neuroendocrine secretory protein antisense nescient helix loop helix 2 nodal nuclear receptor subfamily 5, group A, member 2 5’-nucleotidase, cytosolic II similar to Netrin-1 precursor; netrin 1 pannexin 2 paired box gene 6 protocadherin alpha 11 protocadherin gamma subfamily C, 5 procollagen C-endopeptidase enhancer protein

continued... 158

...continued Symbol Phc1 Phpt1 Pou5f1 Ppil1 Ppp2r2d Prdm14 Prdm16 Prkg1 Prosapip1 Rara Rax Rbmxl2 Rcor2 Rfx4 Rnf165 Rxfp3 Sall3 Sesn2 Sirt4 Six2 Slc15a1 Slc29a1 Slc35d3 Slc38a4 Socs3 Sox17 Spry2 Srd5a2 Tbx3 Tbx4

Name polyhomeotic-like 1 (Drosophila) phosphohistidine phosphatase 1 POU domain, class 5, transcription factor 1 peptidylprolyl isomerase (cyclophilin)-like 1 protein phosphatase 2, reg. sub. B, δ isoform

PR domain containing 14 PR domain containing 16 protein kinase, cGMP-dependent, type I ProSAPiP1 protein retinoic acid receptor, alpha retina and anterior neural fold homeobox RNA binding motif protein, X-linked-like 2 REST corepressor 2 regulatory factor X, 4 (influences HLA class II expression) ring finger protein 165 relaxin family peptide receptor 3 sal-like 3 (Drosophila) sestrin 2 sirtuin 4 sine oculis-related homeobox 2 homolog (Drosophila) solute carrier family 15, member 1 solute carrier family 29, member 1 solute carrier family 35, member D3 solute carrier family 38, member 4 suppressor of cytokine signaling 3 SRY-box containing gene 17 sprouty homolog 2 (Drosophila) steroid 5 alpha-reductase 2 T-box 3 T-box 4

continued... 159

...continued Symbol Tdgf1 Tubb5 Ubr5 Vrtn Vsx2 Wnt10b Wnt5a Wt1 Yjefn3 Zbtb45 Zbtb8a Zfp316 Zfp319 Zfp46 Zfp532 Zfp648 Zfp652 Zfp672 Zfp740 Zfp865 Zic5 Zmynd8 Zscan10

Name teratocarcinoma-derived growth factor 1 tubulin, beta 5 ubiquitin protein ligase E3 component n-recognin 5 visual system homeobox 2 wingless related MMTV integration site 10b wingless-related MMTV integration site 5A Wilms tumor 1 homolog YjeF N-terminal domain containing 3 zinc finger and BTB domain containing 45 zinc finger and BTB domain containing 8a zinc finger protein 316 zinc finger protein 319 zinc finger protein 46 zinc finger protein 532 zinc finger protein 648 zinc finger protein 652 zinc finger protein 672 zinc finger protein 740 zinc finger protein of the cerebellum 5 zinc finger, MYND-type containing 8 zinc finger and SCAN domain containing 10

Subgroup B2 0610040B09Rik 1010001N08Rik 1500002O10Rik 1600014C10Rik 2410017I17Rik

RIKEN cDNA 0610040B09 gene RIKEN cDNA 1010001N08 gene RIKEN cDNA 1500002O10 gene RIKEN cDNA 1600014C10 gene similar to LOC637119 protein

continued... 2

Subject to DNA methylation preferentially in Oct4-cKO/iCdx2 ES⇒TS cells (n=252; 57%)

160

...continued Symbol 2610027K06Rik 2610316D01Rik 3110070M22Rik 4833420G17Rik 4930426I24Rik 4931428F04Rik 4932441J04Rik 5730457N03Rik 5930412G12Rik A830031A19Rik Akt1s1 Alx1 Alx3 Atf3 Atoh1 Barx1 Barx2 Bcl11a Bcl11b Bdnf Bmp4 Bsx Car10 Cbln1 Cbx4 Cbx8 Ccnd2 Ccno Cdk6 Cerkl

Name RIKEN cDNA 2610027K06 gene RIKEN cDNA 2610316D01 gene RIKEN cDNA 3110070M22 gene RIKEN cDNA 4833420G17 gene RIKEN cDNA 4930426I24 gene RIKEN cDNA 4931428F04 gene RIKEN cDNA 4932441J04 gene RIKEN cDNA 5730457N03 gene RIKEN cDNA 5930412G12 gene RIKEN cDNA A830031A19 gene AKT1 substrate 1 (proline-rich) ALX homeobox 1 aristaless-like homeobox 3 activating transcription factor 3 atonal homolog 1 (Drosophila) BarH-like homeobox 1 BarH-like homeobox 2 B-cell CLL/lymphoma 11A (zinc finger protein) B-cell leukemia/lymphoma 11B brain derived neurotrophic factor bone morphogenetic protein 4 brain specific homeobox carbonic anhydrase 10 cerebellin 1 precursor protein chromobox homolog 4 (Drosophila Pc class) chromobox homolog 8 (Drosophila Pc class) cyclin D2 cyclin O cyclin-dependent kinase 6 ceramide kinase-like

continued... 161

...continued Symbol Chat Clec2d Clic5 Col14a1 Col2a1 Crabp2 Crmp1 Ctnna2 Cwc22 Cxcl12 Cyp26b1 Dbx1 Ddn Dio3 Dio3os Dlx1as Dlx5 Dlx6os1 Dmbx1 Dmrt3 Ebf1 Ebf2 Ebf3 Egr3 Egr4 Elfn1 Emx1 Emx2os En1 Esrrg

Name choline acetyltransferase C-type lectin domain family 2, member d chloride intracellular channel 5 collagen, type XIV, alpha 1 collagen, type II, alpha 1 cellular retinoic acid binding protein II collapsin response mediator protein 1 catenin (cadherin associated protein), alpha 2 CWC22 spliceosome-associated protein homolog

chemokine (C-X-C motif) ligand 12 cytochrome P450, fam. 26, subfam. b, polyp. 1

developing brain homeobox 1 dendrin deiodinase, iodothyronine type III deiodinase, iodothyronine type III, opp. strand distal-less homeobox 1, antisense distal-less homeobox 5 Dlx6 opposite strand transcript 1 diencephalon/mesencephalon homeobox 1 doublesex and mab-3 related transcription factor 3

early early early early early

B-cell factor 1 B-cell factor 2 B-cell factor 3 growth response 3 growth response 4

leucine rich repeat and fibronectin type III, extrac. 1

empty spiracles homolog 1 (Drosophila) empty spiracles homolog 2 opp. strand

engrailed 1 estrogen-related receptor gamma

continued... 162

...continued Symbol Evx2 Fev Fezf2 Fgf11 Fgf9 Fgfr2 Fli1 Flrt2 Foxa1 Foxb1 Foxb2 Foxd4 Fst Fxyd7 Fzd2 Gad2 Gal3st2 Gbx2 Gdnf Gja1 Gm12688 Gm13261 Gm13334 Gm13425 Gm14207 Gm14343 Gm14403 Gm15524 Gm15581 Gm16551

Name even skipped homeotic gene 2 homolog FEV (ETS oncogene family) Fez family zinc finger 2 fibroblast growth factor 11 fibroblast growth factor 9 fibroblast growth factor receptor 2 Friend leukemia integration 1 fibronectin leucine rich transmembrane protein 2 forkhead box A1 forkhead box B1 forkhead box B2 forkhead box D4 follistatin FXYD domain-containing ion transport reg. 7 frizzled homolog 2 (Drosophila) glutamic acid decarboxylase 2 galactose-3-O-sulfotransferase 2 gastrulation brain homeobox 2 glial cell line derived neurotrophic factor gap junction protein, alpha 1

predicted gene 13334 hypothetical protein LOC100043609 predicted gene 14343 predicted gene 14403

continued... 163

...continued Symbol Gm17536 Gm17569 Gm17595 Gm20388 Gm20398 Gm20467 Gm53 Gm5607 Gm5884 Gm9996 Gpr6 Gsc Gstt2 Gsx1 Helt Hist1h1b Hlx Hnf1b Hoxa10 Hoxa11 Hoxa9 Hoxb3 Hoxb3os Hoxb4 Hoxb8 Hoxc11 Hoxc12 Hoxd11 Hoxd12 Hspa2

Name

predicted gene 53 predicted gene 5607 predicted gene 5884 predicted gene 9996 G protein-coupled receptor 6 goosecoid homeobox glutathione S-transferase, theta 2 GS homeobox 1 Hey-like transcription factor (zebrafish) histone cluster 1, H1b H2.0-like homeobox HNF1 homeobox B homeo box A10 homeo box A11 homeo box A9 homeo box B3 homeo box B3, opposite strand transcript homeo box B4 homeo box B8 homeo box C11 homeo box C12 homeo box D11 homeo box D12 heat shock protein 2

continued... 164

...continued Symbol Icam1 Ihh Inhbb Irs1 Irx2 Irx3 Irx5 Isl2 Islr2 Jag1 Kcnk12 Kcnk9 Kctd1 Klrb1c Lbx1 Lef1 Lhx1 Lhx2 Lhx5 Lhx8 Lhx9 Lmx1b Lphn3 Lrp2 Mafb Meis1 Meis2 Mn1 Msx1 Neurod2

Name intercellular adhesion molecule 1 Indian hedgehog inhibin beta-B insulin receptor substrate 1 Iroquois related homeobox 2 (Drosophila) Iroquois related homeobox 3 (Drosophila) Iroquois related homeobox 5 (Drosophila) insulin related protein 2 (islet 2) immunoglobulin superfam. leucine-rich repeat 2

jagged 1 potassium channel, subfamily K, member 12 potassium channel, subfamily K, member 9 potassium chann. tetramerisation domain 1

killer cell lectin-like receptor subfam. B 1C ladybird homeobox homolog 1 (Drosophila) lymphoid enhancer binding factor 1 LIM homeobox protein 1 LIM homeobox protein 2 LIM homeobox protein 5 LIM homeobox protein 8 LIM homeobox protein 9 LIM homeobox transcription factor 1 beta latrophilin 3 low density lipoprotein receptor-related protein 2 v-maf musculoaponeurotic fibrosarcoma oncog. fam., prot. B

Meis homeobox 1 Meis homeobox 2 meningioma 1 homeobox, msh-like 1 neurogenic differentiation 2

continued... 165

...continued Symbol Neurog2 Nfix Ngfr Nkx1-1 Nkx2-1 Nkx2-2 Nkx2-3 Nkx3-2 Nkx6-1 Nol4 Npas3 Nphp1 Npr3 Nptx1 Nr2e1 Nr4a3 Nrn1 Nrp2 Ntrk3 Nxph1 Olig2 Onecut2 Onecut3 Osr2 Otp Otx1 Otx2 Patz1 Pax2 Pax5

Name neurogenin 2 nuclear factor I/X nerve growth factor receptor)

NK1 transcription factor related, locus 1 NK2 homeobox 1 NK2 transcription factor related, locus 2 NK2 transcription factor related, locus 3 NK3 homeobox 2 NK6 homeobox 1 nucleolar protein 4 neuronal PAS domain protein 3 nephronophthisis 1 (juvenile) homolog (human) natriuretic peptide receptor 3 neuronal pentraxin 1 nuclear receptor subfam. 2, group E, 1 nuclear receptor subfam. 4, group A, 3 neuritin 1 neuropilin 2 neurotrophic tyrosine kinase, recep., type 3 neurexophilin 1 oligodendrocyte transcription factor 2 one cut domain, family member 2 one cut domain, family member 3 odd-skipped related 2 (Drosophila) orthopedia homolog (Drosophila) orthodenticle homolog 1 (Drosophila) orthodenticle homolog 2 (Drosophila) POZ (BTB) and AT hook containing zinc finger 1 paired box gene 2 paired box gene 5

continued... 166

...continued Symbol Pax6os1 Pax7 Pcdh10 Pcdh17 Pcdh7 Pcdh8 Pdgfa Pdgfra Pgr Pitx1 Pitx2 Plcxd1 Plxdc2 Plxnd1 Pml Pnma2 Pou3f2 Pou4f2 Pou4f3 Prdm6 Prmt8 Prox1 Ptprg Ptprs Rarg Rb1 Runx2 Sall1 Sema6a Shh

Name Pax6 opposite strand transcript 1 paired box gene 7 protocadherin 10 protocadherin 17 protocadherin 7 protocadherin 8 platelet derived growth factor, alpha platelet derived growth factor receptor, alpha progesterone receptor paired-like homeodomain transcription factor 1 paired-like homeodomain transcription factor 2 phosphatidylinositol-specific phospholip. C, X dom. 1

plexin domain containing 2 plexin D1 promyelocytic leukemia paraneoplastic antigen MA2 POU domain, class 3, transcription factor 2 POU domain, class 4, transcription factor 2 POU domain, class 4, transcription factor 3 PR domain containing 6 protein arginine N-methyltransferase 8 prospero-related homeobox 1 protein tyrosine phosphatase, receptor type, G protein tyrosine phosphatase, receptor type, S retinoic acid receptor, gamma retinoblastoma 1 runt related transcription factor 2 sal-like 1 (Drosophila) semaphorin) 6A sonic hedgehog

continued... 167

...continued Symbol Shmt2 Sim2 Six3 Skor1 Skor2 Slc13a5 Slc26a5 Slit2 Sorcs3 Sox14 Sp5 Sp8 Sp9 Spag6 Sstr1 Tal1 Tbx1 Tcfap2a Tchh Tlx1 Tlx2 Tmem132e Trim54 Uncx Vax1 Vwc2 Wnt1 Wnt3 Wnt3a Zbtb7a

Name serine hydroxymethyltransferase 2 (mitochondrial) single-minded homolog 2 (Drosophila) sine oculis-related homeobox 3 homolog

solute carrier family 13, member 5

solute carrier family 26, member 5 slit homolog 2 (Drosophila) sortilin-related VPS10 domain receptor 3 SRY-box containing gene 14 trans-acting transcription factor 5 trans-acting transcription factor 8 trans-acting transcription factor 9 sperm associated antigen 6 somatostatin receptor 1 T-cell acute lymphocytic leukemia 1 similar to T-box 1; T-box 1 transcription factor AP-2, alpha trichohyalin T-cell leukemia, homeobox 1 T-cell leukemia, homeobox 2 transmembrane protein 132E tripartite motif-containing 54 UNC homeobox ventral anterior homeobox containing gene 1 von Willebrand factor C domain containing 2 wingless-related MMTV integration site 1 wingless-related MMTV integration site 3 wingless-related MMTV integration site 3A zinc finger and BTB domain containing 7a

continued... 168

...continued Symbol Zcchc3 Zfp217 Zfp36l1 Zfp456 Zfp503 Zic1 Zic4

Name zinc finger, CCHC domain containing 3 zinc finger protein 217 zinc finger protein 36, C3H type-like 1 zinc finger protein 456 zinc finger protein 503 zinc finger protein of the cerebellum 1 zinc finger protein of the cerebellum 4

Subgroup nA/nB3 A930004D18Rik Cdh11 Cnnm2 Cyp1b1 Epha6 Fam5c Foxp1 Gm14412 Gm20440 Gm5501 Grm3 H2-Q2 H60b Hoxd3 Hrk Jak3 Kdm2b Klhl14 Lfng Magi2 Mex3a

RIKEN cDNA A930004D18 gene cadherin 11 cyclin M2 cytochrome P450, family 1, subfam. b, polypep. 1 Eph receptor A6 family with sequence similarity 5, member C forkhead box P1

predicted gene 5501 glutamate receptor, metabotropic 3 histocompatibility 2, Q region locus 1 histocompatibility 60b homeo box D3 harakiri, BCL2 interacting protein

Janus kinase 3 lysine (K)-specific demethylase 2B kelch-like 14 (Drosophila) LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase

membr. assoc. guanylate kinase, WW and PDZ domain 2 mex3 homolog A (C. elegans)

continued... 3

Promoters with 5m patterns in ES⇒TS cells uncorrelated with subgroup A or B (n=38; 8%)

169

...continued Symbol Mkx Mllt6 Nags Pfdn2 Polr2k Prrxl1 Pycr2 Rps13 Rsph4a Sall4 Sgk1 Slitrk5 Sv2c Tesc Tmem223 Tmem90b Zfp462

Name mohawk homeobox myel./lymph. or mixed-lin. leukemia, transloc. to, 6

N-acetylglutamate synthase prefoldin 2 polymerase (RNA) II (DNA directed) polypeptide K paired related homeobox protein-like 1 pyrroline-5-carboxylate reductase family, member 2 similar to ribosomal protein S13 radial spoke head 4 homolog A (Chlamydomonas) sal-like 4 (Drosophila) serum/glucocorticoid regulated kinase 1 SLIT and NTRK-like family, member 5 synaptic vesicle glycoprotein 2c tescalcin; similar to Tescalcin transmembrane protein 223 predicted gene 14134 zinc finger protein 462

170

171

ELF5

ELF5

DAPI

EGFP TS cells

DAPI

CDX2/ELF5/DAPI

CDX2/ELF5/DAPI

Figure 1: Comparative analysis of ES cell transdifferentiation to TS-like cells: immunofluorescence microscopy for Cdx2 and Elf5 This supplementary figure is an extension to Figure 3.9; here, separate images for Cdx2, Elf5 and DAPI stainings are presented in four subsequent panels. (A) Rosa26 and EGFP TS cells were cultured in TS cell conditions (FGF+CM/serum), on a MEF feeder layer, for 12 days. The majority of TS cells express at high levels both Cdx2 and Elf5; very few differentiated cells – characterized by large polyploid nuclei and Cdx2/Elf5 downregulation – are observed at the periphery of the colonies. (continued...)

CDX2

CDX2

day 12

100 μm

Rosa26 TS cells

100 μm

day 12

CDX2

DAPI

iRAS ES + 4HT

ELF5

DAPI

iRAF ES + 4HT

ELF5

CDX2/ELF5/DAPI

CDX2/ELF5/DAPI

(...continued) (B) iRAS and iRAF ES cells were cultured in FGF+CM/serum, supplemented with 4HT (1µM), on a MEF feeder layer, for 12 days. In both transdifferentiation models, Cdx2-positive colonies were rarely observed; of those, only a minority express some level of Elf5, as shown here. (continued...)

CDX2

172

173

CDX2

CDX2

ELF5

DAPI

DAPI

iCdx2 ES + dox

ELF5

CDX2/ELF5/DAPI

CDX2/ELF5/DAPI

(...continued) (C) Oct4-cKO and iCdx2 ES cells were cultured in FGF+CM/serum, supplemented with doxycycline (1µM), on a MEF feeder layer for 12 days. In both cell lines, the majority of colonies co-express Cdx2 and Elf5, even though their levels were more heterogenous than in TE/ExE-derived TS cells. Notably, differentiated cells (arrowheads) – characterized by large polyploid nuclei and Cdx2/Elf5 downregulation – were observed, in the interior (Oct4-cKO) or in the exterior (iCdx2) of the colonies, at higher frequency than normally found in genuine TS cells. (continued...)

day 12

100 μm

Oct4-cKO ES + dox

day 12

100 μm

DAPI

ctrl ES + 4HT

ELF5

CDX2/ELF5/DAPI

(...continued) (D) ctrl ES cells – stably expressing an EGFP transgene – were cultured in FGF+CM/serum, supplemented with 4HT (1µM), on a MEF feeder layer, for 12 days. This cell line was included in the analysis as control for assessing the effect of environmental stimuli and experimental manipulation; as expected, no sign of transdifferentiation towards the trophoblast lineage was observed.

CDX2

174

iRAS ES + 4HT

iRAF ES + 4HT

cell count

control ES + 4HT

CD31 Oct4-cKO ES+dox

iCdx2 ES +dox

day of reprogramming 0 3 6 12 18

Figure 2: Comparative analysis of ES cell transdifferentiation to TS-like cells: time-course flow cytometry analysis for the ES cell-marker CD31/Pecam1. Inducible ES cell models were subjected to transdifferentiation towards TS-like cells by culture in FGF+CM/serum on a MEF feeder layer +/- 4HT or dox. In all cases, a rapid loss of CD31/Pecam1 expression was observed at the onset of this process. In iCdx2 ES cells, this downregulation occurred with slightly slower kinetics in comparison to the other models.

175

iRAS ES + 4HT

iRAF ES + 4HT

cell count

control ES + 4HT

CD140a Oct4-cKO ES+dox

IM8A1 XEN avg

iCdx2 ES +dox

day of reprogramming 0 3 6 12 18

Figure 3: Comparative analysis of ES cell transdifferentiation to TSlike cells: time-course flow cytometry analysis for the XEN cell-marker CD140a/Pdgfrα. Inducible ES cell models were subjected to transdifferentiation towards TS-like cells by culture in FGF+CM/serum on a MEF feeder layer +/- 4HT or dox. CD140a/Pdgfrα is highly expressed in XEN cells. In all cases, the expression of this marker was not upregulated during the time-course. Dotted line represents average signal intensity in blastocyst-derived IM8A1 XEN cell line.

176

Bibliography Abad, M., Mosteiro, L., Pantoja, C., Cañamero, M., Rayon, T., Ors, I., Graña, O., Megías, D., Domínguez, O., Martínez, D., Manzanares, M., Ortega, S., & Serrano, M. (2013). Reprogramming in vivo produces teratomas and iPS cells with totipotency features. Nature, . doi:10.1038/nature12586. Alder, O., Lavial, F., Helness, A., Brookes, E., Pinho, S., Chandrashekran, A., Arnaud, P., Pombo, A., O’Neill, L., & Azuara, V. (2010). Ring1B and Suv39h1 delineate distinct chromatin states at bivalent genes during early mouse lineage commitment. Development (Cambridge, England), 137 , 2483–92. doi:10.1242/dev.048363. Allis, C. D., Jenuwein, T., Reinberg, D., & Caparros, M.-L. (2007). Epigenetics. CSHL Press. Aloia, L., Di Stefano, B., & Di Croce, L. (2013). Polycomb complexes in stem cells and embryonic development. Development (Cambridge, England), 140 , 2525–34. doi:10.1242/dev.091553. Ambrosetti, D. C., Basilico, C., & Dailey, L. (1997). Synergistic activation of the fibroblast growth factor 4 enhancer by Sox2 and Oct-3 depends on protein-protein interactions facilitated by a specific spatial arrangement of factor binding sites. Molecular and cellular biology, 17 , 6321–9. Andrews, S. R. (2008). Analysing High Throughput Sequencing Data with SeqMonk, version 0.14 . Technical Report The Babraham Institute Cambridge (UK); URL: www.bioinformatics.babraham.ac. Andrews, S. R. (2012). Advanced Analysis with SeqMonk, version 1.2 . Technical Report The Babraham Institute Cambridge (UK); URL: www.bioinformatics.babraham.ac. Arima, T., Hata, K., Tanaka, S., Kusumi, M., Li, E., Kato, K., Shiota, K., Sasaki, H., & Wake, N. (2006). Loss of the maternal imprint in Dnmt3Lmat-/- mice leads to a

177

differentiation defect in the extraembryonic tissue. Developmental biology, 297 , 361–73. doi:10.1016/j.ydbio.2006.05.003. Arman, E., Haffner-Krausz, R., Chen, Y., Heath, J. K., & Lonai, P. (1998). Targeted disruption of fibroblast growth factor (FGF) receptor 2 suggests a role for FGF signaling in pregastrulation mammalian development. Proceedings of the National Academy of Sciences of the United States of America, 95 , 5082–7. Arnold, S. J., & Robertson, E. J. (2009). Making a commitment: cell lineage allocation and axis patterning in the early mouse embryo. Nature reviews. Molecular cell biology, 10 , 91–103. doi:10.1038/nrm2618. Artus, J., Douvaras, P., Piliszek, A., Isern, J., Baron, M. H., & Hadjantonakis, A.K. (2012). BMP4 signaling directs primitive endoderm-derived XEN cells to an extraembryonic visceral endoderm identity. Developmental biology, 361 , 245–62. doi:10.1016/j.ydbio.2011.10.015. Artus, J., & Hadjantonakis, A.-K. (2012). Troika of the mouse blastocyst: lineage segregation and stem cells. Current stem cell research & therapy, 7 , 78–91. Artus, J., Panthier, J.-J., & Hadjantonakis, A.-K. (2010). A role for PDGF signaling in expansion of the extra-embryonic endoderm lineage of the mouse blastocyst. Development (Cambridge, England), 137 , 3361–72. doi:10.1242/dev.050864. Artus, J., Piliszek, A., & Hadjantonakis, A.-K. (2011). The primitive endoderm lineage of the mouse blastocyst: sequential transcription factor activation and regulation of differentiation by Sox17. Developmental biology, 350 , 393–404. doi:10.1016/j.ydbio. 2010.12.007. Auman, H. J., Nottoli, T., Lakiza, O., Winger, Q., Donaldson, S., & Williams, T. (2002). Transcription factor AP-2gamma is essential in the extra-embryonic lineages for early postimplantation development. Development (Cambridge, England), 129 , 2733–47. Avilion, A. A., Nicolis, S. K., Pevny, L. H., Perez, L., Vivian, N., & Lovell-Badge, R. (2003). Multipotent cell lineages in early mouse development depend on SOX2 function. Genes & development, 17 , 126–40. doi:10.1101/gad.224503. Bartolomei, M. S., & Ferguson-Smith, A. C. (2011). Mammalian genomic imprinting. Cold Spring Harbor perspectives in biology, 3 . doi:10.1101/cshperspect.a002592.

178

Beard, C., Hochedlinger, K., Plath, K., Wutz, A., & Jaenisch, R. (2006). Efficient method to generate single-copy transgenic mice by site-specific integration in embryonic stem cells. Genesis (New York, N.Y. : 2000), 44 , 23–8. doi:10.1002/gene.20180. Beck, F., Erler, T., Russell, A., & James, R. (1995). Expression of Cdx-2 in the mouse embryo and placenta: possible role in patterning of the extra-embryonic membranes. Developmental dynamics : an official publication of the American Association of Anatomists, 204 , 219–27. doi:10.1002/aja.1002040302. Beddington, R. S., & Robertson, E. J. (1989). An assessment of the developmental potential of embryonic stem cells in the midgestation mouse embryo. Development (Cambridge, England), 105 , 733–7. Beisel, C., & Paro, R. (2011). Silencing chromatin: comparing modes and mechanisms. Nature reviews. Genetics, 12 , 123–35. doi:10.1038/nrg2932. van den Berg, D. L. C., Snoek, T., Mullin, N. P., Yates, A., Bezstarosti, K., Demmers, J., Chambers, I., & Poot, R. A. (2010). An Oct4-centered protein interaction network in embryonic stem cells. Cell stem cell, 6 , 369–81. doi:10.1016/j.stem.2010.02.014. Bilodeau, S., Kagey, M. H., Frampton, G. M., Rahl, P. B., & Young, R. A. (2009). SetDB1 contributes to repression of genes encoding developmental regulators and maintenance of ES cell state. Genes & development, 23 , 2484–9. doi:10.1101/gad.1837309. Blau, H. M., Chiu, C. P., & Webster, C. (1983). Cytoplasmic activation of human nuclear genes in stable heterocaryons. Cell, 32 , 1171–80. Borgel, J., Guibert, S., Li, Y., Chiba, H., Schübeler, D., Sasaki, H., Forné, T., & Weber, M. (2010). Targets and dynamics of promoter DNA methylation during early mouse development. Nature genetics, 42 , 1093–100. doi:10.1038/ng.708. Boughan, P. K., Argent, R. H., Body-Malapel, M., Park, J.-H., Ewings, K. E., Bowie, A. G., Ong, S. J., Cook, S. J., Sorensen, O. E., Manzo, B. A., Inohara, N., Klein, N. J., Nuñez, G., Atherton, J. C., & Bajaj-Elliott, M. (2006). Nucleotide-binding oligomerization domain-1 and epidermal growth factor receptor: critical regulators of beta-defensins during Helicobacter pylori infection. The Journal of biological chemistry, 281 , 11637–48. doi:10.1074/jbc.M510275200.

179

Boulanger, J., Vézina, A., Mongrain, S., Boudreau, F., Perreault, N., Auclair, B. A., Lainé, J., Asselin, C., & Rivard, N. (2005). Cdk2-dependent phosphorylation of homeobox transcription factor CDX2 regulates its nuclear translocation and proteasome-mediated degradation in human intestinal epithelial cells. The Journal of biological chemistry, 280 , 18095–107. doi:10.1074/jbc.M502184200. Boyer, L. A., Lee, T. I., Cole, M. F., Johnstone, S. E., Levine, S. S., Zucker, J. P., Guenther, M. G., Kumar, R. M., Murray, H. L., Jenner, R. G., Gifford, D. K., Melton, D. A., Jaenisch, R., & Young, R. A. (2005). Core transcriptional regulatory circuitry in human embryonic stem cells. Cell, 122 , 947–56. doi:10.1016/j.cell.2005.08.020. Bradley, A., Evans, M., Kaufman, M. H., & Robertson, E. (1984). Formation of germ-line chimaeras from embryo-derived teratocarcinoma cell lines. Nature, 309 , 255–6. Branco, M. R., Ficz, G., & Reik, W. (2012). hydroxymethylcytosine in the epigenome.

Uncovering the role of 5-

Nature reviews. Genetics, 13 , 7–13.

doi:10.1038/nrg3080. Brons, I. G. M., Smithers, L. E., Trotter, M. W. B., Rugg-Gunn, P., Sun, B., Chuva de Sousa Lopes, S. M., Howlett, S. K., Clarkson, A., Ahrlund-Richter, L., Pedersen, R. A., & Vallier, L. (2007). Derivation of pluripotent epiblast stem cells from mammalian embryos. Nature, 448 , 191–5. doi:10.1038/nature05950. Brook, F. A., & Gardner, R. L. (1997). The origin and efficient derivation of embryonic stem cells in the mouse. Proceedings of the National Academy of Sciences of the United States of America, 94 , 5709–12. Buckley, S. M., Aranda-Orgilles, B., Strikoudis, A., Apostolou, E., Loizou, E., MoranCrusio, K., Farnsworth, C. L., Koller, A. A., Dasgupta, R., Silva, J. C., Stadtfeld, M., Hochedlinger, K., Chen, E. I., & Aifantis, I. (2012). Regulation of pluripotency and cellular reprogramming by the ubiquitin-proteasome system. Cell stem cell, 11 , 783–98. doi:10.1016/j.stem.2012.09.011. Buehr, M., Meek, S., Blair, K., Yang, J., Ure, J., Silva, J., McLay, R., Hall, J., Ying, Q.-L., & Smith, A. (2008). Capture of authentic embryonic stem cells from rat blastocysts. Cell, 135 , 1287–98. doi:10.1016/j.cell.2008.12.007.

180

Burdon, T., Stracey, C., Chambers, I., Nichols, J., & Smith, A. (1999). Suppression of SHP-2 and ERK signalling promotes self-renewal of mouse embryonic stem cells. Developmental biology, 210 , 30–43. doi:10.1006/dbio.1999.9265. Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S., & Smith, A. (2003). Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell, 113 , 643–55. Chambers, I., Silva, J., Colby, D., Nichols, J., Nijmeijer, B., Robertson, M., Vrana, J., Jones, K., Grotewold, L., & Smith, A. (2007). Nanog safeguards pluripotency and mediates germline development. Nature, 450 , 1230–4. doi:10.1038/nature06403. Chapman, V., Forrester, L., Sanford, J., Hastie, N., & Rossant, J. (1984). Cell lineagespecific undermethylation of mouse repetitive DNA. Nature, 307 , 284–6. Chawengsaksophak, K., James, R., Hammond, V. E., Köntgen, F., & Beck, F. (1997). Homeosis and intestinal tumours in Cdx2 mutant mice. Nature, 386 , 84–7. doi:10. 1038/386084a0. Chazaud, C., Yamanaka, Y., Pawson, T., & Rossant, J. (2006). Early lineage segregation between epiblast and primitive endoderm in mouse blastocysts through the Grb2MAPK pathway. Developmental cell, 10 , 615–24. doi:10.1016/j.devcel.2006.02. 020. Cheng, A. M., Saxton, T. M., Sakai, R., Kulkarni, S., Mbamalu, G., Vogel, W., Tortorice, C. G., Cardiff, R. D., Cross, J. C., Muller, W. J., & Pawson, T. (1998). Mammalian Grb2 regulates multiple steps in embryonic development and malignant transformation. Cell, 95 , 793–803. Cherry, A. B., & Daley, G. Q. (2012). Reprogramming Cellular Identity for Regenerative Medicine. Cell, 148 , 1110–1122. doi:10.1016/j.cell.2012.02.031. Cho, L. T. Y., Wamaitha, S. E., Tsai, I. J., Artus, J., Sherwood, R. I., Pedersen, R. A., Hadjantonakis, A.-K., & Niakan, K. K. (2012). Conversion from mouse embryonic to extra-embryonic endoderm stem cells reveals distinct differentiation capacities of pluripotent stem cell states. Development (Cambridge, England), 139 , 2866–77. Chotalia, M., Smallwood, S. A., Ruf, N., Dawson, C., Lucifero, D., Frontera, M., James, K., Dean, W., & Kelsey, G. (2009). Transcription is required for establishment of

181

germline methylation marks at imprinted genes. Genes & development, 23 , 105–17. doi:10.1101/gad.495809. Chuong, E. B., Rumi, M. A. K., Soares, M. J., & Baker, J. C. (2013). Endogenous retroviruses function as species-specific enhancer elements in the placenta. Nature genetics, . doi:10.1038/ng.2553. Clevers, H. (2006). Wnt/beta-catenin signaling in development and disease. Cell, 127 , 469–80. doi:10.1016/j.cell.2006.10.018. Cockburn, K., Biechele, S., Garner, J., & Rossant, J. (2013). The Hippo Pathway Member Nf2 Is Required for Inner Cell Mass Specification. Current biology : CB, . doi:10.1016/j.cub.2013.05.044. Cockburn, K., & Rossant, J. (2010). Making the blastocyst: lessons from the mouse. The Journal of clinical investigation, 120 , 995–1003. doi:10.1172/JCI41229. Cole, M. F., Johnstone, S. E., Newman, J. J., Kagey, M. H., & Young, R. A. (2008). Tcf3 is an integral component of the core regulatory circuitry of embryonic stem cells. Genes & development, 22 , 746–55. doi:10.1101/gad.1642408. Cortázar, D., Kunz, C., Selfridge, J., Lettieri, T., Saito, Y., MacDougall, E., Wirz, A., Schuermann, D., Jacobs, A. L., Siegrist, F., Steinacher, R., Jiricny, J., Bird, A., & Schär, P. (2011). Embryonic lethal phenotype reveals a function of TDG in maintaining epigenetic stability. Nature, 470 , 419–23. doi:10.1038/nature09672. Cortellino, S., Xu, J., Sannai, M., Moore, R., Caretti, E., Cigliano, A., Le Coz, M., Devarajan, K., Wessels, A., Soprano, D., Abramowitz, L. K., Bartolomei, M. S., Rambow, F., Bassi, M. R., Bruno, T., Fanciulli, M., Renner, C., Klein-Szanto, A. J., Matsumoto, Y., Kobi, D., Davidson, I., Alberti, C., Larue, L., & Bellacosa, A. (2011). Thymine DNA glycosylase is essential for active DNA demethylation by linked deamination-base excision repair. Cell, 146 , 67–79. doi:10.1016/j.cell.2011.06. 020. Davis, R. L., Weintraub, H., & Lassar, A. B. (1987). Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell, 51 , 987–1000. Deaton, A. M., & Bird, A. (2011). CpG islands and the regulation of transcription. Genes & development, 25 , 1010–22. doi:10.1101/gad.2037511.

182

Dietrich, J.-E., & Hiiragi, T. (2007). Stochastic patterning in the mouse pre-implantation embryo. Development (Cambridge, England), 134 , 4219–31. doi:10.1242/dev.003798. Doble, B. W., & Woodgett, J. R. (2003). GSK-3: tricks of the trade for a multi-tasking kinase. Journal of cell science, 116 , 1175–86. Dodge, J. E., Kang, Y.-K., Beppu, H., Lei, H., & Li, E. (2004). Histone H3-K9 methyltransferase ESET is essential for early development. Molecular and cellular biology, 24 , 2478–86. Donnison, M., Beaton, A., Davey, H. W., Broadhurst, R., L’Huillier, P., & Pfeffer, P. L. (2005). Loss of the extraembryonic ectoderm in Elf5 mutants leads to defects in embryonic patterning. Development (Cambridge, England), 132 , 2299–308. doi:10. 1242/dev.01819. Dorey, K., & Amaya, E. (2010). FGF signalling: diverse roles during early vertebrate embryogenesis. Development (Cambridge, England), 137 , 3731–42. doi:10.1242/dev. 037689. Ducibella, T., Ukena, T., Karnovsky, M., & Anderson, E. (1977). Changes in cell surface and cortical cytoplasmic organization during early embryogenesis in the preimplantation mouse embryo. The Journal of cell biology, 74 , 153–67. Erlebacher, A., Price, K. A., & Glimcher, L. H. (2004). Maintenance of mouse trophoblast stem cell proliferation by TGF-beta/activin. Developmental biology, 275 , 158–69. doi:10.1016/j.ydbio.2004.07.032. Evans, M. J., & Kaufman, M. H. (1981). Establishment in culture of pluripotential cells from mouse embryos. Nature, 292 , 154–6. Farthing, C. R., Ficz, G., Ng, R. K., Chan, C.-F., Andrews, S., Dean, W., Hemberger, M., & Reik, W. (2008). Global mapping of DNA methylation in mouse promoters reveals epigenetic reprogramming of pluripotency genes. PLoS genetics, 4 , e1000116. doi:10.1371/journal.pgen.1000116. Feldman, B., Poueymirou, W., Papaioannou, V. E., DeChiara, T. M., & Goldfarb, M. (1995). Requirement of FGF-4 for postimplantation mouse development. Science (New York, N.Y.), 267 , 246–9.

183

Feldman, N., Gerson, A., Fang, J., Li, E., Zhang, Y., Shinkai, Y., Cedar, H., & Bergman, Y. (2006). G9a-mediated irreversible epigenetic inactivation of Oct-3/4 during early embryogenesis. Nature cell biology, 8 , 188–94. doi:10.1038/ncb1353. Feng, S., Jacobsen, S. E., & Reik, W. (2010). Epigenetic reprogramming in plant and animal development. Science (New York, N.Y.), 330 , 622–7. doi:10.1126/science. 1190614. Festuccia, N., Osorno, R., Halbritter, F., Karwacki-Neisius, V., Navarro, P., Colby, D., Wong, F., Yates, A., Tomlinson, S. R., & Chambers, I. (2012). Esrrb is a direct Nanog target gene that can substitute for Nanog function in pluripotent cells. Cell stem cell, 11 , 477–90. doi:10.1016/j.stem.2012.08.002. Ficz, G., Branco, M. R., Seisenberger, S., Santos, F., Krueger, F., Hore, T. A., Marques, C. J., Andrews, S., & Reik, W. (2011). Dynamic regulation of 5-hydroxymethylcytosine in mouse ES cells and during differentiation. Nature, 473 , 398–402. doi:10.1038/ nature10008. Ficz, G., Hore, T. A., Santos, F., Lee, H. J., Dean, W., Arand, J., Krueger, F., Oxley, D., Paul, Y.-L., Walter, J., Cook, S. J., Andrews, S., Branco, M. R., & Reik, W. (2013). FGF Signaling Inhibition in ESCs Drives Rapid Genome-wide Demethylation to the Epigenetic Ground State of Pluripotency. Cell stem cell, . doi:10.1016/j.stem.2013. 06.004. Fisher, A. G., & Brockdorff, N. (2012). Epigenetic memory and parliamentary privilege combine to evoke discussions on inheritance. Development, 139 , 3891–3896. doi:10. 1242/dev.084434. Frankenberg, S., Gerbe, F., Bessonnard, S., Belville, C., Pouchin, P., Bardot, O., & Chazaud, C. (2011). Primitive endoderm differentiates via a three-step mechanism involving Nanog and RTK signaling. Developmental cell, 21 , 1005–13. doi:10.1016/j. devcel.2011.10.019. Friedrich, G., & Soriano, P. (1991). Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice. Genes & development, 5 , 1513–1523. doi:10.1101/gad.5.9.1513.

184

Fujikura, J., Yamato, E., Yonemura, S., Hosoda, K., Masui, S., Nakao, K., Miyazaki Ji, J.-i., & Niwa, H. (2002). Differentiation of embryonic stem cells is induced by GATA factors. Genes & development, 16 , 784–9. doi:10.1101/gad.968802. Gardner, R. L. (1985). Clonal analysis of early mammalian development. Philosophical transactions of the Royal Society of London. Series B, Biological sciences, 312 , 163–78. Goldberg, A. D., Allis, C. D., & Bernstein, E. (2007). Epigenetics: a landscape takes shape. Cell, 128 , 635–8. doi:10.1016/j.cell.2007.02.006. Goldin, S. N., & Papaioannou, V. E. (2003). Paracrine action of FGF4 during periimplantation development maintains trophectoderm and primitive endoderm. Genesis (New York, N.Y. : 2000), 36 , 40–7. doi:10.1002/gene.10192. Gotoh, N., Manova, K., Tanaka, S., Murohashi, M., Hadari, Y., Lee, A., Hamada, Y., Hiroe, T., Ito, M., Kurihara, T., Nakazato, H., Shibuya, M., Lax, I., Lacy, E., & Schlessinger, J. (2005). The docking protein FRS2alpha is an essential component of multiple fibroblast growth factor responses during early mouse development. Molecular and cellular biology, 25 , 4105–16. doi:10.1128/MCB.25.10.4105-4116.2005. Grabarek, J. B., Zyzyńska, K., Saiz, N., Piliszek, A., Frankenberg, S., Nichols, J., Hadjantonakis, A.-K., & Plusa, B. (2012). Differential plasticity of epiblast and primitive endoderm precursors within the ICM of the early mouse embryo. Development (Cambridge, England), 139 , 129–39. doi:10.1242/dev.067702. Graf, T. (2011). Historical origins of transdifferentiation and reprogramming. Cell stem cell, 9 , 504–16. doi:10.1016/j.stem.2011.11.012. Graf, T., & Enver, T. (2009). Forcing cells to change lineages. Nature, 462 , 587–94. doi:10.1038/nature08533. Gu, Z., Nomura, M., Simpson, B. B., Lei, H., Feijen, A., van den Eijnden-van Raaij, J., Donahoe, P. K., & Li, E. (1998). The type I activin receptor ActRIB is required for egg cylinder organization and gastrulation in the mouse. Genes & development, 12 , 844–57. Guo, G., Huss, M., Tong, G. Q., Wang, C., Li Sun, L., Clarke, N. D., & Robson, P. (2010). Resolution of cell fate decisions revealed by single-cell gene expression analysis

185

from zygote to blastocyst. Developmental cell, 18 , 675–85. doi:10.1016/j.devcel. 2010.02.012. Gurdon, J. B., Elsdale, T. R., & Fishberg, M. (1958). Sexually mature individuals of Xenopus laevis from the transplantation of single somatic nuclei. Nature, 182 , 64–5. Guzman-Ayala, M., Ben-Haim, N., Beck, S., & Constam, D. B. (2004). Nodal protein processing and fibroblast growth factor 4 synergize to maintain a trophoblast stem cell microenvironment. Proceedings of the National Academy of Sciences of the United States of America, 101 , 15656–60. doi:10.1073/pnas.0405429101. Hackett, J. A., Sengupta, R., Zylicz, J. J., Murakami, K., Lee, C., Down, T. A., & Surani, M. A. (2013). Germline DNA demethylation dynamics and imprint erasure through 5-hydroxymethylcytosine. Science (New York, N.Y.), 339 , 448–52. doi:10. 1126/science.1229277. Hadari, Y. R., Gotoh, N., Kouhara, H., Lax, I., & Schlessinger, J. (2001). Critical role for the docking-protein FRS2 alpha in FGF receptor-mediated signal transduction pathways. Proceedings of the National Academy of Sciences of the United States of America, 98 , 8578–83. doi:10.1073/pnas.161259898. Hadjantonakis, A. K., Gertsenstein, M., Ikawa, M., Okabe, M., & Nagy, A. (1998). Generating green fluorescent mice by germline transmission of green fluorescent ES cells. Mechanisms of development, 76 , 79–90. Hall, J., Guo, G., Wray, J., Eyres, I., Nichols, J., Grotewold, L., Morfopoulou, S., Humphreys, P., Mansfield, W., Walker, R., Tomlinson, S., & Smith, A. (2009). Oct4 and LIF/Stat3 additively induce Krüppel factors to sustain embryonic stem cell self-renewal. Cell stem cell, 5 , 597–609. doi:10.1016/j.stem.2009.11.003. Hemberger, M., Dean, W., & Reik, W. (2009). Epigenetic dynamics of stem cells and cell lineage commitment: digging Waddington’s canal. Nature reviews. Molecular cell biology, 10 , 526–37. doi:10.1038/nrm2727. Hirate, Y., Hirahara, S., Inoue, K.-i., Suzuki, A., Alarcon, A., Akimoto, K., Hirai, T., Hara, T., Adachi, M., Chida, K., Ohno, S., Marikawa, Y., Nakao, K., Shimono, A., & Sasaki, H. (2013). Polarity-dependent distribution of Angiomotin localizes Hippo signaling in preimplantation embryos. Current Biology, 23 , 1181–1194. doi:10.1016/ j.cub.2013.05.014.

186

Home, P., Ray, S., Dutta, D., Bronshteyn, I., Larson, M., & Paul, S. (2009). GATA3 is selectively expressed in the trophectoderm of peri-implantation embryo and directly regulates Cdx2 gene expression. The Journal of biological chemistry, 284 , 28729–37. doi:10.1074/jbc.M109.016840. Hooper, M., Hardy, K., Handyside, A., Hunter, S., & Monk, M. (1987). HPRT-deficient (Lesch-Nyhan) mouse embryos derived from germline colonization by cultured cells. Nature, 326 , 292–5. doi:10.1038/326292a0. Howell, C. Y., Bestor, T. H., Ding, F., Latham, K. E., Mertineit, C., Trasler, J. M., & Chaillet, J. R. (2001). Genomic imprinting disrupted by a maternal effect mutation in the Dnmt1 gene. Cell, 104 , 829–38. Huang, D. W., Sherman, B. T., & Lempicki, R. A. (2009). Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature protocols, 4 , 44–57. doi:10.1038/nprot.2008.211. Illingworth, R. S., Gruenewald-Schneider, U., Webb, S., Kerr, A. R. W., James, K. D., Turner, D. J., Smith, C., Harrison, D. J., Andrews, R., & Bird, A. P. (2010). Orphan CpG islands identify numerous conserved promoters in the mammalian genome. PLoS genetics, 6 , e1001134. doi:10.1371/journal.pgen.1001134. Jackson, M., Krassowska, A., Gilbert, N., Chevassut, T., Forrester, L., Ansell, J., & Ramsahoye, B. (2004). Severe global DNA hypomethylation blocks differentiation and induces histone hyperacetylation in embryonic stem cells. Molecular and cellular biology, 24 , 8862–71. doi:10.1128/MCB.24.20.8862-8871.2004. Ji, H., Ehrlich, L. I. R., Seita, J., Murakami, P., Doi, A., Lindau, P., Lee, H., Aryee, M. J., Irizarry, R. A., Kim, K., Rossi, D. J., Inlay, M. A., Serwold, T., Karsunky, H., Ho, L., Daley, G. Q., Weissman, I. L., & Feinberg, A. P. (2010). Comprehensive methylome map of lineage commitment from haematopoietic progenitors. Nature, 467 , 338–42. doi:10.1038/nature09367. Johnson, M. H., & McConnell, J. M. L. (2004). Lineage allocation and cell polarity during mouse embryogenesis. Seminars in cell & developmental biology, 15 , 583–97. doi:10.1016/j.semcdb.2004.04.002. Johnson, M. H., & Ziomek, C. A. (1981). The foundation of two distinct cell lineages within the mouse morula. Cell, 24 , 71–80.

187

Jones, P. A. (1985). Altering gene expression with 5-azacytidine. Cell, 40 , 485–6. Jones, P. A., & Taylor, S. M. (1980). Cellular differentiation, cytidine analogs and DNA methylation. Cell, 20 , 85–93. Junttila, M. R., Li, S.-P., & Westermarck, J. (2008). Phosphatase-mediated crosstalk between MAPK signaling pathways in the regulation of cell survival. FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 22 , 954–65. doi:10.1096/fj.06-7859rev. Kaji, K., Caballero, I. M., MacLeod, R., Nichols, J., Wilson, V. A., & Hendrich, B. (2006). The NuRD component Mbd3 is required for pluripotency of embryonic stem cells. Nature cell biology, 8 , 285–92. doi:10.1038/ncb1372. Kanai-Azuma, M., Kanai, Y., Gad, J. M., Tajima, Y., Taya, C., Kurohmaru, M., Sanai, Y., Yonekawa, H., Yazaki, K., Tam, P. P. L., & Hayashi, Y. (2002). Depletion of definitive gut endoderm in Sox17-null mutant mice. Development (Cambridge, England), 129 , 2367–79. Kangaspeska, S., Stride, B., Métivier, R., Polycarpou-Schwarz, M., Ibberson, D., Carmouche, R. P., Benes, V., Gannon, F., & Reid, G. (2008). Transient cyclical methylation of promoter DNA. Nature, 452 , 112–5. doi:10.1038/nature06640. Karimi, M. M., Goyal, P., Maksakova, I. A., Bilenky, M., Leung, D., Tang, J. X., Shinkai, Y., Mager, D. L., Jones, S., Hirst, M., & Lorincz, M. C. (2011). DNA methylation and SETDB1/H3K9me3 regulate predominantly distinct sets of genes, retroelements, and chimeric transcripts in mESCs. Cell stem cell, 8 , 676–87. doi:10.1016/j.stem.2011. 04.004. Karwacki-Neisius, V., Göke, J., Osorno, R., Halbritter, F., Ng, J. H., Weiß e, A. Y., Wong, F. C. K., Gagliardi, A., Mullin, N. P., Festuccia, N., Colby, D., Tomlinson, S. R., Ng, H.-H., & Chambers, I. (2013). Reduced oct4 expression directs a robust pluripotent state with distinct signaling activity and increased enhancer occupancy by oct4 and nanog. Cell stem cell, 12 , 531–45. doi:10.1016/j.stem.2013.04.023. Kidder, B. L., & Palmer, S. (2010). Examination of transcriptional networks reveals an important role for TCFAP2C, SMARCA4, and EOMES in trophoblast stem cell maintenance. Genome research, 20 , 458–72. doi:10.1101/gr.101469.109.

188

Kim, J. B., Sebastiano, V., Wu, G., Araúzo-Bravo, M. J., Sasse, P., Gentile, L., Ko, K., Ruau, D., Ehrich, M., van den Boom, D., Meyer, J., Hübner, K., Bernemann, C., Ortmeier, C., Zenke, M., Fleischmann, B. K., Zaehres, H., & Schöler, H. R. (2009). Oct4-induced pluripotency in adult neural stem cells. Cell, 136 , 411–9. doi:10.1016/j.cell.2009.01.023. Klose, R. J., & Bird, A. P. (2006). Genomic DNA methylation: the mark and its mediators. Trends in biochemical sciences, 31 , 89–97. doi:10.1016/j.tibs.2005.12.008. Kriaucionis, S., & Heintz, N. (2009). The nuclear DNA base 5-hydroxymethylcytosine is present in Purkinje neurons and the brain. Science (New York, N.Y.), 324 , 929–30. doi:10.1126/science.1169786. Krueger, F., Madeja, Z., Hemberger, M., McMahon, M., Cook, S. J., & Gaunt, S. J. (2009). Down-regulation of Cdx2 in colorectal carcinoma cells by the Raf-MEK-ERK 1/2 pathway. Cellular signalling, 21 , 1846–56. doi:10.1016/j.cellsig.2009.07.020. Kuckenberg, P., Buhl, S., Woynecki, T., van Fürden, B., Tolkunova, E., Seiffe, F., Moser, M., Tomilin, A., Winterhager, E., & Schorle, H. (2010). The transcription factor TCFAP2C/AP-2gamma cooperates with CDX2 to maintain trophectoderm formation. Molecular and cellular biology, 30 , 3310–20. doi:10.1128/MCB.01215-09. Kunath, T., Arnaud, D., Uy, G. D., Okamoto, I., Chureau, C., Yamanaka, Y., Heard, E., Gardner, R. L., Avner, P., & Rossant, J. (2005). Imprinted X-inactivation in extra-embryonic endoderm cell lines from mouse blastocysts. Development (Cambridge, England), 132 , 1649–61. doi:10.1242/dev.01715. Kunath, T., Saba-El-Leil, M. K., Almousailleakh, M., Wray, J., Meloche, S., & Smith, A. (2007). FGF stimulation of the Erk1/2 signalling cascade triggers transition of pluripotent embryonic stem cells from self-renewal to lineage commitment. Development (Cambridge, England), 134 , 2895–902. doi:10.1242/dev.02880. Kwon, G. S., Viotti, M., & Hadjantonakis, A.-K. (2008). The endoderm of the mouse embryo arises by dynamic widespread intercalation of embryonic and extraembryonic lineages. Developmental cell, 15 , 509–20. doi:10.1016/j.devcel.2008.07.017. Lane, N., Dean, W., Erhardt, S., Hajkova, P., Surani, A., Walter, J., & Reik, W. (2003). Resistance of IAPs to methylation reprogramming may provide a mechanism for

189

epigenetic inheritance in the mouse. Genesis (New York, N.Y. : 2000), 35 , 88–93. doi:10.1002/gene.10168. Latos, P. A., Helliwell, C., Mosaku, O., Dudzinska, D. A., Stubbs, B., Berdasco, M., Esteller, M., & Hendrich, B. (2012). NuRD-dependent DNA methylation prevents ES cells from accessing a trophectoderm fate. Biology open, 1 , 341–52. doi:10.1242/bio. 2012513. Lei, H., Oh, S. P., Okano, M., Jüttermann, R., Goss, K. A., Jaenisch, R., & Li, E. (1996). De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells. Development (Cambridge, England), 122 , 3195–205. Leitch, H. G., McEwen, K. R., Turp, A., Encheva, V., Carroll, T., Grabole, N., Mansfield, W., Nashun, B., Knezovich, J. G., Smith, A., Surani, M. A., & Hajkova, P. (2013). Naive pluripotency is associated with global DNA hypomethylation. Nature structural & molecular biology, . doi:10.1038/nsmb.2510. Li, E., Bestor, T. H., & Jaenisch, R. (1992). Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell, 69 , 915–26. Li, Z., Fei, T., Zhang, J., Zhu, G., Wang, L., Lu, D., Chi, X., Teng, Y., Hou, N., Yang, X., Zhang, H., Han, J.-D. J., & Chen, Y.-G. (2012). BMP4 Signaling Acts via Dual-Specificity Phosphatase 9 to Control ERK Activity in Mouse Embryonic Stem Cells. Cell Stem Cell, 10 , 171–182. doi:10.1016/j.stem.2011.12.016. Lister, R., Pelizzola, M., Kida, Y. S., Hawkins, R. D., Nery, J. R., Hon, G., AntosiewiczBourget, J., O’Malley, R., Castanon, R., Klugman, S., Downes, M., Yu, R., Stewart, R., Ren, B., Thomson, J. A., Evans, R. M., & Ecker, J. R. (2011). Hotspots of aberrant epigenomic reprogramming in human induced pluripotent stem cells. Nature, 471 , 68–73. doi:10.1038/nature09798. Little, A. S., Smith, P. D., & Cook, S. J. (2012). Mechanisms of acquired resistance to ERK1/2 pathway inhibitors. Oncogene, . doi:10.1038/onc.2012.160. Liu, X., Gao, Q., Li, P., Zhao, Q., Zhang, J., Li, J., Koseki, H., & Wong, J. (2013). UHRF1 targets DNMT1 for DNA methylation through cooperative binding of hemimethylated DNA and methylated H3K9. Nature communications, 4 , 1563. doi:10. 1038/ncomms2562.

190

Lohmann, F., Loureiro, J., Su, H., Fang, Q., Lei, H., Lewis, T., Yang, Y., Labow, M., Li, E., Chen, T., & Kadam, S. (2010). KMT1E mediated H3K9 methylation is required for the maintenance of embryonic stem cells by repressing trophectoderm differentiation. Stem cells (Dayton, Ohio), 28 , 201–12. doi:10.1002/stem.278. Lu, C.-W., Yabuuchi, A., Chen, L., Viswanathan, S., Kim, K., & Daley, G. Q. (2008). Ras-MAPK signaling promotes trophectoderm formation from embryonic stem cells and mouse embryos. Nature genetics, 40 , 921–6. Luo, J., Sladek, R., Bader, J. A., Matthyssen, A., Rossant, J., & Giguère, V. (1997). Placental abnormalities in mouse embryos lacking the orphan nuclear receptor ERRbeta. Nature, 388 , 778–82. doi:10.1038/42022. Ma, G. T., Roth, M. E., Groskopf, J. C., Tsai, F. Y., Orkin, S. H., Grosveld, F., Engel, J. D., & Linzer, D. I. (1997). GATA-2 and GATA-3 regulate trophoblast-specific gene expression in vivo. Development (Cambridge, England), 124 , 907–14. Ma, G. T., Soloveva, V., Tzeng, S. J., Lowe, L. A., Pfendler, K. C., Iannaccone, P. M., Kuehn, M. R., & Linzer, D. I. (2001). Nodal regulates trophoblast differentiation and placental development. Developmental biology, 236 , 124–35. doi:10.1006/dbio.2001. 0334. Macfarlan, T. S., Gifford, W. D., Driscoll, S., Lettieri, K., Rowe, H. M., Bonanomi, D., Firth, A., Singer, O., Trono, D., & Pfaff, S. L. (2012). Embryonic stem cell potency fluctuates with endogenous retrovirus activity. Nature, 487 , 57–63. doi:10.1038/ nature11244. Man, A. K., Young, L. J. T., Tynan, J. A., Lesperance, J., Egeblad, M., Werb, Z., Hauser, C. A., Muller, W. J., Cardiff, R. D., & Oshima, R. G. (2003). Ets2-dependent stromal regulation of mouse mammary tumors. Molecular and cellular biology, 23 , 8614–25. Marks, H., Kalkan, T., Menafra, R., Denissov, S., Jones, K., Hofemeister, H., Nichols, J., Kranz, A., Francis Stewart, A., Smith, A., & Stunnenberg, H. G. (2012). The Transcriptional and Epigenomic Foundations of Ground State Pluripotency. Cell, 149 , 590–604. doi:10.1016/j.cell.2012.03.026. Marson, A., Levine, S. S., Cole, M. F., Frampton, G. M., Brambrink, T., Johnstone, S., Guenther, M. G., Johnston, W. K., Wernig, M., Newman, J., Calabrese, J. M.,

191

Dennis, L. M., Volkert, T. L., Gupta, S., Love, J., Hannett, N., Sharp, P. A., Bartel, D. P., Jaenisch, R., & Young, R. A. (2008). Connecting microRNA genes to the core transcriptional regulatory circuitry of embryonic stem cells. Cell, 134 , 521–33. doi:10.1016/j.cell.2008.07.020. Martello, G., Sugimoto, T., Diamanti, E., Joshi, A., Hannah, R., Ohtsuka, S., Göttgens, B., Niwa, H., & Smith, A. (2012). Esrrb is a pivotal target of the Gsk3/Tcf3 axis regulating embryonic stem cell self-renewal. Cell stem cell, 11 , 491–504. doi:10.1016/ j.stem.2012.06.008. Martin, G. R. (1981). Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proceedings of the National Academy of Sciences of the United States of America, 78 , 7634–8. Masui, S., Nakatake, Y., Toyooka, Y., Shimosato, D., Yagi, R., Takahashi, K., Okochi, H., Okuda, A., Matoba, R., Sharov, A. A., Ko, M. S. H., & Niwa, H. (2007). Pluripotency governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem cells. Nature cell biology, 9 , 625–35. doi:10.1038/ncb1589. Matsui, T., Leung, D., Miyashita, H., Maksakova, I. A., Miyachi, H., Kimura, H., Tachibana, M., Lorincz, M. C., & Shinkai, Y. (2010). Proviral silencing in embryonic stem cells requires the histone methyltransferase ESET. Nature, 464 , 927–31. doi:10. 1038/nature08858. Mayer, W., Niveleau, A., Walter, J., Fundele, R., & Haaf, T. (2000). Demethylation of the zygotic paternal genome. Nature, 403 , 501–2. doi:10.1038/35000654. McDonel, P., Costello, I., & Hendrich, B. (2009). Keeping things quiet: roles of NuRD and Sin3 co-repressor complexes during mammalian development. The international journal of biochemistry & cell biology, 41 , 108–16. doi:10.1016/j.biocel.2008.07.022. Meissner, A., Mikkelsen, T. S., Gu, H., Wernig, M., Hanna, J., Sivachenko, A., Zhang, X., Bernstein, B. E., Nusbaum, C., Jaffe, D. B., Gnirke, A., Jaenisch, R., & Lander, E. S. (2008). Genome-scale DNA methylation maps of pluripotent and differentiated cells. Nature, 454 , 766–70. doi:10.1038/nature07107. Messerschmidt, D. M., & Kemler, R. (2010). Nanog is required for primitive endoderm formation through a non-cell autonomous mechanism. Developmental biology, 344 , 129–37. doi:10.1016/j.ydbio.2010.04.020.

192

Métivier, R., Gallais, R., Tiffoche, C., Le Péron, C., Jurkowska, R. Z., Carmouche, R. P., Ibberson, D., Barath, P., Demay, F., Reid, G., Benes, V., Jeltsch, A., Gannon, F., & Salbert, G. (2008). Cyclical DNA methylation of a transcriptionally active promoter. Nature, 452 , 45–50. doi:10.1038/nature06544. Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M., Maeda, M., & Yamanaka, S. (2003). The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell, 113 , 631–42. Mohn, F., Weber, M., Rebhan, M., Roloff, T. C., Richter, J., Stadler, M. B., Bibel, M., & Schübeler, D. (2008). Lineage-specific polycomb targets and de novo DNA methylation define restriction and potential of neuronal progenitors. Molecular cell, 30 , 755–66. doi:10.1016/j.molcel.2008.05.007. Morgan, H. D., Santos, F., Green, K., Dean, W., & Reik, W. (2005). Epigenetic reprogramming in mammals. Human molecular genetics, 14 Spec No, R47–58. doi:10. 1093/hmg/ddi114. Morgani, S. M., Canham, M. A., Nichols, J., Sharov, A. A., Migueles, R. P., Ko, M. S. H., & Brickman, J. M. (2013). Totipotent embryonic stem cells arise in ground-state culture conditions. Cell reports, 3 , 1945–57. doi:10.1016/j.celrep.2013.04.034. Morris, S. A., Teo, R. T. Y., Li, H., Robson, P., Glover, D. M., & Zernicka-Goetz, M. (2010). Origin and formation of the first two distinct cell types of the inner cell mass in the mouse embryo. Proceedings of the National Academy of Sciences of the United States of America, 107 , 6364–9. doi:10.1073/pnas.0915063107. Morrisey, E. E., Tang, Z., Sigrist, K., Lu, M. M., Jiang, F., Ip, H. S., & Parmacek, M. S. (1998). GATA6 regulates HNF4 and is required for differentiation of visceral endoderm in the mouse embryo. Genes & development, 12 , 3579–90. Morrison, S. J., & Spradling, A. C. (2008). Stem cells and niches: mechanisms that promote stem cell maintenance throughout life. Cell, 132 , 598–611. doi:10.1016/j. cell.2008.01.038. Mullen, A. C., Orlando, D. A., Newman, J. J., Lovén, J., Kumar, R. M., Bilodeau, S., Reddy, J., Guenther, M. G., DeKoter, R. P., & Young, R. A. (2011). Master transcription factors determine cell-type-specific responses to TGF-β signaling. Cell, 147 , 565–76. doi:10.1016/j.cell.2011.08.050.

193

Nagamatsu, G., Saito, S., Kosaka, T., Takubo, K., Kinoshita, T., Oya, M., Horimoto, K., & Suda, T. (2012). Optimal ratio of transcription factors for somatic cell reprogramming. The Journal of biological chemistry, 287 , 36273–82. doi:10.1074/jbc.M112.380683. Nakagawa, M., Koyanagi, M., Tanabe, K., Takahashi, K., Ichisaka, T., Aoi, T., Okita, K., Mochiduki, Y., Takizawa, N., & Yamanaka, S. (2008). Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nature biotechnology, 26 , 101–6. doi:10.1038/nbt1374. Narita, M., Young, A. R. J., Arakawa, S., Samarajiwa, S. A., Nakashima, T., Yoshida, S., Hong, S., Berry, L. S., Reichelt, S., Ferreira, M., Tavaré, S., Inoki, K., Shimizu, S., & Narita, M. (2011). Spatial coupling of mTOR and autophagy augments secretory phenotypes. Science (New York, N.Y.), 332 , 966–70. doi:10.1126/science.1205407. Ng, R. K., Dean, W., Dawson, C., Lucifero, D., Madeja, Z., Reik, W., & Hemberger, M. (2008). Epigenetic restriction of embryonic cell lineage fate by methylation of Elf5. Nature cell biology, 10 , 1280–90. doi:10.1038/ncb1786. Niakan, K. K., Ji, H., Maehr, R., Vokes, S. A., Rodolfa, K. T., Sherwood, R. I., Yamaki, M., Dimos, J. T., Chen, A. E., Melton, D. A., McMahon, A. P., & Eggan, K. (2010). Sox17 promotes differentiation in mouse embryonic stem cells by directly regulating extraembryonic gene expression and indirectly antagonizing self-renewal. Genes & development, 24 , 312–26. doi:10.1101/gad.1833510. Nichols, J., Silva, J., Roode, M., & Smith, A. (2009). Suppression of Erk signalling promotes ground state pluripotency in the mouse embryo. Development (Cambridge, England), 136 , 3215–22. doi:10.1242/dev.038893. Nichols, J., & Smith, A. (2012). Pluripotency in the embryo and in culture. Cold Spring Harbor perspectives in biology, 4 , a008128. doi:10.1101/cshperspect.a008128. Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers, I., Schöler, H., & Smith, A. (1998). Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell, 95 , 379–91. Nishioka, N., Inoue, K.-i., Adachi, K., Kiyonari, H., Ota, M., Ralston, A., Yabuta, N., Hirahara, S., Stephenson, R. O., Ogonuki, N., Makita, R., Kurihara, H., MorinKensicki, E. M., Nojima, H., Rossant, J., Nakao, K., Niwa, H., & Sasaki, H. (2009).

194

The Hippo signaling pathway components Lats and Yap pattern Tead4 activity to distinguish mouse trophectoderm from inner cell mass. Developmental cell, 16 , 398–410. doi:10.1016/j.devcel.2009.02.003. Nishioka, N., Yamamoto, S., Kiyonari, H., Sato, H., Sawada, A., Ota, M., Nakao, K., & Sasaki, H. (2008). Tead4 is required for specification of trophectoderm in preimplantation mouse embryos. Mechanisms of development, 125 , 270–83. doi:10.1016/ j.mod.2007.11.002. Nishiyama, A., Xin, L., Sharov, A. A., Thomas, M., Mowrer, G., Meyers, E., Piao, Y., Mehta, S., Yee, S., Nakatake, Y., Stagg, C., Sharova, L., Correa-Cerro, L. S., Bassey, U., Hoang, H., Kim, E., Tapnio, R., Qian, Y., Dudekula, D., Zalzman, M., Li, M., Falco, G., Yang, H.-T., Lee, S.-L., Monti, M., Stanghellini, I., Islam, M. N., Nagaraja, R., Goldberg, I., Wang, W., Longo, D. L., Schlessinger, D., & Ko, M. S. H. (2009). Uncovering early response of gene regulatory networks in ESCs by systematic induction of transcription factors. Cell stem cell, 5 , 420–33. doi:10.1016/j.stem.2009.07.012. Niwa, H., Burdon, T., Chambers, I., & Smith, A. (1998). Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes & development, 12 , 2048–60. Niwa, H., Miyazaki, J., & Smith, A. G. (2000). Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nature genetics, 24 , 372–6. doi:10.1038/74199. Niwa, H., Toyooka, Y., Shimosato, D., Strumpf, D., Takahashi, K., Yagi, R., & Rossant, J. (2005). Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell, 123 , 917–29. doi:10.1016/j.cell.2005.08.040. Ogawa, K., Nishinakamura, R., Iwamatsu, Y., Shimosato, D., & Niwa, H. (2006). Synergistic action of Wnt and LIF in maintaining pluripotency of mouse ES cells. Biochemical and biophysical research communications, 343 , 159–66. doi:10.1016/j. bbrc.2006.02.127. Ohi, Y., Qin, H., Hong, C., Blouin, L., Polo, J. M., Guo, T., Qi, Z., Downey, S. L., Manos, P. D., Rossi, D. J., Yu, J., Hebrok, M., Hochedlinger, K., Costello, J. F., Song, J. S., & Ramalho-Santos, M. (2011). Incomplete DNA methylation underlies a

195

transcriptional memory of somatic cells in human iPS cells. Nature cell biology, 13 , 541–9. doi:10.1038/ncb2239. Okano, M., Bell, D. W., Haber, D. A., & Li, E. (1999). DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell, 99 , 247–57. Ooi, S. K. T., Qiu, C., Bernstein, E., Li, K., Jia, D., Yang, Z., Erdjument-Bromage, H., Tempst, P., Lin, S.-P., Allis, C. D., Cheng, X., & Bestor, T. H. (2007). DNMT3L connects unmethylated lysine 4 of histone H3 to de novo methylation of DNA. Nature, 448 , 714–7. doi:10.1038/nature05987. Oshimori, N., & Fuchs, E. (2012). The harmonies played by TGF-β in stem cell biology. Cell stem cell, 11 , 751–64. doi:10.1016/j.stem.2012.11.001. Oswald, J., Engemann, S., Lane, N., Mayer, W., Olek, A., Fundele, R., Dean, W., Reik, W., & Walter, J. (2000). Active demethylation of the paternal genome in the mouse zygote. Current biology : CB, 10 , 475–8. Pandolfi, P. P., Roth, M. E., Karis, A., Leonard, M. W., Dzierzak, E., Grosveld, F. G., Engel, J. D., & Lindenbaum, M. H. (1995). Targeted disruption of the GATA3 gene causes severe abnormalities in the nervous system and in fetal liver haematopoiesis. Nature genetics, 11 , 40–4. doi:10.1038/ng0995-40. Papp, B., & Plath, K. (2013). Epigenetics of reprogramming to induced pluripotency. Cell, 152 , 1324–43. doi:10.1016/j.cell.2013.02.043. Pardo, M., Lang, B., Yu, L., Prosser, H., Bradley, A., Babu, M. M., & Choudhary, J. (2010). An expanded Oct4 interaction network: implications for stem cell biology, development, and disease. Cell stem cell, 6 , 382–95. doi:10.1016/j.stem.2010.03. 004. Pearton, D. J., Broadhurst, R., Donnison, M., & Pfeffer, P. L. (2011). Elf5 regulation in the trophectoderm. Developmental biology, 360 , 343–50. doi:10.1016/j.ydbio.2011. 10.007. Pedersen, R. A., Wu, K., & Bałakier, H. (1986). Origin of the inner cell mass in mouse embryos: cell lineage analysis by microinjection. Developmental biology, 117 , 581–95.

196

Perini, G., Diolaiti, D., Porro, A., & Della Valle, G. (2005). In vivo transcriptional regulation of N-Myc target genes is controlled by E-box methylation. Proceedings of the National Academy of Sciences of the United States of America, 102 , 12117–22. doi:10.1073/pnas.0409097102. Piotrowska-Nitsche, K., Perea-Gomez, A., Haraguchi, S., & Zernicka-Goetz, M. (2005). Four-cell stage mouse blastomeres have different developmental properties. Development (Cambridge, England), 132 , 479–90. doi:10.1242/dev.01602. Plusa, B., Piliszek, A., Frankenberg, S., Artus, J., & Hadjantonakis, A.-K. (2008). Distinct sequential cell behaviours direct primitive endoderm formation in the mouse blastocyst. Development (Cambridge, England), 135 , 3081–91. doi:10.1242/dev.021519. Polo, J. M., Anderssen, E., Walsh, R. M., Schwarz, B. A., Nefzger, C. M., Lim, S. M., Borkent, M., Apostolou, E., Alaei, S., Cloutier, J., Bar-Nur, O., Cheloufi, S., Stadtfeld, M., Figueroa, M. E., Robinton, D., Natesan, S., Melnick, A., Zhu, J., Ramaswamy, S., & Hochedlinger, K. (2012). A molecular roadmap of reprogramming somatic cells into iPS cells. Cell, 151 , 1617–32. doi:10.1016/j.cell.2012.11.039. Popp, C., Dean, W., Feng, S., Cokus, S. J., Andrews, S., Pellegrini, M., Jacobsen, S. E., & Reik, W. (2010). Genome-wide erasure of DNA methylation in mouse primordial germ cells is affected by AID deficiency. Nature, 463 , 1101–5. doi:10.1038/nature08829. Radzisheuskaya, A., Le Bin Chia, G., Dos Santos, R. L., Theunissen, T. W., Castro, L. F. C., Nichols, J., & Silva, J. C. R. (2013). A defined Oct4 level governs cell state transitions of pluripotency entry and differentiation into all embryonic lineages. Nature cell biology, . doi:10.1038/ncb2742. Ralston, A., Cox, B. J., Nishioka, N., Sasaki, H., Chea, E., Rugg-Gunn, P., Guo, G., Robson, P., Draper, J. S., & Rossant, J. (2010). Gata3 regulates trophoblast development downstream of Tead4 and in parallel to Cdx2. Development (Cambridge, England), 137 , 395–403. doi:10.1242/dev.038828. Ralston, A., & Rossant, J. (2006). How signaling promotes stem cell survival: trophoblast stem cells and Shp2. Developmental cell, 10 , 275–6. doi:10.1016/j.devcel.2006.02. 007.

197

Ralston, A., & Rossant, J. (2008). Cdx2 acts downstream of cell polarization to cellautonomously promote trophectoderm fate in the early mouse embryo. Developmental biology, 313 , 614–29. doi:10.1016/j.ydbio.2007.10.054. Rawn, S. M., & Cross, J. C. (2008). The evolution, regulation, and function of placentaspecific genes. Annual review of cell and developmental biology, 24 , 159–81. doi:10. 1146/annurev.cellbio.24.110707.175418. Roper, S., & Hemberger, M. (2009). Defining pathways that enforce cell lineage specification in early development and stem cells. Cell cycle (Georgetown, Tex.), 8 , 1515–25. Rossant, J. (2008). Stem cells and early lineage development. Cell, 132 , 527–31. doi:10.1016/j.cell.2008.01.039. Rowe, H. M., Jakobsson, J., Mesnard, D., Rougemont, J., Reynard, S., Aktas, T., Maillard, P. V., Layard-Liesching, H., Verp, S., Marquis, J., Spitz, F., Constam, D. B., & Trono, D. (2010). KAP1 controls endogenous retroviruses in embryonic stem cells. Nature, 463 , 237–40. doi:10.1038/nature08674. Rugg-Gunn, P. J., Cox, B. J., Lanner, F., Sharma, P., Ignatchenko, V., McDonald, A. C., Garner, J., Gramolini, A. O., Rossant, J., & Kislinger, T. (2012). CellSurface Proteomics Identifies Lineage-Specific Markers of Embryo-Derived Stem Cells. Developmental Cell, 22 , 887–901. doi:10.1016/j.devcel.2012.01.005. Rugg-Gunn, P. J., Cox, B. J., Ralston, A., & Rossant, J. (2010). Distinct histone modifications in stem cell lines and tissue lineages from the early mouse embryo. Proceedings of the National Academy of Sciences of the United States of America, 107 , 10783–90. doi:10.1073/pnas.0914507107. Russ, A. P., Wattler, S., Colledge, W. H., Aparicio, S. A., Carlton, M. B., Pearce, J. J., Barton, S. C., Surani, M. A., Ryan, K., Nehls, M. C., Wilson, V., & Evans, M. J. (2000). Eomesodermin is required for mouse trophoblast development and mesoderm formation. Nature, 404 , 95–9. doi:10.1038/35003601. Saba-El-Leil, M. K., Vella, F. D. J., Vernay, B., Voisin, L., Chen, L., Labrecque, N., Ang, S.-L., & Meloche, S. (2003). An essential function of the mitogen-activated protein kinase Erk2 in mouse trophoblast development. EMBO reports, 4 , 964–8. doi:10.1038/sj.embor.embor939.

198

Saitou, M., Kagiwada, S., & Kurimoto, K. (2012). Epigenetic reprogramming in mouse pre-implantation development and primordial germ cells. Development (Cambridge, England), 139 , 15–31. doi:10.1242/dev.050849. Sakaue, M., Ohta, H., Kumaki, Y., Oda, M., Sakaide, Y., Matsuoka, C., Yamagiwa, A., Niwa, H., Wakayama, T., & Okano, M. (2010). DNA methylation is dispensable for the growth and survival of the extraembryonic lineages. Current biology : CB, 20 , 1452–7. doi:10.1016/j.cub.2010.06.050. Samavarchi-Tehrani, P., Golipour, A., David, L., Sung, H.-K., Beyer, T. A., Datti, A., Woltjen, K., Nagy, A., & Wrana, J. L. (2010). Functional genomics reveals a BMP-driven mesenchymal-to-epithelial transition in the initiation of somatic cell reprogramming. Cell stem cell, 7 , 64–77. doi:10.1016/j.stem.2010.04.015. Samuels, M. L., Weber, M. J., Bishop, J. M., & McMahon, M. (1993). Conditional transformation of cells and rapid activation of the mitogen-activated protein kinase cascade by an estradiol-dependent human raf-1 protein kinase. Molecular and cellular biology, 13 , 6241–52. Santos, F., Hendrich, B., Reik, W., & Dean, W. (2002). Dynamic reprogramming of DNA methylation in the early mouse embryo. Developmental biology, 241 , 172–82. doi:10.1006/dbio.2001.0501. Sato, N., Meijer, L., Skaltsounis, L., Greengard, P., & Brivanlou, A. H. (2004). Maintenance of pluripotency in human and mouse embryonic stem cells through activation of Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nature medicine, 10 , 55–63. doi:10.1038/nm979. Schier, A. F. (2003). Nodal signaling in vertebrate development. Annual review of cell and developmental biology, 19 , 589–621. doi:10.1146/annurev.cellbio.19.041603. 094522. Schubeler, D. (2012). Epigenetic Islands in a Genetic Ocean. Science, 338 , 756–757. doi:10.1126/science.1227243. Seisenberger, S., Andrews, S., Krueger, F., Arand, J., Walter, J., Santos, F., Popp, C., Thienpont, B., Dean, W., & Reik, W. (2012). The dynamics of genome-wide DNA methylation reprogramming in mouse primordial germ cells. Molecular cell, 48 , 849–62. doi:10.1016/j.molcel.2012.11.001.

199

Senner, C. E., & Hemberger, M. (2010). Regulation of early trophoblast differentiation lessons from the mouse. Placenta, 31 , 944–50. doi:10.1016/j.placenta.2010.07.013. Senner, C. E., Krueger, F., Oxley, D., Andrews, S., & Hemberger, M. (2012). DNA Methylation Profiles Define Stem Cell Identity and Reveal a Tight Embryonic-Extraembryonic Lineage Boundary. Stem cells (Dayton, Ohio), . doi:10.1002/stem.1249. Sequenom (2011). MassArray EpiTyper guide, version 1.0 . Technical Report Sequenom URL: www.sequenom.com. Sharif, J., Muto, M., Takebayashi, S.-i., Suetake, I., Iwamatsu, A., Endo, T. A., Shinga, J., Mizutani-Koseki, Y., Toyoda, T., Okamura, K., Tajima, S., Mitsuya, K., Okano, M., & Koseki, H. (2007). The SRA protein Np95 mediates epigenetic inheritance by recruiting Dnmt1 to methylated DNA. Nature, 450 , 908–12. doi:10.1038/nature06397. Shimokawa, K., Kimura-Yoshida, C., Nagai, N., Mukai, K., Matsubara, K., Watanabe, H., Matsuda, Y., Mochida, K., & Matsuo, I. (2011). Cell surface heparan sulfate chains regulate local reception of FGF signaling in the mouse embryo. Developmental cell, 21 , 257–72. doi:10.1016/j.devcel.2011.06.027. Silva, J., Nichols, J., Theunissen, T. W., Guo, G., van Oosten, A. L., Barrandon, O., Wray, J., Yamanaka, S., Chambers, I., & Smith, A. (2009). Nanog is the gateway to the pluripotent ground state. Cell, 138 , 722–37. doi:10.1016/j.cell.2009.07.039. Simmons, D. G., & Cross, J. C. (2005). Determinants of trophoblast lineage and cell subtype specification in the mouse placenta. Developmental biology, 284 , 12–24. doi:10.1016/j.ydbio.2005.05.010. Singh, A. M., Hamazaki, T., Hankowski, K. E., & Terada, N. (2007). A heterogeneous expression pattern for Nanog in embryonic stem cells. Stem cells (Dayton, Ohio), 25 , 2534–42. doi:10.1634/stemcells.2007-0126. Skene, P. J., Illingworth, R. S., Webb, S., Kerr, A. R. W., James, K. D., Turner, D. J., Andrews, R., & Bird, A. P. (2010). Neuronal MeCP2 is expressed at near histoneoctamer levels and globally alters the chromatin state. Molecular cell, 37 , 457–68. doi:10.1016/j.molcel.2010.01.030. Slack, J. M. W. (2007). Metaplasia and transdifferentiation: from pure biology to the clinic. Nature reviews. Molecular cell biology, 8 , 369–78. doi:10.1038/nrm2146.

200

Smallwood, S. A., Tomizawa, S.-I., Krueger, F., Ruf, N., Carli, N., Segonds-Pichon, A., Sato, S., Hata, K., Andrews, S. R., & Kelsey, G. (2011). Dynamic CpG island methylation landscape in oocytes and preimplantation embryos. Nature genetics, 43 , 811–4. doi:10.1038/ng.864. Smith, A. G., Heath, J. K., Donaldson, D. D., Wong, G. G., Moreau, J., Stahl, M., & Rogers, D. (1988). Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature, 336 , 688–90. doi:10.1038/336688a0. Smith, Z. D., Chan, M. M., Mikkelsen, T. S., Gu, H., Gnirke, A., Regev, A., & Meissner, A. (2012). A unique regulatory phase of DNA methylation in the early mammalian embryo. Nature, 484 , 339–44. doi:10.1038/nature10960. Soldani, C., & Scovassi, A. I. (2002). Poly(ADP-ribose) polymerase-1 cleavage during apoptosis: an update. Apoptosis : an international journal on programmed cell death, 7 , 321–8. Song, J., Oh, S. P., Schrewe, H., Nomura, M., Lei, H., Okano, M., Gridley, T., & Li, E. (1999). The type II activin receptors are essential for egg cylinder growth, gastrulation, and rostral head development in mice. Developmental biology, 213 , 157–69. doi:10.1006/dbio.1999.9370. Soudais, C., Bielinska, M., Heikinheimo, M., MacArthur, C. A., Narita, N., Saffitz, J. E., Simon, M. C., Leiden, J. M., & Wilson, D. B. (1995). Targeted mutagenesis of the transcription factor GATA-4 gene in mouse embryonic stem cells disrupts visceral endoderm differentiation in vitro. Development (Cambridge, England), 121 , 3877–88. Stadtfeld, M., Apostolou, E., Akutsu, H., Fukuda, A., Follett, P., Natesan, S., Kono, T., Shioda, T., & Hochedlinger, K. (2010). Aberrant silencing of imprinted genes on chromosome 12qF1 in mouse induced pluripotent stem cells. Nature, 465 , 175–81. doi:10.1038/nature09017. Stadtfeld, M., Maherali, N., Breault, D. T., & Hochedlinger, K. (2008). Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse. Cell stem cell, 2 , 230–40. doi:10.1016/j.stem.2008.02.001. Stavridis, M. P., Lunn, J. S., Collins, B. J., & Storey, K. G. (2007). A discrete period of FGF-induced Erk1/2 signalling is required for vertebrate neural specification. Development (Cambridge, England), 134 , 2889–94. doi:10.1242/dev.02858.

201

Strumpf, D., Mao, C.-A., Yamanaka, Y., Ralston, A., Chawengsaksophak, K., Beck, F., & Rossant, J. (2005). Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development (Cambridge, England), 132 , 2093–102. doi:10.1242/dev.01801. Surani, M. A., Hayashi, K., & Hajkova, P. (2007). Genetic and epigenetic regulators of pluripotency. Cell, 128 , 747–62. doi:10.1016/j.cell.2007.02.010. Suzuki, M. M., & Bird, A. (2008). DNA methylation landscapes: provocative insights from epigenomics. Nature reviews. Genetics, 9 , 465–76. doi:10.1038/nrg2341. Tahiliani, M., Koh, K. P., Shen, Y., Pastor, W. A., Bandukwala, H., Brudno, Y., Agarwal, S., Iyer, L. M., Liu, D. R., Aravind, L., & Rao, A. (2009). Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1. Science (New York, N.Y.), 324 , 930–5. doi:10.1126/science.1170116. Takahashi, K., & Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 126 , 663–76. doi:10. 1016/j.cell.2006.07.024. Takeda, K., Noguchi, K., Shi, W., Tanaka, T., Matsumoto, M., Yoshida, N., Kishimoto, T., & Akira, S. (1997). Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality. Proceedings of the National Academy of Sciences of the United States of America, 94 , 3801–4. Tanaka, S., Kunath, T., Hadjantonakis, A. K., Nagy, A., & Rossant, J. (1998). Promotion of trophoblast stem cell proliferation by FGF4. Science (New York, N.Y.), 282 , 2072–5. Tesar, P. J., Chenoweth, J. G., Brook, F. A., Davies, T. J., Evans, E. P., Mack, D. L., Gardner, R. L., & McKay, R. D. G. (2007). New cell lines from mouse epiblast share defining features with human embryonic stem cells. Nature, 448 , 196–9. doi:10.1038/nature05972. Tiemann, U., Sgodda, M., Warlich, E., Ballmaier, M., Schöler, H. R., Schambach, A., & Cantz, T. (2011). Optimal reprogramming factor stoichiometry increases colony numbers and affects molecular characteristics of murine induced pluripotent stem cells. Cytometry. Part A : the journal of the International Society for Analytical Cytology, 79 , 426–35. doi:10.1002/cyto.a.21072.

202

Ullah, Z., Kohn, M. J., Yagi, R., Vassilev, L. T., & DePamphilis, M. L. (2008). Differentiation of trophoblast stem cells into giant cells is triggered by p57/Kip2 inhibition of CDK1 activity. Genes & development, 22 , 3024–36. doi:10.1101/gad.1718108. Uy, G. D., Downs, K. M., & Gardner, R. L. (2002). Inhibition of trophoblast stem cell potential in chorionic ectoderm coincides with occlusion of the ectoplacental cavity in the mouse. Development (Cambridge, England), 129 , 3913–24. Veazey, K. J., & Golding, M. C. (2011). Selection of stable reference genes for quantitative rt-PCR comparisons of mouse embryonic and extra-embryonic stem cells. PloS one, 6 , e27592. doi:10.1371/journal.pone.0027592. Voigt, P., Tee, W.-W., & Reinberg, D. (2013). A double take on bivalent promoters. Genes & development, 27 , 1318–38. doi:10.1101/gad.219626.113. Waddington, C. (1957). The strategy of the genes a discussion of some aspects of theoretical biology.. London: Allen & Unwin. Wagers, A. J., & Weissman, I. L. (2004). Plasticity of adult stem cells. Cell, 116 , 639–48. Walsh, C. P., Chaillet, J. R., & Bestor, T. H. (1998). Transcription of IAP endogenous retroviruses is constrained by cytosine methylation. Nature genetics, 20 , 116–7. doi:10.1038/2413. Watanabe, A., Yamada, Y., & Yamanaka, S. (2013). Epigenetic regulation in pluripotent stem cells: a key to breaking the epigenetic barrier. Philosophical transactions of the Royal Society of London. Series B, Biological sciences, 368 , 20120292. doi:10.1098/ rstb.2012.0292. Weber, M., Davies, J. J., Wittig, D., Oakeley, E. J., Haase, M., Lam, W. L., & Schübeler, D. (2005). Chromosome-wide and promoter-specific analyses identify sites of differential DNA methylation in normal and transformed human cells. Nature genetics, 37 , 853–62. doi:10.1038/ng1598. Wen, F., Tynan, J. A., Cecena, G., Williams, R., Múnera, J., Mavrothalassitis, G., & Oshima, R. G. (2007). Ets2 is required for trophoblast stem cell self-renewal. Developmental biology, 312 , 284–99. doi:10.1016/j.ydbio.2007.09.024. White, J., & Dalton, S. (2005). Cell cycle control of embryonic stem cells. Stem cell reviews, 1 , 131–8. doi:10.1385/SCR:1:2:131.

203

Whyte, W. A., Bilodeau, S., Orlando, D. A., Hoke, H. A., Frampton, G. M., Foster, C. T., Cowley, S. M., & Young, R. A. (2012). Enhancer decommissioning by LSD1 during embryonic stem cell differentiation. Nature, 482 , 221–5. doi:10.1038/nature10805. Williams, R. L., Hilton, D. J., Pease, S., Willson, T. A., Stewart, C. L., Gearing, D. P., Wagner, E. F., Metcalf, D., Nicola, N. A., & Gough, N. M. (1988). Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells. Nature, 336 , 684–7. doi:10.1038/336684a0. Wossidlo, M., Nakamura, T., Lepikhov, K., Marques, C. J., Zakhartchenko, V., Boiani, M., Arand, J., Nakano, T., Reik, W., & Walter, J. (2011). 5-Hydroxymethylcytosine in the mammalian zygote is linked with epigenetic reprogramming. Nature communications, 2 , 241. doi:10.1038/ncomms1240. Wray, J., Kalkan, T., Gomez-Lopez, S., Eckardt, D., Cook, A., Kemler, R., & Smith, A. (2011). Inhibition of glycogen synthase kinase-3 alleviates Tcf3 repression of the pluripotency network and increases embryonic stem cell resistance to differentiation. Nature cell biology, 13 , 838–45. doi:10.1038/ncb2267. Wutz, A. (2011). Gene silencing in X-chromosome inactivation: advances in understanding facultative heterochromatin formation. Nature reviews. Genetics, 12 , 542–53. doi:10. 1038/nrg3035. Yagi, R., Kohn, M. J., Karavanova, I., Kaneko, K. J., Vullhorst, D., DePamphilis, M. L., & Buonanno, A. (2007). Transcription factor TEAD4 specifies the trophectoderm lineage at the beginning of mammalian development. Development (Cambridge, England), 134 , 3827–36. doi:10.1242/dev.010223. Yamaji, M., Ueda, J., Hayashi, K., Ohta, H., Yabuta, Y., Kurimoto, K., Nakato, R., Yamada, Y., Shirahige, K., & Saitou, M. (2013). PRDM14 ensures naive pluripotency through dual regulation of signaling and epigenetic pathways in mouse embryonic stem cells. Cell stem cell, 12 , 368–82. doi:10.1016/j.stem.2012.12.012. Yamamoto, H., Flannery, M. L., Kupriyanov, S., Pearce, J., McKercher, S. R., Henkel, G. W., Maki, R. A., Werb, Z., & Oshima, R. G. (1998). Defective trophoblast function in mice with a targeted mutation of Ets2. Genes & development, 12 , 1315–26. Yamanaka, S., & Blau, H. M. (2010). Nuclear reprogramming to a pluripotent state by three approaches. Nature, 465 , 704–12. doi:10.1038/nature09229.

204

Yamanaka, Y., Lanner, F., & Rossant, J. (2010). FGF signal-dependent segregation of primitive endoderm and epiblast in the mouse blastocyst. Development (Cambridge, England), 137 , 715–24. doi:10.1242/dev.043471. Yamanaka, Y., Ralston, A., Stephenson, R. O., & Rossant, J. (2006). Cell and molecular regulation of the mouse blastocyst. Developmental dynamics : an official publication of the American Association of Anatomists, 235 , 2301–14. doi:10.1002/dvdy.20844. Yang, W., Klaman, L. D., Chen, B., Araki, T., Harada, H., Thomas, S. M., George, E. L., & Neel, B. G. (2006). An Shp2/SFK/Ras/Erk signaling pathway controls trophoblast stem cell survival. Developmental cell, 10 , 317–27. doi:10.1016/j.devcel.2006.01. 002. Yeap, L.-S., Hayashi, K., & Surani, M. A. (2009). ERG-associated protein with SET domain (ESET)-Oct4 interaction regulates pluripotency and represses the trophectoderm lineage. Epigenetics & chromatin, 2 , 12. doi:10.1186/1756-8935-2-12. Yildirim, O., Li, R., Hung, J.-H., Chen, P. B., Dong, X., Ee, L.-S., Weng, Z., Rando, O. J., & Fazzio, T. G. (2011). Mbd3/NURD complex regulates expression of 5hydroxymethylcytosine marked genes in embryonic stem cells. Cell, 147 , 1498–510. doi:10.1016/j.cell.2011.11.054. Ying, Q. L., Nichols, J., Chambers, I., & Smith, A. (2003). BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell, 115 , 281–92. Ying, Q.-L., Wray, J., Nichols, J., Batlle-Morera, L., Doble, B., Woodgett, J., Cohen, P., & Smith, A. (2008). The ground state of embryonic stem cell self-renewal. Nature, 453 , 519–23. doi:10.1038/nature06968. Young, R. A. (2011). Control of the embryonic stem cell state. Cell, 144 , 940–54. doi:10.1016/j.cell.2011.01.032. Yuan, P., Han, J., Guo, G., Orlov, Y. L., Huss, M., Loh, Y.-H., Yaw, L.-P., Robson, P., Lim, B., & Ng, H.-H. (2009). Eset partners with Oct4 to restrict extraembryonic trophoblast lineage potential in embryonic stem cells. Genes & development, 23 , 2507–20. doi:10.1101/gad.1831909.

205

Zambrowicz, B. P., Imamoto, A., Fiering, S., Herzenberg, L. A., Kerr, W. G., & Soriano, P. (1997). Disruption of overlapping transcripts in the ROSA beta geo 26 gene trap strain leads to widespread expression of beta-galactosidase in mouse embryos and hematopoietic cells. Proceedings of the National Academy of Sciences of the United States of America, 94 , 3789–94. Zhou, Q., & Melton, D. A. (2008). Extreme makeover: converting one cell into another. Cell stem cell, 3 , 382–8. doi:10.1016/j.stem.2008.09.015. Zwaka, T. P. (2010). Stem cells: Troublesome memories. Nature, 467 , 280–1. doi:10. 1038/467280a.

Grazie Most of the words that you read in this dissertation don’t come from me. Indeed, they are a gift received. From Myriam, who taught me how to become a researcher with her words and her daily activities, splitted between reading papers and doing experiments, discussing results and writing manuscripts, busy hours in the laboratory and quiet tea breaks. From Claire, who donated me serious advices and warm encouragements. From Anne, Wolf, Wendy, Fatima and Peter, because when I think of a scientist, I don’t think to the people of whom I read in the books or seen on TV, I think of them (and Myriam). From Steve, Alex, Paulina, Dominika with whom I shared lab benches and meetings and many tables in the forum, at the canteen and nearby pubs. From Maya, Stefano and Eleonora who visited our lab. With them and others colleagues – and in particular Steffi, Andrew, Arnold, Cristina, Harry, Carmen, Sara, Steve and Jiahao – I also shared office desks and additional words and biscuits and espressos and teas. From Lauren, for her "Good Morning!" every morning. From the PhD colleagues of my year – and in particular from Alice, Alison, Anne, Asmita, Dingxin, Heather, Hema, Harris, Luke – because we walked through these years together. From Emilia, with her quiet strength in conducting her research project while helping everyone else; and – with Nondas – for letting me discover the live heritage of Bulgarian and Greek culture. From Natasha, because she has always been there with her listening and chatting, her messages and gorgeous cakes. From Amy, for the light of the Scottish skies and of her faith. And for sharing the reading of the Bible with Andrew, Heather, Gina and Martin. From the Italian friends of every year and every place – and in particular Annamaria, Silvia, Maria, Gabriele, Sara, Sergio, Anna, Sandra, Rima, Giorgio, Luisa, Giuliana, Edoardo, Silvia, Mario, Ester, Elena, Bianca e Pierluigi – who provided so many rays of sun for my days. From the BI Football Club, wonderfully managed by El Presidente Stefan.

From my friend Nicola, for many discussions about everything and bike rides, pub meals and choral evensongs. From Biao, who shared with me bus journeys and hours spent in making Chinese dumplings. From Rita and Dominik, who taught me how to do experiments and many more things. From my 5Alive friends, for their music, their voices and our Sundays. From the church of OLEM: for the priests who broke the Word and the Bread for my life; and all the community with whom this Word, this Bread, this life I shared. From Rosa, for there has always been a place for me in her house and always a walk to walk together; from Francesca, my flying friend, like a Quentin Blake’s drawing. From Cambridge, Babraham, Shelford, Ely, the Norfolk coast and London with their people, their walls, their roads, their paths, their rivers and canals and brigdges, their grass and flowers, their trees, their fields, their squirrels and cows and all other creatures. From Irene and Andrea, Marco and Paolo, Andrea C. and Alessandro who visited me, as a sign of a friendship stronger of the time and of the space which separate us. From my father Salvatore and my mother Aldina, from my sisters Emanuela (with Gianluca), Valentina (with Maurizio, Domenico and Caterina) and Mariagrazia, from my brother Carlo, because it is from our family that my life and research journey begun; even though I am far away, we come closer with just a thought. From all the Brothers and Sisters of the Bose community – and in particular from Enzo, Luciano, Vincenzo, Lino and Antonella – because it is thanks to them that I am here, writing these last few lines. Therefore, if you wish to remember only a single word of this dissertation, just remember this: grazie!

.

The research project described in this dissertation was presented at the Epigenetic Memory workshop – held at Wiston House (Steyning, UK), 24-27 June 2012 – organized by The Company of Biologists and Sir John Gurdon, who was awarded – about three months later, together with Prof. Shinya Yamanaka – the Nobel Prize in Physiology or Medicine 2012 “for the discovery that mature cells can be reprogrammed to become pluripotent”. A meeting report was published [Fisher & Brockdorff, 2012]