APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Apr. 2005, p. 2158–2161 0099-2240/05/$08.00⫹0 doi:10.1128/AEM.71.4.2158–2161.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Vol. 71, No. 4
Detection of Salmonella Strains and Escherichia coli O157:H7 in Feces of Small Ruminants and Their Isolation with Various Media† Steven Pao,* Dhartika Patel, Aref Kalantari, Joseph P. Tritschler, Stephan Wildeus, and Brian L. Sayre Agricultural Research Station, Virginia State University, Petersburg, Virginia Received 11 July 2004/Accepted 9 November 2004
Salmonella strains and Escherichia coli O157:H7 were detected in 17 and 5 small ruminants in Virginia, respectively, of 287 tested. Background microflora interfered with the fecal analysis. The combination of Salmonella enzyme immunoassay (EIA) detection and xylose-lysine-deoxycholate agar isolation was satisfactory. Modifying enrichment to a 1:100 dilution enabled effective E. coli O157:H7 detection by EIA and isolation by sorbitol-MacConkey agar with cefixime-tellurite. Sample collection. For the microbiological survey, feces were collected from grazing sheep and goats. The animals (with ages ranging from young to mature) were predominately meat breeds raised under forage-based systems with limited concentrate supplementation. For the inoculation study, feces were collected from 20 healthy male sheep at the Virginia State University research farm. The 20 sheep were of breeding age and were provided with high-quality alfalfa hay daily. In all experiments, fecal samples were collected from the rectum with sterile gloves and refrigerated before testing within 24 h. Sample inoculation. Salmonella enterica serovar Typhimurium ATCC 14028, Salmonella enterica serovar Montevideo ATCC 8387, and E. coli O157:H7 strains ATCC 700728 and ATCC 35150 were cultivated on tryptic soy agar (unless otherwise stated, all media were from BioPro, Bothell, Wash.) at 36°C for 24 h. Colonies were diluted in a phosphate buffer to ⬃108 CFU/ml and confirmed by plate counts. Fecal samples from the 20 male sheep were mixed, and 3 g of the mixture was inoculated with 20 l of diluted inocula to achieve estimated inoculation levels of 101 through 106 CFU/g. To evaluate the effect of background microflora, 3 g of each fecal sample was autoclaved and inoculated with E. coli O157:H7 to 101 CFU/g. All control samples tested negative for the target pathogens. Microbial detection. For Salmonella detection, each sample (1 g) was preenriched in 9 ml of buffered peptone water at 36°C for ⬃20 h, followed by enrichment in Rappaport-Vassiliadis broth at 42°C for ⬃18 h and postenrichment in mannose (M) broth at 36°C for ⬃7 h before the Salmonella EIA (Tecra, Frenchs Forest, Australia) was performed. This enrichment protocol was established according to a recently approved AOAC method (method 998.09) for testing raw foods and high microbial load product with the EIA (26, 31). The EIA-positive M broth samples (100 and 10 l) were plated on xyloselysine-deoxycholate (XLD) and xylose-lysine-tergitol 4 (XLT4) media (Difco, Sparks, Md.) for isolation. A minimum of three black (or black-centered) colonies were inoculated into triplesugar–iron and lysine-iron agar slants from each plate and incubated for 24 h at 36°C. Isolates with positive slant reactions were then tested for agglutination with Salmonella O Poly A-I & Vi antiserum (Becton Dickinson and Co., Sparks, Md.). For E. coli O157 detection, each fecal sample (1 g) was enriched in
Direct plating using selective media was found to be successful in detecting and isolating Salmonella strains and Escherichia coli O157:H7 from stools of diseased humans (8, 15, 18). However, an enrichment step was necessary for enhancing the detection and isolation of target pathogens when healthy cattle with possibly low levels of shedding were being evaluated (5, 6, 7, 9, 17, 24). For rapid detection, enzyme immunoassays (EIA) and immunomagnetic separation systems were developed to screen bovine fecal samples before pathogen isolation by plating enriched samples (4, 30). Comments on the methods for detection and isolation of pathogens in animal feces are available (4, 16, 19, 24, 27). Meyer-Broseta et al. (16) stated that previous cattle studies may have missed fecal pathogens and misclassified herds as negative due to the use of limitedsensitivity culture methods. Oberst et al. (19) found that current methods for recovering and identifying E. coli O157:H7 from cattle feces are inconsistent and are hindered by their inability to specifically and rapidly detect small numbers of organisms from the complex and variable matrix. Moreover, Tutenel et al. (27) suggested performing more than one E. coli O157 test on fecal samples to avoid underestimating the incidence of E. coli O157 in cattle. Small ruminants, such as sheep and goats, are potential carriers of Salmonella and E. coli O157:H7 (1, 11, 14, 29). Although a difference between the survivals of E. coli O157:H7 bacteria in ovine and bovine manure was noted (13), specific information on the sensitivities of EIA and common plate assays for detecting and isolating these pathogens in feces of small ruminants is limited. The objectives of this study were to screen for the presence of Salmonella and E. coli O157:H7 in the feces of small ruminants by validated EIA protocols for foods and to evaluate the sensitivities of common selective agars for pathogen isolation (8, 15, 18, 21, 24). (An abstract of this study was presented at the Ninth Biennial Symposium on Minorities, the Medically Underserved & Cancer in Washington, D.C., in March 2004.) * Corresponding author. Mailing address: Virginia State University, Agricultural Research Station, P.O. Box 9061, Petersburg, VA 23806. Phone: (804) 524-6715. Fax: (804) 524-5186. E-mail:
[email protected]. † Contribution of the Virginia State University Research Station (Journal Article Series no. 236). 2158
DETECTION OF SALMONELLA AND E. COLI IN RUMINANT FECES
VOL. 71, 2005
2159
TABLE 1. Detection and isolation of Salmonella and E. coli O157 in fresh feces of sheep and goats from 12 Virginia farms No. of samplesa Farm
Sampling date (mo/yr)
1 2 3 4 5 6 7 8 9 10 11 12 a
7/2002 7/2002 8/2002 8/2002 10/2002 8/2003 8/2003 8/2003 8/2003 8/2003 10/2003 11/2003
Salmonella positive EIA
Isolation
EIA
Isolation
PCR
24 38 28 66 40 10 11 9 16 11 16 18
0 0 0 0 1 0 0 0 0 0 15 1
NP NP NP NP 1 NP NP NP NP NP 12 0
0 0 0 0 0 1 0 5 0 0 1 0
NP NP NP NP NP 0 NP 0 NP NP 1 NP
NP NP NP NP NP 1 NP 4 NP NP NP NP
NP, work not performed.
9 ml of modified EC broth with 20 mg of novobiocin (Sigma, St. Louis, Mo.)/liter at 42°C for 24 h before the E. coli O157 EIA (Tecra) was performed. This enrichment protocol is recommended by the manufacturer for fecal samples and was TABLE 2. Detection and isolation of Salmonella and E. coli O157:H7 in artificially inoculated fresh feces of sheep No. of samples positivea by: Isolationc Strain and inoculation level (CFU/g)
EIA detectionb
Before enrichment
After enrichment
A
B
A
B
Salmonella serovar Typhimurium ATCC 14028 106 5 10 104 103 102 101
3 3 3 3 3 3
3 3 3 3 1 0
3 3 3 2 0 0
3 3 3 3 3 3
3 3 3 3 3 3
Salmonella serovar Montevideo ATCC 8387 106 5 10 104 103 102 101
3 3 3 3 3 3
3 3 2 0 0 0
3 3 3 1 0 0
3 3 3 2 2 1
3 3 2 1 1 1
E. coli ATCC 35150 106 105 104 103 102 101
3 3 3 3 1 0
3 3 1 1 0 0
3 2 2 2 0 0
3 2 1 0 0 0
3 2 2 0 0 0
E. coli ATCC 700728 106 105 104 103 102 101
3 3 3 3 2 0
3 3 3 0 0 0
3 3 3 3 1 0
3 3 2 0 0 0
3 3 3 3 2 0
a
Of three samples tested. Visual EIA and plate assays showed negative results for all noninoculated control samples. c Salmonella isolation was done with XLD (A) and XLT4 (B) plates; E. coli isolation was done with SMAC (A) and SMAC-CT (B) plates. b
E. coli O157 positive
Total tested
validated by AOAC for testing meat products (25). In the inoculation study, a 1:100 sample-to-enrichment-broth ratio (using 1-g samples) was also tested in order to detect samples containing E. coli O157:H7 at 101 CFU/g. The EIA-positive enrichment broth (100 and 10 l) was then plated on sorbitolMacConkey agar (SMAC) and SMAC with 0.05 mg of cefixime/liter and 2.5 mg of tellurite/liter (CT-Supplement; Dynal Biotech, Lake Success, N.Y.) (SMAC-CT) for isolation. Up to 10 colorless colonies were tested for agglutination with E. coli O157 and E. coli H7 latex tests (Remel, Lenexa, Kans.). Bacterial DNA extracted from EIA-positive enrichment samples with a commercial kit (QIAGEN, Valencia, Calif.) was amplified by PCR with primers specific for O157 (RfbE gene) (forward, CTACAGGTGAAGGTGGAATGG; reverse, ATTCC TCTCTTTCTCTGCGG) and H7 (FliC gene) (forward, TAC CATCGCAAAGCAACTCC; reverse, GTCGGCAACGTTA GTGATACC) as previously reported (32). Amplified products were separated by agarose gel electrophoresis and visualized by ethidium bromide staining. To determine background microbial levels, appropriate dilutions (in 0.1% peptone) of each sample were plated on standard method agar with 48 h of incubation at 36°C (for aerobic plate counts) or on acidified potato dextrose agar with 5 days of incubation at 25°C (for yeast and mold counts). E. coli counts were determined by a three-tube, mostprobable-number evaluation according to the U.S. Food and Drug Administration method and statistical table (28). After incubation for 24 to 48 h at 36°C, a loopful of culture from a lauryl sulfate broth tube positive for gas production was transferred to EC-mug broth (EC broth with 4-methylumbelliferyl--D-glucuronide). After incubation at 45.5°C for 24 to 48 h, tubes with gas production and fluorescence under long-wave UV light (336 nm) indicated positive E. coli results. The means and standard errors of log10 microbial counts were reported. Microbiological survey results. Salmonella and E. coli O157 were detected by visual EIA with samples from 17 and 7 small ruminants, respectively, of the 287 tested (Table 1). Salmonellae were isolated exclusively in October, and one fecal sample tested positive for both pathogens. The presence of Salmonella and E. coli O157:H7 in the Virginia herds was expected, as previous surveys conducted at different locations yielded similar results (1, 13, 20, 22, 23). Additional studies, with considerations for age, breed, and location, etc., are needed to de-
2160
PAO ET AL.
APPL. ENVIRON. MICROBIOL.
TABLE 3. Enhancement of E. coli O157:H7 detection and isolation sensitivities by reduction of background microflora in fecal samples from sheep No. of samples positivea by: E. coli strain
EIA detection
SMAC isolation
1:10b 1:10Ac 1:100 1:10 1:10A 1:100
ATCC 35150 ATCC 700728
0 0
3 3
3 3
0 0
3 3
1 0
SMAC-CT isolation 1:10
1:10A
1:100
0 0
3 3
3 3
a Of three samples tested. Feces were inoculated with E. coli O157:H7 at 10 CFU/g. E. coli O157 was absent from all noninoculated control samples. b Sample-to-enrichment broth ratio. c A, fecal samples were autoclaved before inoculation and testing.
termine if the high prevalence of Salmonella found in October is a significant trend in Virginia herds. Salmonella organisms were isolated from 13 of 17 EIApositive enrichment broths by the use of XLD and XLT4 plates, with positive confirmation by biochemical and serological assays. Attempts to isolate E. coli O157:H7 by using SMAC and SMAC-CT plates were unsuccessful, except in one instance in which E. coli O157:H7 was isolated by use of SMAC-CT with confirmation. For the EIA-positive samples that were unsuccessful in isolation, PCR assays confirmed the presence of the E. coli O157 gene in five of six samples and E. coli O157 and E. coli H7 genes in four of six samples. Average background levels of microflora in the feces from 60 sheep and goats included aerobic organisms at 7.2 ⫾ 0.7 log10 CFU/g, yeasts and molds at 3.4 ⫾ 0.7 log10 CFU/g, and generic E. coli organisms at 5.5 ⫾ 1.0 log10 (most probable number)/g. Results from inoculation study. Data in Table 2 indicate that visual EIA, when used with the recently approved AOAC method (method 998.09) involving Rappaport-Vassiliadis and M broths for sample enrichment (31), was effective for screening for the presence of all test levels (from 101 to 106 CFU/g) of Salmonella serovar Typhimurium and Salmonella serovar Montevideo organisms in sheep feces. Furthermore, the isolation sensitivity of XLD or XLT4 plates was improved (from ⱖ104 CFU/g) by about 2 log10 CFU/g when the enriched sample broth was used for EIA. These results show that the combination of visual EIA detection and selective plate isolation (such as that with XLD and XLT4) with the enriched fecal samples is practical and effective for small-ruminant research. The presence of E. coli O157:H7 at low levels (ⱕ102 CFU/g) was less likely to be detected by EIA. After enrichment, PCR identified the presence of E. coli O157:H7 inoculated at the 102-CFU/g level consistently but at the 10-CFU/g level inconsistently. Isolating E. coli O157:H7 by streaking diluted feces on SMAC and SMAC-CT plates was generally successful at inoculation levels of ⱖ105 CFU/g and ⱖ103 CFU/g, respectively. Standard enrichment did not improve isolation with SMAC and SMAC-CT plates. The results from the survey also show inconsistent recoveries of E. coli O157:H7 from the fecal samples, even when the EIA and the PCR assay samples tested positive for the targeted antigens and genes. The isolation failures could be explained by the presence of low levels of E. coli O157:H7 in feces that contain high levels of background microflora, including sorbitol-positive E. coli at about 5.5 log10 CFU/g. The generic E. coli organisms along with other unidentified colonies overcrowded the surfaces of SMAC or
SMAC-CT plates, restricting the formation of identifiable colonies from E. coli O157:H7 at lower levels. This overcrowding is perhaps a problem for all types of selective agar plates, since no known E. coli O157-selective plates could effectively inhibit the growth of generic E. coli organisms (2, 3, 8, 15, 18). The results in Table 2 clearly show that E. coli O157:H7 may not be effectively isolated from sheep feces by common plate assays unless its population is high (⬎104 CFU/g). The EIA with the standard fecal enrichment protocol is a more sensitive detection method than the SMAC or SMAC-CT plate methods for detecting the presence of E. coli O157:H7 in sheep feces. Dilution of background microflora by modifying the sample enrichment ratio to 1:100 from the standard 1:10 enabled consistent EIA detection and postenrichment SMAC-CT, but not SMAC, isolation for three of three fecal samples inoculated with strains of E. coli O157:H7 at 101 CFU/g (Table 3). Furthermore, elimination of background microflora by autoclaving samples before the inoculation of E. coli O157:H7 enabled consistent EIA detection and postenrichment isolation either by SMAC-CT or by SMAC. At a low level (101 CFU/g) of inoculation, even PCR detection can be inaccurate (Table 2). Interference in detecting low levels of E. coli O157 by PCR may be due to the relative growth of background fecal microflora or the presence of potential PCR inhibitors, such as polysaccharides, bilirubin, and bile salts, commonly found in animal feces (10, 12). In conclusion, Salmonella and E. coli O157 were detected in a limited number of small ruminants in Virginia by the use of conventional EIA enrichment and detection. The combination of EIA and selective plate assays with conventional Salmonella and improved E. coli O157 enrichment is relatively simple and inexpensive and may be easily merged (in medium preparation and sample incubation, etc.) with current food testing protocols (21, 26). These protocols are useful for on-farm evaluation when PCR or immunomagnetic separation systems are considered not feasible or are not available. REFERENCES 1. Alvseike, O., and E. Skjerve. 2002. Prevalence of a Salmonella subspecies diarizonae in Norwegian sheep herds. Prev. Vet. Med. 52:277–285. 2. Bettelheim, K. A. 1998. Studies of Escherichia coli cultured on Rainbow Agar O157 with particular reference to enterohaemorrhagic Escherichia coli (EHEC). Microbiol. Immunol. 42:265–269. 3. Bettelheim, K. A. 1998. Reliability of CHROMagar O157 for the detection of enterohaemorrhagic Escherichia coli (EHEC) O157 but not EHEC belonging to other serogroups. J. Appl. Microbiol. 85:425–428. 4. Chapman, P. A., A. T. Cerdan Malo, C. A. Siddons, and M. Harkin. 1997. Use of commercial enzyme immunoassays and immunomagnetic separation systems for detecting Escherichia coli O157 in bovine fecal samples. Appl. Environ. Microbiol. 63:2549–2553. 5. Cornick, N. A., S. L. Booher, T. A. Casey, and H. W. Moon. 2000. Persistent colonization of sheep by Escherichia coli O157:H7 and other E. coli pathotypes. Appl. Environ. Microbiol. 66:4926–4934. 6. Cray, W. C., Jr., T. A. Casey, B. T. Bosworth, and M. A. Rasmussen. 1998. Effect of dietary stress on fecal shedding of Escherichia coli O157:H7 in calves. Appl. Environ. Microbiol. 64:1975–1979. 7. Cray, W. C., Jr., and H. W. Moon. 1995. Experimental infection of calves and adult cattle with Escherichia coli O157:H7. Appl. Environ. Microbiol. 61: 1586–1590. 8. Dusch, H., and M. Altwegg. 1995. Evaluation of five new plating media for isolation of Salmonella species. J. Clin. Microbiol. 33:802–804. 9. Fedorka-Cray, P. J., D. A. Dargatz, L. A. Thomas, and J. T. Gray. 1998. Survey of Salmonella serotypes in feedlot cattle. J. Food Prot. 61:525–530. 10. Fratamico, P. M., L. K. Bagi, and T. Pepe. 2000. A multiplex polymerase chain reaction assay for rapid detection and identification of Escherichia coli O157:H7 in foods and biovine feces. J. Food Prot. 63:1032–1037. 11. Grauke, L. J., I. T. Kudva, J. W. Yoon, C. W. Hunt, C. J. Williams, and C. J.
VOL. 71, 2005
12.
13. 14. 15. 16.
17.
18.
19.
20.
21.
DETECTION OF SALMONELLA AND E. COLI IN RUMINANT FECES
Hovde. 2002. Gastrointestinal tract location of Escherichia coli O157:H7 in ruminants. Appl. Environ. Microbiol. 68:2269–2277. Holland, J. L., L. Louie, A. E. Simor, and M. Louie. 2000. PCR detection of Escherichia coli O157:H7 directly from stools: evaluation of commercial extraction methods for purifying fecal DNA. J. Clin. Microbiol. 38:4108– 4113. Kudva, I. T., K. Blanch, and C. J. Hovde. 1998. Analysis of Escherichia coli O157:H7 survival in ovine or bovine manure and manure slurry. Appl. Environ. Microbiol. 64:3166–3174. Kudva, I. T., P. G. Hatfield, and C. J. Hovde. 1997. Characterization of Escherichia coli O157:H7 and other Shiga toxin-producing E. coli serotypes isolated from sheep. J. Clin. Microbiol. 35:892–899. March, S. B., and S. Ratnam. 1986. Sorbitol-MacConkey medium for detection of Escherichia coli O157:H7 associated with hemorrhagic colitis. J. Clin. Microbiol. 23:869–872. Meyer-Broseta, S., S. N. Bastina, P. D. Arne, O. Cerf, and M. Sanaa. 2001. Review of epidemiology surveys on the prevalence of contamination of healthy cattle with Escherichia coli serogroup O157:H7. Int. J. Hyg. Environ. Health 203:347–361. Nam, H. M., S. E. Murinda., L. T. Nguyen, and S. P. Oliver. 2004. Evaluation of universal pre-enrichment broth for isolation of Salmonella spp., Escherichia coli O157:H7, and Listeria monocytogenes from dairy farm environmental samples. Foodborne Pathog. Dis. 1:37–44. Novicki, T. J., J. A. Daly, S. L. Mottice, and K. C. Carroll. 2000. Comparison of sorbitol MacConkey agar and a two-step method which utilizes enzymelinked immunosorbent assay toxin testing and a chromogenic agar to detect and isolate enterohemorrhagic Escherichia coli. J. Clin. Microbiol. 38:547– 551. Oberst, R. D., M. P. Hays, L. K. Bohra, R. K. Phebus, and J. M. Sargeant. 2003. Detection of Escherichia coli O157:H7 in cattle feces using a polymerase chain reaction-based fluorogenic 5⬘ nuclease (TaqMan) detection assay after secondary enrichment. J. Vet. Diagn. Invest. 15:543–552. Paiba, G. A., J. C. Gibbens, S. J. Pascoe, J. W. Wilesmith, S. A. Kidd, C. Byrne, J. B. Ryan, R. P. Smith, M. McLaren, R. J. Futter, A. C. Kay, Y. E. Jones, S. A. Chappell, G. A. Willshaw, and T. Cheasty. 2002. Faecal carriage of verocytotoxin-producing Escherichia coli O157 in cattle and sheep at slaughter in Great Britain. Vet. Rec. 150:593–598. Pao, S., G. E. Brown, and K. R. Schneider. 1998. Challenge studies with
22.
23. 24. 25. 26. 27. 28. 29.
30.
31. 32.
2161
selected pathogens bacteria on freshly peeled Hamlin orange. J. Food Sci. 63:359–362. Rey, J. J. E. Blanco, M. Blanco, A. Mora, G. Dahbi, J. M. Alonso, M. Hermoso, J. Hermoso, M. P. Alonso, M. A. Usera, E. A. Gonzalez, M. I. Bernardez, and J. Blanco. 2003. Serotypes, phage types and virulence genes of shiga-producing Escherichia coli isolated from sheep in Spain. Vet. Microbiol. 94:47–56. Sandberg, M., O., Alvseike, and E. Skjerve. 2002. The prevalence and dynamics of Salmonella enterica IIIb 61:k:1,5,(7) in sheep flocks in Norway. Prev. Vet. Med. 52:267–275. Sanderson, M. W., J. M. Gay, D. D. Hancock, C. C. Gay, L. K. Fox, and T. E. Besser. 1995. Sensitivity of bacteriologic culture for detection of Escherichia coli O157:H7 in bovine feces. J. Clin. Microbiol. 33:2616–2619. Tecra International Pty. Ltd. 2001. Methods manual: E. coli O157 visual immunoassay. Tecra International Pty. Ltd., Frenchs Forest, Australia. Tecra International Pty. Ltd. 2002. Methods manual: Salmonella visual immunoassay. Tecra International Pty Ltd., Frenchs Forest, Australia. Tutenel, A. V., D. Pierard, D. Vandekerchove, J. van Hoof, and L. de Zutter. 2003. Sensitivity of methods for the isolation of Escherichia coli O157 from naturally infected bovine faeces. Vet. Microbiol. 94:341–346. U.S. Food and Drug Administration. 2001. Bacteriological analysis manual, 8th ed., revision A. U.S. Food and Drug Administration, Washington, D.C. Uzzau, S., G. S. Leori, V. Petruzzi, P. R. Watson, G. Schianchi, D. Bacciu, V. Mazzarello, T. S. Wallis, and S. Rubino. 2001. Salmonella enterica serovarhost specificity does not correlate with the magnitude of intestinal invasion in sheep. Infect. Immun. 69:3092–3099. Veling, J., F. G. van Zijderveld, A. M. van Zijderveld-van Bemmel, H. W. Barkema, and Y. H. Schukken. 2000. Evaluation of three newly developed enzyme-linked immunosorbent assays and two agglutination tests for detecting Salmonella enterica subsp. enterica serovar Dublin infections in dairy cattle. J. Clin. Microbiol. 38:4402–4407. Wallace, H. A. 2002. Microbiological methods, p. 126–130. In W. Horwitz (ed.), Official methods of analysis of AOAC International, 17th ed. AOAC International, Gaithersburg, Md. Wang, G., C. G. Clark, and F. G. Rodgers. 2002. Detection in Escherichia coli of the genes encoding the major virulence factors, the genes defining the O157:H7 serotype, and components of the type 2 Shiga toxin family by multiplex PCR. J. Clin. Microbiol. 40:3613–3619.
