Essential Functional Interactions of SAGA, a Saccharomyces ...

Copyright 0 1997 by the Genetics Society of America

Essential Functional Interactions of SAGA, a Saccharomyces cereuiSiae Complex of Spt, Ada, and Gcn5 Proteins, With the Snf/Swi and Srb/Mediator Complexes Shannon M. Roberts and Fred Winston Department of Genetics, Harvard Medical School, Boston, Massachusetts 02115

Manuscript received May 10, 1997 Accepted for publication June 23, 1997 ABSTRACT The Saccharomycescerevisiae transcription factor Spt20/Ada5 was originallyidentified by mutations that suppress Ty insertion alleles and by mutationsthatsuppressthetoxicitycaused by Ga14W16 overexpression. Herewe present evidence for physical associations between Spt20/Ada5 and three other Spt proteins, suggesting that they exist in a complex. A related study demonstrates that this complex also contains the histone acetyltransferase, Gcn5, and Ada2. This complex has been named SAGA (Spt/ Ada/Gcn5 acetyltransferase). To identify functionsthat genetically interactwith SAGA, we have screened for mutations that cause lethality in anspt20A/ada5A mutant. Our screen identified mutations in SNF2, SZN4, and G A L l l . These mutations affecttwo known transcription complexes: Snf/Swi, which functions in nucleosome remodeling, and Srb/mediator, which is required for regulated transcription by RNA polymerase 11. Systematic analysis hasdemonstrated that spt20A/ada5Aand spt7A mutations cause lethality with every snf/sswi and srb/mediator mutation tested. Furthermore,a gcn5A mutation causes severe sickness with snf/sswi mutations, but notwith srb/mediator mutations. These findings suggest thatSAGA has multiple activities and plays critical roles in transcription by RNA polymerase 11.

G

ENETIC studies in the yeast Saccharomyces cerevisiae have identified alarge number of factors required for proper transcriptional regulation by RNA polymerase I1 in vivo (for reviews, see GUARENTE 1995; STRUHL 1995). In many cases, these studies have suggested that groups of factors might function by a common mechanism. For some of these functional groups, subsequent biochemical analysis has demonstrated that theirmembers function in large complexes. This has been most clearly demonstrated for two complexes, the Snf/Swi complex (CAIRNS et al. 1994; PETERSON et al. 1994) and theSrb/mediator/holoenzyme complex (KIM et al. 1994; KOLESKE and YOUNG1994). Studies of two other groups of transcription factors, Spt and Ada proteins, have suggested that they may function in complexes (EISENMANN et al. 1992; MARCUS et al. 1994,1996; HORIUCHI et al. 1995; CANDAU and BERGER1996; SALEH et al. 1997). Both genetic and biochemical characterizations led to models concerning theroles of these large transcription complexes in the control of transcription by RNA polymerase 11. The Snf/Swi complex is believed to control transcription by overcoming repression by nucleosomes (for a recent review, see KINGSTON et al. 1996). Genetic analyses demonstrated that mutationsin S. cerevisiae ShrF/SW genes are suppressed by mutations in genes encoding histones and in the putative non-his(KRUGER and tone chromatin component, Sinl/Spt2 Curresponding author: Fred Winston, Department of Genetics, Harvard Medical School, 200 Longwood Ave., Boston, MA 02115. E-mail: [email protected] Genetics 147: 451-465 (October, 1997)

HERSKOWITZ 1991; HIRSCHHORN et al. 1992; KRUGER et al. 1995). Suppression in the case of reduced levels of histones H2A and H2B is accompanied by changes in et al. 1992). Biochromatinstructure (HIRSCHHORN chemical analyses have shownthat Snf/Swi possesses an in vitrochromatin remodeling activity and can facilitate binding of transcriptional activators and the general transcription factors, TFIIA and TBP, to nucleosomal et al. 1994; KWONet DNA (COTE et al. 1994; IMBALZANO al. 1994). The Srb/mediator complex, required for activated transcription in vivo and in vitro, has also been characterized by both genetic and biochemical studies (for review, see CARLSON 1997). Srb/mediator is composed of certain general transcription factors as well asGall 1/ Sptl3, Sin4, Rgrl, Rox3, and numerous Srb proteins. Mutations in SRB genes were isolated as suppressors of the cold-sensitive phenotype caused by truncation of the carboxy-terminal domain (CTD) of the largest subunit of RNA polymerase I1 (NONETand YOUNG 1989). Many other Srb/mediator components were identified by mutant screens and selections for altered gene expression (CARLSON 1997). Srb/mediatorhas been purified as a large complex with RNA polymerase 11, called holoenzyme ( KOLESKEand YOUNG 1994), andas a complex separate fromRNA polymerase I1 (KIMet al. 1994). I n vitro, Srb/mediator stably associates with RNA polymerase I1 and can mediate activated transcription, increase basal transcription, and allow increased phosand phorylation of the CTD (KIM et al. 1994; KOLESKE YOUNG 1994). Other studies have suggested a negative role for Srb/mediator in transcription (CARLSON 1997).

452

and S . M. Roberts

Consistent with its function in activated transcription, Srb/mediator can physically interact with VP16 (HENGARTNER et aL 1995). Although some studies have provided evidence for a stable biochemical association between Srb/mediator/holoenzyme and Snf/Swi, other studies find them as distinct biochemical complexes (CAIRNS et al. 1996c; COTE et al. 1994; KIM et al. 1994; PETERSON et al. 1994; WILSONet al. 1996). A third set of proteins, Spt proteins, was identified by mutations that suppress Ty and S insertion mutations in the promoter regions of certain genes. A subset of Spt proteins (Spt3, Spt7, Spt8, and Spt20) have been hypothesized to help TBP function at particular promoters (WINSTON 1992). This model is based on several lines of evidence. First, null mutations in these four genes cause similar mutant phenotypes and decrease transcription from a subset ofRNA pol 11-dependent promoters.Second, these phenotypesare similar to those caused by particular missense mutations in SPTl5, which encodes TBP. In addition, TBP and Spt3 interact physically, based on allele-specific suppression and coimmunoprecipitation experiments (EISENMANN et al. 1992).Spt3 also interacts genetically withMot1 and TFIIA, two other factors known to associate with TBP (MALNSON and WINSTON 1997). Finally, Spt3 has sequence similarity to the human TBP-associated factor (TAF), TAFI118(MENCUSet al. 1995). Despite this evidence, no biochemical role has yet been identified for these Spt proteins. In this work, we have focused on the SPT20 gene, which we originally identified as a suppressor of the his4-9176 insertion mutation (ROBERTS and WINSTON 1996). SPT20 encodes a604 amino acid nuclear protein that is glutamine- and asparagine-rich but that has no known sequence homologies. Although spt2OA mutants are viable, they growpoorly and have a numberof transcriptional defects (MARCUS et al. 1996;ROBERTSand WINSTON 1996). Interestingly, SPT20 is also known as ADA5 (MARCUSet al. 1996), which, along with ADA1, ALlA2,ADA3, and GCN5, was identified based on its ability, when mutant, to confer resistance to the toxicity caused by overexpression of the artificial transcriptional activator, Ga14W16 (BERGER et al. 1992;PINAet al. 1993; MARCUS et al. 1994). SPT20/ADA5 is hereafter called SPT20 for brevity. Genetic and biochemical evidence suggests that Ada proteins function together as a complex that serves as an intermediary between transcriptional activators and the general transcription apparatus (for examples, see GEORGAKOPOULOS and THIREOS 1992;MELCHERandJOHNSToN 1995; BRANDLet al. 1996; CANDAU and BERCER 1996; MARTENS et al. 1996; HORIUCHI et al. 1997). Recent evidence has shown that one of the Ada proteins, Gcn5, can acetylate histones in vitro (BROWNELL et nl. 1996). Histone acetylation can occur on the lysine residues of the histone amino terminaltails. This modification is believed to activate transcription by weaken-

F. Winston

ing DNA-histone associations, thereby allowing other factors to bind to nucleosomal DNA (for reviews, see TURNER and O’NEILL1995;BROWNELL and ALLIS 1996). Interestingly, although recombinant Gcn5 can acetylate free histones, it cannot acetylate histones in the context of nucleosomes, suggesting that other factors are required for nucleosome acetylation by Gcn5 (KUO et al. 1996; YANG et al. 1996). The common mutant phenotypes between GCNS and other ADA genes suggest that these functions regulate such an activity in vivo. Consistent withthis hypothesis, CANDAU et al. (1997) show that GCN5 function in vivo requires both the region of Gcn5 required for histone acetyltransferase activity (HAT) and the region required for interaction with Ada2. Thus, Spt20 may also be requiredforproper Gcn5 activity in vivo. To further our understanding of the role of Spt20 in transcription initiation, we examined two aspects of Spt20 function. First, we wanted to determine whether Spt20 was biochemically associated with other Spt proteins. Using a Gst-Spt20 fusion protein, we have identified interactions between Gst-Spt20 and Spt3, Spt7, Spt8 and TBP. These results suggest that Spt proteins may function together in a complex to affect the activity of TBP. Recent results demonstrate that this complex also contains Gcn5 and Ada2 and thatit acetylates nucleosomal histones (GRANTet al. 1997). This complex has beennamed SAGA(SAGA = Spt/Ada/Gcn5 gcetyltransferase). Second, we sought to identify factors that are functionally related to Spt20 and the SAGA complex. To do this, we screened for mutations that cause inviabilityspecifically inthe absence of SPT20. Our screen identified one member of the Snf/Swi complex ( S W 2 )and two members of the Srb/mediator complex (GALll, SIN4). Furthergenetic analysis has demonstratedthat all snf/swi and srb/mediator mutations tested are inviable in combination with null mutations in SPT20 and SPT7. These data suggest that SAGA performs functions related to those of Snf/Swi and Srb/ mediator. Additional genetic analysis of mutations in the SAGA genes SPT20, SPT7,GCN5, and SPT3, strongly suggests that SAGAis required for multiple activities, only a subset of which depends on Gcn5 HAT activity. MATERIALS AND METHODS Yeast strains, genetic methods, and media: S. cerevisiae strains used in this study are listed in Table 1. All FY strains arecongenic and wereoriginally derived fromthe S288C derivative FY2 (WINSTONet al. 1995). Strain 2560 (THOMPSON et ul. 1993) was crossed into FY background to create strain L937 containing the srb5Al:: URA3hisGmutation. Thestrains used for identification andanalysis of spt20A synthetic lethal mutants, L934-6, are progeny derived from several crosses between strains FY630, CH1305 (KRANZ and HOLM 1990), and Gmy30 (MARCUS et al. 1996). Null mutants were constructed by transformingdiploid strains with a restriction fragment designed to delete the gene being studied (ROTHSTEIN1983). Ineach case, the null muta-

InteractionsSAGA Functional tion contained a selectablenutritional marker. Transformants were then sporulated and dissected to generate haploid mutant progeny. The spt20A20O:ARM strain was constructed by transforming diploid strain FY1275 with the 3.4kb XhoI-XbaI fragment frompSR97 containing the spt20A200:ARM allele. To create sin4A ::TRPl and galll A ::TRPl strains, plasmids pHH239 (HIMMELFARB et al. 1990) and M1389 UIANG and STILLMAN 1992) were digested with BamHI and used to transform FY1275. RGRl is an essential gene (SAKAI et al. 1990); to create viable rgrl truncation mutants, rgrlA2::TRPl and rgrlA2::LEU2, plasmids M1977 and M1979 UIANG et al. 1995) were both digested with KpnI and transformed into diploids FY1275, FY1278, and FY1277. To create swilA::LEU2strains, plasmid BD39 (PETERSON and HERSKOWITZ 1992) was digested with PstI and transformed into a diploid made from a cross between strains FYlOl and Fy267. In the gcn5A::HZS? allele, the entire GCN5 open readingframe was replaced with the HZS3 gene using a fragment generated by PCR (AUSUBEL et al. 1988). The primers OIP-13 (5’-CAAAAGTCTTCAGTT AACTCAGGTTGGTATTCTACATTAGCTGTGCGGTATTTC ACAC CG3’)and OIP-14 (5”TCTTCGAAAGGAATAGTA GCGGAAAAGCTTCTKTACGCAAGATTGTACTGAGAGTG CAC-3’) were used in a standard PCR reaction to amplify the HZS? gene from pRS303. The resulting 1.2-kb PCR fragment contained the HZS? gene flanked by 80 bp of 5’ and 3’ noncoding sequence fromGCN5. This 1.2-kb fragment was transformed into a diploid constructed by a cross between strains FY37 and FY86. The snPA ::LEU2 and sn@A ::HZS? alleles have been described previously (HIRSCHHORN et al. 1992; CAIRNS et aL 1996b). To introduce the sn@A::LEU2 allele into S288C background, plasmid pKOSNF2L was used to transform a diploid constructed by a cross of strains FYl20 and FY653. To introduce srb2A::HZS? into our background, plasmid pTK-33 (provided by RICK YOUNG) was digested with EcoRI and used to transform strain FY37 to His+. The snp5::URA3 allele has been described previously (ABRAMS et al. 1986). Rich (YPD), minimal, synthetic complete (SC) and sporulation media were prepared as described previously (ROSEet al. 1990). Media for testing the Gal and Ino phenotypes were as described by GANSHEROFF et al. (1995). Standard protocols for transformation and tetrad analysis were used instrain constructions (ROSEet al. 1990). Plasmids: All plasmids were constructed by standard procedures (AUSUBEL et al. 1988). The pRS (SIKORSKI and HIETER et al. 1992) andYCpLac (GIETZand SUG 1989; CHRISTIANSON I N 0 1988) series of yeast Eschm’chia coli shuttle vectors were used for all subcloning experiments. pSR78, which encodes a Gst-Spt20 fusion protein under control of the GALl-10 UAS, was created by cloning a 2.5-kb BamHI-Hid111 fragment containing SPT20 encoding amino acids 15-604 into the same sites of pEG(KG) (MITCHELL et al. 1993). This construct is functional based complementation of an spt2OA mutant for growth, Spt- and Ino- phenotypes. Plasmid pYBS305 (CHOIet al. 1994) was used to express Gst alone. Plasmids pSR7 and pSR8 contain the 3.1-kb SalI-SpeI fragment from pSR6 (EISENMANN et al. 1994), containing cmyc epitope tagged Spt8,in pRS424 and pRS314, respectively. Both pSR7 and pSR8 can complement an spt8A mutation. Plasmids pSR137 and pSR138 encode HAl-epitope tagged Spt3, contain ARM as a selectable marker, and were created in several steps. First the ARM parental vectors, pSR55 and pSR66 were constructed by inserting a 2.1-kb HpaI ARM fragment into either pRS424 [cut with EcolO91 (blunt ended using Klenow) to remove the TRPl marker] or pRS415 [cut with HpuI and TthlllI (blunt ended using Klenow) to remove the LEU2 gene]. The 2.4kb EcoRI-Hind111 fragment from et al. 1992),encodingHAl-epitope pDE119-1 (EISENMANN

453 tagged Spt3, was then inserted into the same sites of pSR55 and pSR66 to create pSR137 and pSR138, respectively. Both pSR137 and pSR138 complement spt?A. pSR86, which contains the SPT20, ADE?, and URA? genes, was created by cloning-the 3.4 kb BamHI-SalI fragment from pSR40 (ROBERTS and WINSTON1996), containingSPT20 complementing fragment (aminoacids 1-500) into theBamHI-SalI sites of pPS719 (pRS42&ADE?; G. SCHLENSTEDT and P. SILVER, personal communication). The 6.8-kb NotI-SalI fragment from pSR86 containing the SPT20 and ADE? genes was cloned into the NotISalI sites of pRS425 to create pSR89. Both pSR86 and pSR89 have SPT20 function. Plasmids SO23 (GALll; BARBERIS et al. 1995), pSR127 (ShrF2) and pSR124 (SZN4) were used to verify the identity of synthetic lethal mutations incomplementation groups 1-3 based on complementation of the spt20Asynthetic lethal phenotype with a single gene. pSR124 contains the 4.8-kb BamHI fragment from M1387 UWVG and STILLMAN 1992) in pRS415. pSR127 contains the 7.9-kbSphI fragment from pLN138 (ABRAMS et al. 1986) in Ycplaclll. pSR97 contains the spt20A200::ARM allele. This plasmid was made by subcloning ARM into SPT20 between the BstXI and HpaI sites of pSR46. Thus, in spt20A200::ARG4, codons 11-403 of SPT20 are replaced with the ARM gene. Thefollowing plasmids were constructed to determine linkage of the complementing genes to mutations that are synthetic lethal with spt2OA. pSR123 containsa 2.0-kbPstI-SalI fragment from pLN138 (SM’Q) in pRS305.pSR129 contains the 2.0-kb BamHI-Hind11 fragmentfrom SO23 (GALll) in pRS305. pSR126 contains the 4.8-kbBamHI fragment from M1387 (SZN4; JWVG and STILLMAN 1992) in pRS305. The following URAkontaining plasmids were used to recover otherwise lethal doublemutant progenyin crosses: pLN138 (ShrF2), pSR37 (SPT20; ROBERTS and WINSTON 1996), pFW127 (SPT7; GANSHEROFF et al. 1995), BD1 (SWl; PETERSON and HERSKOWITZ 1992), FB565 (GALll; J. FASSLER and F. WINSTON, unpublished results), M2596 (RGRl inYEplacl95; D. STILLMAN, personal communication). Preparation of yeast extracts: Yeast whole cell extracts were prepared as described with acid-washed glass beads (ELIONet al. 1993). Cells were lysed in buffer containing 25 mM TrisC1 (pH 7.5),15 mM EGTA, 10% glycerol, 1 mM dithiothreitol ( D m ) , and 1.5% n-lauryl sarcosine (sarkosyl). The protease inhibitors chymostatin, leupeptin, pepstatin A, benzamidine and phenylmethyl sulfonyl flouride were added as described (CAIRNSet al. 1 9 9 6 ~ )Triton-X . 100 was added following the final centrifugation to a concentration of 0.1%. We observed that additionof sarkosyl to the lysis buffer increased the solubility of the Gst-Spt2O protein (FRANGIONI and NEEL1993). Gst binding experiments and Western analysis: Individual transformants were grown in selective synthetic complete media to 2 X lo7 cells/ml in 2 % raffinose and then galactose was added to 4% for 4 hr to induce expression of the Gst constructs. Glutathione sepharose beads (Pharmacia Biotech, Uppsala, Sweden) were prepared by washing in 10 bead volumes of PBS and then incubating for 10 min at 4” in binding buffer [25 mM Tris-C1 (pH 7.5), 15 mM EGTA, 10% glycerol, 1 mM DTT, 0.1% Triton-X 100, and 150 mM NaCl]. Two milligrams of protein extract were incubated with 300 p1 of prepared glutathione sepharose beads for 1.5 hr in a final volume of 800 pl. Binding was performed at4” with agitation. Ethidium bromide (EtBr) was added to parallel samples to 50 pg/ml. Following binding, beads were washed three times in 10 ml of binding buffer containing 150 mMNaC1, three times in 10 ml binding buffer containing 400 mM NaCl, and finally resuspended in 100 pl 2XSDS sample PAGE buffer. Twenty-five percent of the final resuspension was run on a SDS 5-20% acrylamide gradient gel and analyzed by Western analysis.

454

S. M. Roberts and F. Winston TABLE 1

s. cerevisiae strains Strain

Genotype

FY29 FY37 FY50 FY51 FY86 FYlOl FYI 20 FY267 FY294 FY297 FY405 FY416 FY630 FY653 FY737 FY933 FY963 FY1254 FY1255 FYl256 FY1257 FY1258 FYl272 FYI 275 FYI 276 FYI277 FYI 278

MATa ura3-52 his3A200 snp-5 ::URA3 MATa lys2-1286 his3A200 ura3-52 MATa h 2 A l trplA63 ura3-52 his4-9176 spt8A302::LEU2 MATa spt3A203:: TRPl trplA63 leu2Al ura3-52 his4-9176 MATa his3A200 ura3-52 h 2 A l MATa leu2Al a h 8 ura3-52 MATa his4-9126 lys2-1286 h 2 A l ura3-52 MATa his4-9126lys2-1286 h 2 A l MATa spt3A202 ura3-52 leu2Al lys2-173R2 his491 76 trplA63 MATa ura3-52 lys2-173R2 his491 76 spt3A202 trplA63 MATa spt3A203:: TRPl trplA63 his4-917 lsy2-1286 leu2Al ura3-52 MATa snj2A ::HIS3 sptA203::TRPl his4-9176 ura3-52 his3A200 trplA63 MATa his491 76 lys2-173R2 trplA63 leu2Al ura3-52 MATa his4-9126 lys2-1286 ura3-52 leu2Al MATa his3A200 lys2-1288 leu2Al ura3-52 snj2A::HIS3 MATa spt3A202 lys2-173R2 his3A200 ura3-52 leu2Al MATa ura3-52 leu2Al his491 76 spt7A402::LEU2 MATa his3A200 lys2-1286 ura3-52 h 2 A l swilA::LEU2 MATa ura3-52 arg4-12 trplA63 sin4A::TRPl lys2-173R2 h 2 A l MATa h 2 A l ura3-52 lys2-173R2 trplA63 sin4A::TRPl arg4-12 MATa trplA63 gall1A::TRPl ura3-52 arg4-12 leu2Al lys2-173R2 MATa ura3-52 arg4-12 leu2Al trplA63 gall1A::TRPl lys2-173R2 MATa spt20A200::ARW arg4-12 h 2 A l 452-173R2 trplA63 ura3-52 his3A200 MATa/MATa ura3-52/ura3-52 arg4-12/arg4-12trplA63/trplA63 452-173R2/lys2-173R2L E U 2 / k 2 A l MATa/MATa ura3-52/ura3-52 his4-9176/his4-9176 lys2-173R2/lys2-173R2 trplA63/trpIA63 k 2 A l / h 2 A l MATa/MATa ura3-52/ura3-52 arg4-12/arg4-12 TRPl/trplA63 kZAl/leu2Al lys2-173R2/lys2-173R2his49176/HIS4 MATa/MATa his4-9126/HIS4 lys2-1286/lys2-I73R2 HIS3/his3A200 ARG4/arg4-12 leu2Al/leu2Al ura3-52/ura3-52 TRPl/trplA63 MATa are-12 h 2 A l rgrlA2::LEU2 ura3-52 trplA63 lys2-173R2 MATa lys2-1286 ura3-52 his3A200 srb2A::HIS3 trplA63 leu2Al MATa his3A200 gcn5A ::HIS3 h 2 A l ura3-52 arg4-12 lys2-173R2 MATa lys2-1286 ura3-52 arg4-12 his3A200 srb2A ::HIS3 h 2 A l MATa t q l A 6 3 ura3-52 lys2-1286 spt3A202 his3A200 MATa his4-9176 lys2-173R2 ura3-52trplA63 bu2Al rgrlA2::TRPl MATa trplA63 leu2AI spt7A402::LEU2 lys2-173R2 his3A200 ura3-52 MATa spt20A200::ARW arg4-12 trplA63 leu2Al lys2-173R2 ura3-52 MA Ta his3A 200 gcn5A ::HIS3 leu2A 1 ura3-52 arg4-12 trplA 6 3 lys2-173R2 MATa swilA::LEU2 h 2 A l lys2-1286 ura3-52 his3A200 trplA63 MATa his3A200 gcn5A::HIS3 leu2Al ura3-52 t q l A 6 3 MATa his3A200 trplA63 lys2-173R2 ura3-52 h 2 A I spt8A302::LEU2 MATa trplA63 ku2Al spt7A402::LEU2 lys2-173R2 ura3-52 his3A200 MATa lys2-173R2 trplA63 h 2 A l arg4-12 ura3-52 MATa lys2-173R2 trplA63 leu2Al arg4-12 ura3-52 spt20A200::ARW MATa spt20A200::ARW arg4-12 trplA63 lys2-173R2 leu2Al ura3-52 his3A200 MATa snf5-5::URA3 his3A200 ura3-52 arg4-12 h 2 A l MATa trplA63 sin4A::TRPl ura3-52 arg4-12 452-173R2 MATa ura3-52 lys2-1286 arg4-12 his4-9126 snj2A ::LEU2 leu2Al MATa lys2-1286 ura3-52 snflA::LEU2 trplA63 leu2Al MATa lys2-1286 ura3-52 arg4-12 his3A200 srb2A::HIS3 trplA63 MATa ura3-52 h 2 A l swilA::LEU2 lys2-173R2 are-12 MATa trplA63 sin4A::TRPl leu2Al lys2-l73R2 his3A200 ura3-52 MATa his491 76 452-173R2 h 2 A l trplA63 ura3-52 arg4-12 rgrlA2::LEU2 MATa h 2 A l snj2A::LEU2 trplA63 ura3-52 lys2-173R2 MATa leu2Al snj2A::LEU2 ura3-52 his3A200 arg4-12 MATa ura3-52 lys2-173R2 leu2Al his3A200 gcn5A::HISjr snfza ::LEU2 MATa ura3-52 lys2-173R2 h 2 A l his3A200 MATa ura3-52 bs2-173R2 leu2AI his3A200 gcn5A ::HIS3

FY1279 FY1285 FY1286 FY1287 N1288 FY1289 FY1290 FY129 1 FY1292 FY1293 FYI 294 FYl299 FY1300 FY1301 FYl302 FY1303 FYI 304 FY1305 FYl306 FY1307 FY1308 FY1309 FY1310 FY1311 FY1312 FY1314 FY1352 FY1353 FY1354

SAGA Functional Interactions

455

TABLE 1 Continued Strain N1356 N1360 FYI 363 €51' 364 N1366 FYI 367 N1368 N1370 L934 L935 L936 L937 L938 L939 L940 FW1800 CH1305 GMY30 2560

Genotype

MATa ura3-52 arg4-12 trplA63 sin4A::TRPl lys2-173R2 MATa leu2Al snpA::LEU2 his3A200 ura3-52 lys2-173R2 MATa sin4A::TRPl gcn5A::HIS3 trplA63 his3A200ura3-52 lys2-I 73R2 arg4-12 leu2AI MATa srb2A ::HIS3 his3A200 gcn5A::HIS3ura3-52 arg4-12 leu2Al lys2-1286 MATa arg4-12 his3A200 spt20A200::ARG4 srb2A::HIS3 lys2-173R2 trplA63 ura3-52 leu2AI ( P S R ~ ~ ) ~ MATO spt3A202 his3A200 srb2A ::HIS3 lys2-1286 ura3-52 arg4-12 MATa ura3-52 arg4-12 leu2AI spt20A::ARW snf2A::LEU2 his4-91% 4x2-I 73R2 or lys2-1286 (pSR37)" MATa his3A200 gcn5A ::HIS3 leu2AIura3-52 MATa ade2 ade3 lys2 ura3 canl ada5A/spt20A his4 leu2 MATa ura3 leu2 trplA63 ada5A/spt20A his4 MATa leu2 ade2 ade3 lys2 ura3 ada5A/spt20A MATa ura3-52 srb5Al ::URA3hisG his3A200 leu2 arg4-12 trplA63 MATa ade3 ade2 his4 lys2 canl leu2 ada5A/spt20A gall 1-1 ura3 (pSR86)a MATa leu2 lys2 or lys2-I 73R2 ura3 trplA63 his4 or his4-9176 ada5A/spt20A snf2-1 ura3 (pSR86)" MATa leu2 lys2 or lys2-173R2 ura3 trplA63 ada5A/spt20A sin4-l ura3 (pSR86)" MATa snf2A ::HIS3 trpIA63 his4-917 lys2-1286 ura3-52 MATa ade2 ade3 leu2 lys2 ura3 canl MATa adel ura3 leu2 his4 ada5A/spt20A MATa ura3-52 his3A200 leu2-3,112 srb5Al:: URA3hisG

For viabiliw, strains FYI366 and N1368 require plasmid pSR37 (SPT20) and strains L938, L939, and L940 require plasmid pSR86 (SPT20j. .

I

The following primary antibodies were used for Western analysis: 12CA5 (gift of C. TABIN)to identify HAl-Spt3; 9E10 (Santa Cruz Biotechnology,Inc.) to identify Myc-Spt8; affinity purified Spt7 antisera (GANSHEROFF etal. 1995); anti-yeast TBP (gift of STEVE BURATOWSKI); anti-Gst (Santa Cruz Biotechnology, Inc.); anti-Toa2 (KANG et al. 1995); 8W616 to identify Rpbl (THOMPSON et al. 1989); and anti-Np13 (BOSSIE et al. 1992). Horseradish peroxidase conjugated secondary antibodies were purchased from Biorad Laboratories (Hercules, C A ) . Proteins were detected using enhanced chemiluminescence (ECL) reagents from Amersham Life Science (Buckinghamshire, UK). Isolation of spt20 synthetic lethal mutants: The red/white colony sectoring assay initially described by KOSHLANDet al. (1985) and adapted by KRANZ and HOLM(1990) was used to isolate spt20Asynthetic lethal mutants. The assay relies on the colony color of different ade mutants: ade2 colonies are red while ade3 and ade2 a d d colonies are white. Thus, ade2 ade3 spt2OA colonies harboring a plasmid with ADE3 and SPT20 are red; however, whitesectors will form when the plasmid is lost. Strains that require SPT20for viabilitywill not form white sectors and are candidates to contain mutations that cause synthetic lethality in combination with spt2OA. In our screen, the yeast strain L934 was transformed with plasmid pSR86. Several transformants were grown overnight inSC-Ura media to saturation. Cellswere spread on YFD ' plates to a density of -2500 cells/plate (15Gmm petri dishes). All but one of the plates were then irradiated with 300 ergs of UV light per square millimeter (to -40% cell viability). Approximately 81,000 colonies were mutagenized and screened for a non-sectoring phenotype. No non-sectoring colonies appeared on the control non-mutagenized plate. After 5 days incubation at 30°, we observed 213 non-sectoring red colonies that were colony purified and retested for their non-sectoring phenotype. We identified 11 independent spt20 synthetic lethal mutants by the following criteria: (1) they failed to sector and failed to grow on 5-fluoroorotic acid meet al. 1984)], dia [5-FOA an agent that kills Ura+ cells (BOEKE indicating they required plasmid pSR86 for viability; (2) once

transformed with plasmid pSR89 they could grow on 5-FOA media, and thus lose pSR86, indicating that the synthetic lethality was specific to expression of SPT20; and (3) their 5FOA-sensitive phenotype segregated 2:2 whentheywere crossed to L935, indicating this phenotype was due to mutation in a single nuclear gene. The synthetic lethality phenotype was recessive based on the ability of heterozygous d i p loids to grow on 5-FOA media. All synthetic lethal mutants were screened for additional phenotypes including growth at different temperatures and on different types of media. Cloningof synthetic lethal genes:To clone genes identified by complementation groups 1-3, the mutant strains, L938, L939, and L940 were transformed with a genomic plasmid library in a LEU2marked vector (SPENCER et al. 1988). For each mutant, -1-2 X lo3 Leu+ transformants were screened by replica plating for those that could now lose the SPT20 plasmid by growth on 5-FOA media lacking leucine. Growth would indicate that they contained plasmids able to complement the spt2OA synthetic lethal phenotype. Library plasmids were isolated from 5-FOARLeu+ transformants, and their insert DNAs were analyzed by sequence analysis of the ends of the insert, followed by identification of the cloned sequence by a computer database search. As expected, several plasmids contained the SPT20 locus. In addition, for each mutant, we isolated one to three additional clones that were not SPT20 but that allowed growth on 5-FOA media. By knowing the exact DNA sequence for each insert, followed by subcloning, we identified single genes for each mutant that allowed growth on 5-FOA media. To verify that the complementing genes corresponded to the synthetic lethal mutations and were not unlinked suppressors, we examined their ability to direct plasmid integration to the mutant locus. Integrating LEU2 plasmids containing each complementing DNA sequence (pSR123, pSR129, and pSR126)wereindividually transformed into spt2OA strain L936. Each integrant class was crossed to the corresponding L934-derived mutant. Analysis of 19-20 four-spored tetrads from each of these diploids revealed tight linkage of the Leu+ and 5-FOA' phenotypes (in all cases, wesaw all parental di-

S . 11. Robrrts a nd F. 14'inston

4.56

bound

types), demonstrating that thr insrrts in plasmids pSK12.3, pSR129. ;\nd pSRI26 dircctctl intc*gmtion t o tllct corrcspontling mutant loci and thrrrforr contained r l ~ c .correct grnc*s.

input 0

8

0

8

0

cZ,g $ \

s g g g $ $ 5 -

EtBr

-

+

RESL'LTS

+

7 GSt-Spt20

.c ,

b

"0

GSt

H Spt3 (CEN)

. I )

sPt3 (29

-

spts

TBP

-

Rpbl

Toa2

I

Np13 % ,

FK;I'KI.1 .-(;st-Spt20 association with SptS, Sptt, Spt8, and TRP. \Vilrl-typc strain R'I3Ol \\.;IS cotrxnsformc-d with pSKX (c-myc-.S/"/'S':' CK.\], pSKl3H ( H.lI-.Vr/'3/ (:k..\) for a 1 1 excc-pt Spt.3 ( 2 p ) ;tnd Khp1 panels, \vhich h;ld pSR7 (c-nmy-.V'7'A'/ 2 p ) and pSRl3f ( I l,Al-.S/y/'3/!?p).I n addition, a11 strains containcd cithrr plWO.5 ( ( k t ) o r pSR78 ((kt-.SPT20) as noted.

SptZO/Ada5 is physically associated with Spt3, Sptir, Spt8and TBP: Previous genetic and biochc.tnic;~lresults stronglysuggestedthat Spt3 interacts with TRP ( EISESMASSP/ 01. 1992).Thcrcforc, we wanted t o detc-rmine whetherSpt20, Spt'i and Spt8were also physically associated with Spt3 andTRP. To dothis, w e rxprcsscd a Gst-Spt'LOfusion protein in yeast and assayed its physical association with these Spt proteins and TRP. The Gst-Spt2O fusion is functional in uiao since it complcments an sj,/2OA mutation (data not shown). Our results demonstrate that Gst-Spt'LO physically associates with Spt3, Spt7, Spt8 and TRP (Figure 1). The associations are specific for Spt2O since none o f these proteins hound to spt3A > gcn5A > spt2OA. Finally, previous studies demonstrated that spt2OA and gcn5A mutants, but not spt3A mutants, have an Ada- phenotype (resistance to the toxicity caused by overexpression of Gal4 VP16) (MARCUS et aL 1996). In summary, the spt20A mutant has the largest number of mutant phenotypes, and in most cases where they display similar mutant

S A G A Frlnctiomal Inrcmctions

4.5!)

a

A.

Q

A.

d

d

m S ?

.-

g &

%

Q %

%

m

&

complete -lysine

1,

Cl"

-inositol

m

YPgalactose

B.

wild-type

FIGUREJ.-gcn ?A sn//.wi h u t n o t p t i A sd)/mcdi;rtor double mutmts arc syntI1rtic:rlly sick. \'c.ast strains FYI 333. NI354, R'13fi0, and IT1332 (..I)or Wfi30, R'I292, kYl3lO. and R'I 363 (R) were strc-irkrtl o n rich \TI) medii1 ;rnd grown for 3 clays at 30'. phenotypes, the spr204 phcnot\.pcs a r c generally m o r e severe than cithcrthe s/)134 or gm51 phenotypes. These results suggrst that different SAGA members do not contribute cq11all! to a c o m m o n f h c t i o n . Genetic interactions between srb/mediator and snf/ swimutations: Sincc s/lt2OAand .s/l174 mutations cm~sc synthctic lethalit\. with both .srh/mediator and .snf/.s7oi mutations, wc wanted to examine genetic interactions between representative Snf/Swi and Srh/mediator fmctions. \Ye have ohsencd thrce types of interactions between the s77f/.s7vi;1nd .sdl/mediator mutants that were tested (Table 4). First, .sn/24 and n o i 1 4 mutations are

F ~ ~ x ' R4.--