Ethylene-orchestrated circuitry coordinates a ... - Semantic Scholar

INAUGURAL ARTICLE

Ethylene-orchestrated circuitry coordinates a seedling’s response to soil cover and etiolated growth Shangwei Zhonga,b, Hui Shia,b, Chang Xuea, Ning Weib,1, Hongwei Guoa,1, and Xing Wang Denga,b,1 a

Peking–Yale Joint Center for Plant Molecular Genetics and Agro-biotechnology, National Key Laboratory of Protein and Plant Gene Research, and Peking–Tsinghua Center for Life Sciences, College of Life Sciences, Peking University, Beijing 100871, China; and bDepartment of Molecular, Cellular, and Developmental Biology, Yale University, New Haven, CT 06520 This contribution is part of the special series of Inaugural Articles by members of the National Academy of Sciences elected in 2013.

The early life of terrestrial seed plants often starts under the soil in subterranean darkness. Over time and through adaptation, plants have evolved an elaborate etiolation process that enables seedlings to emerge from soil and acquire autotrophic ability. This process, however, requires seedlings to be able to sense the soil condition and relay this information accordingly to modulate both the seedlings’ growth and the formation of photosynthetic apparatus. The mechanism by which soil overlay drives morphogenetic changes in plants, however, remains poorly understood, particularly with regard to the means by which the cellular processes of different organs are coordinated in response to disparate soil conditions. Here, we illustrate that the soil overlay quantitatively activates seedlings’ ethylene production, and an EIN3/EIN3-like 1–dependent ethylene-response cascade is required for seedlings to successfully emerge from the soil. Under soil, an ERF1 pathway is activated in the hypocotyl to slow down cell elongation, whereas a PIF3 pathway is activated in the cotyledon to control the preassembly of photosynthetic machinery. Moreover, this latter PIF3 pathway appears to be coupled to the ERF1-regulated upward-growth rate. The coupling of these two pathways facilitates the synchronized progression of etioplast maturation and hypocotyl growth, which, in turn, ultimately enables seedlings to maintain the amount of protochlorophyllide required for rapid acquisition of photoautotrophic capacity without suffering from photooxidative damage during the dark-to-light transition. Our findings illustrate the existence of a genetic signaling pathway driving soil-induced plant morphogenesis and define the specific role of ethylene in orchestrating organ-specific soil responses in Arabidopsis seedlings. plant hormone ethylene

In the absence of light signals, the growth modulation of etiolated seedlings is determined by the coaction of a variety of plant hormones (12–16). For example, Gibberellin (GA) is known to promote hypocotyl elongation and repress photomorphogenic gene expression in darkness within the context of the etiolation program (17–19). The mechanism by which seedlings monitor soil depth and texture, and modulate their growth pattern accordingly, however, remains poorly understood. Previous research has suggested that ethylene gas is likely to play an important role in modulating plant growth and development, particularly in light of the fact that ethylene, as the smallest plant hormone, can rapidly spread throughout the plant (10, 20–26). Ethylene is perceived by five receptors that are related to bacterial two-component regulators (27–29), whereas the biological responses to ethylene are known to be mediated by ethylene insensitive 3 and ethylene insensitive 3-like 1 (EIN3/EIL1) (30–33), two plant-specific transcription factors that are rapidly induced by ethylene at the protein level (34–36). Loss of EIN3/EIL1 function has been known to lead to complete insensitivity to ethylene (37, 38). In early physiological experiments, pea seedlings and bean roots have been shown to produce an increased amount of ethylene in response to mechanical stress (39, 40), whereas ethylene pathway mutants are found to exhibit defects in their soil emergence capabilities (41). Moreover, ethylene has also been shown to induce dramatic morphological changes known as “the triple response” on typical dark-grown seedlings (20, 38, 42). These changes include inhibition of hypocotyl and root elongation, radial swelling (horizontal growth) of hypocotyl Significance

| chlorophyll biosynthesis | ROS | cell death

Seedlings’ ability to both adapt to their soil environment and acquire photoautotrophic capacity under various buried conditions is a life-or-death issue for terrestrial flowering plants. By designing and utilizing a standardized real-soil assay, we identify the key features of germinating seedlings’ soil response and deduce that the gaseous phytohormone ethylene acts as the primary regulator of soil-induced plant morphogenetic changes. Moreover, our study illustrates that an EIN3/ EIL1-conducted PIF3–ERF1 molecular circuitry enables seedlings to synchronize the rate of protochlorophyllide biosynthesis with upward growth, a mechanism critical to the prevention of photooxidative damage during seedlings’ initial transition from dark to light in natural conditions.

T

errestrial flowering plants often drop their seeds under soil or litter, which serves to protect the propagation process from hostile conditions such as cold temperatures and/or predators (1–3). As a result of this soil cover and/or dense canopy, seeds often germinate in subterranean darkness. Unlike seedlings that undergo germination in the light, which immediately undergo photomorphogenesis, seedlings that germinate under soil follow an adaptive growth program known as skotomorphogenesis or etiolation (4–6). When seedlings finally emerge from soil, light terminates the etiolation program and activates the conversion of etioplasts to chloroplasts, which, in turn, enable the plants to gain photoautotrophic ability (7, 8). This transition from darkness to light is a point of particular vulnerability in the life cycle of a higher land plants, however, due to the fact that light energy absorbed by protochlorophyllide (Pchlide) (a precursor of chlorophyll) is extremely phototoxic and can potentially cause seedling death by light-induced photooxidative damage (6, 9–11). To deal with these obstacles, higher land plants have adapted an elaborate etiolation program that allows for precise control of the progression of etioplast development before their conversion into chloroplasts. www.pnas.org/cgi/doi/10.1073/pnas.1402491111

Author contributions: S.Z., N.W., H.G., and X.W.D. designed research; S.Z., H.S., and C.X. performed research; S.Z., H.S., N.W., H.G., and X.W.D. analyzed data; and S.Z., H.S., N.W., H.G., and X.W.D. wrote the paper. The authors declare no conflict of interest. 1

To whom correspondence may be addressed. E-mail: [email protected], ning. [email protected], or [email protected].

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1402491111/-/DCSupplemental.

PNAS Early Edition | 1 of 8

PLANT BIOLOGY

Contributed by Xing Wang Deng, February 10, 2014 (sent for review January 2, 2014)

cells, and exaggeration of the apical hook (20, 43). This “triple response” seedling morphology is thought to optimize the seedling’s ability to push through the soil without damaging its shoot meristem. Nonetheless, little is known about the specific role of ethylene plays over the course of etiolation program under soil. Here, we demonstrate that the documented “triple response” is actually an adaptive response to soil overlay, and that ethylene is the primary mediator of plants’ soil response during growing out of soil. In soil-induced etiolation program, EIN3/EIL1 acts a point of convergence from which cellular activities of the cotyledon and hypocotyl are coordinated in accordance to the depth and texture of the soil in which a seedling finds itself. Once activated by the soil, EIN3/EIL1 stimulates ethylene response factor (ERF1) in the hypocotyl, which, in turn, inhibits cell elongation and slows down the upward-growth rate. Similarly, EIN3/EIL1 concurrently activates phytochrome-interacting factor 3 (PIF3) in the cotyledon to repress Pchlide biosynthesis, and thus cope with the extended time in subterranean darkness. As a result of this synchronized mechanism, the progression of the Pchlide accumulation is optimized so as to ensure seedlings rapidly acquire photosynthetic capacity without experiencing photooxidative damage once they emerge from the soil. Results Soil Overlay Quantitatively Activates Ethylene Production and EIN3 Protein Accumulation. To examine how Arabidopsis seedlings re-

spond to various buried conditions, we designed a set of convenient and highly reproducible soil assays with which we monitored the emergence of seedlings from soil of divergent depth and texture (Fig. S1). We found that soil induced ethylene production in Arabidopsis seedlings in a manner that correlated with the depth and firmness of the soil (Fig. 1A). To monitor the in planta activity of ethylene signaling activity in real time, we generated EIN3p:EIN3-Luciferase/ein3eil1 transgenic plants, in which the EIN3-Luciferase fusion protein driven by the EIN3 native promoter was expressed in ein3eil1 (Fig. 1B). As indicated by the heat map images shown in Fig. 1B, EIN3 protein levels were observed to dramatically increase over the course of etiolated seedlings’ growth through the soil overlay. Similarly, this increase in the EIN3 protein level was also observed to correlate with the depth of the soil (Fig. 1B). Thus, it appears that ethylene signaling activity can be sensitively and effectively induced by the presence of soil.

Fig. 1. Soil overlay quantitatively activates ethylene production and the endogenous level of EIN3 protein, which is essential for soil-induced morphogenetic changes in seedlings. (A) Ethylene production from 4-d-old dark grown Col-0 seedlings on MS medium without soil covering (0 mm) or buried under soft soil (silicon powder) or firm soil (sand) of indicated depth. Mean ± SD; n = 3. (B) Image analysis of 4-d-old dark grown EIN3p:EIN3-Luciferase/ ein3eil1 seedlings under white light (Left) or bioluminescence (Right). The bioluminescence of EIN3p:EIN3-Luciferase/ein3eil1 indicates the EIN3 protein level. The seedlings were grown on MS medium without soil (No soil) or buried in 1 or 2 mm of soft soil. The color-coded bars display the intensity of luciferase activity. Two independent T2 transgenic lines #7 and #20 were used. Hypocotyl phenotypes (C) and hypocotyl length (D) of 5-d-old etiolated Col-0 and ein3eil1 seedlings on MS medium without soil (0 mm), buried in 2 mm (2 mm) or 3 mm (3 mm) of firm soil. Mean ± SD; n ≥ 20. (E) Hypocotyl length of 5-d-old etiolated Col-0 and ein3eil1 seedlings on MS medium without ACC (0 μM), with gradient of ACC (0.1 or 1 μM). Mean ± SD; n ≥ 20.

We next observed how soil overlay influenced the growth pattern of seedlings. In comparison with soil-free etiolated seedlings, seedlings growing through soil overlay exhibited a morphology characterized by a shorter, thicker hypocotyl with a distinct apical hook (Fig. 1C). Furthermore, the severity of these morphological changes was observed to increase with soil depth (Fig. 1 C and D). No changes were observed, however, in the ethylene pathway of the ein3eil1 mutant (Fig. 1 C and D), which suggests that the inducement of soil-elicited morphological change is dependent on the function of EIN3/EIL1. Moreover, the soil-induced phenotype was observed to be phenocopied in soil-free seedlings treated with 1-aminocyclopropane-1-carboxylic acid (ACC), a biosynthetic precursor of ethylene (Fig. 1E) (also see Fig. 4D). These observations suggest not only that ethylene is required for soil-induced growth modification but also that it can, on its own, induce comparable growth responses in etiolated seedlings.

seedlings failed to emerge from 3 mm of firm soil (Fig. 2 A–D). Taken together, these results demonstrate that the EIN3dependent ethylene pathway is essential to seedlings’ successful emergence from soil. Interestingly, when ein3eil1 mutant seeds were germinated in the light without soil covering, the seedlings’ survival rate were comparable to that of the WT (Fig. 2 A–D). This result indicates that ethylene signaling is imperative to the seedling growth process only when the germinating seedlings are buried in soil. The survival of soil-covered seedlings hinges on their ability to both break through the soil and turn green upon exposure to light. Although almost 100% of the WT seedlings effectively penetrated their soil cover, less than 50% of ein3eil1 seedlings grown under the same soil overlay in darkness were observed to successfully emerge (Fig. 2E), indicating that the mutants were less capable of penetrating the soil. In addition, after the plates were transferred into light for an additional 2 d, those ein3eil1 seedlings that had made it to the soil surface died on account of photobleaching (Fig. 2F). Thus, ethylene signaling appears to be important for two different processes of etiolation growth: strengthening of the hypocotyl to better penetrate the soil, and preventing photooxidation of the cotyledons.

Ethylene Signaling Is Critical for Seedlings Germinating Under Soil Cover. To address the functional significance of the ethylene–

Soil Overlay Activates Gene Expression of ERF1 in the Hypocotyl and PIF3 in the Cotyledon. Given that previous research has shown that

EIN3 pathway under soil conditions, WT and ein3eil1 seeds were buried at different depths (Fig. 2 A and B) or within different textures (Fig. 2 C and D) of soil. The seeds were then grown for 7 or 9 d under long-day conditions (16 h light/8 h dark). In contrast to WT seedlings, which successfully emerged from 3 mm of firm soil, the survival rate of ein3eil1 seedlings was observed to drastically decrease with increasing soil depth (Fig. 2 A and B) and firmness (Fig. 2 C and D). Similarly, almost all of the ein3eil1

ERF1 represses hypocotyl elongation in etiolated seedlings (26, 44) and that PIF3 is known to play a role in regulating the greening process (45–47), we examined the soil-dependent activation of ERF1 and PIF3 in different seedling organs. Using reporter transgenic plants ERF1p:GUS and PIF3p:GUS in our soil assays, we found that soil overlay dramatically stimulated ERF1 gene expression in the hypocotyl and increased PIF3 expression most strongly in the cotyledon (Fig. 3 A and B).

The Soil Responses of Etiolated Seedling Are Dependent on EIN3/EIL1.

2 of 8 | www.pnas.org/cgi/doi/10.1073/pnas.1402491111

Zhong et al.

INAUGURAL ARTICLE

ERF1 acts downstream of EIN3/EIL1 and mediates the repressive effect of ethylene on hypocotyl cell elongation.

Fig. 2. EIN3/EIL1 is critical to seedlings’ emergence from soil and survival. Phenotypes (A) and survival percentage (B) of Col-0 and ein3eil1 seedlings on MS medium without soil (0 mm), buried in 2 or 3 mm of firm soil and grown under white light for 7 d. Mean ± SD; n = 3. Phenotypes (C) and survival percentage (D) of Col-0 and ein3eil1 seedlings grown on MS medium without soil (0 mm), buried in 3 mm of silicon powder (soft soil) or 3 mm of sand (firm soil), and grown under white light for 9 d. Mean ± SD; n = 3. (E) Percentages of etiolated seedlings emerging from the soil for Col-0 and ein3eil1 seedlings on MS medium without soil (0 mm) or buried in 3 mm of firm soil (3 mm). The seedlings were grown in the dark for 5 d, and the percentage of seedlings that successfully emerged from the soil was calculated. Mean ± SD; n = 3. (F) Greening percentage of Col-0 and ein3eil1 seedlings on MS medium without soil (0 mm) or buried in 3 mm of firm soil (3 mm). The seedlings were grown in the dark for 5 d and then irradiated with white light for an additional 2 d. Mean ± SD; n = 3.

tion process is the regulation of cotyledon greening, which determines whether seedlings turn green or are killed by photobleaching after their initial exposure to light (6, 9, 10). After being transferred to light, ERF1ox exhibited a normal cotyledon greening response (Fig. S3), which suggests that the initiation of chlorophyll biosynthesis is not regulated by the ERF1-mediated pathway. Previous research has demonstrated that PIF3 plays a critical role in regulating the greening process (45–47). In light of the findings that EIN3/EIL1 is required for cotyledon greening (10, 48) and that PIF3 is activated by soil and ethylene in the cotyledon (Fig. 3 B and D), we set out to determine whether the function of PIF3 is driven by ethylene during chlorophyll biosynthesis. Over the course of our greening experiment, which was conducted with 5-d-old seedlings transferred from dark to light, both ein3eil1 and pif3ein3eil1 mutants underwent photobleached cell death with a high level of reactive oxygen species (ROS) accumulation (Fig. 5 A–C and Fig. S4). The mutants of pif3 also perished on account of photooxidative damage, regardless of their ACC treatment status (Fig. 5 A–C and Fig. S4). Overexpression of PIF3, however, was able to rescue the greening defect of ein3eil1 (Fig. 5 A–C and Fig. S4). Thus, it appears that EIN3/ EIL1’s regulation of the greening process is mediated through PIF3. Interestingly, although the pif3 mutants suffered photooxidative damage in the cotyledons, they displayed normal hypocotyl growth in response to ACC treatment (Fig. 5D and Fig. S5). These results thus indicate that the processes of cotyledon greening and hypocotyl elongation are regulated via separate pathways. EIN3/EIL1 Represses Pchlide Biosynthesis Through PIF3. Overaccumulation of Pchlide is known to cause photooxidative damage to etiolated seedlings during the greening process (9, 49, 50). To investigate whether the photobleaching death of pif3 and ein3eil1 was caused by Pchlide overaccumulation, we examined the expression of specific genes in these mutants known to be involved in Pchlide and chlorophyll biosynthesis. HEMA1 is known to encode the first committed enzyme of the chlorophyll biosynthesis pathway of higher land plants (Fig. 6A) (51–53), whereas genomes uncoupled 4/5 (GUN4/GUN5) are known to determine

Ethylene was also observed to have similar effects on the same reporters (Fig. 3 C and D) and was found to activate the expression of both of these genes via an EIN3/EIL1-dependent pathway in etiolated seedlings (Fig. S2). Taken together, these results suggest that ERF1 and PIF3 may play a role in modulating hypocotyl growth and cotyledon development, respectively, during seedlings’ adaptation to their soil environment. ERF1 Acts Downstream of EIN3/EIL1 to Mediate Ethylene-Inhibited Hypocotyl Cell Elongation. Given that ethylene (ACC) treatment

is able to elicit soil-dependent growth responses in etiolated seedlings, we used ACC treatment to mimic soil-induced phenotypic changes during our additional mechanistic studies. To elucidate the role of ERF1 in hypocotyl growth, we generated inducible ERF1 transgenic plants (pER8-ERF1) that expressed ERF1-MYC in a β-estradiol concentration-dependent manner (Fig. 4A). As the expression of ERF1-MYC was increased in etiolated seedlings, the hypocotyls appeared to be progressively stunted (Fig. 4B). The observed effect of induced ERF1 inhibition on hypocotyl elongation resembled the effect of soil or ethylene (ACC) on the hypocotyl cell elongation of etiolated seedlings (Figs. 4 C and D and 1 C–E). Moreover, constitutive overexpression of ERF1 in ein3eil1 mutants (ERF1ox/ein3eil1) was found to override the ein3eil1 phenotype, and thus converted the long hypocotyl characteristic of a deficient ethylene response to the shortened hypocotyl characteristic of a constitutive ethylene response (Fig. 4E). These results thus demonstrate that Zhong et al.

Fig. 3. Soil overlay dramatically stimulates ERF1 and PIF3 expression, whereas the comparable expression can be attained using exogenous ethylene treatment and no soil. GUS staining images of 4-d-old dark grown ERF1p:GUS (A) and PIF3p:GUS (B) seedlings on MS medium without soil (0 mm) or buried in 3 mm of firm soil (3 mm). (C) GUS staining of 3-d-old darkgrown ERF1-promoter:GUS (ERF1p:GUS) seedlings on MS with or without 10 μM ACC. The #1 and #11 are two independent T2 transgenic lines of ERF1p: GUS. (D) GUS staining of 3-d-old dark grown PIF3-promoter:GUS (PIF3p:GUS) seedlings. The seedlings were grown on MS (Air) or on MS treated with ∼20 ppm ethylene (Ethylene).


PLANT BIOLOGY

PIF3 Acts Downstream of EIN3/EIL1 to Prevent Light-Induced Photooxidation. One of the central components of the deetiola-

Fig. 4. ERF1 acts downstream of EIN3/EIL1 to mediate ethylene-inhibited hypocotyl cell elongation. (A) β-Estradiol–induced expression of ERF1-MYC in pER8ERF1#7 as shown by the anti-MYC immunoblot in 4-d-old etiolated seedlings. (B) β-Estradiol–dependent inhibition of hypocotyl growth in 4-d-old etiolated seedlings. Mean ± SD; n ≥ 20. (C) Propidium iodide (PI) staining hypocotyl cell wall of 4-d-old etiolated seedlings shows inhibition of cell elongation treated with 10 μM ACC or 10 μM β-estradiol. DMSO was added in the same amount in uninduced control. (D) Hypocotyl phenotype of 4-d-old etiolated seedlings treated with 10 μM ACC or 10 μM β-estradiol. The pER8-ERF1#7 and #27 are two independent T2 transgenic lines. (E) Hypocotyl length of 4-d-old dark-grown seedlings on MS with or without 10 μM ACC. The #22 and #31 are two independent T2 transgenic lines of ERF1ox/ein3eil1. Mean ± SD; n ≥ 20.

the branch pathways leading to Pchlide/chlorophyll synthesis (54– 56). As a result of chlorophyll synthesis occurring in the dark, a pool of Pchlide accumulates in the etioplasts. Upon exposure to light, this accumulated Pchlide is then rapidly converted to chlorophyll by Pchlide oxidoreductases (PORs) (encoded by PORA,B,C genes). This chlorophyll, in turn, enables the plant to instantly achieve photoautotrophic capacity (9, 10, 57). PIF3 has previously been reported to inhibit the expression of HEMA1, GUN4, and GUN5 (45, 46). Here, we found that the expression of these genes was stimulated in both the pif3 and ein3eil1 mutants in darkness (Fig. 6B). Unlike pif3, however, ein3eil1 also exhibited a markedly reduced expression of PORA and PORB (Fig. S6). These results thus suggest that EIN3/EIL1 suppresses Pchlide biosynthesis via PIF3, but activates PORA and PORB independently of PIF3. We next measured the degree of Pchlide accumulation in ein3eil1 and pif3 etiolated seedlings. Our results indicated that far more Pchlide was accumulated in ein3eil1 than the WT. Furthermore, an even higher level of Pchlide was accumulated in pif3, which displayed Pchilide levels comparable to the pif3ein3eil1 triple mutant (Fig. 6 C and D). Consistent with the observed greening phenotypes of ein3eil1 and PIF3ox/ein3eil1 (Fig. 5A), overexpression of PIF3 (PIF3ox) was found to dramatically decrease the Pchlide levels in ein3eil1, and fully rescue ein3eil1 in terms of Pchlide accumulation (Fig. 6 C and D). These data thus suggest that PIF3 plays a key role in the ethylene-mediated suppression of Pchlide biosynthesis. Ethylene-Orchestrated PIF3–ERF1 Circuitry Optimizes Seedling Survival in a Variety of Buried Environments. Although it is logical

that ethylene responds to soil pressure by modulating the hypocotyl growth pattern (via ERF1), it is intriguing that ethylene also appears to actively repress Pchlide biosynthesis (via PIF3). Consequently, we next investigated whether the coregulation of cotyledon 4 of 8 | www.pnas.org/cgi/doi/10.1073/pnas.1402491111

development and hypocotyl growth in response to soil condition is a particularly advantageous adaptive response for plants. Although the pif3 mutant was observed to suffer from photooxidative damage to its cotyledons, this mutant displayed a normal ethylene response with regard to hypocotyl growth (Fig. 5 and Fig. S5). Similarly, although ERF1ox displayed repressed hypocotyl elongation, it developed a normal cotyledon during the greening process (Fig. S3). Consequently, these results seem to indicate that PIF3-regulated cotyledon greening and ERF1mediated hypocotyl elongation are two independent pathways that are orchestrated downstream of EIN3/EIL1. Nonetheless, given that the ERF1 and PIF3 pathways are activated by the same stimulus, it seems likely that these two pathways are regulated in a synchronized manner. We next examined whether the coregulation of the PIF3 and ERF1pathways is necessary for seedlings’ adaptation to their soil environment. Prior research has shown that firm, deep soil induces more ethylene production than soft soil (Fig. 1A). Given that both soil and exogenous ACC treatment have both been shown to comparably activate ERF1 and PIF3 expression (Fig. 3 and Fig. S2), we used ACC treatment to simulate the firmness of different soil conditions. In the absence of ACC treatment (simulation of soft soil), dark-grown seedlings that had reached a stipulated length (to simulate depth of soil) within 4 d of growth were transferred into light. Upon exposure to light, approximately one-half of the pif3 seedlings died from photobleaching due to their lack of PIF3 activity (Fig. 7A). Overactivation of ERF1 resulted in ERF1ox exhibiting slower hypocotyl growth than the WT. Specifically, ERF1ox required 7 d to reach a hypocotyl length comparable to that which the WT achieved in 4 d. Furthermore, due to the lack of corresponding compensation of the PIF3 pathway in repressing etioplast maturation, one-half of the seedlings were photobleached upon irradiation with light (Fig. 7A). In the presence of ACC, which was used to mimic firm soil, seedlings required an extended time period (6 d) to attain hypocotyl lengths that were comparable to the 4-d-old WT. Although most WT seedlings were observed to still green normally, all of the pif3 seedlings died due to photobleaching (Fig. 7A). We further examined the effect of simulated soil depths on seedling growth. To accomplish this task, seedling hypocotyls were allowed to grow to different lengths in the dark (from 5.5 to 15 mm to simulate soil depth) before being transferred to the light (Fig. 7B). Under soft soil conditions [in this case, Murashige and Skoog (MS) medium], less ethylene was produced and WT seedlings were able to turn green at hypocotyl lengths up to 15 mm (Fig. 7B). In firm soil (in this case, MS with ACC supplement), only a slight reduction in the greening percentage was observed when seeds were buried deeper than 10 mm (Fig. 7B). In contrast, abolishing the PIF3 pathway (pif3) and constitutively activating ERF1 (ERF1ox) were observed to render the seedlings hypersensitive to simulated soil depths of greater that 5.5 mm (Fig. 7B). Therefore, it appears that seedlings, with either a constitutively activated ERF1 pathway or a defective PIF3 pathway, face a clear disadvantage in terms of greening when they are grown in either soft or firm soil at a simulated depth greater than 5.5 mm. Genetically Reconstructing PIF3–ERF1 Circuitry in an EthyleneInsensitive Mutant Restores a Normal Ethylene Response. Finally,

to further determine the role of the PIF3–ERF1 circuitry in mediating seedlings’ survival as they emerge from soil, we artificially reconstructed the PIF3 and ERF1 pathways in an ethyleneinsensitive ein3eil1 mutant background. Our results demonstrated that overactivation of ERF1 in ein3eil1 (ERF1ox/ein3eil1) constitutively suppressed hypocotyl elongation to such an extent that 6 d of growing time were required for ERF1ox/ein3eil1 seedlings to attain the same hypocotyl length that ein3eil1 seedlings reached within 4 d. Upon exposure to light, almost all of the ERF1ox/ein3eil1 seedlings died due to photobleaching (Fig. 7 C and D). Importantly, however, although seedlings in which both PIF3 and ERF1 had been artificially coactivated (ein3eil1/PIF3ox/ ERF1ox) still required a longer growth period (6 d) to attain Zhong et al.

INAUGURAL ARTICLE

a hypocotyl length comparable to the WT, these seedlings still successfully turned green at a percentage comparable to WT (Fig. 7 C and D). In fact, the ein3eil1/PIF3ox/ERF1ox seedlings exhibited a phenotype that resembled that of ethylene-treated WT (Fig. 7 C and D). This result thus demonstrates that when the ERF1 pathway is activated by either soil or ethylene, coactivation of PIF3 is absolutely crucial to seedlings’ ability to survive the greening process. PIF3–ERF1 Circuitry Provides a Genetic Foundation for Germinating Seedlings to Adapt to Both Etiolation and Deetiolation Processes.

The importance of PIF3 and ERF1 coactivation is due to the fact that the ERF1-controlled hypocotyl elongation rate ultimately determines the duration of etiolation. Given that Pchlide continuously accumulates in the cotyledons throughout the entire etiolation period (Fig. 7E), ethylene’s suppression of the rate of Pchlide accumulation and hypocotyl elongation must be coactivated, which is

crucial to seedlings’ ability to survive in different buried environments. Therefore, breaking the coregulation of PIF3–ERF1 circuitry by constitutive activation of the ERF1 pathway only, which causes prolonged period of dark growth but without repressing Pchlide biosynthesis accordingly, or mutation of PIF3 pathway that abolishing the repression of Pchlide accumulation, could result in lethal photooxidative damage upon light irradiation. The etiolation process in plants is terminated when seedlings are exposed to light, which induces the degradation of PIF3 (58– 60) (Fig. 7F), and thus leads to the derepression of Pchlide biosynthesis. In addition, light also stabilizes ERF1 protein (26) (Fig. 7F) to suppress hypocotyl elongation. Together, the repression of hypocotyl elongation and activation of chlorophyll biosynthesis make the seedlings be able to rapidly develop cotyledons, and thus achieve the capacity of photoautotrophic growth, once seedlings emerge from the soil.

Fig. 6. PIF3 mediates EIN3/EIL1-repressed Pchlide biosynthesis in etiolated seedlings. (A) A simplified schematic of the tetrapyrrole biosynthesis process in higher land plants. PɸB, phytochromobilin, shares a common biosynthetic pathway from glutamate to protoporthyrin IX (Proto IX) with chlorophyll. The glutamyl-tRNA reductase, encoded by HEMA1 gene, is the first committed enzyme and rate-limiting step in tetrapyrrole biosynthesis. The branching point from protoporthyrin IX to chlorophyll is catalyzed by the Mg-chelatase, which is regulated by genomes uncoupled 4 (GUN4) and GUN5. The photoreduction of Pchlide to chlorophyll is catalyzed by NADPH: Pchlide oxidoreductases (PORs) (encoded by PORA,B,C genes). (B) Quantitative RT-PCR showing the expression of key tetrapyrrole biosynthesis genes in 3-d-old dark-grown seedlings. Mean ± SD; n = 3. (C) Fluorescence of Pchlide in 4-d-old etiolated seedlings. (D) The Pchlide fluorescence at 634 nm of three biological replicates in 4-d-old dark-grown seedlings. Mean ± SD; n = 3.

Zhong et al.


PLANT BIOLOGY

Fig. 5. PIF3 acts downstream of EIN3/EIL1 to prevent lethal photooxidative damage upon light irradiation, and this pathway is independent of hypocotyl elongation. (A) Greening percentage of 5-d-old dark grown seedlings on MS with or without 1 μM ACC or 10 μM ACC, followed by 2 d of continuous white-light irradiation. Mean ± SD; n = 3. (B) Fluorescence microscopy images of ROS accumulation (indicated by H2DCFDA fluorescence) in the cotyledons of 5-d-old dark-grown seedlings on MS with or without 1 or 10 μM ACC, followed by 12 h of white-light irradiation. (C) Trypan blue staining of the cotyledons of 5-d-old dark-grown seedlings on MS with or without 10 μM ACC followed by 1 d of white-light irradiation. (D) Hypocotyl and cotyledon phenotypes of 5-d-old dark-grown seedlings on MS with or without 1 μM ACC or 10 μM ACC, followed by 2 d of continuous white-light irradiation.

Taken together, our results provide compelling genetic evidence that plants adapt to various buried conditions by using ethylene signaling to coactivate a PIF3–ERF1 circuitry that couples the rate of Pchlide accumulation to the hypocotyl elongation process. Discussion Although a great deal is known about how plant seedlings grow in the dark, little is known about how seedlings respond and adapt to the various soil conditions they may face. In addition, even less is known about the mechanisms by which these soil responses are integrated into the full etiolation program. By studying the effect of soil cover on the growth of Arabidopsis seedlings, we have identified ethylene as the primary mediator of soil responses during plant etiolation. Plants proportionally produce ethylene in response to soil pressure, and then use the ethylene signaling pathway to relay the information necessary for growth modulations in both the hypocotyl and cotyledons. Thus, we suggest that the ethylene-induced “triple response” (20, 43) is actually etiolated seedlings’ typical response to soil. Under the soil, the duration of dark growth time is determined by the rate of hypocotyl elongation and the depth of soil, which varies according the burial conditions a given seedling faces. The biosynthesis of Pchlide must also be precisely controlled so as to enable the rapid conversion of accumulated Pchilide into functional chlorophyll by light at the exact moment the shoots protrude from the soil surface. Underaccumulation of Pchilde can potentially delay a seedlings’ transition to photoautotrophic growth (6, 45), whereas overaccumulated Pchlide poses an even greater danger due to its lethal phototoxicity (6, 9). Our studies revealed that the EIN3/EIL1-directed PIF3–ERF1 circuitry synchronizes the mechanisms of cotyledon development and hypocotyl growth in response to different soil environments (Fig. 8). For example, seedlings were observed to produce a greater amount of ethylene under firmly packed soil than they did under soft soil. In turn, this ethylene, most likely via the ERF1 pathway, serves to strengthen the hypocotyl cell wall and slow down the hypocotyl elongation rate. At the same time, this increased ethylene also acts via the PIF3 pathway to repress Pchlide biosynthesis

and thus limit Pchlide accumulation. Both of these regulatory functions are crucial to plants’ ability to successfully emerge from the soil and survive the transition from dark to light. Overall, the ethylene-directed PIF3–ERF1 circuitry coordinates the transcription networks that govern a seedlings’ heterotrophic growth in preparation for its transition to the photoautotrophic phase. It has been hypothesized that photomorphogenesis is the default developmental pathway, whereas etiolation (skotomorphogenesis) is an adaptive developmental program that evolved later in plants (61). The majority of terrestrial seed plants germinate under the soil and thus initially grow in a subterranean, dark environment. To adapt to this reality, plants have developed the etiolation program. The process of etiolation both allows germinating seedlings to grow in darkness against the mechanical pressure of the soil and prepares the photosynthetic apparatus for the critical dark-to-light transition, so as to enable the plant to immediately acquire photoautotrophic capacity upon exposure to light. Our study indicated that ethylene plays an essential role in mediating the various soil responses throughout the etiolation process. Mutation of EIN3/EIN3-like 1 was observed to abolish seedlings’ soil response. In addition, we demonstrated that the morphological responses and tissuespecific gene expression of seedlings grown in soil are comparable to that exhibited by the WT under exogenous ethylene treatment without soil. Moreover, the ethylene pathway was also found to be not essential to plants’ ability to establish vegetative growth when the plants are germinated under light and without soil. Consequently, we suggest that plants developed the ethylene pathway as a means of specifically coping with the soil environment, at least at seedling stage. Although ethylene plays a variety of key regulatory roles over the course of plant development, including promoting both fruit ripening and the senescence of leaves and flowers (12, 20), based on our results, the ethylene pathway is crucial to the growth of etiolated seedlings only when they must push their way out from under the soil. Materials and Methods Plant Materials and Growth Conditions. All of the plants used in this study were Columbia-0 ecotype. The ein3eil1, pif3, pif3ein3eil1, PIF3ox, EIN3ox, ERF1ox,

Fig. 7. The coactivation of PIF3 and ERF1 is essential for etiolated seedlings’ ability to survive the darkto-light transition. (A) Hypocotyl lengths (mean ± SD; n ≥ 20) of etiolated seedlings grown on MS with or without 1 μM ACC for the indicated number of days (D4, D6, and D7 mean 4, 6, and 7 d grown in the dark) and their greening percentages (mean ± SD; n = 3) after being transferring to white light for an additional 2 d. (B) Greening percentage of etiolated seedlings on MS (/M) or M with 1 μM ACC (/A) as a function of the hypocotyl length at the time of being transferred from darkness to white light. Mean ± SD; n = 3. Phenotypes (C ) and the hypocotyl lengths (mean ± SD; n ≥ 20) with greening percentages (mean ± SD; n = 3) (D) of seedlings that were grown in the dark for the indicated number of days (D4 and D6 mean 4 and 6 d grown in the dark) and transferred to white light for an additional 2 d. The #3 and #4 are two independent T2 transgenic lines of ein3eil1/PIF3ox/ERF1ox. (E) Fluorescence of Pchlide (Pchlide) in WT seedlings grown in darkness for the indicated number of days. (F ) Light has opposing regulatory effects on the accumulation of PIF3 and ERF1 proteins. Immunoblots of PIF3-MYC and ERF1-MYC proteins (by anti-MYC antibody) in 5-d-old dark-grown ein3eil1/PIF3ox/ERF1ox#4 seedlings. Dark to light means that the etiolated seedlings were transferred into white light for 0–4 h. WL4 to D means after 4 h of white light exposure, the seedlings were transferred back to darkness for the indicated number of hours (hr). Ponceau S staining is used as a loading control.


Zhong et al.

Phenotype, Histochemistry, and Microscopy. Hypocotyl lengths were measured from the point at which the cotyledons join to the hypocotyl to the hypocotyl–root junction using ImageJ software. More than 20 seedlings were measured for each set of experiments. To determine the greening percentage, the seedlings were grown in darkness for the indicated number of days, and then exposed to continuous white light (120–150 μmol·m−2·s−1) for an additional 2 d. The greening percentage was then calculated by dividing the number of successfully greened seedlings by the total number of seedlings (10). More than 100 seedlings were examined each time with at least four biological repeats. After the etiolated seedlings had been irradiated with continuous white light for 24 h, the seedlings were collected to perform trypan blue staining. Samples were submerged in lactic acid phenol trypan blue (LPTB) solution (the LPTB solution was made by mixing 9.3 mL of not–water-saturated phenol, 10 mL of lactic acid, 10 mL of glycerol, and 10 mL of 10 mg/mL water-dissolved trypan blue stock; the solution was freshly prepared within a week of its use, and prewarmed to 65 °C before use). The samples were placed under vacuum for 5 min, and then allowed to return to normal atmospheric pressure for 5 min. The vacuum infiltration was repeated three times to remove air bubbles from the leaves. The samples were then placed into boiling water for 10 min. After the samples had been cooled to room temperature, the LPTB solution was removed, and 1 mL of chloral hydrate solution (25 g dissolved in 10 mL of ddH2O) was added. The samples were then gently shaken for 4–8 h to remove any unspecific staining. Multiple washes of chloral hydrate solution were used if necessary. Finally, the samples were mounted and photographed on a dissecting microscope with a CCD camera. For the histochemical β-glucuronidase (GUS) staining assays, seedlings were pretreated with 90% (vol/vol) acetone at −20 °C for 30 min, and then rinsed three times with a 1× PBS buffer. The pretreated seedlings were then incubated in the substrate buffer [1× PBS, 1 mM K3Fe(III)(CN)6, 0.5 mM K4Fe (II)(CN)6, 1 mM EDTA, 1% Triton X-100, and 1 mg/mL X-gluc] at 37 °C. After incubation, the seedlings were submerged in a graded series of ethanol treatments (30%, 70%, 95%) and stored in 95% (vol/vol) ethanol at 4 °C. Biological triplicates were performed for the two independent transgenic lines, and representative images were selected for each of these lines. Fluorescence microscopy images of ROS accumulation [indicated by 2′,7′dichlorodihydrofluorescein diacetate (H2DCFDA) fluorescence] in the cotyledons were captured after the 5-d-old dark-grown seedlings had been exposed to white light for 12 h. About 20 seedlings from each sample population were incubated in 0.8 mL of ROS staining solution (100 μM H2DCFDA in 10 mM Tris·HCl, pH 7.22) (Sigma) at room temperature. After being shaken on an incubator for 5 min in the dark, the staining solution was removed, and the seedlings were washed with 10 mM Tris·HCl (pH 7.22). The seedlings were then washed three times over the course of being shaken for 10 min at room temperature to eliminate any unspecific staining. Fluorescence microscopic images were captured using a DMI6000 B fluorescence microscope with a CCD camera (Leica). To examine the hypocotyl cell morphology, dark-grown seedlings were stained with 10 μg/mL propidium iodide (PI) (Sigma) for 5–10 min, washed with ddH2O, and then observed using a LSM 510 Meta confocal laser scanning microscope (Carl Zeiss). The wavelength for excitation was 535 nm, and a bandpass filter of 580–617 nm was used for emission. To measure the levels of Pchlide, 20 dark-grown etiolated seedlings were collected under a dim-green safe light, and soaked in 1 mL of extraction

Zhong et al.

INAUGURAL ARTICLE

Fig. 8. A working model for the integrated regulation of Pchlide accumulation and hypocotyl elongation in etiolated seedlings under soil. (Left) A diagram of the seedlings grown in different soil environments. (Right) The model showing the signaling pathway that enables seedlings to grow out of soil and survive the critical dark-to-light transition. After germination under soil, the etiolated seedlings produce ethylene in response to the mechanical stress of the soil. Through the EIN3/EIL1 proteins, ethylene activates a PIF3–ERF1 transcriptional circuitry to synchronize tissue-specific developments in etiolated seedlings. The ERF1 pathway most likely regulates hypocotyl cell elongation so that the etiolated seedlings can better penetrate the soil cover, whereas the PIF3 pathway simultaneously modulates the preassembly of photosynthetic machinery in the cotyledon. The coupling of these two processes enables seedlings to rapidly acquire photosynthetic capacity without being damaged by photooxidation during their initial transition from dark to light.

buffer [90% (vol/vol) acetone containing 0.1% NH3]. The pigments were then extracted in the dark at room temperature for 24 h. After the sample had been centrifuged, the fluorescence emission spectra of the supernatant were analyzed at room temperature. The excitation wavelength was 440 nm, and the emission spectra from 610 to 750 nm with a bandwidth of 1 nm were recorded. All Pchlide measurements were independently performed in biological triplicate, and representative results were shown. RNA Extraction and qRT-PCR. Total RNA was extracted from 3-d-old darkgrown etiolated seedlings using a Spectrum plant total RNA kit (Sigma) (3). The gene expression results were normalized according to a PP2A control gene using the primers shown in Table S1. EBF2, a known EIN3-regulated gene, was used as an ethylene activation control (65). All quantitative PCR experiments were independently performed in triplicate, and representative results with three technical replicas are shown in the figures of this paper. Soil Experiment. Seeds were surface sterilized and plated on a MS medium. The silicon dioxide powder (Sigma) and sand (50–70 mesh particle size; Sigma) were autoclaved, and the amounts were measured using a 50-mL Falcon tube. The silicon powder or sand was then evenly spread onto the agar medium to cover the plated seeds. Given that the area of the plate was ∼50 cm2, we measured out 5-, 10-, and 15-mL portions of powder or sand, and used them to form a cover over the seeds that was 1, 2, and 3 mm in depth, respectively. The plates were then placed in the dark for 3 d at 4 °C before being illuminated under white light for 6 h to induce germination. For the light-grown condition, the bottom and rim of the plate were covered with aluminum foil to prevent the roots from being exposed to light. The top of the plate was then illuminated with white light for the indicated number of days. For the dark-grown condition, the plates were incubated in darkness for the indicated number of days. For soil experiments, 150 seeds of each sample were plated with at least three biological repeats. The survival percentage of light-grown seedlings was calculated by dividing the number of green seedlings that successfully emerged from soil by the total number of plated seeds. Similarly, the percentage of dark-grown seedlings emerging from the soil was calculated by dividing the number of etiolated seedlings that grew out of soil after incubation in darkness for the indicated number of days by the total number of plated seeds. For the greening experiments, the plates were incubated in darkness for the indicated number of days, and then transferred into white light for an additional 2 d. Then greening percentage was calculated by dividing of number of successfully greened seedlings by the total number seedlings that emerged from soil. To examine the EIN3-Luciferase protein levels, EIN3p:EIN3-Luciferase/ein3eil1 transgenic plants were incubated under dark-grown conditions for 4 d. The plates were then washed three times with ddH 2O to remove the soil. Thirty milliliters of 0.5 M D-Luciferin potassium salt solution (BIOTIUM)


PLANT BIOLOGY

PIF3p:GUS (#7, 3 kb upstream of ATG), and PIF3ox/ein3eil1 lines have all been previously reported in the literature (10, 26, 62). To generate ERF1ox/ ein3eil1 and ERF1ox/PIF3ox/ein3eil1 lines, the full length of ERF1 coding DNA sequence (CDS) was amplified from cDNA of Col-0 and cloned into a pENTR/D-TOPO vector (Invitrogen). The entry vectors were then subcloned into gateway compatible binary vector pGWB17 (65) and transformed into ein3eil1 or PIF3ox/ein3eil1 plants. To generate ERF1p:GUS, the promoter of ERF1 was amplified from genomic DNA of Col-0 and cloned into a pENTR/DTOPO vector (Invitrogen). The entry vectors were then subcloned into gateway compatible binary vector pGWB3 (63) and transformed into Col0 plants. To generate EIN3p:EIN3-Luciferase/ein3eil1, the full length of EIN3 CDS without a stop codon was amplified from cDNA of Col-0, and connected to the promoter of EIN3 that had been amplified from genomic DNA of Col0. The EIN3p-EIN3 fragment was then further subcloned into a compatible binary vector and transformed to ein3eil1 plants. The ERF1 CDS, which was fused with a 4×MYC tag, was then cloned into a pER8-derived plasmid (64) to generate β-estradiol–induced ERF1 transgenic plants. Seeds were surface sterilized, and plated on a MS medium with a half dosage of MS salts and sucrose (2.2 g/L MS salt, 5 g/L sucrose, pH 5.7, and 8 g/L agar). The plates were then stored in the dark at 4 °C for 3 d before germination was induced by irradiating the plates with 6 h of white light at 22 °C.

were then added to the plate to submerge the seedlings, which were then incubated for 10 min in the dark. The luciferase bioluminescence images were obtained using a Xenogen IVIS Spectrum imaging system (Caliper). To measure the production of ethylene, seeds of ∼5 mg were evenly plated in 10-mL vials and covered with soil of varying depth and texture. After the seeds had been incubated under dark-grown conditions for 4 d, gas chromatography (6890N Network GC System; Agilent Technologies) was used to determine the amount of ethylene present in the headspace of the vials.

ACKNOWLEDGMENTS. We thank Abigail Coplin for critically reading the manuscript; Yanpeng Xi and Lei Wang for help in experiments; Dr. Dongqin Chen for help in trypan blue staining assay; Dr. T. Nakagawa for providing us the pGWBs vector; and Ying Zhu and Xiangzhong Sun for help in the ethylene amount determination. This work was supported by grants from National Natural Science Foundation (31330048), National Basic Research Program of China (973 Program) (2012CB910900), National Institutes of Health (GM-47850), and National Science Foundation (MCB-0929100) (to X.W.D.); and National Natural Science Foundation (91017010) and Ministry of Agriculture (2010ZX08010-002) of China (to H.G.). H.S. is a Monsanto fellow.

1. Bentsink L, Koornneef M (2008) Seed dormancy and germination. Arabidopsis Book 6: e0119. 2. Vaistij FE, et al. (2013) Differential control of seed primary dormancy in Arabidopsis ecotypes by the transcription factor SPATULA. Proc Natl Acad Sci USA 110(26):10866–10871. 3. Shi H, et al. (2013) HFR1 sequesters PIF1 to govern the transcriptional network underlying light-initiated seed germination in Arabidopsis. Plant Cell 25(10):3770–3784. 4. Koornneef M, Karssen CM (1994) 12 seed dormancy and germination. Cold Spring Harb Monogr Arch 27:313–334. 5. Von Arnim A, Deng XW (1996) Light control of seedling development. Annu Rev Plant Physiol Plant Mol Biol 47:215–243. 6. Huq E, et al. (2004) Phytochrome-interacting factor 1 is a critical bHLH regulator of chlorophyll biosynthesis. Science 305(5692):1937–1941. 7. Pudelski B, Soll J, Philippar K (2009) A search for factors influencing etioplast-chloroplast transition. Proc Natl Acad Sci USA 106(29):12201–12206. 8. Reinbothe C, Lebedev N, Reinbothe S (1999) A protochlorophyllide light-harvesting complex involved in de-etiolation of higher plants. Nature 397(6714):80–84. 9. Reinbothe S, Reinbothe C, Apel K, Lebedev N (1996) Evolution of chlorophyll biosynthesis—the challenge to survive photooxidation. Cell 86(5):703–705. 10. Zhong SW, et al. (2009) EIN3/EIL1 cooperate with PIF1 to prevent photo-oxidation and to promote greening of Arabidopsis seedlings. Proc Natl Acad Sci USA 106(50):21431–21436. 11. op den Camp RG, et al. (2003) Rapid induction of distinct stress responses after the release of singlet oxygen in Arabidopsis. Plant Cell 15(10):2320–2332. 12. Chang KN, et al. (2013) Temporal transcriptional response to ethylene gas drives growth hormone cross-regulation in Arabidopsis. Elife 2:e00675. 13. Sánchez-Rodríguez C, Rubio-Somoza I, Sibout R, Persson S (2010) Phytohormones and the cell wall in Arabidopsis during seedling growth. Trends Plant Sci 15(5):291–301. 14. Oh E, Zhu JY, Wang ZY (2012) Interaction between BZR1 and PIF4 integrates brassinosteroid and environmental responses. Nat Cell Biol 14(8):802–809. 15. Bai MY, et al. (2012) Brassinosteroid, gibberellin and phytochrome impinge on a common transcription module in Arabidopsis. Nat Cell Biol 14(8):810–817. 16. An F, et al. (2012) Coordinated regulation of apical hook development by gibberellins and ethylene in etiolated Arabidopsis seedlings. Cell Res 22(5):915–927. 17. Alabadí D, Gil J, Blázquez MA, García-Martínez JL (2004) Gibberellins repress photomorphogenesis in darkness. Plant Physiol 134(3):1050–1057. 18. Feng S, et al. (2008) Coordinated regulation of Arabidopsis thaliana development by light and gibberellins. Nature 451(7177):475–479. 19. de Lucas M, et al. (2008) A molecular framework for light and gibberellin control of cell elongation. Nature 451(7177):480–484. 20. Ecker JR (1995) The ethylene signal transduction pathway in plants. Science 268(5211): 667–675. 21. Johnson PR, Ecker JR (1998) The ethylene gas signal transduction pathway: A molecular perspective. Annu Rev Genet 32:227–254. 22. Smalle J, et al. (1997) Ethylene can stimulate Arabidopsis hypocotyl elongation in the light. Proc Natl Acad Sci USA 94(6):2756–2761. 23. Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR (1999) EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Science 284(5423):2148–2152. 24. Kieber JJ, Rothenberg M, Roman G, Feldmann KA, Ecker JR (1993) CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of protein kinases. Cell 72(3):427–441. 25. Zhu Z, et al. (2011) Derepression of ethylene-stabilized transcription factors (EIN3/ EIL1) mediates jasmonate and ethylene signaling synergy in Arabidopsis. Proc Natl Acad Sci USA 108(30):12539–12544. 26. Zhong S, et al. (2012) A molecular framework of light-controlled phytohormone action in Arabidopsis. Curr Biol 22(16):1530–1535. 27. Chang C, Stadler R (2001) Ethylene hormone receptor action in Arabidopsis. Bioessays 23(7):619–627. 28. Hua J, Chang C, Sun Q, Meyerowitz EM (1995) Ethylene insensitivity conferred by Arabidopsis ERS gene. Science 269(5231):1712–1714. 29. Chang C, Kwok SF, Bleecker AB, Meyerowitz EM (1993) Arabidopsis ethylene-response gene ETR1: Similarity of product to two-component regulators. Science 262(5133):539–544. 30. Chao QM, et al. (1997) Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related proteins. Cell 89(7):1133–1144. 31. Bleecker AB, Kende H (2000) Ethylene: A gaseous signal molecule in plants. Annu Rev Cell Dev Biol 16:1–18. 32. Chang C, Shockey JA (1999) The ethylene-response pathway: Signal perception to gene regulation. Curr Opin Plant Biol 2(5):352–358. 33. Yoo SD, Cho Y, Sheen J (2009) Emerging connections in the ethylene signaling network. Trends Plant Sci 14(5):270–279. 34. Gagne JM, et al. (2004) Arabidopsis EIN3-binding F-box 1 and 2 form ubiquitin-protein ligases that repress ethylene action and promote growth by directing EIN3 degradation. Proc Natl Acad Sci USA 101(17):6803–6808.

35. Guo H, Ecker JR (2003) Plant responses to ethylene gas are mediated by SCF(EBF1/ EBF2)-dependent proteolysis of EIN3 transcription factor. Cell 115(6):667–677. 36. Potuschak T, et al. (2003) EIN3-dependent regulation of plant ethylene hormone signaling by two arabidopsis F box proteins: EBF1 and EBF2. Cell 115(6):679–689. 37. Guo H, Ecker JR (2004) The ethylene signaling pathway: New insights. Curr Opin Plant Biol 7(1):40–49. 38. Chen YF, Etheridge N, Schaller GE (2005) Ethylene signal transduction. Ann Bot (Lond) 95(6):901–915. 39. Goeschl JD, Rappaport L, Pratt HK (1966) Ethylene as a factor regulating the growth of pea epicotyls subjected to physical stress. Plant Physiol 41(5):877–884. 40. Kays SJ, Nicklow CW, Simons DH (1974) Ethylene in relation to response of roots to physical impedance. Plant Soil 40(3):565–571. 41. Harpham NVJ, et al. (1991) The effect of ethylene on the growth and development of wild-type and mutant Arabidopsis thaliana (L) Heynh. Ann Bot (Lond) 68(1):55–61. 42. Zhao Q, Guo HW (2011) Paradigms and paradox in the ethylene signaling pathway and interaction network. Mol Plant 4(4):626–634. 43. Benavente LM, Alonso JM (2006) Molecular mechanisms of ethylene signaling in Arabidopsis. Mol Biosyst 2(3-4):165–173. 44. Solano R, Stepanova A, Chao QM, Ecker JR (1998) Nuclear events in ethylene signaling: A transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1. Genes Dev 12(23):3703–3714. 45. Stephenson PG, Fankhauser C, Terry MJ (2009) PIF3 is a repressor of chloroplast development. Proc Natl Acad Sci USA 106(18):7654–7659. 46. Shin J, et al. (2009) Phytochromes promote seedling light responses by inhibiting four negatively-acting phytochrome-interacting factors. Proc Natl Acad Sci USA 106(18): 7660–7665. 47. Monte E, et al. (2004) The phytochrome-interacting transcription factor, PIF3, acts early, selectively, and positively in light-induced chloroplast development. Proc Natl Acad Sci USA 101(46):16091–16098. 48. Zhong S, Shi H, Xi Y, Guo H (2010) Ethylene is crucial for cotyledon greening and seedling survival during de-etiolation. Plant Signal Behav 5(6):739–742. 49. Mochizuki N, et al. (2010) The cell biology of tetrapyrroles: A life and death struggle. Trends Plant Sci 15(9):488–498. 50. Buhr F, et al. (2008) Photoprotective role of NADPH:protochlorophyllide oxidoreductase A. Proc Natl Acad Sci USA 105(34):12629–12634. 51. Tanaka R, Kobayashi K, Masuda T (2011) Tetrapyrrole metabolism in Arabidopsis thaliana. Arabidopsis Book 9:e0145. 52. Goslings D, et al. (2004) Concurrent interactions of heme and FLU with Glu tRNA reductase (HEMA1), the target of metabolic feedback inhibition of tetrapyrrole biosynthesis, in dark- and light-grown Arabidopsis plants. Plant J 40(6):957–967. 53. Kumar AM, Söll D (2000) Antisense HEMA1 RNA expression inhibits heme and chlorophyll biosynthesis in Arabidopsis. Plant Physiol 122(1):49–56. 54. Tanaka R, Tanaka A (2007) Tetrapyrrole biosynthesis in higher plants. Annu Rev Plant Biol 58:321–346. 55. Adhikari ND, et al. (2011) GUN4-porphyrin complexes bind the ChlH/GUN5 subunit of MgChelatase and promote chlorophyll biosynthesis in Arabidopsis. Plant Cell 23(4):1449–1467. 56. Larkin RM, Alonso JM, Ecker JR, Chory J (2003) GUN4, a regulator of chlorophyll synthesis and intracellular signaling. Science 299(5608):902–906. 57. Moon J, Zhu L, Shen H, Huq E (2008) PIF1 directly and indirectly regulates chlorophyll biosynthesis to optimize the greening process in Arabidopsis. Proc Natl Acad Sci USA 105(27):9433–9438. 58. Leivar P, Quail PH (2011) PIFs: Pivotal components in a cellular signaling hub. Trends Plant Sci 16(1):19–28. 59. Al-Sady B, Ni W, Kircher S, Schäfer E, Quail PH (2006) Photoactivated phytochrome induces rapid PIF3 phosphorylation prior to proteasome-mediated degradation. Mol Cell 23(3):439–446. 60. Park E, et al. (2004) Degradation of phytochrome interacting factor 3 in phytochrome-mediated light signaling. Plant Cell Physiol 45(8):968–975. 61. Wei N, et al. (1994) Arabidopsis COP8, COP10, and COP11 genes are involved in repression of photomorphogenic development in darkness. Plant Cell 6(5):629–643. 62. Zhang Y, et al. (2013) A quartet of PIF bHLH factors provides a transcriptionally centered signaling hub that regulates seedling morphogenesis through differential expressionpatterning of shared target genes in Arabidopsis. PLoS Genet 9(1):e1003244. 63. Nakagawa T, et al. (2007) Development of series of gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transformation. J Biosci Bioeng 104(1):34–41. 64. Zuo J, Niu QW, Chua NH (2000) Technical advance: An estrogen receptor-based transactivator XVE mediates highly inducible gene expression in transgenic plants. Plant J 24(2):265–273. 65. Konishi M, Yanagisawa S (2008) Ethylene signaling in Arabidopsis involves feedback regulation via the elaborate control of EBF2 expression by EIN3. Plant J 55(5): 821–831.


Zhong et al.

Supporting Information Zhong et al. 10.1073/pnas.1402491111

Fig. S1. A diagram of how to prepare the buried seeds in the soil experiment. Col-0 and mutant seeds were surface sterilized and separately plated in the same MS medium plate. A precise amount of powder (soft soil) or sand (firm soil) was measured using a 50-mL Falcon tube and evenly spread on top of the medium, so as to cover the plated seeds. The images of both the front and back of the finished plates are shown.

Zhong et al. www.pnas.org/cgi/content/short/1402491111

1 of 4

Fig. S2. Ethylene activates the gene expression of ERF1 and PIF3 through EIN3/EIL1. (A and B) Quantitative RT-PCR showing the expression of ERF1 (A) and PIF3 (B) genes in 4-d-old dark-grown seedlings. The etiolated seedlings were grown on MS (/MS) or MS with 10 μM ACC (/ACC). The ethylene-insensitive mutant (ein2) and constitutive mutant (ctr1) were used as ethylene signaling pathway controls. Mean ± SD; n = 3.

Fig. S3. ERF1ox does not notably affect the greening process of etiolated seedlings upon exposure to light. Greening percentage of Col-0 and ERF1ox etiolated seedlings on MS with or without 10 μM ACC. The seedlings were grown in darkness for the indicated number of days (D3, D4, or D5) and then irradiated with white-light irradiation for an additional 2 d. Mean ± SD; n = 3.


2 of 4

Fig. S4. PIF3 acts downstream of EIN3/EIL1 to prevent photooxidative damage upon initial light irradiation. Cotyledon phenotypes of 5-d-old dark-grown seedlings on MS with or without 1 μM ACC or 10 μM ACC, followed by 2 d of continuous white-light irradiation.

Fig. S5. PIF3 does not visibly affect ethylene-repressed hypocotyl elongation. Hypocotyl lengths of 5-d-old dark-grown seedlings on MS with or without 1 μM ACC or 10 μM ACC, followed by 2 d of continuous white-light irradiation. Mean ± SD; n ≥ 20.


3 of 4

Fig. S6. EIN3/EIL1 regulates PORA, PORB, and EBF2 gene expression in a manner that is independent of PIF3. Quantitative RT-PCR showing the expression of POR genes in 3-d-old dark-grown seedlings. Mean ± SD; n = 3.

Table S1.

List of primers used in this study

Name RTM-HEMA1-F RTM-HEMA1-R RTM-GUN4-F RTM-GUN4-R RTM-GUN5-F RTM-GUN5-R RTM-PORA-F RTM-PORA-R RTM-PORB-F RTM-PORB-R RTM-PORC-F RTM-PORC-R RTM-EBF2-F RTM-EBF2-R RTM-PP2A-F RTM-PP2A-R RTM-ERF1-F RTM-ERF1-R RTM-PIF3-F RTM-PIF3-R


Sequence CAAGGAGTGAATGGCTTTGGGAG TCACAAGCTTCCCCATTTTTCCAG GGTAGATTCGGATACAGCGTGCA GCATTTCAGAAGCTGCGTTCCTC TTCTCCAAGTCAGCAAGTCCTCATC GGTAGCTTCAGAGGGATTGTTAGCT CAACGACTGGTTTGTTCAGAGAGC CAGCCACCACCTGAGCAAGTC CAAGAGTTTCACAGGCGTTTCC GTGCTCTCGGAATAAACCTGTGG TGGCTCTCCAAGCTGCCTATTCTC CGCGGCATTGCAGACAAGAACATC CTTTGGTTTAGGTTCGTGATAGTGC CGAAGAGTTGTAATGGCGGATTAAG GTGACTTGGTTGAGCATTTCACTCC GAGCTGATTCAATTGTAGCAGCAAACT ACCGCTCCGTGAAGTTAGATAATG ATCCTAATCTTTCACCAAGTCCCAC CTGAAAGGAGACGGCGTGATAG CAGATAGTAACCAGACGCCATTGAC

4 of 4