modulating HIV-1 promoter activity in uiuo. For ex- ample, induction of latent HIV-1 gene expression in re- sponse to superinfection by herpes simplex virus type ...
Vol.269,No. 33, Issue of August 19,pp. 21269-21276,
THEJOURNAL OF BIOLIXICALCHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc
1994
Printed in U.S.A.
Evidence That Levels of the Dimeric Cellular Transcription Factor CP2 Play Little Rolein the Activation of theHIV-1 Long Terminal Repeat in Vivo or following Superinfection with Herpes Simplex Virus Type 1” (Received forpublication, January 24, 1994, and in revised form, May 18, 1994)
Fengming ZhongS, Steven L. SwendemanS, Waldemar PopikP,Paula M. Pitha§, and Michael ShefferySn From the $Molecular Biology Program and the Graduate School of Medical Sciences, Cornell University, Memorial Sloan-Kettering Cancer Center, New York, New York 10021 and §the Oncology Center and the Department of Molecular Biology and Genetics, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21231
Thedimerictranscriptionfactor CP2 bindsa se- natural a-globin promoter template in a factor binding sitequence element found near the transcription start site dependent manner (Lim et a l . , 1993). Our analysis of the deof the human immunodeficiency virus(HIV-1) long ter- duced amino acid sequence of the cloned factor (Lim et al., minal repeat. Several groups have suggested that cellu1992) indicated that CP2 is relatedto a Drosophila transcriplar factors binding this element might play a role in et al., 1989,1991; tion factor termedElf-l/NTF-1(Bray modulating HIV-1 promoteractivity in uiuo. For ex- Dynlacht et al., 1989; hereafter termed simply Elf-11, and that ample, induction of latent HIV-1 gene expression in re- the region of CP2 most closely related to Elf-1 is localized 1 (predominantly) to a single exon in the murine and human sponse to superinfection by herpes simplex virus type is thought to be mediated, in factors (Swendemanet al.,1994). Additionalcharacterization of (HSV-1) or cytomegalovirus part, by factors binding the CP2 site. In this report we the cloned factor showed that CP2 recognizes a hyphenated began to examine directly the relationship between CP2 DNA sequence element composed of a pair of 4 base motifs and expression of the HIV-1 promoter. First, we tested separated by a linker of 5 or 6 bases (CNRG-No,-CNR(G/C); what effectHSV-1 infection of T cells had on the cellular levels of CP2. The results showed thatHSV-1 infection Lim et al. (1993)). We identified similar motifs that bound the of the y-fibrinogen, SV40 led to a significant reduction in the level of CP2 DNA bacterially expressed factor upstream virus (HIV-1)’ promoters late and human immunodeficiency binding activity and protein within 20 h. Next, we tested the effect of overexpressing either the wild-type factor (Swendeman et a l . , 1994). Independently, several groups have characterized a cellular or a dominant negative variant of CP2 on HIV-1 proCP2 had DNA binding activity, termed LBP-1, that interacts with a moter activityin uiuo. The results showed that -3 to +20 region of HIV-1 promoter activity CTGG element repeated three times in the little effect or slightly repressed the HIV-1 LTR (Jones et al., 1988; Huang et al., 1990; Kat0 et in uiuo. In addition, these expression constructs had little effect on the induction ofHIV-1 promoter activity al., 1991). TheLBP-1bindingelement, which is strikingly elicited by HSV-1 infection. reminiscent of a CP2 binding site, interacts with bacterially synthesized CP2 in vitro(Swendeman et al.,1994). LBP-1 binding sites have been implicated in modulating a variety of HIV-1 CP2 is a transcription factor present in nuclear extracts prepromoter activities. For example, LBP-1 has been shown to pared from a variety of cells (Chodosh et al., 1988; Kim et al., repress HIV-1 promoter activity in vitro (Kato et al., 1991). On 1988; Barnhart et al.,1988; Limet al.,1992; Swendeman et al., the other hand, LBP-1has been implicated in the inductionof 1994), and the murine a-globin promoter contains a strong latent HIV-1 gene expression in response tosuperinfection by a binding site for the factor (Barnhart et al., 1988). Indeed, we variety of viral agents, including herpes simplex virus type 1 previously purified and cloned CP2 using a DNA sequence af- (HSV-1) and cytomegalovirus (Vlach and Pitha, 1992,1993; finity column based on the a-globin sequence (Kimet al.,1990; Barry et al., 1990). Lastly, the LBP-1 binding sites are conLim et al., 1992). Using in vitrotranscription assayswe showed tained within an element, termed the inducer of short tranthat CP2, purifiedeither from nuclear extractsor from bacteria scripts, that mediates the premature termination of transcripexpressing thecloned factor, was a potent activatorof synthetic tion complexes traversing the site in either an HIV-1 or a templates comprised of CP2 sites juxtaposed to the a-globin heterologous promoter context (Ratnasabapathy et al., 1990). TATAA-box (Kim et al., 1990; Limet al.,1993). We also showed Together, these previous results suggested that LBP-1 might that overexpression of the cloned factor in vivo activated a play a role in regulating the activityof the HIV-1 LTR in vivo. We showed here that LBP-1 is identical toCP2. We further * The Sloan-Kettering studieswere conducted in the DeWitt Wallace showed that CP2 exists as a dimer in solution, and that domResearch Laboratory and supported in part by United States Public inant negative versions of the factor could be produced. To Health Service Grants NCI-P30-CA-08748 and DK-37513 and by the Businessmen’s Assurance Fund. Research in Baltimore was supported examine directly the role CP2 plays in mediating HIV-1 gene in part by Grants AI26123 and AI27297 from the National Institutes of expression in vivo we examined what effect HSV-1 infection Health and American Foundation for AIDS Research Grants 001502 had on intracellular levels of CP2. In addition, we tested the of publication of this article were defrayedin part and 001684. The costs effect of artificially altering intracellular levels of CP2 using by the payment of page charges. Thisarticle must thereforebe hereby marked “advertisement” in accordancewith 18 U.S.C.Section 1734 solely to indicate this fact. The abbreviations used are: HIV-1, human immunodeficiency vill To whom correspondence should be addressed. Tel.: 212-639-6570; rus-1; CAT, chloramphenicol acetyltransferase; HSV, herpes simplex Fax: 212-639-2861. virus; LTR, long terminal repeat; GST, glutathione S-transferase.
21269
21270
CP2 and H N - 1 Promoter Activity
expression vectors encoding either the wild-type ora dominant negative version of CP2.
viously (Vlachand Pitha, 1992)and assayed 24 h after electroporation. HSV-1 infections were performed at an multiplicity of infection of 3. CATAssay-CAT assays wereperformed as described previously (Gorman et al., 1982; Vlach and Pitha, 1992).
MATERIALSANDMETHODS Cell Lines, Viruses,and Tissue Culture4urkat andA3.01 cells were RESULTS maintained as described previously (Vlach and Pitha, 1992). HSV-1 CP2 Exists in Solution and Binds DNA as a Dimer-Fig. 1 infections werealsoperformed as describedpreviously(Vlach and Pitha, 1992). shows the glycerol gradient sedimentation profileof bacterially Nuclear Extracts and Bacterially Expressed CP2-Nuclear extracts synthesized CP2 ( M , = 64,000 under denaturing conditions) were prepared as described from murine erythroleukemia cells (Lim et assessed by silver staining (Fig. lA),electrophoretic shift (Fig. al., 1992) and from Jurkat and A3.01 cells (Vlach and Pitha, 1992). Bacterially expressed CP2 wasprepared as described previously (Lim et lB), and Western blotting techniques (Fig. 1C). The bacterial al., 1993). The CP2-GST-fusion was prepared by performing a polym- factor sedimented at a position between p-amylase (native M, erase chain reaction that allowed insertion of the full-length human of 200,000) and bovine serum albumin ( M , = 68,0001, correprotein downstream of GST in the correct reading frame (as confirmed sponding to a M , for the native factor between 110,000 and by DNA sequencing; Sambrook et al. (1989) and Sanger et al. (1977)). 130,000. The sedimentation profileof the native factor, present Truncations of the full-length product and the Elf-1 deletion were prein nuclear extracts, was identical that to of the bacterial factor pared by similar polymerase chain reactions using appropriate primers. (Fig. 1 D ) . These results, which suggested that the native factor The truncations and the deletion were subsequently recloned into the GST-fusion expression vector and sequenced to confirm the appropriate exists as a dimer, were tested directly by constructing a CP2mutation. GST-fusion polypeptides were induced by adding isopropyl- GST-fusion polypeptide that included the full-length human thiogalactoside (0.5 m ~ to) bacterial cultures for 2 h. Induced bacteria protein fused to glutathione S-transferase. As expected, the were lysed as described (Limet al., 1992) and soluble proteins applied GST-fusion protein bound a CP2 site derived from the murine to a glutathione-Sepharose column (Pharmacia Biotech Inc.) and eluted a-globin promoter and exhibited a substantially reduced mowith buffers containing glutathione according to the manufacturer's gels compared tothat of either the recommendations. SDS-polyacrylamidegelsshowed that enriched bility in electrophoretic shift or the native polypeptides were substantially free of most other bacterial proteins nonfusion bacterially expressed factor (not shown) factor presentin J u r k a t cells (Fig. 2 A , compare lanes 1 and 2 ) . (not shown). In addition, Western blotting showed that the truncations and the Elf-1 deletion reacted well with the antibody directed against In addition, when the GST-fusion polypeptide was mixed with CP2 (not shown). Jurkat cell nuclear extracts we observed bands of intermediate Glycerol Gradients-Glycerol gradients (15-35%) were prepared and that the native electrophoretic shift, consistent with the notion run as described (SW55Ti rotor a t 48,000 rpm for 16-24 h; Kim et al. (1990)).Marker proteins were from Sigma. A plot of the relative sedi- factor and fusion protein rapidly formed heteromers (Fig. 2A, mentation positions of P-amylase (a tetramer with an M , of 200,000), lane 3 ) .An identical resultwas obtained by mixing GST-fusion bovine serum albumin ( M , = 68,000), and ovalbumin ( M , = 43,000) was and nonfusion bacterially expressed factors (not shown). In used to estimate that CP2 wassedimenting under these nondenaturing contrast, the GST-fusion protein had no effect on the electroconditions with an M , of 110,000-130,000. Under denaturing conditions phoretic shift of t h e CCAAT box binding factor, CP1 (Fig. 2, (SDS-polyacrylamidegels, for example) CP2 has a M , of 64,000. lanes 4 and 5).From these results we concludedthat CP2 exists SDS-PolyacrylamideGels, Antibodies, and Western BlotsSDS-polyacrylamide gels and Western blots were performed accordingto stand- as a dimer in solution. We showed previouslythat CP2 binds a sequence motifcomard procedures (Laemmli, 1970;Towbin et al., 1979). The polyclonal antibody prepared against CP2 has been described previously (Limet prised of two "CNRG boxes" separated by a linker sequence of al., 1992).The antibody to the p50 subunit of NFKBwas purchased from 5 or 6 bases (Lim et al., 1993). Both boxes must be intact for Santa Cruz Biotechnology, Inc. Western blots were developed using a binding to occur (Lim et al., 1993). The symmetry of the CP2 chemiluminescent system purchased from Amersham Life Sciencesacbinding site together with the factor's dimeric structure sugcording to the manufacturer's instructions. Electrophoretic Gel Shift Assays-Electrophoretic shift assays were gested that it might be possible t o generate dominant negative performed as described previously (Garner and Rezvin, 1981; Strauss versions of CP2 in which one of t h e subunits had a disrupted and Varshavsky, 1984) using appropriate labeled (using T4 polynucle- DNA binding (but intact dimerization) domain.In this regard, otide kinase; Sambrook et al., 1989) or unlabeled oligonucleotides, de- we examined a small seriesof carboxyl-terminal truncations of scribed below. CP2 fused toGST (Fig. 2B). The results indicated that a deleOligonucleotides-For electrophoretic gel shift assays all oligonucle- tion of 225 carboxyl-terminal amino acids significantly affected otides were double stranded and comprised of hybrids formed between the DNA binding activity of the GST-hsion protein (Fig. 2 B , the following pairs of sequences. HIV-A 5'-GAT CGT ACT GGG TCT 08).A deletion of 262 amino acids, however, abolished binding CTC TGG TTA GAC CAG ATC T-3'15"GAT CAG ATC TGG TCT AAC CAGAGA GAC CCA GTAC-3'; HIV-B: 5"TAC TGG GTC TCT CTG GTT (Fig. 2B, 09). Examination of the amino acids removed bythe AGA CCA GAT CTG AGC C-3'15'-GAG GCT CAG ATC TGG TCT AAC truncations suggested that CP2 DNA binding activity was being CAG AGA GAC CCAG-3'; HIV 3'(3'): 5'"lTA GAC CAG ATC TGA GCC lost as the deletions encroached upon the region related Elf-1.to TGG GAG CTC TC-3'15'-CAG AGA GCT CCC AGG CTC AGA TCT GGT To test directly whether the exon most closely related to Elf-1 CT-3'; NFKB:5'-GAT CAA GGG ACT TTC CGC TGG GGA CTT T-3'1 a GST-fusion pro5'-GCA AAGTCCCCAGCGGAAAGTCCCTTG A-3'; mut NFKB: was essential for DNAbinding we constructed 5'-GAT CAAGGGACT TTGAGC TGG GGACTT T-3'15"GCAAAG TCCtein lacking these amino acids (Fig. 2C). Electrophoretic shift CCAGCT CAA AGT CCC TTG A-3'; a-globin CP2 site: 5'-GAG CAA assays showed that this polypeptide had no DNA binding acGCA CAAACC AGC CAA-3' (and its exact complement). tivity (Fig. 2A, lane 7). When mixed with t h e wild-type factor, Reporter Constructs, Expression Constructs, and Electroporationhowever, t h e Elf-1 deletion significantly reduced CP2 DNAbindThe HIV-CAT reporter construct and the CP2 expression construct (in ing in a dominant manner (Fig.2A, lanes 6-8).In contrast the pRCICMV, an expressionvector driven by the cytomegalovirus promoter; Invitrogen)have been described before (Vlach and Pitha,1992;Limet al., Elf-1 deletion of CP2 had no effect on the binding of CP1 to its 1993).The Elf-1 deletion of CP2 was cloned into the same cytomegalo- cognate site (Fig. 2 A , lanes 9 and 10). These results suggested virus-driven expression vector noted above. Testsin K562 cells showed that the Elf-1 deletion disrupted the DNA binding domain of that these vectors effectively increased or reduced the amount of CP2 CP2, leaving the dimerization domain We intact. concluded that DNA binding activity as assayed by electrophoretic shift (not shown). dominant negative versionsof CP2 could be designed. Transient transfections were performed as described previously (Vlach CP2 AppearsIdentical to the H N - 1 Promoter Binding Activand Pitha, 1992). Briefly,each transfection contained 10 pg ofCAT reity, LBP-1-A cellular factor that binds an HIV-1 promoter porter plasmid and 20 pg of the CP2 or Elf-1 deletion of CP2 and 1pg element strikingly similar to a CP2 site has been identified ofpSV2Luc plasmid to assess transfection efficiency (Brasier et al., 1989). Electroporation of Jurkat cells was performed as described pre- previously and termed LBP-1 (Huang et al., 1990; Kat0 et al.,
CP2 Activity Promoter and HW-1 amylose
CP2
c
4
BSA
OVAL
1
1
21271
C.
A. 1
2
3
4
5
6
7
8
9 1 0
2 3 4 5 6
7 8 9 1 0
CP2i-r
D.
B. 2 3 4 5 6 7 8 9 1 0
2 3 4 5 6 7 8 9 1 0
b
>
7CPL’
CP2.
FIG.1. Glycerol gradient sedimentation of CP2. Bacterially expressed CP2 (panels A X ) and the native factor present in nuclear extracts (panel D ) were sedimented through 15-35%, glycerol gradients. Fractions (indicated numerically above each panel) were collected and analyzed a s described below. A, indicated fractions were subjected to SDS-polyacrylamide gels and stained with silver. The peak concentration of each marker protein @-amylase(amylase),bovine serum albumin( B S A ) ,and ovalbumin(oual)),and of the bacterial factor(CP2) is indicated (arrows) a t t h etop of the panel. The bacterially expressed factor is visualized as a thin line migrating slightly faster than bovine serum albumin, and its position in theSDS-polyacrylamide gel is indicated tothe left. B, indicated fractions were analyzed by electrophoretic gel shift using a probe derived from the a-globin promoter specific for CP2. C, indicated fractions were assayed for CP2 protein by Western blotting.0, nuclear extracts prepared from murine erythroleukemia cells and sedimented in the same experiment as described above were assayed for CP2 DNA binding activity by electrophoretic gel shift. The electrophoretic shift due to the native factor is indicated by an arrow to the left of the panel. A more rapidly sedimenting species (visible in lanes marked 2 4 ) was unrelated to CP2 (as determined by antibody supershift experiments) and was not investigated further. The smeared complex toward the bottomof the gel was also unrelated to CP2.
1991). To test whether LBP-1 was related to CP2 we used a probe prepared from the HIV-1 LTR to examine nuclear extracts preparedfrom the T cell line A3.01. As illustrated in the Fig. 3A, lanes 1 and 2 , the HIV-1 probe bound a factor present in A3.01 cell nuclear extracts thatcould be supershifted by a n antibody specific for CP2. The same was true for nuclear extracts prepared from Jurkat cells (not shown). In addition, when increasing amounts of the CP2-GST-fusion protein were added to the A3.01 cell nuclear extracts, the T-cell factor formed specific heteromeric complexes with the GST-fusion polypeptide (Fig. 3A, lanes 3-7). Lastly, while the Elf-1 deletion construct did not bind the HIV-1 probe (Fig. 3A, lane 81, it did significantly inhibit bindingof the A3.01 cell factor to its cognate site (Fig. 3A, compare lanes 9 and 10). From these observations, we concluded that thepreviously described HIV-1 promoter binding factor, LBP-1, is identical to CP2. Effect ofHerpes Simplex Virus Type 1 Infection on CP2 Activity in Vivo-What role might CP2 play in regulating HIV-1 promoter expression? It hasbeen well documented that superinfection of T cells with HSV-1 can activate expression of a n HIV-1 provirus. Promoter activation is thought tobe mediated by an induction of NFKB bindingactivity and by way of a factor that interacts with theLBP-1 binding sites in theHIV-1 LTR (Vlach and Pitha, 1992). For this reason we felt it was important totest directly what effect HSV-1 infection of T-cells had on CP2 DNA binding activity and protein. As illustrated in Fig. 3A, lanes 9-14, HSV-1 infection of A3.01 cells resulted in a n
abrupt decline of CP2 DNA binding activity 10-20 h after infection (Fig. 3A; compare lanes 9,11, and 13).The identification of this diminishing band as CP2 was confirmed by the fact that addition of the Elf-1 deletion construct resulted in a further (and specific) reduction in the amount of shifted complex binding theprobe (Fig. 3A, lanes 10, 12, and 14 ). Fig. 3B shows that the level of CP1 wasalso reduced 20 h after infection, but not to the extent of CP2 (2-3-fold for CP1 versus 8-10-fold for CP2). Also note that theHIV-1 probe detected the weak induction of a novel DNA binding species 20 h after infection, as did the probe for CP1 (Fig. 3, A and B, arrows). The decreased DNA binding activityof CP2 could result from a virally induced post-translational modification that abolishes DNA binding activity, from the synthesis of an alternatively spliced product that does not bind DNA (for example, a factor lacking the Elf-1 related exon), or from a simple reduction in the amountof CP2 protein. To test thesepossibilities we examined the level of CP2 protein present in nuclear extracts at various times after HSV-1 infection by Western blotting. The results (Fig. 4)showed that HSV-1 infection resulted in a dramatic reduction of CP2 protein 20 h after infection. Since no other prominent species that reacted with this polyclonal antisera were observed late ininfection we concluded that HSV-1 infection resulted in a significant reduction in CP2 nuclear protein concomitant with theloss of CP2 DNA binding activity. An HSV-1-induced Factor Binds Downstream of the CP2 Sites-Previous reports have noted that HSV-1 infection of T
CP2 and HW-1 Promoter Activity
21272 A
1
2
3
4
5
6
7
0
9
1
0
B GST FL V8 V 9
-- .
FIG.2. CP2 exists as a dimer.A, electrophoretic gel shifts were performed using probes derived fromthe murine a-globin promoter specific for either CP2 (lanes 1-3 and 6-8) or CP1 (lanes 4-5 and 9-10). Reactions contained Jurkat cell nuclear extract (lanes 1 and 6);apurifiedCP2GST-fusion polypeptide alone (lane 2 ) ; a mixture of the nuclear extract and the GST-fusion polypeptide (lane 3 ); nuclear extract alone (lanes 4 and 9;note probe is for CP1); nuclear extract mixed with the CP2-GST-fusion(lane 5);the Elf-1 deletion of CP2 (lane 7; see panel C); a mixture of Jurkat cell nuclear extract and the Elf-1 deletion of CP2 (lane 8);nuclear extract mixedwith the Elf-1 deletion of CP2 (lane 10;note: probe is for CP1). B, electrophoretic gel shifts of carboxyl-terminal truncations ofCP2-GST-fusionpolypeptides. Full-length CP2-GST-fusion (FL), truncated by either 225 ( 0 8 )or 262 amino acids (09). C,schematic showing the CP2 removed exon from the Elf-1 deletion conStNCt.
v
CP2 GST CP2CPI CPPCP2
GST
GST
CP2*CPI cPI+ 0 v
Basic
O/P
= O N ltOST CLOBXLY FSLATKD TO ELF-1 TSVFIQ :
AKINIA
~
C
I
: :::::::
B :
l
: :: :
a 1:::::
r
~ :
~ :
~
G
:
::::::
E
PKGADRKQKM ~ ~ ~ :::::: :
DKQAERKTRD VQCLSTD~BSQK--~OLPLwvpIDREDPRD---TAVFHRGYCQI~C
20 h post-infection when cells resulted in the induction of a factor that interacts with theHIV-A, nuclear CP2 was nearly absent CP2LBP-1 binding site (Vlach and Pitha,1992; Margolis et al., assayed using eitherprobe. In contrast,HIV-B detected an ad1993). Our results, which showed only that CP2 DNA binding ditional species that was induced 20 h post-infection that was activity decreased after HSV-1 infection, seemed at variance present inboth nuclear andcytoplasmic extracts (Fig. 5, A and with these previous observations. We were prompted, there- B ) , consistent with previous reports (Vlach and Pitha, 1992; fore, to re-examine the nature of the HSV-1-induced LBP-1 Margolis et al., 1993). In addition, while the 3' probe did not binding activity. One difference we noted between the experi- detect CP2(as expected) it did detect anHSV-1-induced factor ments reported here and those described previously was that in both nuclear and cytoplasmic extracts 20 h post-infection the probe used in the previous experiments extended slightly (Fig. 5, A and B ) . Lastly, Fig. 5C shows that these downstream further 3' (by 5 bases) of the probe employed above. This sug- probes wereeffective specific competitors for the induced factor, gested that theHSV-1-induced factor might bind downstream whereas theHIV-Aoligonucleotide did not compete for this binding activity. We concluded from these data that thepreviously of the CP2 sites. To test this notion we used three related probes to examine the nuclearfactors present after HSV-1 in- reported HSV-1-induced factor binds the HIV-1 LTR in sefection. These included a probe that contained a single binding quences that lie downstream of the CP2binding sites. HSV-1 Induction of Factors That Interact with an HW-1 site for CP2 (the sameprobe used above, termed HIV-A, Fig. 51, a probe that extended a n additional 5 basesdownstream NFKB Site-As noted above, it has also been reported that (termed HIV-B; Fig. 5), and a probe overlapping with the 3' HSV-1 infection can induce NFKB DNA binding activity and region of HIV-B,but containingonly one(the most3') of the two can activateHIV-1-driven CAT expression through NFKB sites 3' in present in theHIV-1 LTR (Vlach and Pitha, 1992). Our results CNRG boxes that comprise a CP2 binding site (designated Fig. 5; Lim et al. (1993)). The results (Fig. 5A) showed that al- confirmed that HSV-1 infection resulted in an increase infacthough theHIV-B probe did not interactas well with CP2as did tors thatbind a n HIV-1-derived NFKBprobe (Fig. 5, A and B ) .
C
Q
CP2 and HIV-1 Promoter Activity
AI
2
3 4 5 6
FIG.3. CP2 accounts for LBP-1 binding activity and its DNA binding activity is significantly reduced b y infection with HSV-1.A, electrophoretic gel shifts were performed using a probe (HlV-A) derived from the HIV-1 promoter and nuclear extracts preparedfrom the T cell line, A3.01, either before (lanes 1-10) n r after (lanes 11-14]HSV-1 infection. Reactionscontained:nuclearextractplus CP2 preimmune sera(lane I ) or immune sera (lane 2 ); nuclear extract(lane 3 )plus 1.2, or 5 1.11of a 1:5 dilutionof a CPS-GST(lanes 4-6, respecfusionpolypeptide tively), or 2 pl of the CP2-GST-fusion polypeptide alone (lane 7); the Elf-1 deletion of CP2 alone (lane 8);nuclear extracts prepared from HSV-1 infected cells eitherwithout (lanes 9, I l , and 13) or with addition of the Elf-1 deletion (lanes 10, 12, and 14). Nuclearextracts from HSV-1-infected cells were prepared at 0 (lanes 9 and 10),10(lanes 1I and 12),and 20 (lanes I 3 and 14) h after infection.An arrow to the right of the panel indicates the inductionof new, minor, DNA binding species a t 20 h. B, the HSV-1-infected extracts described above weretested for CP1 DNA bindingactivity by electrophoretic shift. CP1 is the major bandtoward the top of the gel. Again, a n arrow to the right of the panel indicates the induction of new DNA binding species at 20 h.
We observed, however, two distinct nuclear complexes: a n upper complex, running slightly above CP2 (Fig. 5A, compare lanes labeled HIV-A a t 0 h and NFKB a t 20 h) anda lower, more abundant complex (Fig. 5). In addition, the lower complex was abundant in cytoplasmic extracts of infected cells (Fig. 5B). These complexes could be specifically competed by addition of an excess of the unlabeled NFKB oligonucleotide, but not by excess HIV-A (Fig. 5 C ) . To determine which of the observed complexes corresponded to NFKB we performed two experiments. First, we used an antibody against the p50 subunit of NFKB. Addition of the anti-p50 sera to electrophoretic shift reactions (Fig. 6 , left) abolished binding of only the uppercomplex. In addition, we synthesized a mutant NFKBprobe (mut NFKB) and tested its ability to bind the factors induced by HSV-1. The results (Fig. 6 , right) showed that binding of the upper complex was abolished, while the lower complex present in either nuclear or cytoplasmic extracts was unaffected. We concluded that HSV-1 infection induced two distinct factors that interacted with the viral NFKB probe. One of these appeared tobe a version of NFKB thatcontained p50. The nature of the other, more abundant complex, however, was not ascertained. While these binding activities appear tobe specific (as shown in Fig. 5 they do not bind the labeled HIV-A probe and they arespecifically competed by appropriate cold competitors) the functional relevance of these activities isunknown. Effect of Modulating CP2Expression on HN-1Promoter Activity in Vivo-Lastly, we utilized our ability to express wildtype and dominant negative forms of CP2 invivo to test the role CP2 plays in mediating HIV-1 promoter activity either in the presence or absence of HSV-1 infection. The results of these
7
8 9
21273
B
1011 1213 14
CPI
0 IO 2 0
c
c
0 IO 20
CP2 and HW-1 Promoter Activity
21274
B
A
NFkB H IV-B 0 IO 20 0 io X) 0 10 20 0 HIV-A
NUCLEAR 0
io
20
HIV-B
NFkB
HIV-A
CP2
CYTO.
0
IO 20 0
IO
3' 10 20
3'
20 0 IO
20
c
NUCLEAR
C
NF kB
,,
C Y TO.,
-
FIG. 5. The HSV-I-inducedHlV-I leader b i n d i n g a c t i v i t y i n t e r a c t swith sequences d o w n s t r e a m of the CP2 binding sites. Nuclear (panel A ) or cytoplasmic extracts(panel B ) were prepared from cells infected with HSV-1 for 0, 10, or 20 h (indicated at thetop of eachpanel) and were used in electrophoretic gel shifts in reactionsthat contained probes specific for various regions of the HIV-1 promoter (see textfor details). Note that probes designated NFKB, HW-B, and 3' interact with induced factors present in both the nuclear and cytoplasmic extracts20 h after infection, whereasCP2 DNA binding activity (assayedby either theHIV-Aor B probe; indicated by a n arrow to theleft ofpanel A ) is predominantly localized to the nucleus and is significantly reducedHSV-1 after infection. C, electrophoretic shifts resulting from incubating nuclearor cytoplasmic extracts prepared 20 h after HSV-1 infection with the labeled probe and unlabeled competitor oligonucleotides indicated at the top of the panel. Unlabeled competitors wereat a 100-fold molar excess compared to labeled probe DNAs. The position of NFKB(which was induced less well in this experiment) is indicatedto the left of the panel.
21275
CP2 and HN-1Promoter Activity
PI ap50 wt mut
-
.
.
*-
, .
FIG.7. CP2 is a modest repressorof HIV-1 promoter activity in uiuo. CAT constructs driven by the HIV promoter (HIV-CAT) were
transfected into Jurkat cells that were either uninfected (left set of three) or infected with HSV-1 (right three; indicated by +HSV).Cotransfections were performed by electroporation of the HIV-CAT reporter in the absence(far left) or presence of a CP2 expression vector (+CP2) or a n expression vector encodingthe Elf-1 deletion of CP2 (indicated a s +VCP2). CAT activity was assayed and the activity of the HIV-CAT vector alone was normalized to 1. Relative CAT activity is indicated to the left. Two independent experiments (solid and hatched bars) are illustrated.
factor binding sites on the LTR (Vlach and Pitha,1992). One of these sites appeared indistinguishable from a CP2 bindingsite. The other siteimplied that HSV-1 was mediating HIV-1 transcriptional activation through NFKB. In the results presented here we tested directly for CP2 DNA binding and protein (Figs. FIG.6. HSV-1 induces distinct species that interact with an HIV-1 NFKBsite. Left pair, electrophoretic shifts were performed using3 and 4) andfor the p50 subunit of NFKB(Fig. 6). Our results possible mechanisms for an NFKBprobe derived from the HIV-1 promoter and nuclear extracts provided some additional insights into prepared 20 h afterHSV-1 infection. Reactions were incubated either in the HSV-1 activation of the HIV-1 LTR. PI) or an antiserumdirected the presence of preimmune sera (indicated We found that HSV-1 infection led to a moderately rapid loss against the p50 subunit of NFKB (ap50).A band that is significantly inhibited from binding the probe in the presence of antibody is indicated of CP2 DNA binding activity and protein, perhaps through to the left. Right pair, a n oligonucleotide was prepared that was iden- factor turnover as a result of viral effect on protein synthesis tical to the probe used panel in A except that two bases were altered to (Figs. 3 and 4). Loss of CP2 could promote activation of the GGGACTlTCC; mutant (mut) HIV-1 promoter by a mechanism similar tode-repression. This disrupt the NFKB site (wild-type NFKB: NFKB:GGGAC'MTW). A band correspondingto a species detectedby observations that CP2 acts the wild-type probe but not by the mutant probe is indicated by a n notion would be consistent with our arrow to the right. The indicated species hasa mobility indistinguish- to repressweakly HIV-1 promoter activity (Fig. 7). On the other able from the complex abolished by the NFKB antiserum (left pair). hand,any model that invoked HIV-1 promoteractivation Another species seen in this gel, running slightly below the indicated through the HSV-1 mediated induction of CP2 DNA binding band, is visualized in some HSV-1 infected extracts. Its binding is not activity can be ruled out. In this regard, it should be recalled influenced by the NFKB mutation (as shown), nor is i t affected by the that, in contrast to observations, our previous studies indicated NFKB antiserum (not shown). that HSV-1 infection led to the induction of factors (present in negative relative had little effect on HIV-1 promoter activation both nuclear and cytoplasmic extracts) that bound an LBP-1 in the wake of HSV-1 infection, suggesting that CP2 did not (that is, CP2) probe (Vlach and Pitha, 1992). While U V crosshave a substantial effect in modulatingexpression of the intact linking studiesalso suggestedthat theinduced factor mightbe HIV-1 promoter under these conditions. distinctive from LBP-lKP2 (Vlach and Pitha,1992) the results presented hereshowed unequivocally that CP2 is reduced after DISCUSSION HSV-1 infection. Consistent with previous observations, howWe have described previously the cloning of murine and hu- ever, we did observe that HSV-1 infection induced a factor man cDNAs that encode CP2, a transcription factor present in (which remains tobe characterized either structurally orfuncnuclear extracts prepared from a variety of cells (Lim et al., tionally) that interacts withsequences that aredistinctive and 1992, 1993; Swendeman et al., 1994). In this reportwe further downstream from the CP2 factor binding site (Fig. 5). Further characterized the factor and began to investigate its effect on characterization of the appropriate target sequence for this the activity of the HIV-1 promoter. We showed that the factor HSV-1-induced factor should help to define more precisely the exists as a dimer insolution (Figs.1and 2), that deletion of 262 nature of this factor. carboxyl-terminal amino acids ablates DNA binding activity, Our results also confirmed that HSV-1 infection induced and that dominant negativeversions of the factor can be gen- NFKB (Vlach and Pitha, 1992), which we assayed using a n erated by eliminating a domain related to the Drosophila tran- antiserum specific for its p50 subunit, and by observing the scription factor Elf-1(Fig. 2). In addition,we showed that CP2 electrophoretic shifts produced by wild-type and mutant NFKB accounts for the previously described HIV-1 promoter binding probes (Fig. 6). Our observations, however, raised the possibilfactor termed LBP-1 (Fig. 3). ity that HSV-1 infection induced an abundant DNA binding We also studied theeffect HSV-1 infection had on the cellular species (present inboth nuclear andcytoplasmic extracts) that levels of CP2. HSV-1 infection had been shown previously to was distinct from p50 containing NFKBheteromers. The eviinduce HIV-1 promoter activity through at least two distinctive dence for this assertion came from data which showed that the
21276
CP2 and H N -Activity 1 Promoter
HSV-1-induced factor neither interacted with an antiserum specific for the p50 subunit of NFKB, nor was its binding inhibited by mutations thatabolished binding of p50 containing NFKB(Fig. 6). The natureof this HSV-1-induced factor, and the functional role (if any) it plays in activating the HIV-1 LTR through the NFKBbinding sites, remains to be determined. Lastly, we used our ability to express CP2 and dominant to assess whateffect the negative versions of the factor in vivo factor has on HIV-1 promoter activity. Previous results suggested that LBP-1ICP2 repressed the HIV-1 promoter in vitro (Kato et al., 1991). Consistent with thesein vitro results, ourin vivo data also suggested that overexpression of CP2 in vivo led to a moderate repression of HIV-1 promoter activity. This result is in contrast to the activation of the a-globin promoterby CP2 both in vitro or in vivo (Kim et al., 1990; Lim et al.,1993). Presumably, the contextualplacement of the CP2 binding site in the a-globin promoter (where it is upstream of the CCAAT box) distinguishes the effect this factor has on a-globin promoter activity from its effect on the HIV-1 promoter (where its cognate binding domain overlaps with the site of transcript initiation). Thus, the role CP2 plays in mediating HIV-1 promoter activityis relatively subtle. Thisnotion was confirmed by the observation that CP2 had little influence (positive or negative) on the activation of the HIV-1 promoter by HSV-1 infection. Presumably,the effects of HSV-1 infection outweighed any influence mediated by CP2. In summary we further characterized the transcriptionfactor CP2 and directly tested the role this factor plays in mediating the activation of the HN-1 promoter either alone, or in the context of a virus, HSV-1, known to induce the HIV-1 promoter. Our results suggest that CP2 itself playsa subtle role as a repressor of HIV-1 promoter activity in vivo.The factor is decreased by HSV-1 infection, and virally induced factors previously thought t o bind CP2 sites were shown t o bind further downstream. In addition, HSV-1 infection led to the dramatic induction of a factor that binds the viral NFKB site, but in a region that appears distinctfrom the sitebound by NFKBcontaining p50. The implications of this finding for the viral acti-
vation of HIV-1 promoter activity remain to be determined. Acknowledgment-The technical assistance of Libing Chen is gratefully acknowledged, Addendum-After this manuscript was submitted, other workers LBP-1 exists as a dimer (Yoon et also presented results suggesting that al., 1994). REFERENCES Barnhart, K. M., Kim, C. G., Baneji, S. S., and Sheffery, M. (1988) Mol. Cell.B i d . 8,3215-3226 Barry, P. A., Pratt-Lowe, E., Peterlin, B. M., and Luciw, P. A. (1990) J. Virol. 64, 2932-2940 Brasier, A. R., Tate, J. E., and Habener, J . F. (1989) Biotechniques 6, 1116-1122 Bray, S. J., and Kafatos, F. C. (1991) Genes & Deu. 6, 1672-1683 Bray, S. J., Burke,B., Brown, N. H., and Hirsh, J. (1989)Genes & Deu. 3,1130-1145 Chodosh, L. A., Baldwin, A. S., Carthew, R. W., and Sharp, P. A. (1988) Cell 63, 11-24 Dynlacht, B. D., Attardi, L. D.,Admon, A,, Freeman, M., and Tjian,R.(1989) Genes & Deu. 3, 1677-1688 Garner, M. M., and Rezvin, A. (1981) Nucleic Acids Res. 9, 3047-3060 Gorman, C. M., Moffat, L. F., and Howard, B. H. (1982) Mol. Cell. Biol. 2, 10441051 Huang, H-C., Sundseth, R., and Hansen, U. (1990) Genes & Deu. 4,287-298 Jones, K. A,, Luciw, P. A., and Duchange, N. (1988) Genes & Deu. 2, 1101-1114 Kato, H., Horikoshi, M., and Roeder, R. G . (1991) Science 261, 1476-1479 Kim, C. G., Barnhart, K. M., and Sheffery, M. (1988) Mol Cell. Biol. 8,4270-4281 Kim, C. G., Swendeman, S. L., Barnhart, K. M., and Sheffery, M. (1990) Mol. Cell. Biol. 10,5958-5966 Laemmli, U. K. (1970) Nature 227,680-685 Lim, L. C., Swendeman, S. L., and Sheffery, M. (1992) Mol. Cell. Biol.12,828-835 Lim, L. C., Fang, L., Swendeman, S. L., and Sheffery, M. (1993) J. Biol. Chem. 268, 18008-18017 Margolis, D. M., Ostrove, J . M., and Straus, S. E. (1993) Virology 192, 370-374 Ratnasabapathy, R., Sheldon, M., Johal, L., and Hernandez, N. (1990) Genes & Dev. 4, 2061-2074 Sambrook, J., Fritch, E. F., and Maniatis, T. (1989)Molecular Cloning: ALaboratory Manual, 2nd Ed., Cold Spring HarborLaboratory, Cold Spring Harbor,NY Sanger, F., Nicklen, S., and Coulson, A. R.(1977)Proc. Natl. Acad. Sci. U. S . A. 74, 5463-5467 Swendeman, S. L., Spielholz, C., Jenkins, N. A,, Gilbert, D. J., Copeland, N. G., and Sheffery, M. (1994) J. B i d . Chem. 269, 11663-11671 Strauss, E, andVarshavsky, A. (1984) Cell 37,889-901 Towbin, H., Staehlin T., and Gordon, J. (1979) Proc. Natl. Acad. Sci. U. S . A. 76, 4350-4354 Vlach, J., and Pitha, P. M. (1992) J. Virol. 66, 361tL3623 Vlach, J., and Pitha, P. M. (1993) J. Virol. 67, 4427-4431 Yoon, J-B., Li, G., and Roeder, R. G. (1994) Mol. Cell. Biol. 14, 1776-1785
