from pBRU-2 (kindly provided by Keith Peden) was cleaved by HindIIl and Sall and ligated ..... Harper, S. Broder, R. C. Gallo, and F. Wong-Staal. 1986. Infectious ...
JOURNAL OF VIROLOGY, Jan. 1991, p. 225-231
Vol. 65, No. 1
0022-538X/91/010225-07$02.00/0 Copyright C) 1991, American Society for Microbiology
Evolution of Human Immunodeficiency Virus Type 1 nef and Long Terminal Repeat Sequences over 4 Years In Vivo and In Vitro SYLVIE DELASSUS, REMI CHEYNIER,
AND
SIMON WAIN-HOBSON*
Laboratoire de Retrovirologie Moleculaire, Institut Pasteur, 28 Rue de Dr. Roux, 75724 Paris Cedex 15, France Received 2 August 1990/Accepted 19 October 1990
The evolution of an 851-bp segment of the human immunodeficiency virus type 1 (HIV-1) genome encoding the nef open reading frame and U3/R elements of the long terminal repeat has been followed over a 4-year period in vivo and in vitro. The population of viral sequences at any given time was established by sequencing cloned polymerase chain reaction products. The samples studied were derived from the same man for whom a detailed analysis of the tat gene was previously described (A. Meyerhans, R. Cheynier, J. Albert, M. Seth, S. Kwok, J. Sninsky, L. Morfeldt-Manson, B. Asjo, and S. Wain-Hobson, Cell 58:901-910, 1989). Once again in vitro culture resulted in the selection of minor forms. Over a 4-year period in vivo, there was no obvious selection for, or outgrowth of, any particular nef or U3/R sequence. Few defective nef protein sequences were observed, which argues against nef acting as a negative regulatory factor. Although no functionally defective promoter/trans-activation-responsive elements were identified, the transactivation efficiencies varied between 0.2 and 2 times that of the control. The sequence encoding the most efficient trans-activation-responsive region did not outgrow others. The extreme genetic heterogeneity of the different samples of the locus, either in vivo or in vitro, indicates that there is no such thing as a single, distinct HIV sequence. It is suggested that different HIV-1 loci evolve independently, recombination being responsible for their uncoupling.
The plasticity of the human immunodeficiency virus (HIV) genome has been amply described. It is due to a multitude of phenomena encompassing viral polymerase miscopying, duplication, deletion, recombination, and hypermutation of the viral genome. These events, while rendering the task of molecular biologists particularly arduous, are probably an advantage to the virus in its continual effort to adapt to local environments or respond to selection pressures. In order to describe such complexity inherent in all RNA viruses, the concept of a quasispecies has been developed (11, 12, 34). In brief, a quasispecies may be defined as a population of distinct but related viral genomes. The 10-kb size of the HIV type 1 (HIV-1) provirus effectively prohibits accurate analysis of populations of complete sequences. A sequence analysis of cloned DNA fragments, derived by polymerase chain amplification of the HIV-1 provirus, is perhaps as close as can be got to a description of a HIV-1 quasispecies at the nucleotide sequence level (28). In a previous longitudinal study of the HIV-1 tat gene sequences in vivo and in vitro, it was shown that the one did not reflect the other (28). There was no selection for moreefficient tat genes with time despite the suggestion that viruses isolated from asymptomatic seropositives, which grow poorly, could be complemented by a cell line permanently expressing tat (2). These isolates are referred to as slow/low isolates (3). By contrast, isolates from patients with AIDS replicate well, the growth of the isolates being unaffected by passage to a tat-producing cell line. These viruses are called rapid/high isolates (3). These observations suggested that perhaps there was selection, coincident with disease, of isolates with increased trans-activation efficiencies. As it happened no selection at the level of the tat gene was described (28).
The viral long terminal repeat (LTR) carries the sequences essential for transcription, reverse transcription, and integration. A particular feature is the trans-activation-responsive (TAR) sequence in the R region, which is a target for tat-dependent trans-activation of provirus expression (29, 31). The tat, as well as host proteins, binds TAR RNA, resulting in efficient transcription and a positive feedback loop (10, 38). Thus, it was possible that the differences between viruses in early and late stage disease might be due to subtle differences in the TAR region. HIV-1 is endowed with at least nine genes. The ninth and most 3' gene, called nef, is a unique feature of the primate lentiviruses, as opposed to the other animal lentiviruses (30). It was originally thought to be a negative regulatory factor (14, 18, 27, 36), perhaps interacting with the negative regulatory elements in the U3 region of the LTR (1), hence the mnemonic nef (16). The role of nef is, however, now no clearer than when it was first identified (19, 25). While it is not essential to viral growth, its conservation in all primate lentiviruses argues for an important role. Since the U3 element of the LTR overlaps with the 3' half of the HIV-1 nef open reading frame, it was decided to amplify the entire nef open reading frame and LTR sequences. Apart from addressing the problem of possible functional differences within the LTR and TAR regions, it would also permit the most extensive (approximately 10% of the provirus) high-resolution study of the evolution of HIV-1 quasispecies coincident with disease progression. The data provided here show that, as in the tat gene analysis, there was no selection of more efficient TAR elements. In addition no completely defective LTR sequences were identified. Thus, differences between the so-called slow/low and high/ fast viruses must be encoded elsewhere within the genome. Little evolution of nef or LTR sequences was noted from the asymptomatic to the disease stage.
* Corresponding author. 225
226
J. VIROL.
DELASSUS ET AL.
I
F
env
|
I
rev
tat
|nef
I
Oligonucleotides Amplification -_ Sequencing Subcloning FIG. 1. HIV-1 nef-U31R locus amplified. The region of the HIV-1 genome studied is shown expanded. The locations and orientations of the oligonucleotides used for amplification, screening and sequencing of M13 recombinants, and subcloning of the promoter/ TAR regions are marked Amplification, Sequencing, and Subcloning, respectively.
MATERIALS AND METHODS Blood and culture samples. Fresh peripheral blood mononuclear cells from a HIV-1-infected man were analyzed over a 4-year period. Samples Li, L2, L3, and L6 were taken in June 1985, March 1986, June 1986, and June 1989, respectively. Viral isolates Vi, V2, V3, and V6 were derived by coculture using seronegative donor phytohemagglutininstimulated blasts. Samples Li, L2, L3, Vi, V2, and V3 have already been described (28). In June 1989, HIV-1 was isolated from a sixth sample (L6) by cocultivation with HIV-1 seronegative donor peripheral blood mononuclear cells. Unlike all other isolates from this patient, the virus derived from L6, i.e., V6, was typically a rapid/high isolate (3) and induced large syncytia. It also grew well on established cell lines. The DNA used to characterize V6 was from first-passage virus. PCR. The nef-U3/R amplification primers used for polymerase chain reaction (PCR) were located in highly conserved regions flanking these sequences. The DNA plus strand primer NL1 (5'-CCAGCATGCAGTAGCTGAGGG GACAGATAG) and DNA minus strand primer NL2 (5'CCAGTCGACCAGAGTCACACAACAGACGGG) mapped to positions 8278 to 8300 and 131 to 109, respectively, on the HIV-1 Bru sequence (37) (Fig. 1). The primers carried SphI and SalI restriction sites (underlined), respectively. DNA amplification conditions have been previously described (28). Approximately 1 ,ug of total DNA was used. Denaturation, annealing, and elongation temperatures and times were 94°C and 30 s, 55°C and 30 s, and 72°C and 1 min, respectively. Cloning and sequencing. PCR material was purified on a low-melting-point agarose gel, phosphorylated, and bluntend ligated into dephosphorylated, SmaI-cleaved, M13mp8 replicative-form DNA (Amersham). After transformation of Escherichia coli TG1, plaques were screened in situ by using a mixture of three oligonucleotides, Si, S2, and S3, all of which were located in highly conserved regions within the nef-U31R sequence. The sequences were Si, 5'-AGTC CCCAGCGGAAAGT; S2, 5'-GGAAGTAGCCTTGCGCG; and S3, 5'-GCTGCTGTATTGCTACT, which mapped to the minus strand at 9047 to 9031, 8753 to 8737, and 8538 to 8522, respectively (Fig. 1). Twenty M13 recombinants from each sample were sequenced by the dideoxy chain termination
method (33) using M13 universal primer and the three oligonucleotides, Si, S2, and S3. Polyacrylamide gel blotting. After separation on a 3.5% acrylamide-TBE (89 mM Tris-borate, 2 mM EDTA) gel, the PCR-amplified products were denatured in situ by using 0.2 M NaOH-0.6 M NaCl for 30 min followed by 30 min in 7% formaldehyde. The DNA was then transferred to a nitrocellulose filter by a standard method. The filter was hybridized with an equimolar proportion of 5' 32P-labeled oligonucleotides Si, S2, and S3. Construction of expression vector and subcloning. The large HindIII-SspI fragment of the pBC12/PL/SEAP vector (5), which encodes the entire human secreted alkaline phosphatase (SEAP) cDNA, was cloned into the HindIII and SspI sites of pUC18. This vector, pUC/SEAP, contains all the pUC18 polylinker sites 5' to the SEAP gene, and was constructed so as to delete the simian virus 40 early enhancer from the original plasmid. The enhancer, promoter, and TAR sequences of HIV-1 were amplified from 10 to 50 ng of recombinant M13 DNA under standard conditions. The amplification primers were NL2 and NL3 (5'-GAGAGGTC GACCGGAGTATTACAAAGACTGCTGA, positions 8987 to 9010) (Fig. 1). The Sall restriction site used in subcloning of the HIV-1 promoter/TAR fragments is underlined. After 10 cycles, amplified DNA from 22 M13 recombinants and from pBRU-2 (kindly provided by Keith Peden) was cleaved by HindIIl and Sall and ligated into pUC/SEAP through the same sites (HindIll cleaved within the R region, 3' to the TAR region). The sequences of the resulting series of 23 constructions, named pTAR/SEAPO to pTAR/SEAP22, were all checked by double-stranded plasmid sequencing (20) using the M13 reverse sequencing primer. No differences between the subclone and the original recombinant M13 sequences were identified. Transfection and SEAP assays. SW480 cells (human colon carcinoma cells) were cotransfected by pTAR/SEAP and pSV2tat Bru (28) by the calcium phosphate method (8), whereas Jurkat-tat cells (31) were transfected by pTAR/ SEAP plasmids by using the DEAE-dextran procedure (15). Sixty-hour posttransfection culture supernatants were cleared by centrifugation (15,000 x g) and heated for 10 min at 65°C to inactivate any endogenous alkaline phosphatase. SEAP activities were determined on 50 ,ul of supernatant as previously described (5). The values given are the means of at least two independent transfections of SW480 cells and were confirmed by transfection of the Jurkat-tat cell line (see Fig. 3). Nucleotide sequence accession numbers. The GenBank accession numbers for the HIV-1 nef and LTR sequences presented here are M58193 to M58283. RESULTS What is a HIV-1 sequence? Twenty recombinant M13 clones were sequenced for each sample (i.e., Li, L3, L6, V2, V3, and V6). None of the 60 sequences from Li, L3, and L6 were identical over the 851-bp locus analyzed. The maximum nucleic acid sequence divergence noted between any pair was 3.1%. Of the three in vitro quasispecies, V3 was the most homogeneous and V6 was the least. A major species representing 35% of all sequences could be identified within V3. Nonetheless, even within V3 up to 2.4% nucleic acid sequence divergence was noted between any pair. As was observed previously (28) the in vivo quasispecies (Li, L3, and L6) were more complex than the in vitro quasispecies (V2, V3, and V6).
VOL. 65, 1991
PCR analysis of the nef-U3IR region from a molecular clone (pNL4.3; see reference 30 for sequence) indicated that there were no hot spots for the enzyme within this region. A study of 20 clones indicated that 1 clone in 4 carried a single base substitution per 851-bp sequence due to Taq polymerase errors (data not shown). This value was concordant with those derived from analyses of 300-bp segments of the HIV-1 tat and env genes (17, 28). Since the minimum number of substitutions within any quasispecies, using any sequence as a reference, was always greater than 35, the ratio of natural to artifactual substitutions would be 7:1 [i.e., 35:(20/4)] or more. A comparison of the nef-U31R quasispecies in vivo and in vitro (i.e., comparisons of L3 with V3 and L6 with V6) showed that there were no common nucleotide sequences, indicating once again that the in vitro culture of HIV-1, whether from early (L3 and V3) or late (L6 and V6) stages in disease, leads to the selection of low-abundance forms. These in vitro forms are presumably in the original peripheral blood mononuclear cell quasispecies. However, the resolution of the analysis (1 clone of 20) must have prohibited their identification. What is a nef sequence? The nef protein sequences are shown in Fig. 2 for each of the three lymphocyte samples, Li, L3, and L6. Only two sequences, L1.14 and L1.16, were present at 10% of their original quasispecies. All other sequences were present at 5%, the resolution of the study. Of the 60 sequences only 4 were common to the Li and L3 quasispecies. All the L6 sequences were unique. None of the V3 or V6 nef protein sequences could be found in the parental L3 or L6 samples, respectively. Thus, no single nef protein sequence could possibly have reflected the complexity of nef sequences present in any sample. The mutations were not randomly distributed but were clustered in the amino and carboxy termini. Apart from a few substitutions, the region between amino acids 40 and 130 was highly conserved. Overall the internal sequence variation among nef proteins was between 1 and 4.5%. While there does not appear to be any obvious selection for a particular nef sequence, some progression may be noted at specific positions. Thus, threonine 15 is present in 30% of all Li sequences, in 45% of L3 sequences, and in 95% of L6 sequences. Sequences L3.14 and L6.01 appeared particularly divergent at their amino acid termini. These substitutions may be explained by G--A hypermutation of RNA genome during DNA synthesis by the HIV-1 reverse transcriptase (36a). There were few cases of obviously defective nef sequences. L6.01 encoded a mutated initiator methionine codon (ATG-*ATA) as well as an in-phase stop codon at position 57. Sequences L1.13 and L1.21 also encoded in-phase stop codons. Finally, clones L1.09 and L3.21 carried deletions of 154 and 68 residues within their nef sequences. These deletions, 462 and 204 nucleotides, respectively, were multiples of 3 and were considered authentic for the following reasons. (i) Polyacrylamide gel blot analysis of the original PCR-amplified material by using oligonucleotide probes corresponding to sequences within the deletions showed that there were uncloned PCR products lacking these sequences (data not shown). (ii) No sequence homology around the deletions that argued against a PCR artifact could be found. (iii) In the positive control (amplification of the same region from a molecular clone) no similarly deleted products could be identified. In all the loci that have been studied in the laboratory by PCR no deletions have ever been found. Occasionally a deletion was found at the 5' or 3' end of a
EVOLUTION OF HIV-1 nef AND LTR SEQUENCES
227
sequence. Invariably the neighboring amplification primer was also deleted, which argues more for a cloning artifact. Functional analysis of the HIV promoter region. The essential transcriptional control sequences of the HIV-1 LTR map to the noncoding region between bases 636 and 801 in the locus amplified. If just this region was analyzed at the nucleic acid sequence level a very different picture would be obtained. Thus, the Li and L3 quasispecies were complex while that for L6 was relatively simple, a major form being present at 65%. Again there were substantial differences among the Li, L3, and L6 subsets. While a number of sequences were common to Li and L3, none of the L6 sequences could be found in either Li or L3 (data not shown). When all the enhancer/promoter sequences from the L and V quasispecies were taken together, most of the mutations mapped to the TAR region, notably in the base of the stem. All but two of the mutations were point mutations. As usual, transitions greatly outnumbered transversions. The few mutations in the upstream region invariably mapped just outside of the NFKB and Spl sites (Fig. 3). Twenty-two clones were analyzed at the functional level after the TAR region was PCR amplified and subcloned into the pUC/SEAP expression vector. The mutants and their relative trans-activation efficiencies with respect to HIV-1 Bru tat and LTR are given in Fig. 3. The relative degrees of transactivation varied from 0.2 to 2 times that of the HIV-1 Bru tat and LTR control. These differences were not due to experimental errors. Those pTAR/SEAP plasmids which yielded a reduced relative transactivation efficiency were tested at least three times by using two different plasmid preparations. In these experiments the basal level of SEAP activity for each plasmid was the same. These levels were comparable with that of the HIV-1 Bru LTR reference. The relative transactivation efficiencies varied by +0.05. All the clones representing more than 5% of a quasispecies showed relative transactivation ratios comparable with that of the reference (i.e., between 0.7 and 1.3). Clones 7 and 12 encoded a G-*A substitution at position 20 at the base of the bulge which reduced the transactivation efficiency by a factor of 5. However, deletion of a single base in the stem at position 42 (clone 17) hardly affected transactivation. Two C->T substitutions, one in the bulge and one in the loop, did not influence transactivation. A smaller region at the base of the stem may be important, for substitution at position 7 or 53 either decreased or increased the efficiency of transactivation. Interestingly, clone 13, which proved to be the most efficiently transactivated sequence and which was derived from the L3 quasispecies, was not identified in the L6 quasispecies whatsoever. DISCUSSION After having assimilated all the sequence data it is very difficult to speak of a single, distinct HIV-1 sequence either at the nucleic or amino acid level (11, 12, 34). The 851 bases sequenced, approximately 9% of the genome, were not among the most variable regions of the HIV-1 genome. Extrapolating from this data, it is possible to estimate, at least in this individual case, that any two complete viral genomes in vivo may differ by upwards of 10 to 20 bases. It may not be assumed, however, that the HIV-1 reverse transcriptase misincorporation rate is of the same order, because the precise relationship between sequences and the number of cycles separating them is unknown. Given the number of unique sequences involved it is not
*.
.~ ~~~ ]a -2
Cy CYC
CY
Cy
yCp CYvor
*i .
hi
.
.
pp
C
hhhhhh
2 yCY2
Icoay
PPP
P a
o
av
CY CY
CY
hihi I
vC
Cy Cy CY Cy a CY CY Cy
fihil S 01
a . * jI XvvvvvIvvvv.vsvvvvvvvvv*
o
vvvv
vv
.,
CY
I
I
9H X J X Xp -X O g
VA KK
4
W Xx
J Jz JX X
2..1
. . W
-
-
J KJ J
X
J JJ XJ W
J
-X H~~~~~~~~~~~~~~~~b H H - w H . H
.
I
A
X
KFX
FX
Ki
S
2ko
z .> -
A
2
222
22
II E~~~~~~~~~~~1 1 I o;~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~t
:2
A
..
.
"
.~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~C
*
g
"S " .Y S~~~~~~~~~~~~~~~~~~~~~~~~~u
.
RV
3
^l
.
x
.
zz
ZZDZ Zo *Z Dz .0 Z
-,D Z * HD 0 ~ ~~~~~~~~~~~~~~~~~~,D
228
VOL. 65, 1991
EVOLUTION OF HIV-1 nef AND LTR SEQUENCES
E4
E4 E-4 (N
-W lw
lw
r-
0%
lw
lw
E-4
: 4 A
CD
CD
E-
LI
C
(4
CD
4
)
A
* C.)) E-4 E o o E4 14 U E4 4414
4CD
41
V
04
LI
U)
A
I
v
V
A
I
I
14
I
A
E4 0 C,4Ut
U1
E
_:
U
E-4 UUc E-4
c
.
+w0r
o
sr
1-
+4
+
E-
E-4 E4 U
n *1
7 oc~
~
~
C)
LI) E4
U) (.
in
+
144
4.1
_
n%N n M0 e(
%a %
E14
E4
-4 -4 -4 H~~~~~~~~~~~ H
I
-4
-4
-4
-
N C1
Cl
E4Uq Eq
C,
4z
hO
229
230
J. VIROL.
DELASSUS ET AL.
surprising that any two quasispecies are distinct. However it is not possible to conclude that the differences are significant. The sampling of 20 genomes, all present at low frequencies, from a large pool would invariably give different populations with perhaps different structures. These data caution against using a single molecular clone to represent HIV-1. Only a few sequential changes at particular sites, such as Thr-15--lAla-15, may possibly have any meaning. If the four such sites are considered, then there was little evolution of the nef protein sequence over the 4 years covered in this study. Once again the in vitro data did not reflect the in vivo data. Comparing either the nef or the LTR sequences, the relatively abundant forms recovered in vitro represented minor forms in vivo. In the case of the L3 and V3 and L6 and V6 pairs there were no common nucleic acid sequences (data not shown). The minimum number of differences was 1 to 2 nucleotides. This extends our previous study based on a 314-base segment encoding the first exon of the tat gene (28). Perhaps because the segment was smaller it was possible to find the minor form in the in vivo quasispecies. The new data from the nef-U3/R region indicated that in vitro coculture of HIV-1 resulted in the isolation of very minor forms. V6 was isolated from the patient during late-stage disease (CD4+ = 10/mm3) and was typically a rapid/high syncytium-inducing isolate. Despite the fact that patients with AIDS have little or no cell-mediated immunity (21), the virus isolated still did not reflect the major species in vivo. Once again these data caution against the extrapolation of in vitro data to a description of HIV-1-associated pathogenesis. The distortion of the population of genomes in culture may be due to statistical factors, methods, or the nature of the lymphocytes. Recently it has been shown that, in the context of virus coculture, seronegative donor cells secrete a soluble factor capable of inhibiting HIV-1 replication (7). Another nonnegligible factor may be the presence of substantial proportions of HNK-1 suppressor cells, particularly in patients with AIDS (23). Clearly a detailed study of the factors influencing the isolation of HIV-1, perhaps by using a genetic fingerprinting analysis as in this study, is urgently called for. Among all the 120 nef protein sequences within this study only a few were obviously defective. Thus, sequences L1.15, L1.21, and L6.01 encoded in-phase stop codons; L6.01 encoded a mutated start codon; and L1.09 and L3.21 carried large deletions. The L1.09 and L3.21 proviruses should be completely defective for replication, since the polypurine tract and 5' inverted repeat were also deleted. Though nef was, at one time, described as a negative regulatory element, no obviously defective nef protein sequences predominated. These protein sequences in vitro or in vivo did not present any amino acid substitutions that have not hitherto been observed (30). However, the distribution of amino acid substitutions among the Li, L3, and L6 (Fig. 2) or V2, V3, and V6 sets of sequences (data not shown) appeared nonrandom and was essentially confined to the amino- and carboxy-terminal regions. This would, if anything, suggest that a nef gene product is selected both in vitro and in vivo and that the central region between residues 40 and 130 encodes the most important functional domain. These data are not irreconcilable with the observation that nef mutant viruses are viable (14, 27, 36). The contribution of nef to the HIV life cycle may simply be subtle and unamenable to analysis in short-term experiments. That none of the LTR sequences were defective for transcription is understandable. A functionally defective LTR would be incapable of producing virus and cannot be
complemented. It is interesting to note that, while there was only a 10-fold difference in relative efficiencies of transactivation, the corresponding tat gene products varied by more than 100-fold in the same assay. This may simply reflect the fact that a defective tat may be complemented in trans while an LTR-defective genome may not. Clone pTAR/SEAP13 (representing 5% of L3 sequences) was twice as efficient as any of its homologs, as well as the Bru tat-U31R pair, at directing transcription. It is intriguing that this genome did not outgrow its siblings. A number of possibilities present themselves. However, a couple of trivial explanations could be (i) that the lymphocyte(s) harboring the sequence as a latent provirus was never activated by antigen or (ii) that the genome harbored a defect in some other gene, thus prohibiting viral replication. In the other clones, the mutations that greatly reduced the transactivation efficiency were concordant with the deletions and substitutions that have already been described for the Spl sites (24) and the TAR region (29). In the initial study no selection for more-efficient tat gene products was observed. The same conclusion can now be drawn from the analyses presented here of the promoter/ TAR region. Taken together, these data indicate that the apparent emergence of rapid/high syncytium-inducing isolates (3, 9, 35) with declining CD4 cell numbers is not due to modulation of the transactivating system. Thus, differences between the so-called slow/low and high/fast viruses must be encoded elsewhere within the genome. A comparison of the sequences from the V6 quasispecies showed that for both nef and U3/R there were two major forms (36 and 18% for nef and 45 and 36% for U3/R). Despite these comparable frequencies the sequences encoding the major nef sequence did not at the same time encode the major U3/R sequence. Even when single point mutations were eliminated, thus simplifying the analysis, the same conclusion held. This suggests that the nef and U3/R quasispecies were evolving independently of each other. Since they are located in cis, the only explanation for their being uncoupled would be efficient recombination between genomes. The efficiency of recombination has been estimated to be of the order of 20 to 50% per cycle (4, 6, 22, 26). In view of this it is indeed likely that HIV gene sequences may be uncoupled throughout the genome. Consequently the HIV genome would resemble that of a segmented virus despite being continuous. This would once again emphasize the plasticity of the HIV and allow individual genes to evolve independently. In conclusion these data greatly extend the notion, already described for a few molecular clones (13, 32), that the phenotype of any given clone may differ from that of another. As a consequence the biological properties of a given isolate will be made up of the sum of the properties of a myriad of subtly different genomes. In addition the extreme heterogeneity of the HIV-1 quasispecies either in vivo or in vitro cautions against extrapolating from sets of data that are too limited. ACKNOWLEDGMENTS
We thank Bryan Cullen for the gift of the plasmid pBC12/PL/ SEAP, and Birgitta Asjo, John Sninsky, and Andreas Meyerhans for providing viral isolates, chromosomal DNA, and valuable help in PCR. Sylvie Delassus and Remi Cheynier were supported by l'tcole Polytechnique and la Fondation pour la Recherche Medicale, respectively. This work was supported by grants from Institut Pasteur and l'Agence Nationale de Recherches sur le SIDA.
VOL. 65, 1991
REFERENCES 1. Ahmad, N., and S. Venkatesan. 1988. Nef protein of HIV-1 is a transcriptional repressor of HIV-1 LTR. Science 241:1481-
1485. 2. Asjo, B., J. Albert, F. Chiodi, and E. M. Fenyo. 1988. Improved tissue culture technique for production of poorly replicating human immunodeficiency virus strains. J. Virol. Methods 19: 191-196. 3. Asjo, B., L. Morfeldt-Manson, J. Albert, G. Biberfeld, A. Karlsson, K. Lidman, and E. M. Fenyo. 1986. Replicative capacity of human immunodeficiency virus from patients with varying severity of HIV infection. Lancet ii:660-662. 4. Beemon, K., P. Duesberg, and P. Vogt. 1974. Evidence for crossing-over between avian tumor viruses based on analysis of viral RNAs. Proc. Natl. Acad. Sci. USA 71:4254-4258. 5. Berger, J., J. Hauber, R. Hauber, R. Geiger, and B. R. Cullen. 1988. Secreted placental alkaline phosphatase: a powerful new quantitative indicator of gene expression in eukaryotic cells. Gene 66:1-10. 6. Blair, D. G. 1977. Genetic recombination between avian leukosis and sarcoma viruses. Experimental variables and the frequencies of recombination. Virology 77:534-544. 7. Brinchmann, J., G. Gaudernak, and F. Vartdal. 1990. Cellmediated suppression of HIV-specific cytotoxic T lymphocytes. J. Immunol. 144:2961-2966. 8. Chen, C., and H. Okayama. 1987. High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7:2745-2752. 9. Cheng-Mayer, C., D. Seto, M. Tateno, and J. A. Levy. 1988. Biologic features of HIV-1 that correlate with virulence in the host. Science 240:80-83. 10. Dingwall, C., I. Ernberg, M. J. Gait, S. M. Green, S. Heaphy, J. Karn, A. D. Lowe, M. Singh, M. A. Skinner, and R. Valerio. 1989. Human immunodeficiency virus 1 tat protein binds transactivation-responsive region (TAR) RNA in vitro. Proc. Natl. Acad. Sci. USA 86:6925-6929. 11. Domingo, E., J. J. Holland, and P. Ahiquist. 1988. RNA genetics. CRC Press, Inc., Boca Raton, Fla. 12. Eigen, M. 1973. Self organization of matter and the evolution of biological macromolecules. Naturwissenschaften 58:65-523. 13. Fisher, A. G., B. Ensoli, D. Looney, A. Rose, R. C. Gallo, M. S. Saag, G. M. Shaw, B. H. Hahn, and F. Wong-Staal. 1988. Biologically diverse molecular variants within a single HIV-1 isolate. Nature (London) 334:444 447. 14. Fisher, A. G., L. Ratner, H. Mitsuya, L. M. Marselle, M. E. Harper, S. Broder, R. C. Gallo, and F. Wong-Staal. 1986. Infectious mutants of HTLV-III with changes in the 3' region and markedly reduced cytopathic effects. Science 233:655-658. 15. Fujita, T., H. Shibuya, T. Ohashi, K. Yamanishi, and T. Taniguchi. 1986. Regulation of human interleukin-2 gene: functional DNA sequences in the 5' flanking region for the gene expression in activated T lymphocytes. Cell 46:401-407. 16. Gallo, R., F. Wong-Staal, L. Montagnier, W. A. Haseltine, and M. Yoshida. 1988. HIV/HTLV gene nomenclature. Nature (London) 333:504. 17. Goodenow, M., T. Huet, W. Saurin, S. Kwok, J. Sninsky, and S. Wain-Hobson. 1989. HIV-1 isolates are rapidly evolving quasispecies: evidence for viral mixtures and preferred nucleotide substitutions. J. Acquired Immune Defic. Syndr. 2:344-352. 18. Guy, B., M. P. Kieny, Y. Riviere, C. LePeuch, K. Dott, M. Girard, L. Montagnier, and J. P. Lecoq. 1987. HIV Ff3' ORF encodes a phosphorylated GTP-binding protein resembling an oncogene product. Nature (London) 330:266-269. 19. Hammes, S. R., E. P. Dixon, M. H. Malim, B. R. Cullen, and W. C. Greene. 1989. Nef protein of human immunodeficiency virus type 1: evidence against its role as a transcriptional inhibitor. Proc. Natl. Acad. Sci. USA 86:9549-9553. 20. Hattori, M., and Y. Sakaki. 1986. Dideoxy sequencing method using denatured plasmid template. Anal. Biochem. 152:232-238. 21. Hoffenbach, A., P. Langlade-Demoyen, G. Dadaglio, E. Vilmer,
EVOLUTION OF HIV-1 nef AND LTR SEQUENCES
22.
23.
24.
25.
231
F. Michel, C. Mayaud, B. Autran, and F. Plata. 1989. Unusually high frequencies of HIV-specific cytotoxic T lymphocytes in humans. J. Immunol. 142:452-462. Hu, W. S., and H. M. Temin. 1990. Genetic consequences of packaging two RNA genomes in one retroviral particle: pseudodiploidy and high rate of genetic recombination. Proc. Natl. Acad. Sci. USA 87:1556-1560. Joly, P., J. M. GuilHon, C. Mayaud, F. Plata, I. Theodorou, M. Denis, P. Debre, and B. Autran. 1989. CD8+ T cells inhibit HIV replication in naturally infected CD4+ T cells. J. Immunol. 143:2193-2201. Jones, K. A., J. T. Kadonaga, P. A. Luciw, and R. Tjian. 1986. Activation of the AIDS retrovirus promoter by the cellular transcription factor, Spl. Science 232:755-759. Kim, S., K. Ikeuchi, R. Byrn, J. Groopman, and D. Baltimore. 1989. Lack of negative influence on viral growth by the nef gene of human immunodeficiency virus type 1. Proc. Natl. Acad. Sci.
USA 86:9544-9548. 26. Linial, M., and D. Blair. 1982. Genetics of retroviruses, p. 649-783. In R. Weiss, N. Teich, H. Varmus, and J. Coffin (ed.), RNA tumor viruses. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 27. Luciw, P. A., C. Cheng-Mayer, and J. A. Levy. 1987. Mutational analysis of the human immunodeficiency virus. The orf-B region down-regulates virus replication. Proc. Natl. Acad. Sci. USA 84:1434-1438. 28. Meyerhans, A., R. Cheynier, J. Albert, M. Seth, S. Kwok, J. Sninsky, L. Morfeldt-Manson, B. Asjo, and S. Wain-Hobson. 1989. Temporal fluctuations in HIV quasispecies in vivo are not reflected by sequential HIV isolations. Cell 58:901-910. 29. Muesing, M. A., D. H. Smith, and D. J. Capon. 1987. Regulation of mRNA accumulation by a human immunodeficiency virus trans-activator protein. Cell 48:691-701. 30. Myers, G., A. B. Rabson, J. A. Berzofsky, T. F. Smith, and F. Wong-Staal. 1990. Human retroviruses and AIDS. Los Alamos National Laboratory, Los Alamos, N.M. 31. Rosen, C. A., J. G. Sodroski, and W. A. Haseltine. 1985. Location of cis-acting regulatory sequences in the human T cell lymphotropic virus type III (HTLV-III/LAV) long terminal repeat. Cell 41:813-823. 32. Sakai, K., S. Dewhurst, X. Ma, and D. J. Volsky. 1988. Differences in cytopathogenicity and host cell range among infectious molecular clones in human immunodeficiency virus type 1 simultaneously isolated from an individual. J. Virol. 62:40784085. 33. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 34. Steinhauer, D. A., and J. J. Holland. 1986. Rapid evolution of RNA viruses. Annu. Rev. Microbiol. 41:409-433. 35. Tersmette, M., R. E. Y. de Goede, B. J. M. Al, I. N. Winkel, R. A. Gruters, H. T. Cuypers, H. G. Huisman, and F. Miedema. 1988. Differential syncytium-inducing capacity of human immunodeficiency virus isolates: frequent detection of syncytiuminducing isolates in patients with acquired immunodeficiency syndrome (AIDS) and AIDS-related complex. J. Virol. 62:20262032. 36. Terwilliger, E., J. G. Sodroski, C. A. Rosen, and W. A. Haseltine. 1986. Effects of mutations within the 3' orf open reading frame region of human T-cell lymphotropic virus type III (HTLV-III/LAV) on replication and cytopathogenicity. J. Virol. 60:754-760. 36a.Vartanian, J.-P., A. Meyerhans, B. Asjo, and S. Wain-Hobson. Submitted for publication. 37. Wain-Hobson, S., P. Sonigo, 0. Danos, S. Cole, and M. Alizon. 1985. Nucleotide sequence of the AIDS virus, LAV. Cell 40:9-17. 38. Zapp, M. L., and M. R. Green. 1989. Sequence-specific RNA binding by the HIV-1 rev protein. Nature (London) 342:714716.
