Evolution of RH Genes in Hominoids: Characterization of a Gorilla ...

Evolution of RH Genes in Hominoids: Characterization of a Gorilla RHCE-like Gene A. Blancher and P.-A. Apoil

The human RH locus is responsible for the expression of the Rh blood group antigens. It consists of two closely linked genes, RHD and RHCE, that exhibit 92% similarity between coding regions. These observations suggest that they are derived from a relatively recent duplication event. Previously a study of nonhuman primate RH-like genes demonstrated that ancestral RH gene duplication occurred in the common ancestor of man, chimpanzees and gorillas. By amplification of intron 3 and intron 4 of gorilla RH-like genes, we have now shown that, like man, gorillas possess two types of RH intron 3 (RHCE intron 3 being 289 bp longer than the RHD intron 3) and two types of intron 4 (RHCE intron 4 being 654 bp longer than the RHD intron 4). Here we report the characterization of a cDNA encoded by a gorilla RH-like gene which possesses introns 3 and 4 of the RHCE type. A comparison of this gorilla RHCE-like coding sequence with previously characterized human and ape cDNA sequences suggests that RH genes experienced complex recombination events after duplication in the common ancestor of humans, chimpanzees and gorillas.

From the Laboratoire d’Immunoge´ne´tique Mole´culaire, Universite´ Paul Sabatier, Pavillon Charles Lefebyre, Ho ˆpital Purpan, Toulouse, France. This work was supported by funds from MESR (contrat Jeune e´quipe 1966) and from Agence Franc¸aise du Sang (contract 65001731231). We wish to thank Dr. Francis Roubinet for critically reviewing this manuscript and for helpful discussions and advice. We are indebted to Ste´phanie Despiau for her very efficient laboratory assistance. All experiments described in this article were performed in accordance with French laws and regulations currently in force. We thank Alejandro Rooney and Masatoshi Nei for helpful discussion and critical review. The gorilla RHCE-like coding sequence was submitted to GenBank/EMBL. We are waiting for the accession number. Address correspondence to Antoine Blancher, Laboratoire d’Immunologie, CHU (Centre Hospitalier et Universitaire) de Toulouse, Ho ˆpital Purpan, 31059 Toulouse CEDEX, France, or e-mail: blancher@mail. easynet.fr. This paper was delivered at a symposium entitled ‘‘Genetic Diversity and Evolution’’ sponsored by the American Genetic Association at the Pennsylvania State University, University Park, PA, USA, June 12–13, 1999.
2000 The American Genetic Association 91:205–210

The human Rh system encompasses five main antigens—D, C, c, E, and e—that are present on red blood cells ( Issitt and Anstee 1998). The term ‘‘Rhesus antigen’’ was introduced by Landsteiner and Wiener, who found that rabbits (and later, guinea pigs) immunized with red blood cells (RBCs) from a rhesus monkey produced antibodies which agglutinated 85% of Caucasian blood samples ( Landsteiner and Wiener 1940, 1941). The antibodies were called anti-Rhesus (anti-Rh), and the two human groups were defined as Rh positive and Rh negative. Before the discovery of the rhesus factor it was suspected that some cases of grave hemolytic anemia in newborn babies resulted from an unspecified immunologic incompatibility between the mother and the fetus ( Levine and Stetson 1939). Several observations made following the discovery of the Rh factor firmly established that the Rh factor was at the root of unexplained reactions that occurred during transfusion of blood that was of the same ABO, MNS and P types as the recipient, and that it was the cause of hemolytic disease in newborns ( Levine et al. 1941; Wiener and Peters 1940). Because the animal anti-Rh antibodies required extensive absorption before being able to produce faint Rh-specific agglutination, the use of animal anti-Rh an-

tibodies was abandoned and the definition of the Rh antigen was based on the use of human anti-Rh antibodies. Another problem was that it was impossible to demonstrate the presence of the Rh antigen on macaque red cells by tests with human anti-Rh reagents. Twenty years after Landsteiner and Wiener’s experiments, Levine et al. (1961) characterized in the serum of a guinea pig immunized with human RBCs a fraction of antibodies (called anti-LW in honor of Landsteiner and Wiener), which identified an antigen present on human Rh-positive and Rh-negative and rhesus monkey red cells ( Levine et al. 1961, 1963). The antigen LW was clearly distinct from the Rh antigen, and later it was demonstrated that the LW gene lies on human chromosome 19 (Sistonen 1984), while the RH gene is localized on the short arm of human chromosome 1 (Che´rif-Zahar et al. 1991; Marsh et al. 1974). Although the two genes are distinct, the Rh and LW proteins are part of a molecular complex called the Rh complex at the surface of red cells (Cartron et al. 1998). In conclusion, if the term ‘‘Rh’’ was coined by Landsteiner and Wiener because of the source of antigens (the rhesus monkey) they used to obtain anti-Rh in rabbits, it is highly probable that, in fact, they produced anti-LW antibodies. Despite that, the term Rh has con-

205

Table 1. Primer sequences Name of primers

Sequences

References

Ex.1-dir Ex10.rev Ex.4-dir Ex.5-rev Int.3-dir Int.3-rev RB46-dir intron4.RHCE-rev Gor.CE-dir

GCCTGCACAGAGACGGACACAGG CAACAGCCAAATGAGGAAACTTCC CGATACCCAGTTTGTCTGCCATGC TTGGGGTGAGCCAAGGATGAC(C/A)C (A/G)GGATTACAAGCAAGCATCACC CACGCAC(C/T)TCACTGATTCCTACTTC TGGCAAGAACCTGGACCTTGACTTT CCACCCTTGTTCCTTCACTCCTGG AAAGGGGGATAAAGGTCAGAG

Apoil and Blancher Apoil and Blancher Apoil and Blancher Apoil and Blancher Apoil and Blancher Apoil and Blancher Matassi et al. 1997 This study This study

tinued to be used for the most important human blood group system after ABO for clinical transfusion. Cross-reactivity of human anti-Rh reagents with nonhuman primate RBCs indicated that apes, contrary to rhesus monkey, possess counterparts of human Rh antigens (Masouredis et al. 1967; MoorJankowski et al. 1973). More recently, the use of monoclonal antibodies confirmed that some chimpanzees and gorillas express antigens that share epitopes (the term epitope designate the portion of an antigen which reacts with the antibody site of a given antibody) with the human D antigen ( Blancher et al. 1992a,b; Socha and Ruffie´ 1990) and that chimpanzees, gorillas, and gibbons express monomorphic c-like antigens (Socha and Ruffie´ 1983). Chimpanzee and gorilla counterparts of human antigen D are antigens Rc and Dgor, respectively ( Blancher et al. 1992a,b; Roubinet et al. 1993). The expression of antigens Rc and Dgor was shown to depend on chimpanzee and gorilla RH-like genes (Apoil et al. 1999; Salvignol et al. 1993, 1994). Although Rh-like antigen expression appears restricted to apes, Rh-like polypeptides are present at the surface of RBCs of rhesus monkey as well as several nonprimate mammalian taxa (e.g., cat, cow, rat; Saboori et al. 1989). Moreover, Rh-like polypeptides were also found in proteins extracted from RBC membranes of both Old World monkeys (OWM), New World monkeys ( NWM), lemur, mouse, rat, and dog by immunoblotting techniques (Apoil and Blancher 1999; Mouro et al. 1994; Salvignol et al. 1995). The human RH locus consists of two closely linked genes, RHD, responsible for the expression of the antigen D, and RHCE, which encodes proteins carrying antigens C or c and E or e. RHD is present or absent depending on the RH haplotype (Colin et al. 1991), and RHCE displays four common alleles (ce, Ce, cE, CE) responsible for the expression of the two antithetical (allelic) series of antigens C or c and E or e (Mouro et al. 1993). Moreover, it was demonstrat-

206 The Journal of Heredity 2000:91(3)

1999 1999 2000 2000 2000 2000

ed that the four main alleles of the RHCE gene were derived, by intergenic exchanges and interallele recombinations, from a few ancestor alleles (Carritt et al. 1997). Southern blot studies have shown that chimpanzees and gorillas possess at least three and two RH-like genes per haploid genome, respectively, whereas orangutan, gibbon, OWM, and NWM possess only one RH-like gene per haploid genome ( Blancher et al. 1992a; Blancher and Socha 1997). Thus it was inferred that the duplication event that produced the human RHCE and RHD genes occurred in the common ancestor of humans, chimpanzees, and gorillas. In man, intron 3 and intron 4 in the RHCE gene are longer by 289 bp and 654 bp, respectively, than those of the RHD gene (Arce et al. 1993; Matassi et al. 1997). By PCR it was shown that chimpanzees and gorillas have two types of intron 3 (RHCE-like and RHD-like) homologous in length with those of human RHD and RHCE genes, respectively, and two types of intron 4 (RHCE-like and RHD-like) homologous in length with those of human RHD and RHCE genes, respectively (Apoil et al. 1999; Apoil and Blancher 2000; Westhoff and Wylie 1996). Moreover, sequence studies showed that chimpanzees and gorillas have two types of RHD intron 4, which differ by the absence (type 1) or presence (type 2) of a 12-mer repeat (Apoil and Blancher 2000). Apparently only the RHD type 1 intron exists in humans, because the type 2 intron 4 cannot be detected by PCR experiments (Apoil and Blancher 2000). Existence of the two types of introns in chimpanzees and gorillas suggests that the gene with type 2 intron was lost in the human lineage after the split from chimpanzees (Apoil and Blancher 2000). The Rh-like cDNA sequences of three chimpanzees and one gorilla (Mabeke) were shown to be closer to the human RHD coding sequences than to the RHCE coding sequences (Salvignol et al. 1995). However, RHCE-like genes, which possess

Figure 1. Length polymorphism of intron 3 and 4 regions in gorilla RH-like genes. Black rectangles show the DNA regions present in the introns of the RHCE type and absent from introns of the RHD type. (A) Length differences between gorilla RHCE and RHD types introns 3 (289 bp) and between gorilla RHCE and RHD types introns 4 (654 bp). (B) A fragment of 1.95 kb amplified from gorilla Kessala genomic DNA. It contains introns 3 and intron 4 of the RHCE type. (C) Primer Gor.CE-dir used for amplication of gorilla RHCE-like cDNA from exon 4 to exon 10.

intron 3 and 4 of the RHCE type may exist in chimpanzees and gorillas. Nevertheless, the existence of functional RHCE-like genes in chimpanzees and gorillas has to be confirmed by detecting RHCE-like transcripts. Here we report the results of characterization of a cDNA encoded by a gorilla RH-like gene, which possess introns 3 and 4 of the RHCE type.

Materials and Methods Data Collection Fresh blood samples of gorillas were obtained from CIRMF (Centre International de Recherche Me´dicale de Franceville), Franceville, Gabon. Frozen blood samples were from LEMSIP ( Laboratory for Experimental Medicine and Surgery in Primates, New York Medical Center, Tuxedo, NY). The intron 4 and intron 3 regions of gorilla RH-like genes were studied by PCR amplification using two pairs of oligonucleotide primers described in Apoil et al. (1999) and Apoil and Blancher (2000). The sequences of primers used here are given in Table 1. From these preliminary studies, we opted to select DNA samples from a gorilla ( Kessala) that has introns 3 and 4 of the RHCE type. Long PCR amplification from intron 3 (primer RB.46-dir) to intron 4 (primer intron 4.RHCE-rev) was carried out with the genomic DNA from this gorilla ( Figure 1B). The length of the amplified fragment was identical to that obtained from the genomic DNA of a human control possessing only the RHCE gene (i.e., an RhD-negative Caucasian). The exon 4 region of the gorilla RHCE-like amplified fragment was sequenced on both strands using automated protocols ( Figure 1B). The mRNA extracted from the peripheral white blood cells of the previously mentioned gorilla was submitted to reverse transcription PCR (RT-PCR). The re-

sultant cDNA product was first amplified from exon 1 to 10 (primers Ex.1-dir and Ex.10-rev) using cDNAs obtained from total RNA extracted from peripheral blood of gorilla Kessala as templates. The resulting amplified fragments were used for a second seminested PCR amplification (from exon 4 to 10) using primers Gor.CE-dir and Ex.10-rev. The fragment obtained by the seminested PCR was sequenced (see Figure 1C). In order to enhance the specificity of the PCR reaction; a mismatch was introduced into the sequence of primer Gor.CEdir at position 6 from the 5⬘ end. Amplified fragments were separated by size with agarose-gel electrophoresis and were purified on columns (Qiagen, Hilden, Germany). Following purification, PCR fragments were sequenced on a 373A automated DNA sequencer (PE Applied Biosystems, Foster City, CA). DNA Sequence Analysis An alignment of nucleotide sequences was conducted by taking into account the deduced amino acid sequence alignment of the RH-like genes. The alignment was done by using the computer program CLUSTALW version 1.7 ( Thompson et al. 1994), with subsequent corrections made after visual inspection. Phylogenetic analysis was carried out using the computer program MEGA version 1.03 ( Kumar et al. 1993). Pairwise distances between nucleotide sequences were calculated by using Kimura’s (1980) two-parameter distances or the uncorrected p distance. Distances between amino acid sequences were calculated using a gamma distance with a shape parameter a ⫽ 2. Phylogenetic trees were constructed by the neighbor-joining method (Saitou and Nei 1987) with the pairwise deletion option. Statistical reliability was assessed using the bootstrap method ( Felsenstein 1985) with 500 replicates.

Results Characterization of a Gorilla Gene Which Possesses Intron 3 and 4 of the RHCE Type Figure 1A shows the length polymorphism in gorilla introns 3 and 4 (Apoil et al. 1999). In the case of intron 4, all gorillas tested so far (15 unrelated animals) had an intron 4 sequence similar in length (0.5 kb) to the human RHD intron 4. The second type of intron was similar in length to the human RHCE intron 4 (1.25 kb), but was detected by PCR amplification in only 5 of 15 gorillas. In the case of intron 3, 7

of 15 gorillas showed two different PCR length fragments. One was similar to the human RHD gene (290 bp) and the other one was similar to the human RHCE gene (580 bp). In the remaining eight gorilla samples, only RHCE-like intron 3 was detected. To confirm the presence of an RHCE-like gene in gorillas, we tried to amplify a long genomic fragment which encompassed both introns 3 and 4 of this putative gene. From gorilla Kessala, which was known to have introns 3 and 4 of the RHCE type, a DNA fragment approximately 2 kb was amplified using an intron 3 primer (RB46-dir) and a primer specific to the RHCE intron 4 ( Intron4.RHCE-rev) ( Figure 1B). The length of this gorilla amplified fragment was equivalent to those obtained by amplification of human DNA control samples from individuals having only the RHCE gene. By means of primers RB46-dir and Intron4.RHCE-rev, this DNA fragment was not obtained from a DNA sample of a different gorilla, which did not have intron 4 of the RHCE type. Direct sequencing of the gorilla 2 kb amplified fragment confirmed the presence of RHCE-specific elements in intron 3 and intron 4 (data not shown). The sequence of exon 4 of these fragments ( hereafter named Gor RHCE exon 4) was closer to human RHCE exon 4 rather than to human RHD exon 4 ( Figure 2 and Table 2). Moreover, the Gor RHCE exon 4 sequence differs significantly from all other gorilla cDNA sequences previously characterized (Salvignol et al. 1995).

Characterization of Gorilla RHCElike cDNA From the gorilla Gor RHCE exon 4 sequence, we designed a primer (Gor.CE-dir) for allele-specific PCR amplification (see Material and Methods; Table 1 and Figure 1C). cDNA obtained from total RNA extracted from peripheral blood of gorilla Kessala was first amplified from exon 1 to 10 (primers Ex.1-dir and Ex.10-rev). The resulting amplified fragments were used for a second seminested PCR (from exon 4 to 10) using primers Gor.CE-dir and Ex.10-rev. The fragment obtained by the seminested PCR was sequenced (see Figure 1C). The cDNA region which corresponds to exon 4 (33 bp) was identical to the genomic Gor RHCE exon 4. The cDNA region that corresponds to the Gor RHCE exon 5 sequence differed from the genomic exon 5 sequence obtained in another study by only one position (Apoil et al. 1999). We concluded from these compari-

sons that the amplified fragment corresponded to the mRNA encoded by RHCE gene detected in the genome of Kessala. All our attempts to amplify the RHCE-like cDNA of gorilla Kessala from exon 1 to exon 4 failed. A coding sequence was deduced from the Kessala genomic exon 4 and from Kessala’s RHCE-like cDNA. This gorilla RHCElike coding sequence (exon 4 to 10) was aligned to human and primate Rh cDNA sequences ( Figure 2). Gorilla RHCE-like cDNA differs from human RHCE cDNA (cE allele) by 34 nucleotides and from human RHD cDNA by 35 nucleotides ( Table 2). However, the phylogenetic tree shown in Figure 2 suggests that the gorilla RHCE-like coding sequence is closer to that of human RHCE (cE allele) than to that of human RHD ( Figure 3), although the bootstrap value was very low (34%). The phylogenetic trees constructed for exons 4 and 5 confirmed this result (data not shown). For other coding regions, the gorilla RHCE-like cDNA sequence clustered either with human counterparts [RHD and RHCE (cE and Ce alleles)] and chimpanzee Patr 211 sequences (exon 6), or with human RHD cDNA and the gorilla cDNA sequences Gor IC and Gor ID (exon 7), or with the two gorilla cDNA sequences Gor IC and Gor ID (exons 8, 9, and 10). The gorilla RHCE-like coding region was translated into an amino acid sequence and compared with the sequences of other primates ( Figure 4). The number of amino acid differences between the gorilla RHCE-like polypeptide and the human RhD and RhcE polypeptides were 29 and 25, respectively ( Table 2). Differences between gorilla RHCE-like polypeptide and two other gorilla Rh-like polypeptides were almost identical (24 and 25, respectively) ( Table 2). The topology of the phylogenetic tree obtained from the alignment shown in Figure 4 was identical to the tree reconstructed from nucleotide sequences given in Figure 3.

Discussion We have shown here that a gorilla gene is similar to the human RHCE gene with respect to introns 3 and 4. A gorilla cDNA amplified fragment that is encoded by this gorilla RHCE-like gene was partially sequenced. Although it is not possible to determine if RHCE-like encoded polypeptides are expressed at the surface of red blood cells on the basis of this study, one might still speculate on the relationship between gorilla RHCE-like encoded protein and the

Blancher and Apoil • Genes Evolution in Primates 207

Table 2. Number of total and nonsynonymous nucleotide substitutions observed when the Gor.CE-like cDNA is compared to human and gorilla RH sequences Analyzed region

RhcE

Exon 4a Exon 5 Exon 6 Exon 7 Exons 8–10 Exons 4–10

6 7 4 13 4 34

RhD

Gor.IC

Gor.ID

(6) 9 (9) 11 (9) 8 (6) 5 (5) 7 (6) 6 6 (4) 7 (3) 8 (2) 9 (8) 12 (8) 5 (3) (3) 3 (3) 5 (4) 0 (25) 35 (29) 35 (25) 31

(8) (6) (5) (5) (0) (2.4)

Nb 121 165 137 133 180 736

The numbers in parentheses correspond to nonsynonymous substitutions. The lowest numbers of differences are underlined. a Only 121 positions were available in exon 4 for comparison. b Number of nucleotide positions analyzed.

Figure 2. Gorilla RHCE-like coding sequence in comparison with human and other primate sequences. Nucleotide positions are numbered according to the RHCE cDNA (⫹1 taken as the first nucleotide of the ATG initiator codon). The nucleotide sequence of human RHCE (cE allele) cDNA is used as a reference, with a point (.) for nucleotide identity, a dash (-) for nucleotide deletion, and a question mark (?) when the position is unknown. Only variable positions are shown. Exon boundaries are those of the human RHCE gene (Che´rif-Zahar et al. 1994). The references of Rh and Rh-like cDNA sequences presented in this figure are human RhD (Homo sapiens): L08429 (Arce et al. 1993); human RhcE and RhCe (Che´rif-Zahar et al. 1990, Mouro et al. 1993); Chimp. ⫽ chimpanzee (Pan troglodytes); gorilla (Gorilla gorilla); cynomolgus (Macaca fascicularis) (Salvignol et al. 1995); baboon (Papio papio) (Apoil et al., 2000); rhesus monkey (Macaca mulatta) (Mouro et al. 1994); capuchin monkey (Cebus apella) (this study, accession number AF101479).

Rh-like antigens of gorilla. The single gorilla Rh-like antigen that can be studied is called Dgor and is detected on red blood cells by means of certain human anti-D monoclonal antibodies (Roubinet et al. 1993). The reactivity of one of these human monoclonal anti-D antibodies, LOR15C9, was extensively studied with large panels of human RhD antigenic variants (Apoil et al. 1997). It was deduced from the results that the reactivity of LOR-15C9

208 The Journal of Heredity 2000:91(3)

depended mainly on the sixth external loop of the Rh polypeptide, and more precisely on a motif of three amino acids (Asp350-Gly353-Ala354; Apoil et al. 1997). This was confirmed by tests with erythroleukemia cells transfected with human RHCE cDNA mutagenized at codons 350, 353, and 354 ( His350- → Asp, Trp353- → Gly, Asn354- → Ala) ( Liu et al. 1999). Rh polypeptides that are recognized by the LOR15C9 antibody are expressed on the mem-

branes of these transfected cells (Smythe, JS personal communication). Moreover, the mutation Asp350- → His in the human DIVa variant is sufficient to abolish reactivity with LOR-15C9 (Apoil et al. 1997; Rouillac et al. 1995). Of interest, the gorilla RHCE-like polypeptide shows the motif His350, Glu353, Ala354, which is equivalent to human DIVa. These data suggest that the gorilla RHCE-like polypeptide is not responsible for the expression of the Dgor antigen in gorilla. In fact, Kessala was Dgor negative (Apoil et al. 1997). By contrast, an animal that does not have the RHCElike gene (Mabeke) is Dgor positive and expresses one Rh polypeptide (Gor ID) that shows the RhD characteristic motif Asp350Gly353-Ala354 ( Figure 4). The RHCE-like cDNA exhibited a sequence suggestive of recombination between gorilla RHCE-like and RHD-like genes. Indeed, the gorilla RHCE-like coding sequence appears to be composite: RHCElike in exons 4 and 6, slightly closer to RHD-like in exon 5, and closer to other gorilla sequences than to human RH sequences from exon 8 to exon 10 (see Table 2). These observations suggest that the

Figure 3. Neighbor-joining tree of RH and RH-like coding sequences. Evolutionary distances were calculated by Kimura’s two-parameter method on the basis of the nucleotide alignment ( Figure 2). Bootstrap values are based on 500 replications. The percentages of occurrence of each branching are reported on the tree.

References Apoil P-A and Blancher A, 1999. Sequence and evolution of mammalian RH gene transcripts and proteins. Immunogenetics 49:15–25. Apoil P-A and Blancher A, 2000. Rh gene evolution in primates: study of intron sequences. Mol Biol Evol. 17: 127–136 Apoil P-A, Reid ME, Halverson G, Mouro I, Colin Y, Roubinet F, Cartron J-P, and Blancher A, 1997. A human monoclonal anti-D antibody which detects a nonconformation-dependent epitope on the RhD protein by immunoblotting. BJ Haematol 98:365–374. Apoil P-A, Roubinet F, and Blancher A, 1999. Gorilla RHlike genes and antigens. Immunogenetics 49:125–133. Arce MA, Scott-Thompson E, Wagner S, Coyne KE, Ferdman BA, and Lublin DM, 1993. Molecular cloning of RhD cDNA derived from a gene present in RhD positive but not RhD-negative individuals. Blood 82:651–655. Blancher A, Calvas P, and Ruffie´ J, 1992a. Etude des e´quivalents des antige`nes rhe´sus chez les primates non hominiens. C R Soc Biol 186:682–695. Blancher A and Socha WW, 1997. The Rhesus system. In: Molecular biology and evolution of blood group and MHC antigens in primates ( Blancher A, Klein J, Socha WW, eds). Heidelberg: Springer Verlag; 93–164. Blancher A, Socha WW, and Ruffie´ J, 1992b. Diversity of human anti-D monoclonal antibodies revealed by reactions with chimpanzee red blood cells. Vox Sang 63: 112–118. Carritt B, Kemp TJ, and Poulter M, 1997. Evolution of the human RH (rhesus) blood group genes: a 50 year old prediction (partially) fulfilled. Hum Mol Genet 6: 843–850. Cartron JP, Bailly P, Le Van Kim C, Cherif-Zahar B, Matassi G, Bertrand O, and Colin Y, 1998. Insights into the structure and function of membrane polypeptides carrying blood group antigens. Vox Sang 74(suppl 2):29– 64.

Figure 4. Amino acids alignment of predicted Rh and Rh-like polypeptides. The human RhcE polypeptide is used as reference, with a point (.) for amino acid identity and a dash (-) for a deletion. Only variable positions are shown.

gorilla RHCE-like gene might be a product of a series of complex recombination events between two gorilla ancestor genes: one resembling the human RHD gene and another that was closer to human RHCE. If this is the case, it is possible that the common ancestor of man and gorilla already had two different RH genes: the RHD ancestor and the RHCE ancestor. In this case, humans, chimpanzees, and gorillas would have RH genes of two clearly differentiated RHD and RHCE types. This is demonstrated only in a region encompassing introns 3 and 4. The noncoding regions of nonhuman RH-like genes outside intron 3 and 4 have not yet been characterized. Moreover, the analysis of coding sequences does not allow us to determine whether actual RH genes of humans, chimpanzees, and gorillas are closer to the RHD ancestor or to the RHCE ancestor genes (Apoil and Blancher 2000; Salvignol et al. 1995). One might evoke another hypothesis in which the differentiation of the resulting genes occurred inde-

pendently in humans, chimpanzees, and gorillas after the duplication of the ancestor gene, and some parts of the genes were subsequently subject to homogenization by intergenic exchanges. This type of evolution is compatible with the mosaic aspect of the gorilla RHCE-like cDNA, which is closer to human RHCE in some exons and closer to human RHD or gorilla sequences in other exons. However, in humans the RHD and RHCE genes remain differentiated (along 417 codons, 41 nucleotide substitutions in the coding parts 35 being nonsynonymous) despite intergenic exchanges which are now well documented ( Huang 1997). In gorilla the difference between the RHCE-like and other gorilla RH-like genes is similar to that observed in man (along 245 codons, 33 or 35 nucleotidic substitutions, 24 or 25 being nonsynonymous; see Table 2). This suggests that the maintenance of such differences between the two types of genes in humans and in gorillas could have been favored by positive selection.

Che´rif-Zahar B, Bloy C, Le Van Kim C, Blanchard D, Bailly P, Hermand P, Salmon C, Cartron J-P, and Colin Y, 1990. Molecular cloning and protein structure of a human blood group Rh polypeptide. Proc Natl Acad Sci USA 87:6243–6247. Che´rif-Zahar B, Le Van Kim C, Rouillac C, Raynal V, Cartron J-P, and Colin Y, 1994. Organization of the gene (RHCE) encoding the human blood group RHCcEe antigens and characterization of the promoter region. Genomics 19:68–74. Che´rif-Zahar B, Matte´i MG, Le Van Kim C, Bailly P, Cartron JP, and Colin Y, 1991. Localisation of the human Rh blood group gene structure to chromosome 1p34.3– 1p36.1 region by in situ hybridization. Hum Genet 86: 398–400. Colin Y, Che´rif-Zahar B, Le Van Kim C, Raynal V, Van Huffel V, and Cartron J-P, 1991. Genetic basis of the RhD-positive and RhD-negative blood group polymorphism as determined by Southern analysis. Blood 78: 2747–2752. Felsenstein J. 1985. Confidence limits of phylogenies: an approach using the bootstrap. Evolution 36:783–791. Huang CH, 1997. Molecular insights into the Rh protein family and associated antigens. Curr Opin Hematol 4: 94–103. Issitt PD and Anstee DJ, 1998. The Rh blood group system. In: Applied blood group serology, 4th ed ( Issitt PD and Anstee DJ, eds). Durham, NC: Montgomery Scientific; 315–423. Kimura M, 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16: 111–120. Kumar S, Tamura K, and Nei M, 1993. MEGA: molecular evolutionary genetics analysis, version 101. University Park, PA: Pennsylvania State University. Landsteiner K and Wiener AS, 1940. An agglutinable fac-

Blancher and Apoil • Genes Evolution in Primates 209

tor in human blood recognized by immune sera for blood. Proc Soc Exp Biol Med 43:223.

hybrid D-CE-D gene in the DVI phenotype. Am J Hum Genet 60:808–817.

Landsteiner K and Wiener AS, 1941. Studies of an agglutinogen (Rh) in human blood reacting with anti-rhesus antisera and human isoantibodies. J Exp Med 74: 309–320.

Moor-Jankowski J, Wiener AS, Socha WW, Gordon EB, and Kaczera Z, 1973. Blood group homologues in orangutans and gorillas of the human Rh-Hr and chimpanzee C-E-F systems. Fol Primatol 19:360–367.

Levine P, Burnham L, Katzin EM, and Vogel P, 1941. The role of isoimmunization in the pathogenesis of erythroblastosis fetalis. Am J Obstet Gynecol 42:925–937.

Mouro I, Colin Y, Che´rif-Zahar B, Cartron J-P, and Le Van Kim C, 1993. Molecular genetic basis of the human rhesus blood group system. Nat Genet 5:62–65.

Levine P, Celano MJ, Fenichel R, Pollack W, and Singher HA, 1961. ‘‘D-like’’ antigen in rhesus monkey, human Rh positive and human Rh negative red blood cells. J Immunol 87:747–752.

Mouro I, Le Van Kim C, Che´rif-Zahar B, Salvignol I, Blancher A, Cartron J-P, and Colin Y, 1994. Molecular characterization of the Rh-like locus and gene transcripts from the rhesus monkey (Macaca mulatta). J Mol Evol 38:169–176.

Levine P, Cellano MJ, Wallace J, and Sanger R, 1963. A human ‘‘D-like’’ antibody. Nature 198:596–597. Levine P and Stetson RE, 1939. An unusual case of intragroup agglutination. JAMA 113:126–127. Liu W, Smythe JS, Scott ML, Jones JW, Voak D, and Avent ND, 1999. Site-directed mutagenesis of the human D antigen: definition of D epitopes on the sixth external domain of the D protein expressed on K562 cells. Transfusion 39:17–25. Marsh WL, Chaganti RS, Gardner FH, Mayer K, Nowell PC, and German J, 1974. Mapping human autosomes: evidence supporting assignment of rhesus to the short arm of chromosome no. 1. Science 183:966–968.

Roubinet F, Blancher A, Socha WW, and Ruffie´ J, 1993. Quantitative study of chimpanzee and gorilla counterparts of the human D antigen. J Med Primatol 22:29– 35. Rouillac C, Colin Y, Hughes-Jones NC, Beolet M, D’Ambrosio AM, Cartron J-P, and Le Van Kim C, 1995. Transcript analysis of D category phenotypes predicts hybrid RhD-CE-D proteins associated with alteration of D epitopes. Blood 85:2937–2944. Saboori AM, Denker BM, and Agre P, 1989. Isolation of proteins related to the Rh polypeptides from nonhuman erythrocytes. J Clin Invest 83:187–191.

Masouredis SP, Dupuy ME, and Elliot M, 1967. Distribution of the Rh ( D) antigen in the red cells of nonhuman primates. J Immunol 98:8–16.

Saitou N and Nei M, 1987. The neighbor joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425.

Matassi GB, Che´rif-Zahar I, Mouro I, and Cartron J-P, 1997. Characterization of the recombination hot spot involved in the genomic rearrangement leading to the

Salvignol I, Blancher A, Calvas P, Clayton J, Socha WW, Colin Y, and Ruffie´ J, 1994. Molecular genetics of chimpanzee Rh-related genes: their relationship with R-C-E-

210 The Journal of Heredity 2000:91(3)

F blood group system the chimpanzee counterpart of human RH system. Biochem Genet 32:201–221. Salvignol I, Blancher A, Calvas P, Socha WW, Colin Y, Cartron J-P, and Ruffie´ J, 1993. Relationship between chimpanzee Rh-like genes and the R-C-E-F blood group system. J Med Primatol 22:19–28. Salvignol I, Calvas P, Socha WW, Colin Y, Le Van Kim C, Bailly P, Ruffie´ J, Cartron J-P, and Blancher A, 1995. Structural analysis of the RH-like blood group gene products in nonhuman primates. Immunogenetics 41: 271–281. Sistonen P, 1984. Linkage of the LW blood group locus with the complement C3 and Lutheran blood group loci. Ann Hum Genet 48:239–242. Socha WW and Ruffie´ J, 1983. Blood groups of primates: theory, practice, evolutionary meaning. New York: A. Liss. Socha WW and Ruffie´ J, 1990. Monoclonal antibodies directed against human red cell antigens in tests with the red cells of non human primates. Rev Fr Transfus Hemobiol 33:39–48. Thompson JD, Higgins DJ, and Gibson TJ, 1994. CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting position-specific gap penalties and weight matrix choices. Nucleic Acids Res 22:4673–4680. Westhoff CM and Wylie DE, 1996. Investigation of the Rh locus in gorillas and chimpanzees. J Mol Evol 42: 658–668. Wiener AS and Peters HR, 1940. Hemolytic reactions following transfusions of blood of the homologous group with three cases in which the same agglutinogen was responsible. Ann Intern Med 13:2306–2322. Corresponding Editor: Masatoshi Nei