Evolutionarily conserved nucleotides within the E.coli 4.5S optimal ...

k.) 1992 Oxford University Press

Nucleic Acids Research, 1992, Vol. 20, No. 22 5919-5925

Evolutionarily conserved nucleotides within the E.coli 4.5S RNA are required for association with P48 in vitro and for optimal function in vivo Heather Wood*, Joen Luirink+ and David Tollervey European Molecular Biology Laboratory, Postfach 102209, Meyerhofstrasse Germany

1,

6900 Heidelberg,

Received September 4, 1992; Revised and Accepted October 16, 1992

ABSTRACT E.coli 4.5S RNA is homologous to domain IV of eukaryotic SRP7S RNA, the RNA component of the signal recognition particle. The 4.5S RNA is associated in vivo with a 48kD protein (P48), which is homologous to a protein component of the signal recognition particle, SRP54. In addition to secondary structural features, a number of nucleotides are conserved between the 4.5S RNA and domain IV of all other characterised SRP-like RNAs from eubacteria, archaebacteria and eukaryotes. This domain consists of an extended stem-loop structure; conserved nucleotides lie within the terminal loop and within single-stranded regions bulged from the stem immediately preceding the loop. This conserved region is a candidate for the SRP54/P48 binding site. To determine the functional importance of this region within the 4.5S RNA, mutations were introduced into the 4.5S RNA coding sequence. Mutated alleles were tested for their function in vivo and for the ability of the corresponding RNAs to bind P48 in vitro. Single point mutations in conserved nucleotides within the terminal tetranucleotide loop do not affect P48 binding in vitro and produce only slight growth defects. This suggests that the sequence of the loop may be important for the structure of the molecule rather than for specific interactions with P48. On the other hand, nucleotides within the single-stranded regions bulged from the stem were found to be important both for the binding of P48 to the RNA and for optimal function of the RNA in vivo. INTRODUCTION Signal recognition particle (SRP) is a ribonucleoprotein (RNP). Mammalian SRP is composed of a 7S RNA molecule, (SRP7S), and six different protein subunits. It is required for targeting *

nascent secretory proteins to the endoplasmic reticulum (reviewed in 1). Small RNA species which contain a domain homologous to domain IV of SRP7S RNA have been identified in a wide variety of organisms, including a number of eubacterial species (2, 3). The E.coli representative is the 4.5S RNA, a 114 nucleotide, metabolically stable RNA, which is essential for viability (4). The 4.5S RNA is associated in vivo with the P48 protein, (product of the ffh gene), which shows similarity in sequence to a protein component of the signal recognition particle, SRP54 (5, 6, 7, 8). SRP54 recognises the signal sequence of the nascent polypeptide chain as it emerges from the ribosome (9, 10). The existence of homologues of two SRP components in E. coli raised the possibility that the prokaryotic RNP may also be involved in a pathway of protein secretion. The functional relationship of the mammalian and bacterial components is highlighted by the ability of the human 7S RNA to complement the loss of 4.5S or scRNA (the B.subtilis homologue) in vivo (8, 11) and by the ability of mammalian SRP54 to bind to the E. coli 4.5S RNA in vitro (7, 8, 12). More recently it has been shown that, like SRP54, P48 also interacts with nascent signal sequences in vitro (13). A comparison of 7S-like RNAs reveals a number of conserved regions (14). Archaebacterial and eukaryotic 7S-like RNAs share domain mI, the major binding site for SRP19 (15). This domain is not present in eubacterial 7S-like RNAs. The binding site for the SRP9/14 heterodimeric protein, domain I, which appears to be present in all characterised eukaryotic and archaebacterial 7Slike RNAs, has so far been found in only one eubacterial 7Slike RNA, the scRNA from B.subtilis (16). The only region of 7S-like RNAs that is universally conserved is domain IV (17). This domain consists of an extended stem-loop structure. Highly conserved and invariant residues lie within the terminal tetranucleotide loop and within single-stranded regions bulged from the stem immediately preceding this loop. This conserved region is a candidate for the SRP54/P48 binding site. In order to determine the functional importance of this region within the

To whom correspondence should be addressed

+ Present address: Department of Molecular Microbiology,

Faculty of Biology, De Boelelaan 1087, 1081 HV Amsterdam, The Netherlands

5920 Nucleic Acids Research, 1992, Vol. 20, No. 22 E.coli 4.5S RNA, we changed conserved residues by site directed mutagenesis and analysed the effects of these changes on P48 binding and on the function of the mutated alleles in vivo. The results indicate that the evolutionarily conserved residues within the bulged region are important both for P48 binding and function of the RNA. Conserved residues within the tetranucleotide loop, although important for function, are not required for P48 binding in vitro.

MATERIALS AND METHODS Plasmid constructions The region encoding the mature portion of the 4.5S RNA (lacking 4 nucleotides at the 3' end) was amplified by PCR using the 4.5S RNA clone in p801 (kindly provided by M.J.Fournier) as a template. Primers were designed to introduce SaIl and BamHI restriction sites at the 5' and 3' ends respectively. The fragment was cloned between the SalI and BamHI sites of pT7/T3a19 (purchased from Stratagene). In order to express the 4.5S RNA in vivo, the fragment which encodes the 4.5S RNA precursor was amplified by PCR using primers to introduce Sall and BamHI restriction sites at the 5' and 3' ends respectively. This fragment was cloned between the BamHI and Sall sites of pDR720 (18), thus placing the gene under the control of the trp promoter. The tip promoter-4.5S gene was then removed on a EcoRI-BamHlI fragment and cloned between the EcoRI and BamHI sites of pLK9159. pLK9159 is a derivative of pLK915 (19), which has been modified to remove the unique Sall site; pLK915 was cut with Sall and HindlII, treated with T4 DNA-polymerase and religated. The final plasmid (pPre4.5wt), contains the 4.5S RNA precursor coding sequence cloned between the tip promoter and phage fD transcriptional terminators.

Construction of mutant alleles Mutations were constructed by successive PCR reactions using the 4.5S RNA coding sequence in pT7/T3a19 as a template. A mutagenic oligonucleotide was employed as a primer along with a second primer which hybridises to 5' flanking plasmid sequences. Concurrently, an independent PCR reaction was performed to generate the 3' end of the 4.5S RNA coding sequence. The PCR products from these two reactions overlap by 15 nucleotides. These fragments were then combined and used as templates in a further PCR reaction. In this reaction the mutated 4.5S RNA coding region was amplified using primers designed to incorporate Sall and BamHI at the 5' and 3' ends respectively. The resulting fragments were cloned between the Sall and BamHI sites of pT7/T3a 19 as described for the wild-type gene. In order to incorporate the mutations into the pre4.5S RNA gene, each mutant 4.5S gene in pT7/T3cd19 was used as a template in a further PCR reaction. The primer at the 5' end of the gene was extended so as to generate a fragment which encodes the 4.5S RNA precursor. This SalI-BamI-l fragment was then used to replace the wild-type fragment in pPre4.5wt (described above). The nucleotide sequence of all mutant alleles was confirmed by DNA sequencing of one strand. In cases where the sequence was ambiguous the second strand was sequenced or dGTP was replaced by dITP in the sequencing reaction. The fraction of nucleotides misincorporated over the double PCR reaction was found to be approximately 0.2%.

Bacterial strains The ability of the mutant alleles to support growth was tested in E. coli FF283T (F'::TnIO proA+B+ lacIQ A(lacZ)Ml5/lacAx74 araD139[araABOIC-leu] A7679 galU galK rpsL), a variant of E.coli FF283 (kindly provided by M.J.Fournier) in which the F' factor from FF283 has been replaced by that containing the tetracycline resistance marker from E. coli XL1 blue. The endogenous 4.5S RNA gene (ifs) in this strain is under the control of the tac promoter and hence the strain is IPTG or lactose dependent. Other manipulations were carried out in E.coli XL1 blue. Media Growth of E. coli FF283T transformants was analysed on M9-glucose media containing glucose (0.4%) and casamino acids (0.2%). The chromosomal copy of the ifs gene was induced by replacing the glucose with lactose (0.4%). Where stated tryptophan was added to 0.04mgnl--'. For other manipulations cells were routinely grown on LB (20). Ampicillin (I00igmln-) and tetracycline (12.5ygmn-1) were added to all media. RNA preparation Cells were grown in M9-glucose media for 4.5hrs (37°C), 5.5hrs (30°C), or 7.75hrs (25°C). At these time points the chromosomally expressed 4.5S RNA has fallen to a level, below which it cannot support growth. The cells from the equivalent of 6 OD6Wo units of culture were resupended in I00A of a 1:1 mixture of 4M guanidinium thiocyanate (GTC), (buffered with Tris.HCl pH7.5) and phenol. An equal volume of glass beads (Sigma, G-1 145) was added and the mixture vortexed for 5 min. at 4°C. A further 350A1d each of 4M GTC and phenol were added, followed by 4001t chloroform/isoamylalcohol and 2001il 100mM NaOAc in TE, and the mixture was heated to 65°C for 5min. After centrifugation the aqueous phase was recovered and extracted twice with phenol/chloroform. The RNA was precipitated with 2.5 volumes of ethanol. RNA was separated by electrophoresis on 8% acrylamide, 8.3M urea gels. RNA was transferred to Hybond-N membrane (Amersham). The filter was probed with [32P]-labelled anti-sense RNA transcribed in vitro using T3 RNA-polymerase and the wild-type 4.5S RNA construct in pT3/T7o19 (see above) as template. To allow for variation in transfer and hybridisation efficiencies, northern blotting was performed in duplicate.

Immunoprecipitation E.coli lysates were prepared by resupending cells in 150mM NaCl, 5mM MgCl2, 20mM Tris (pH8.0), 0.05% NP40, 4mM vanadyl-ribonucleoside complex, 0. 1mM PMSF. 0.5 volumes of glass beads (Sigma, G- 1145) were added and the suspension was vortexed for 5 min at 4°C. Protein A-Sepharose was equilibrated in 150mM NaCl, 5mM MgCl2, 20mM Tris (pH 8), 0.05% NP40 and incubated for 2 hrs with the polyclonal antiserum 730. This antibody was raised against a peptide derived from an evolutionarily conserved region of SRP54 and cross-reacts with P48 (8). After antibody binding, the protein A-Sepharose was washed with the same buffer and incubated with the lysate. To specifically block the interaction of the antibody with P48 in control experiments, competitor peptide (lag) was added to the protein A-Sepharose-antibody complex and incubated for 5 min before addition of the lysate. After centrifugation, the pellet was washed 3 times in the same

Nucleic Acids Research, 1992, Vol. 20, No. 22 5921 V

40

Ac

30

5

10

u 20 4 ACCA UA C UCC G-A GGU UCUGUUU UCCCG CA ACGC AGG A CCG AGACGGA UGCG AGGGC A A A CG UGU go 70 CGUG 80 CAGU

GGGGGCUCUGUUGGUU CCCACCCCCGGGACGGUCGA 110

100

C

CIU C G A4

G

CAGG50O4

c

CU C3GU GU 60

t 17 6

5 .' 3.

GAAC

GGGGU CCUCA A

220

A

CGGCC

A

cA UCG A

A CUGG

GGC A A

ACG A

B Figure 1. A. Locations of the point mutations within the E.coli 4.5S RNA secondary structure. Residues which are invariant across all known 7S-like RNAs (14), are indicated in bold. The large arrows denote the endpoints of the deletion in the mutant A(49-60). B. The coffesponding region, domain IV of the human SRP7S RNA (nucleotides 176-220), (17).

buffer. RNA was recovered by heating to 65°C in a 1: 1 mixture of 4M GTC and phenol, and extracted as described above. In vitro binding assay The RNAs encoded by each of the mutant 4.5S genes were transcribed in vitro using T7 polymerase after linearisation of the constructs in pT7/T3ct19 with BamHI. As a negative control the plasmid containing the wild-type 4.5S RNA gene was linearised with Sall and transcribed using T3 RNA-polymerase to generate an anti-sense RNA. RNAs were ethanol precipitated after adjustment to 2.5M ammomium acetate. pET-8c-48 (kindly provided by A.Giner and B.Dobberstein), was used for the in vitro transcription of the P48 protein. This contains the coding region for P48 under the control of the T7 promoter in pET-8c (8). RNA was ethanol precipitated and translated for 30 min at 25°C in a wheat germ cell free system (Promega), in the presence of [35S]methionine. EDTA was added to a final concentration of 5mM to release nascent chains from ribosomes and tRNA, and incubation was continued for a further 15 min. The translation reactions were then adjusted to 5mM MgOAc2, 450mM KOAc. 10,lO of the translation reaction were incubated with lAg RNA at 25°C for 30 min. The volume was adjusted to 200i1 with 450mM KOAc, 5mM MgOAc2, 50mM Tris pH7.4 (wash buffer). 20d1 was removed and TCA precipitated to monitor total protein synthesis. 30A1 of DEAE-Sepharose CL-6B (Pharmacia) equilibrated in wash buffer was added to the remainder and incubated at 4°C for 30 min. The supernatant fraction was removed and TCA precipitated. The DEAE-Sepharose beads were washed twice with 800y1 wash buffer. The DEAE-Sepharose bound material was eluted by incubation at 4°C with 200/1 of wash buffer adjusted to 2M KCl. Eluted protein was TCA precipitated and samples were analysed on a 10% SDS-PAG. Failure of P48 to bind to mutant RNAs was confirmed by repetition of the assay.

RESULTS Location of mutations within the 4.5S gene The structure proposed for E.coli 4.5S RNA (2) is shown in Figure IA. The predicted structure of the terminal region and

the nucleotides shown in bold are invariant in all known SRPlike RNAs. For comparison, the corresponding domain of human SRP7S RNA is also shown (Figure 1B). The position of mutations introduced into the 4.5S RNA are indicated in Figure IA. These include: a deletion of 12 nucleotides, 49 to 60 (the endpoints are indicated by arrows in Figure 1), which removes the tetranucleotide loop and terminal stem; point mutations within the terminal tetranucleotide loop; point mutations of the invariant and highly conserved nucleotides within the single-stranded regions bulged prior to the terminal loop; two point mutations within the previous bulge; a mutation, C52G, which disrupts predicted base pairing with G57 and a double mutation, C52G, G57C which restores the base pairing ability. A change from C to U at position 23, which lies within a region conserved among eubacterial 4.5S RNA homologues (3), was found as a PCR artifact and this mutant allele was also analysed. To test the ability of mutant RNAs to bind to P48 in vitro, mutations were introduced into the mature 4.5S RNA coding sequence under control of the T7 promoter in the vector pT7/T3ac19. To test the ability of mutant RNAs to provide 4.5S RNA function in vivo, mutations were cloned into the pre4.5S RNA gene under the control of a trp promoter (see Materials and Methods).

Some mutant RNAs are unable to bind P48 in vitro The ability of P48 to bind to each of the mutant 4.5S RNAs was examined by an in vitro assay (5). RNA was transcribed in vitro from the wild-type and each of the mutant alleles in pT7/T3c 19, using T7 polymerase. As a control the complementary strand of the wild-type allele was transcribed using T3 polymerase. The RNA was incubated with [35S]methionine labelled, in vitro translated P48. 10% of the incubation mixture was withdrawn to monitor total protein synthesis (T). Complex formation was detected by incubation with DEAE-sepharose: unbound protein (U) was removed in the supernatant fraction, while protein bound to the RNA and hence to the DEAE-Sepharose (B) was eluted in 2M KCI. Samples were TCA precipitated and protein detected by SDS-PAGE and fluorography. The results are shown in Figure 2 and summarised in Table 1.

5922 Nucleic Acids Research, 1992, Vol. 20, No. 22 Table 1. Viability of Ecoli FF283T containing mutant 4.5S alleles.

370C

300C

370C

+ tryptophan 300C

250C

P48 Binding in vitro

++++

++++

++++

++++

++++

+

++++ n.t. ++++ ++++ + ++++ ++++ ++ ++++ ++++ ++++ ++++ ++++ ++++ ++

++++ n.t. ++++

++++

++++

++++

+

n.t. ++++

n.t. ++++

n.t.

+

+++

-

4.5S allele none wild-type A(49-60) C23U

U37A A39C C40G

A47C G48U

G49C C52G C52G, G57C G53A G53C G54A A56U

A60U G61U C62G

A63C

-

tryptophan

+++++ +++++

+

++ +++ ++++ ++++ ++++ ++++ ++++

++++ +++ +++ ++++

++++ ++++ ++++ ++++

+ ++ ++++ ++++ ++++

-

-

+

+ + +

++++

++++ ++++

+++ +++ +++ + ++

++

+

-

++++

++

+

+

++++ +

+++

++++ ++++

+ + +

++++

+ + + + Colony size > 80% of wild-type. + + + Colony size 30% to 80% of wild-type. + + Colony size 10% to 30% of wild-type. + Colony size < 10% of wild-type. - No visible colonies. n.t. Not tested.

'P"'"

Figure 2. In vitro binding of the P48 protein to the mutant 4.5S RNAs. Complex formation was examined by DEAE chromatography. Samples containing no RNA (-RNA), and the 4.5S reverse transcript (Rev), were used as negative controls. An aliquot (10%) of the total incubation mixture (T), material not bound to the DEAE (U), and the material bound to the DEAE (B), were analysed by SDSPAGE and fluorography.

Deletion of the 12 terminal nucleotides of the stem-loop abolishes the ability of the RNA to form a complex with P48, suggesting that nucleotides within this region are important for binding. The introduction of single point mutations within the

conserved tetranucleotide loop does not, however, affect binding. On the other hand, point mutations within the opposing bulged residues at positions 47, 48, 49, 61 and 62 completely abolish binding. A mutation from A to C at position 39, which lies within the adjacent single-stranded bulged region also abolishes the ability to bind P48 in vitro. This suggests that these nucleotides, four of which are invariant and the remainder of which are conserved in 26 of 27 characterised SRP-like RNAs (14), may make sequence-specific contacts with P48. A plasmid expressed 4.5S RNA is functional in vivo 4.5S RNA is synthesised in the cell as a larger precursor which is cleaved by RNase P to yield the mature 4.5S RNA (21). In order to examine the function of the mutant alleles in vivo, the DNA which encodes the 4.5S RNA including its native 24 nucleotide 5' extension (referred to below as pre4.5S), was cloned into an expression vector between a trp promoter and phage fD terminator sequences (see Materials and Methods). This plasmid was called pPre4.5Swt. The expression and function of this 4.5S RNA gene was examined after transformation of E.coli FF283T. In this strain the chromosomal copy of the 4.5S RNA gene is under the control of the tac promoter. In the absence of an inducer (lactose or IPTG), this strain fails to grow. The presence of the plasmid encoded 4.5S RNA gene restores growth. To examine expression levels of the plasmid encoded 4.5S RNA, cells were grown in the absence of lactose for the time required for the chromosomafly expressed RNA to fall to a level below which it is insufficient to support growth. This requires 4.5hrs at 37°C, 5.5hrs at 30°C and 7.75hrs at 25°C. RNA was prepared and analysed by electrophoresis and northern blotting (Figure 3). RNA in lane 6 (Figure 3) was prepared from a control strain which contains the plasmid pLK9159. This shows the residual level of

Nucleic Acids Research, 1992, Vol. 20, No. 22 5923 12

3

4

5

6

7

*

-

mature

4.5S RNA

Figure 3. Expression of the wild-type 4.5S RNA from pPre4.5wt in E.coli FF283T. Cells were grown in M9-glucose media (in the absence or presence of tryptophan), for 4.5hrs (37°C), 5.5hrs (30°C), or 7.75hrs (25°C). RNA was prepared and separated on a 8% acrylamide, 8.3M Urea gel. The RNA was transferred to Hybond-N membrane and hybridised with a[3 P]-labelled reverse transcript of the 4.5S RNA coding region. Lanes: 1. 37°C, + tryptophan; 2. 37°C, tryptophan; 3. 30°C, + tryptophan; 4. 30°C,-tryptophan; 5. 25°C, + tryptophan; 6. Control plasmid without the 4.5S RNA sequence, 25°C, + tryptophan. 7. wild-type control, E.coli JM109. -

chromosomally expressed 4.5S RNA in cells at this time point. Figure 3, lanes 1-5 show RNA prepared from cells containing pPre4.5wt. As can be seen, greater than 90% of the plasmid encoded 4.5S RNA is processed to the size of the mature form. This indicates that sequences required for recognition and processing by RNaseP are contained within the pre4.5S RNA coding sequence. Constitutive expression from the trp promoter results in levels of 4.5S RNA two to three fold higher than that found in a wild-type E. coli strain, JM109 (Figure 3, compare lane 2 with lane 7). When tryptophan is added to the growth medium, transcription from the trp promoter is repressed (compare lane 1 with lane 2) resulting in approximately 50% of the level of 4.5S RNA found in the wild-type strain (compare lane 1 with 7). This amount of RNA is sufficient to support growth under the conditions tested. In the presence or absence of tryptophan, RNA levels did not vary significantly when cells were grown at 37°C (lanes 1 and 2), 30°C (lanes 3 and 4) or 25°C (lane 5). Function of the 4.5S mutant alleles in vivo To analyse the effects of the mutations within the 4.5S gene, each mutated allele was used to replace the wild-type sequence in pPre4.5Swt. The resulting plasmids were used to transform E.coli FF283T. Northern blot analysis showed that in each case the mutant allele was expressed. Levels of the mutant RNA varied from approximately 25% to 100% of that of the plasmid borne wild-type allele (data not shown). In all cases except two, (G49C and the deletion mutant), expression levels were similar to those that allowed wild-type growth in the case of other alleles. Transformants were tested for their ability to grow on solid media in the absence of lactose. Cells were first grown in M9-lactose medium for 5 hours, under which conditions the chromosomal copy of the 4.5S RNA gene is expressed. Cultures were diluted 10-5 in M9-glucose medium, plated on M9-glucose medium in the absence and presence of tryptophan and scored for their ability to form colonies at 370C, 300C and

250C (Table 1). Relative growth supported by the mutant alleles was found to be reproducible in independent experiments. Two of the alleles fail to support growth under any of the conditions tested. These are the 12 nucleotide deletion and the point mutant C62G. Five mutant alleles show no apparent phenotype. The remaining alleles give rise to varying defects in growth. Generally, the defect is more pronounced when cells are grown in the presence of tryptophan and a more severe defect is observed with decreasing growth temperature. Three alleles with mutations within the tetranucleotide loop (G53C, G53A and A56U), confer growth defects only under the most restrictive growth conditions while a further change within this region (G54A), has no apparent effect on growth under any of the conditions tested. The mutation C52G, which disrupts the predicted base pair which closes the loop, results in a reduced growth rate of the cells at 30°C and 25°C. When base pairing is restored in the double mutant C52G, G57C, the colony size is indistinguishable from that of cells expressing the wild-type allele. Both of these alleles are expressed at comparable levels. Mutations which result in the strongest phenotype are located within the bulged nucleotides immediately preceding the loop. The transversion C62G results in lethality. A47C allows formation of visible colonies only under the least restrictive conditions i.e. at 37°C in the absence of tryptophan. G48U and G61U result in either no or reduced growth respectively at 25°C, but allow normal growth at 370C. The G49C allele also has a strong effect on growth at 25°C. This allele is however expressed at low levels (approximately 25 % of the wild-type), which may contribute to the phenotype. Notably these five mutant RNAs fail to bind P48 in vitro. Two further mutations within this region A60U and A63C, have no or little effect on growth and correspondingly the RNAs retain the ability to bind P48 in vitro, although in the case of A60U the efficiency of binding may be reduced. The two alleles tested which have mutations within the neighbouring bulged region, A39C and C40G, have little or no effect on colony size. This is surprising in the former case, as this mutant RNA fails to bind P48 in vitro. The C23U mutation, which lies within a region conserved across eubacterial 7S-like RNAs, likewise has no detectable effect on growth.

Association of mutant RNAs with P48 in vivo Mutant RNAs which fail to bind P48 in vitro show a gradation of phenotypic effects, ranging from the C62G allele, which fails to support growth under any conditions, to the A39C allele which, even under the most restrictive conditions, confers only a slight growth defect. An explanation may be that the in vitro binding assay does not accurately reflect binding under physiological conditions. To address this question, the amount of wild-type or mutant 4.5S RNA associated with P48 in vivo was examined. Lysates were prepared from strains expressing the wild-type 4.5S RNA, the deletion mutant (A49-60), the A39C mutant RNA, which gives rise to only a slight growth defect, and the A47C mutant RNA which results in a severe growth defect. Antibodies, which were raised against a peptide found in the SRP54 protein but which cross-react with P48 (8), were used to immunoprecipitate P48 from the lysates. In control experiments the interaction between the antiserum and P48 was specifically blocked by addition of the peptide against which the antiserum was raised. The amount of 4.5S RNA co-precipitated with P48 in each case was examined by northern blot hybridisation. The

5924 Nucleic Acids Research, 1992, Vol. 20, No. 22

*

Figure 4. Association of wild-type and mutant 4.5S RNAs with P48 in vivo. Lysates were prepared from strains after 4.5hrs growth at 37°C in the absence of lactose. P48 was immunoprecipitated using antiserum 730 (8), and levels of co-precipitating 4.5S RNAs were analysed by gel electrophoresis and autoradiography. Lanes 1-4 contain aliquots of total RNA from the lysates; 1. wild type; 2. A(49-60); 3. A47C; 4. A39C; lanes 5-12, the immunoprecipitated RNA: 5 and 6. wild-type; 7 and 8. A(49-60); 9 and 10. A47C; and 12. A39C. For the samples in lanes 5, 7, 9 and competitor peptide (Iitg) was added prior to incubation of the lysate with antibody.

results are shown in Figure 4. The RNA with the 12 nucleotide deletion is poorly precipitated (Figure 4, lane 8). Both alleles with point mutations also show reduced co-precipitation of the 4.5S RNA (Figure 4, lanes 10 and 12) when compared to the wild-type control (Figure 4, lane 6). No clear difference can be detected between these two mutant strains in the level of 4.5S RNA which is associated with P48. Thus at least in the case of the alleles tested, the in vitro binding assay would appear to reflect the in vivo situation.

DISCUSSION A stem-loop structure resembling the terminal loop region of E. coli 4.5S RNA is present in eukaryotes as a domain of SRP7S RNA. In addition to conservation of the secondary structure, a number of nucleotides are highly conserved. These lie within the terminal tetranucleotide loop and adjacent single stranded bulged regions. No other regions have been found to be universally conserved in primary sequence in 7S-like RNAs. Mammalian SRP54 is homologous to E. coli P48, and is able to bind to 4.5S RNA, suggesting that these conserved nucleotides within the terminal loop region may be important for binding. The results presented here show that this region is indeed at least part of the P48 binding site. Moreover, four of the six invariant nucleotides are required for P48 binding in vitro. This suggests that a requirement for P48/SRP54 binding is the selective pressure maintaining the identity of these nucleotides across all kingdoms. The only known exception is the RNA component of the Saccharomyces cerevisiae SRP, scRl (22), which shows little resemblance to other SRP RNAs (23). The sequence of the terminal tetranucleotide loop conforms to the consensus GNRA, a sequence which is overrepresented in 16S rRNA tetranucleotide loops (24) and which confers unusual thermodynamic stability to the hairpin structure (25). This suggests that the sequence of the loop may be important for the structure of the molecule rather than for specific interactions with P48. Consistent with this is the observation that mutations within the 4.5S RNA loop do not block P48 binding. Mutations within the loop do, however, have some effect on growth as does the mutation affecting the loop-closing base-pair, C52-G57. A

compensatory change in this base-pair restores wild-type growth, again consistent with the idea that the structure of this region, rather than its primary sequence, is important. Nucleotides which are required for P48 binding in vitro, and hence postulated to make sequence specific contacts with P48, lie within two singlestranded regions bulged from the stem. The effects on growth of some mutations in the homologous domain of SRP7S RNA from Schizosaccharomyces pombe have also been analysed (26, 27). A number of these have similar effects to mutations in equivalent sites within the 4.5S RNA. For example, a change at position 54 (4.5S RNA numbering) has no phenotype in either case. Similarly, a change from A to U at position 56 produces, in both cases, a mild conditional growth defect. A mutation in S.pombe SRP7S RNA at the site corresponding to A63 has no phenotype, and the equivalent mutation in the 4.5S RNA also has little effect. Other mutations, however, produce quite different effects. A double mutation in SRP7S RNA at the sites corresponding to A56 and C62 produced only mild conditional impairment of growth, whereas the C62 mutation alone is lethal in 4.5S RNA. Conversely, the G to C transversion at position 53 of the 4.5S RNA results in only a mild conditional growth defect, whereas the equivalent mutation in the SRP7S RNA is lethal. Thus it is evident that not all mutations in this region of S.pombe SRP7S RNA and 4.5S RNA have identical effects. The situation for the eukaryotic RNA is complicated because this region also contains a binding site for the SRP19 protein (28) and SRP54 binding to the mammalian SRP7S RNA is enhanced by SRP19 (5, 29). Thus protein-protein interaction may stabilise SRP54 binding to the S.pombe SRP RNA. The growth defects conferred by mutant alleles were observed to be more pronounced in the presence of tryptophan and a more severe defect was observed with decreasing growth temperature. The former effect is likely to be due to the decreased levels of expression of the 4.5S RNA in the presence of tryptophan (see Figure 3) i.e. the deleterious effect of a mutant allele is revealed only at low expression levels. The latter effect may depend on the higher basal level of heat-shock proteins present in cells grown at increased temperature (30). Induction of the heat shock response is observed in cells depleted of 4.5S RNA (31); this may be due to an accumulation of mis-folded polypeptides (32), resulting from lack of targeting function in the absence of 4.5S RNA. The increased basal levels of the heat shock proteins at 37°C compared to 25°C may suppress the phenotypic effects of a defective 4.5S RNA by the chaperone function of some of the heat shock proteins. Heat shock proteins have recently been found to substitute for SecB function during protein export in Ecoli (33, 34). P48 has been shown to interact with the signal sequence of nascent polypeptide chains in vitro (13). The efficiency of this interaction is greatly reduced in the absence of 4.5S RNA, suggesting that the interaction of 4.5S RNA and P48 is required for the signal recognition function of P48. Of the alleles which fail to bind P48 in vitro, only the deletion mutant (A49 -60) and the C62G allele fail to support growth under any conditions. The others show varying growth defects with one of these, the A39C allele, giving rise to only slight growth retardation even under the most restrictive conditions. This would suggest that these mutant RNAs are associated to some extent with P48 in vivo. Levels of RNA co-precipitated with P48 were, however, found to be comparable for the A39C and A47C alleles; the former results in only a slight growth defect whereas the latter gives rise

Nucleic Acids Research, 1992, Vol. 20, No. 22 5925 to a severe growth defect. In both cases co-precipitation of 4.5S RNA with P48 was similarly reduced in comparison to the wildtype control. It is possible that the immunoprecipitation was not sensitive enough to detect subtle differences in binding efficiency which may differentiate between functional and non-functional RNAs, or that the conditions used for immunoprecipitation disrupted the already weakened association between the RNA and protein. We cannot, however, exclude the possibility that in addition to a P48-associated function in signal-sequence recognition, 4.5S RNA plays an additional role which is essential, but which does not depend on binding to P48.

ACKNOWLEDGEMENTS We thank Bernhard Dobberstein and Angelika Giner for plasmid pET-8c-48 and for anti-SRP54/P48 serum and Maurille Fournier for the strain FF283. We also thank Bernhard Dobberstein, lain Mattaj, Yves Henry and John Morrissey for critical review of the manuscript. Heather Wood was the recipient of an EMBO fellowship.

REFERENCES 1. Siegel, V. and Walter, P. (1988) Trends Biochem. Sci. 13, 314-315. 2. Brown, S., Thon, G. and Tolentino, E. (1989) J. Bacteriol. 171, 6517-6520. 3. Struck, J. C. R., Lempicki, R. A., Toschka, H. Y., Erdmann, V. A. and Fournier, M. J. (1990) J. Bacteriol. 172, 1284-1288. 4. Brown, S. and Fournier, M. J. (1984) J. Mol. Biol. 178, 533-550. 5. R6misch, K., Webb, J., Herz, J., Prehn, S., Frank, R., Vingron, M. and Dobberstein, B. (1989) Nature 340, 478-482. 6. Bernstein, H. D., Poritz, M. A., Strub, K., Hoben, P. J., Brenner, S. and Walter, P. (1989) Nature 340, 482-486. 7. Poritz, M. A., Bernstein, H. D., Strub, K., Zopf, D., Wilhelm, H. and Walter, P. (1990) Science 250, 1111-1117. 8. Ribes, V., Romisch, K., Giner, A., Dobberstein, B. and Tollervey, D. (1990) Cell, 63, 591-600. 9. Kreig, U. C., Walter, P. and Johnson, A. E. (1986) Proc. Natl. Acad. Sci. USA. 83, 8604-8608. 10. Wiedmann, M., Kurzchalia, T. V., Bielka, H. and Rapoport, T. A. (1987) J. Cell Biol., 104, 201-208. 11. Nakamura, K., Imai, Y., Nakamura, A. and Yamane, K. (1992) J. Bacteriol. 174, 2185-2192. 12. Zopf, D., Berstein, H. D., Johnson, A. E. and Walter, P. (1990) EMBO J. 9, 4511-4517. 13. Luirink, J., High, S., Wood, H., Giner, A., Tollervey, D. and Dobberstein, B. Nature, in press. 14. Larson, N. and Zwieb, C. (1991) Nuc. Acids Res. 19, 209-215. 15. Zwieb, C. (1991) Nuc. Acids Res. 19, 2955-2960. 16. Strub, K., Moss, J. and Walter, P. (1991) Mol. Cell. Biol. 11, 3949-3959. 17. Poritz, M. A., Strub, K. and Walter, P. (1988) Cell 55, 4-6. 18. Russell, D. R. and Bennett, G. N. (1982) Gene 20, 231-243. 19. Stanley, K. K. and Luzio, J. P. (1984) EMBO J. 3, 1429-1434. 20. Miller, J. H. (1972) Experiments in Molecular Genetics (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory). 21. Bothwell, A. L. M., Garber, R. L. and Altman, S. (1976) J. Biol. Chem. 251, 7709-7716. 22. Hann, B. C. and Walter, P. (1991) Cell 67, 131-144. 23. Felici, F., Cesareni, G. and Hughes, J. M. X. (1989) Mol. Cell. Biol. 9, 3260-3268. 24. Woese, C. R., Winker, S. and Gutell, R. R. (1990) Proc. Natl. Acad. Sci. USA. 87, 8467-8471. 25. Heus, H. A. and Pardi, A. (1991) Science 253, 191-194. 26. Laio, X., Brennwald, P. and Wise, J. A. (1989) Proc. Natl. Acad. Sci. USA 86, 4137-4141. 27. Laio, X., Selinger, D., Althoff, S., Chaing, A., Hamilton, D., Ma, M. and Wise, J. A. (1992) Nuc. Acids Res. 20, 1607-1615. 28. Zwieb, C. (1992) J. Biol. Chem. 267, 15650-15656. 29. Walter, P., and Blobel, G. (1983) Cell 34, 525-533.

30. Yamamori, T. and Yura, T. (1982) Proc. Natl. Acad. Sci. USA. 79, 860-864. 31. Bourgaize, D. B., Phillips, T. A., Van Bogelen, R. A., Jones, P. G. Neidhardt, F. C. and Fournier, M. J. (1990) J. Bacteriol. 172, 1151-1154. 32. Goff, S. A. and Goldberg, A. L. (1985) Cell 41, 587-595. 33. Altman, E., Kumamoto, C. A. and Emr, S. D. (1991) EMBO J. 10, 239-245. 34. Wild, J., Altman, E., Yura, T. and Gross, C. A. (1992) Genes Dev. 6, 1165-1172.