Exogenous Jasmonic Acid and Cytokinin ... - Springer Link

J Plant Growth Regul (2016) 35:366–376 DOI 10.1007/s00344-015-9539-0

Exogenous Jasmonic Acid and Cytokinin Antagonistically Regulate Rice Flag Leaf Senescence by Mediating Chlorophyll Degradation, Membrane Deterioration, and SenescenceAssociated Genes Expression Li Liu1 • Haixia Li1 • Hanlai Zeng1 • Qingsheng Cai2 • Xie Zhou2 • Changxi Yin1

Received: 26 January 2015 / Accepted: 20 July 2015 / Published online: 11 September 2015 Ó Springer Science+Business Media New York 2015

Abstract Although it is well known that jasmonic acid (JA) and cytokinin (CK) are involved in regulating leaf senescence, the antagonistic mechanisms of JA and CK on leaf senescence are still unknown. To explore the antagonistic effects of JA and CK on leaf senescence, we treated detached rice flag leaves with JA and CK under dark conditions, and evaluated their chlorophyll contents, membrane deterioration, and expression levels of chlorophyll-degradation-related genes (CDRGs) and senescenceassociated genes (SAGs). Our results demonstrated that exogenous application of JA promoted chlorophyll degradation by enhancing the expression levels of CDRGs, promoted membrane deterioration by accelerating the increases in lipid peroxidation and membrane permeability, enhanced the expression levels of SAGs, and consequently accelerated rice flag leaf senescence. On the other hand, exogenous application of CK retarded chlorophyll degradation by down-regulating the expression levels of CDRGs, retarded membrane deterioration by retarding the increases in lipid peroxidation and membrane permeability, downregulated the expression levels of SAGs, and consequently delayed rice flag leaf senescence. Furthermore, the senescence-accelerating effect of a certain concentration of JA was nullified by the senescence-retarding effect of a certain concentration of CK. These results suggested that exogenous applications of JA and CK were able to antagonistically regulate flag leaf senescence by mediating & Changxi Yin [email protected] 1

College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070, China

2

College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China

123

chlorophyll degradation, membrane deterioration, and SAGs expression. In addition, our results suggested that the progression of flag leaf senescence might not only depend on the level of JA or CK but also depend on the balance between JA and CK. Keywords Rice flag leaf senescence Jasmonic acid Cytokinin Chlorophyll degradation Membrane deterioration Senescence-associated genes

Introduction Leaf senescence is the final stage of leaf development and is critical for plant fitness (Lim and others 2007). Leaf senescence can be seen as an evolutionarily selected developmental process and is an important phase in the plant life cycle (Nam 1997). However, in agricultural aspects, premature senescence results in deterioration of the quality of vegetables, poor grain quality, and reduces crop yield, while delaying leaf senescence can maintain the supply of assimilated carbon to grain during the grainfilling period, thereby ensuring the maximum mass per grain (Jiang and others 2007; Gregersen and others 2013). In cereal crops, studies on senescence have focused on the flag leaf, which has been proved to be the main source of assimilates for grain filling (Wardlaw 1990). Rice is the world’s most important cereal crop and a primary source of food for more than half the world’s population (Khush 2005). It has been shown that premature senescence of flag leaves is negatively correlated with grain yield in rice (Zhang and others 2007). Plant hormones play crucial roles in mediating leaf senescence (Jibran and others 2013). Jasmonic acid (JA) has been linked with the senescence program for many years.

J Plant Growth Regul (2016) 35:366–376

Ueda and others first reported that exogenously supplied methyl jasmonate accelerated senescence of leaves (Ueda and others 1981). More recently, methyl jasmonate application was shown to increase transcript abundance of genetic markers of developmental senescence such as SEN4, ERD1, and the senescence-associated gene 21(SAG21) (Miao and others 2004; Jung and others 2007). Increasing evidence suggests that transcript abundance of genes involved in JA synthesis (LOX3, AOC1, AOC4, and OPR3) and signaling (MYC2, JAZ1, JAZ6, and JAZ8) increases during developmental leaf senescence (van der Graaff and others 2006; Breeze and others 2011), and that the JA level increases in leaves as they senesce developmentally (He and others 2002; Seltmann and others 2010; Breeze and others 2011). In addition, in coronatine-insensitive 1 (coi1), which is defective in all jasmonate responses (Yan and others 2009), 12 % of the developmental senescence-associated genes (SAGs) are no longer up-regulated (Buchanan-Wollaston and others 2005).Therefore, JA is an important senescence-promoting factor. In contrast, cytokinin (CK) has been proposed as one of the key signals inhibiting senescence (Gan and Amasino 1995, 1996). During senescence, transcript abundance of genes involved in CK biosynthesis declines, such as isopentenyl transferase gene (IPT), whereas transcript abundance of genes involved in CK degradation increases, such as cytokinin-inactivating N-and O-glucosyltranferases and CK oxidase genes (Buchanan-Wollaston and others 2005), thus the CK level decreases in senescing leaves. Although increasing CK production can delay leaf senescence (Gan and Amasino 1995), reducing the endogenous CK level results in accelerated senescence (Masferrer and others 2002). A drop in the CK level before the onset of senescence was believed to be a key signal for the initiation of senescence (Noodeń and others 1990; Gan and Amasino 1995). Moreover, plants with a gain of function mutation in one of the CK receptors, AHK3, exhibited delayed leaf senescence, whereas plants with the gene knocked out showed a reduced CK-dependent delay in senescence (Kim and others 2006). The most prominent visible change in leaf senescence is associated with the loss of green color due to chlorophyll degradation (Schelbert and others 2009). Membrane deterioration is another characteristic feature of senescence engendering increased membrane permeability (Brown and others 1991), and lipid peroxidation was considered to be an important mechanism of membrane deterioration during leaf senescence (Dhindsa and others 1981). In addition, leaf senescence is accompanied by increased expression of SAGs that play important roles in regulating leaf senescence (Lim and others 2007). These results suggest that changes in leaf color, chlorophyll content, lipid peroxidation, membrane permeability, and the expression levels of

367

SAGs can be used to reflect the progression of leaf senescence. Substantial evidence suggested that JA and CK have opposite roles in regulating leaf senescence. However, the antagonistic mechanisms of JA and CK on leaf senescence are still unknown. To address this issue, the antagonistic effects of JA and CK on the changes in leaf color, chlorophyll content, lipid peroxidation, membrane permeability, and the expression levels of SAGs during rice flag leaf senescence were studied in the present work.

Materials and Methods Plant Material and Growth Conditions Rice Zhenshan 97B (Oryza sativa L.) was used in this study, and rice plants were grown according to the method of Yin and others (2007). Seeds of Zhenshan 97B were immersed in distilled water for 2 days, grown for 1 month in a greenhouse, and then transplanted to a paddy field. During the first day of the heading stage, flag leaf segments (the middle part; each about 6 cm in length) were harvested from the fully expanded flag leaves and used in this study.

Chemicals and Treatments JA and 6-benzylaminopurine (6-BA) were purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd. JA and 6-BA were dissolved in 0.5 ml of 100 % ethanol and 0.5 ml of HCl at 1 M, respectively, and diluted with distilled water to a stock concentration of 1 mM. The stock solutions were stored at 4 °C. When used, appropriate amounts of stock solution were added to distilled water to obtain the different concentrations required. Flag leaf segments were collected and washed three times with deionized water, and then incubated in Petri dishes containing 25 ml of different incubation solutions including JA, 6-BA, JA ? 6-BA, or distilled water (control) at 26 °C under dark conditions. The final concentration of ethanol was 0.03 ml l-1, and the pH was adjusted to 6.0 for each solution. Tween-80 at 0.1 ml l-1 was used as a surfactant in all cases.

Determination of Chlorophyll Content Samples (0.5 g) from the flag leaf segments were collected and ground in 10 ml 80 % cold acetone. The absorbance of the extract was estimated at 645 nm and 663 nm, and chlorophyll content was determined according to the method described by Mackinney (1941).

123

368

Determination of Membrane Permeability Membrane permeability was determined by assaying the electrolyte leakage according to the method of Lutts and others (1996). Electrical conductivity of the incubation solution (Lt) was determined immediately after the treatment and then once every 3 days during the treatment period. Subsequently, samples were autoclaved at 120 °C for 20 min, and a last conductivity reading (L0) was obtained upon equilibration at 25 °C. The electrolyte leakage was defined as Lt/L0 and expressed as percentage. Determination of Lipid Peroxidation Malondialdehyde (MDA, a product of lipid peroxidation) content has been often utilized as a suitable marker for membrane lipid peroxidation (Dhindsa and others 1981; Liu and others 2012; Jakhar and Mukherjee 2014). Thus, in the present work, lipid peroxidation in the flag leaf tissue was measured in terms of MDA content determined by the thiobarbituric acid reaction according to the method of Heath and Packer (1968). RNA Isolation, RT-PCR, and Quantitative RT-PCR (qRT-PCR) Analyses Total RNA was extracted from flag leaf segments that had been incubated with treatment solution for 6 days using an RNAprep Pure Plant Kit (Tiangen Biotech, China) following the instructions in the user manual. First-strand cDNA was synthesized from 2 lg of total RNA using a FastQuant RT Kit (Tiangen Biotech, China). CDRGs such as STAY-GREEN RICE (OsSGR) (AK105810), PHEOPHORBIDE A OXYGENASE (OsPAO) (Os03g0146400), RED CHLOROPHYLL CATABOLITE REDUCTASE 1 (OsRCCR1) (Os10g0389200), and NONYELLOW COLORING 1 (OsNYC1) (AB255025) play important roles in regulating chlorophyll degradation (Park and others 2007; Ho¨rtensteiner 2009; Sato and others 2009; Tang and others 2011). The SGR gene encodes a chloroplast protein and is required for the initiation of chlorophyll breakdown in plants (Park and others 2007; Ho¨rtensteiner 2009). OsPAO and OsRCCR1 catalyze key steps in chlorophyll degradation by opening the porphyrin macrocycle of pheophorbide a and forming the primary nonphotoreactive fluorescent chlorophyll catabolite (Tang and others 2011). The OsNYC1 gene encodes a membrane-localized short-chain dehydrogenase/reductase that is thought to represent a chlorophyll b reductase necessary for catalyzing the first step of chlorophyll b degradation (Sato and others 2009). Thus, OsSGR, OsPAO, OsRCCR1, and OsNYC1 were selected as marker genes for the investigation of chlorophyll degradation in this study.

123


Leaf senescence has been recognized as the last phase of plant development, a highly ordered process regulated by SAGs (Buchanan-Wollaston and others 2005). In this study, eight SAGs including Osl139 (AF251071), Osl2 (AF251073), Osl20 (AF251067), Osh36 (AF251070), Osl381 (AF251077), Osl43 (AF285163), Osl57 (AF251076), and Osh70 (AF251069) that have been described previously (Lee and others 2001) were selected as representative marker genes for the investigation of JA and 6-BA on SAGs expression. The expression levels of CDRGs and SAGs were analyzed by RT-PCR using the primers listed in Table 1. The rice OsActin (NM_001057621) gene fragment was used as an internal control in the RT-PCR analysis. The fragments of Osl139, Osl2, Osl20, Osh36, Osl381, Osl43, Osl57, and OsActin were amplified at 94 °C for 3 min, followed by 30 cycles at 94 °C for 45 s, 56 °C for 45 s, 72 °C for 45 s, and finished by an extension at 72 °C for 10 min. The fragments of OsPAO, OsRCCR1, OsNYC1, and Osh70 were amplified at 94 °C for 3 min, followed by 31 cycles at 94 °C for 45 s, 56 °C for 45 s, 72 °C for 45 s, and finished by an extension at 72 °C for 10 min. The OsSGR fragment was amplified at 94 °C for 3 min, followed by 38 cycles at 94 °C for 45 s, 56 °C for 45 s, 72 °C for 45 s, and finished by an extension at 72 °C for 10 min. The expression levels of OsSGR, OsRCCR1, Osl20, Osh36, and Osl43 were also determined through qRT-PCR analysis on an iQ5 Real-Time PCR Detection System (BioRad, USA). Primers used for qRT-PCR are listed in Table 2. Transcription levels were calculated using the comparative threshold (CT) method, with OsActin as the internal control.

Results Rice Flag Leaf Senescence was Antagonistically Regulated by Exogenous Applications of JA and 6BA JA treatment accelerated flag leaf senescence, and the speed of flag leaf senescence was positively correlated with the concentrations of JA (Fig. 1a). After 8 days of incubation, the chlorophyll contents of JA treatments at 0.01, 0.1, 1, and 10 lM were 92.3, 59.1, 43.5, and 4.9 % of that of controls, respectively (Fig. 1e). However, after 18 days of incubation, the vast majority of chlorophylls were degraded, and there was no significant difference in chlorophyll content among different treatments (Fig. 1e). In contrast, 6-BA treatment delayed flag leaf senescence, and the speed of flag leaf senescence was negatively correlated with the concentrations of 6-BA (Fig. 1b). After 18 days of 6-BA treatment, the chlorophyll contents of

J Plant Growth Regul (2016) 35:366–376 Table 1 Primers used in RTPCR analysis

Table 2 Primers used in qRTPCR analysis

369

Gene

Forward primer 50 ? 30

Reverse primer 50 ? 30

OsSGR

CTTCCTCCCATCACCCAGC

CGAACGCCTTCAGAACCAC

OsPAO

TGGTGCATGGGGATATTCAG

GCCAAAACAAAACGGTCAGC

OsRCCR1

TCTCATCTTTCTGAACGCCTC

CTCTCGCCTTCTTCCATCTC

OsNYC1

TTGGATAAATAACGCTGGCA

AGAAGAACCGCTCAAAAGGA

Osl139

AGACGATGAGCCAGAAGACGAG

GGACGAGAAGGCATAGAGAAGC

Osl2

ATCTGCCTATGTGCCCATTG

TTCAGCTCAGCCACCCTCTC

Osl20

TGAAGATGGACAAGAAAGATGC

GAACTGTTCACTAGTTGGGGTG

Osh36

GATGATTGCCCGGCTTTACAC

CCACTATTCCACCCACTCCCT

Osl381

GTGAGGATTGCTCGGATTTT

CTCTTTCGCACGGGTGATGT

Osl43

TTGCCTTCAACTACATCGGT

CATTTGGGACTCCAGCCTCG

Osl57

TGTTGGAGTTCCCGAAAACG

GGGCAAAAGACAATCCTGTG

Osh70

CAAGGGAATAAATGGTGGCAAGAT

CAGACGTGTCAATGTGACAGATGG

OsActin

GCGATAATGGAACTGGTATGG

GTTGAGAGGAGCCTCGGTGAG

Gene

Forward primer 50 ? 30

OsSGR

GTGGTTCTGAAGGCGTTCGTC

TTGAAGCGTGGGAGGTTGG

OsRCCR1

ATTGATTTCATGCTCCAGTCCTC

GATCGAAGTTGGGCTACCTTGT

Osl20

TTCTTCTGCCGCAACAATG

GCTTGACCACGGATAACAGC

Osh36

GAGGTGCTTTCGGTTCTGATG

CCACTCCCTGTATGGCTTCC

Osl43

ATGACGCTGGTGAAGATTGG

CTAACAGCTTCTTGGGTGGC

OsActin

CTGACGGAGCGTGGTTACTCAT

TCATAGTCCAGGGCGATGTAGG

6-BA treatments at 0.001, 0.01, 0.1, and 1 lM were 1.1, 13.3, 20.5, and 30.3 times that of controls, respectively (Fig. 1f). Figure 1a, e demonstrates that the highest concentration of JA (10 lM) dramatically accelerated flag leaf senescence. However, the accelerating effect of 10 lM JA on flag leaf senescence was weakened by 6-BA, and the degree of weakening depended on the concentration of 6-BA (Fig. 1c, g). Consequently, the higher concentration of 6-BA was accompanied by a higher degree of weakening, and 1 lM 6-BA completely nullified the accelerating effect of 10 lM JA on flag leaf senescence. On the other hand, 6-BA at 1 lM significantly retarded flag leaf senescence (Fig. 1b, f), but the retarding effect of 1 lM 6-BA on flag leaf senescence was weakened by JA, and the degree of weakening depended on the concentration of JA (Fig. 1d, h). Thus, the higher concentration of JA was accompanied by the higher degree of weakening, and 10 lM JA completely nullified the retarding effect of 1 lM 6-BA on flag leaf senescence. These results suggested that flag leaf senescence might not only depend on the level of JA or CK but also depend on the balance between JA and CK; the higher ratio between JA and CK resulted in the stronger promotion of flag leaf senescence, whereas the lower ratio between JA and CK resulted in the stronger retardation of flag leaf senescence (Fig. 1c, d).

Reverse primer 50 ? 30

Antagonistic Effects of JA and 6-BA on the Changes in Leaf Color and Chlorophyll Content As shown in Fig. 2a, JA treatment quickly promoted the change in leaf color, which resulted from the chlorophyll degradation (Fig. 2b). After 9 days of JA treatment, 98.7 % of the chlorophyll was degraded and the leaf color changed from green to yellow. In contrast, 6-BA treatment retarded the changes both in leaf color and chlorophyll content. In 6-BA-treated samples, only 4.4 % of the chlorophyll was degraded, and the color was still green 9 days after treatment, and the change process in leaf color and chlorophyll content lasted for 27 days (Fig. 2a, b). Further, the accelerating effect of 10 lM JA was completely nullified by the retarding effect of 1 lM CK on yellowing and chlorophyll degradation during flag leaf senescence (Fig. 2a, b). These results suggested that JA and 6-BA could antagonistically regulate flag leaf senescence through the mediation of chlorophyll degradation.

Antagonistic Effects of JA and 6-BA on the Change in Membrane Permeability The results in Fig. 2c indicated that JA might quickly induce an increase in membrane permeability, and as a

123

370


Fig. 1 The progression of flag leaf senescence was antagonistically regulated by exogenous applications of JA and 6-BA. Flag leaf segments were washed three times with deionized water and incubated in Petri dishes containing 25 ml of different incubation solutions at 26 °C under dark conditions. Change in leaf color (a–d).

Photos were taken 8 and 18 days after different treatments. Change in chlorophyll content (e–h). Chlorophyll content was determined 8 and 18 days after different treatments. The data show mean ± SE (n = 3). FW fresh weight

consequence of it, electrolyte leakage increased quickly. In contrast, 6-BA treatment might retard the increase in membrane permeability, thus the increase in electrolyte leakage was delayed (Fig. 2c). After 9 days of treatment, the electrolyte leakage of JA-treated leaves was three times

that of controls, whereas the electrolyte leakage of 6-BAtreated leaves was only one-fourth that of controls. Figure 2c also indicates that the accelerating effect of 10 lM JA was completely nullified by the retarding effect of 1 lM 6-BA on the change in membrane permeability during flag

123


371

Fig. 2 Antagonistic effects of JA and 6-BA on the changes in leaf color, chlorophyll content, electrolyte leakage, and MDA content. Flag leaf segments were washed three times with deionized water and incubated in Petri dishes containing 25 ml of different incubation solutions at 26 °C under dark conditions. Change in leaf color (a). Photos were taken immediately after the treatment and then once every 3 days during the treatment period. Change in chlorophyll

content (b). Change in electrolyte leakage (c). Change in MDA content (d). Chlorophyll content, electrolyte leakage, and MDA content were determined immediately after the treatment and then once every 3 days during the treatment period. The data show mean ± SE (n = 3). FW fresh weight, Control treatment of control, JA treatment of 10 lM JA, 6-BA treatment of 1 lM 6-BA, JA ? 6BA treatment of 10 lM JA ? 1 lM 6-BA

leaf senescence. Consequently, the change in electrolyte leakage of JA ? 6-BA-treated leaves was almost the same as that of control leaves (Fig. 2c). This result suggested

that JA and 6-BA could antagonistically regulate flag leaf senescence through the mediation of membrane permeability.

123

372


Antagonistic Effects of JA and 6-BA on the Change in Lipid Peroxidation As shown in Fig. 2d, the MDA content of JA-treated leaves increased quickly and sharply, and after 3 days of treatment, the MDA content reached 364.6 % that of the control leaves, but at the same time, the MDA content of 6-BAand JA ? 6-BA-treated leaves was 72.7 and 98.1 %, respectively, that of control leaves. The MDA content of control, JA-, 6-BA-, and JA ? 6-BA-treated leaves reached their maximum after 9, 3, 18, and 9 days of treatment, respectively. These results indicated that compared with controls, JA treatment accelerated and enhanced the increase in MDA content, whereas 6-BA treatment retarded and inhibited the increase in MDA content. Moreover, the accelerating effect of 10 lM JA could be completely nullified by the retarding effect of 1 lM 6-BA on the change in lipid peroxidation during flag leaf senescence. Consequently, the changes in MDA content of JA ? 6-BA-treated leaves were almost the same as that of control leaves (Fig. 2d). This result suggested that JA and 6-BA could antagonistically regulate flag leaf senescence through the mediation of lipid peroxidation. Antagonistic Effects of JA and 6-BA on the Expression of CDRGs and SAGs The RT-PCR result indicated that the transcription levels of OsPAO, OsNYC1, Osl139, Osl2, Osl381, Osl57, and Osh70 were not affected by the applications of exogenous JA, 6-BA, or JA ? 6-BA (Fig. 3). However, both the RT-PCR and the qRT-PCR results indicated that transcription levels of OsSGR, OsRCCR1, Osl20, Osh36, and Osl43 were enhanced and down-regulated by the applications of JA and 6-BA, respectively (Figs. 3, 4). These phenomena suggested that certain CDRGs or SAGs were differentially regulated by different senescence-regulating factors, and that OsSGR, OsRCCR1, Osl20, Osh36, and Osl43 were involved in the regulation of JA and 6-BA on flag leaf senescence. The SGR gene encodes a chloroplast protein and is required for the initiation of chlorophyll breakdown in plants (Park and others 2007; Ho¨rtensteiner 2009). RCCR1 catalyzes a key conversion from a red chlorophyll catabolite to a primary fluorescent chlorophyll catabolite during chlorophyll degradation. The transcription levels of OsSGR and OsRCCR1 are up-regulated during natural and dark-induced leaf senescence (Jiang and others 2007; Park and others 2007; Tang and others 2011; Rong and others 2013). This previous evidence suggests that OsSGR and OsRCCR1 play important roles in regulating chlorophyll degradation. The results in Figs. 3 and 4 demonstrated that the transcription level of OsSGR in control flag leaf

123

Fig. 3 RT-PCR analysis of the expression of CDRGs and SAGs in differently treated flag leaf segments. During the first day of the heading stage, flag leaf segments (the middle part; each about 6 cm in length) were harvested from the fully expanded flag leaves, and then these flag leaf segments were washed three times with deionized water and incubated in Petri dishes containing 25 ml of different incubation solutions at 26 °C under dark conditions. Total RNA was extracted from flag leaf segments that had been incubated with treatment solution for 6 days. Control treatment of control, JA treatment of 10 lM JA, 6-BA treatment of 1 lM 6-BA, JA ? 6-BA treatment of 10 lM JA ?1 lM 6-BA

segments was low, but 10 lM JA enhanced the transcription level of OsSGR, and 1 lM 6-BA inhibited OsSGR transcription significantly. Similarly, the transcription level of OsRCCR1 was up-regulated by 10 lM JA and downregulated by 1 lM 6-BA. Additionally, the regulatory effects of 10 lM JA on these two genes’ transcription levels were nullified by 1 lM 6-BA (Fig. 4). Osl20, Osh36, and Osl43 are SAGs that have been described previously (Lee and others 2001). Osl20 encoding branched-chain a-keto dehydrogenase for amino acid metabolism was found to be significantly enhanced during dark-induced senescence and natural senescence, whereas Osh36 and Osl43 encoding an aminotransferase and a stress-induced protein, respectively, were associated with dark-induced senescence but not with natural leaf senescence (Lee and others 2001). Results in Fig. 4 showed that


373

Discussion

Fig. 4 qRT-PCR analysis of the expression of CDRGs and SAGs in differently treated flag leaf segments. During the first day of the heading stage, flag leaf segments (the middle part; each about 6 cm in length) were harvested from the fully expanded flag leaves, and then these flag leaf segments were washed three times with deionized water and incubated in Petri dishes containing 25 ml of different incubation solutions at 26 °C under dark conditions. Total RNA was extracted from flag leaf segments that had been incubated with treatment solution for 6 days. Control treatment of control, JA treatment of 10 lM JA, 6-BA treatment of 1 lM 6-BA, JA ? 6-BA treatment of 10 lM JA ? 1 lM 6-BA. The expression levels of each gene in JA-, 6-BA-, and JA ? 6-BA-treated flag leaf segments were determined relative to levels in control flag leaf segments. The relative quantification method (Delta–Delta CT) was used to evaluate quantitative variation, and the amplification of OsActin was used as an internal control. Statistical analyses were performed by ANOVA using SPSS version 16.0 (SPSS, Chicago, USA), and comparisons between the mean values were performed using Duncan’s multiple range test. The data presented are the mean values ± SE of three individual experiments. Different letters above the bars indicate the significant differences at P \ 0.05 of the same gene between different treatments

10 lM JA enhanced the transcription level of Osl43, whereas 1 lM 6-BA inhibited Osl43 transcription significantly. Similarly, 10 lM JA up-regulated, while 1 lM 6-BA inhibited the transcription of Osl20 and Osh36. Moreover, the regulatory effects of 10 lM JA on these three genes’ transcription levels were nullified by 1 lM 6-BA (Fig. 4). Taken together, the transcription levels of CDRGs, such as OsSGR and OsRCCR1, and SAGs, such as Osl20, Osh36, and Osl43, were correlated with rice flag leaf senescence. Exogenous JA and CK were able to antagonistically regulate flag leaf senescence by mediating chlorophyll degradation through the mediation of CDRGs expression, and by mediating SAGs expression.

Leaf yellowing is one of the most prominent characteristics of plant senescence, which is caused by unmasking of preexisting carotenoids by chlorophyll breakdown (Matile 2000). Changes in leaf color and chlorophyll content are integrally associated with leaf senescence and, as the most obvious signs of senescence, are widely used for senescence quantification. Previous evidence suggested that the senescence process of detached leaf segments can reflect the progression of leaf senescence in intact plants, and the detached leaf segments are often used as a model system for the investigation of rice leaf senescence (Liang and others 2014; Yamada and others 2014). Thus, detached leaf segments were used to elucidate the antagonistic effects of JA and CK on leaf senescence, and the changes in leaf color and chlorophyll content were investigated in the present work. Our results revealed that JA treatment accelerated, while 6-BA treatment retarded the changes in leaf color and chlorophyll content (Figs. 1a, b, e, f, 2a, b). CDRGs such as OsSGR and OsRCCR1 play important roles in regulating chlorophyll degradation. The transcription levels of OsSGR and OsRCCR1 are up-regulated during natural and dark-induced leaf senescence (Jiang and others 2007; Park and others 2007; Tang and others 2011; Rong and others 2013). The rice mutant sgr maintains greenness during leaf senescence, whereas transgenic rice overexpressing SGR produce yellowish-brown leaves. Park and others suggested that SGR regulates chlorophyll degradation by inducing light harvesting chlorophyll a/bprotein complex II (LHCPII) disassembly through direct interaction, leading to the degradation of chlorophylls and chlorophyll-free LHCPII by catabolic enzymes and proteases, respectively (Park and others 2007). RCCR1 catalyzes a key conversion from a red chlorophyll catabolite to a primary fluorescent chlorophyll catabolite during chlorophyll degradation. The transcription level of OsRCCR1 is much lower in young leaves, but is about 20-fold higher in senescent leaves. Moreover, the transcription level of OsRCCR1 is significantly up-regulated by dark or wound treatment (Tang and others 2011). The evidence suggests that OsSGR and OsRCCR1 play important roles in regulating chlorophyll degradation, and that the changes in the transcription levels of OsSGR and OsRCCR1 can reflect the regulation of JA and CK on chlorophyll degradation and leaf senescence. Our result demonstrated that in flag leaf segments, the transcription levels of OsSGR and OsRCCR1 were up-regulated by JA treatment and down-regulated by 6-BA treatment, and that the up-regulations of 10 lM JA on these two genes’ transcription levels were nullified by 1 lM 6-BA (Fig. 3). Our result is consistent with previous evidence that the

123

374

transcription levels of OsSGR and OsRCCR1 were upregulated by JA treatment and down-regulated by CK treatment in 7-d-old light-grown rice seedlings (Garg and others 2012). Membrane deterioration is a characteristic feature of senescence engendering increased membrane permeability (Brown and others 1991). Additionally, lipid peroxidation has been thought to be an important mechanism of membrane deterioration (Dhindsa and others 1981; Jakhar and Mukherjee 2014). Thus, the increases in membrane permeability and lipid peroxidation can reflect the progression of leaf senescence. Previous study demonstrated that the increases in membrane permeability (electrolyte leakage) and lipid peroxidation start at the same leaf age as the decline in chlorophyll content (Dhindsa and others 1981), and that there is a close relationship between the increased electrolyte leakage and the increased level of lipid peroxidation. MDA content has been utilized as a suitable marker for membrane lipid peroxidation (Jakhar and Mukherjee 2014). Developing leaves exhibit lower amounts of MDA, which increase significantly with the progress of senescence in leaves (Jakhar and Mukherjee 2014). Rising values of lipid peroxidation have been mentioned by many workers in their studies in relation to senescence (Dhindsa and others 1981; Liu and others 2012; Jakhar and Mukherjee 2014). To elucidate the antagonistic effects of JA and 6-BA on membrane deterioration, membrane permeability and lipid peroxidation were investigated by assaying the electrolyte leakage and MDA content, respectively. Results in Fig. 2a–c demonstrated that the changes in electrolyte leakage were negatively correlated with the changes in leaf color and chlorophyll content. Similarly, during the early senescence period, the changes in MDA content were negatively correlated with the changes in leaf color and chlorophyll content (Fig. 2a, b, d). However, with the progression of leaf senescence, MDA content decreased quickly, possibly as a result of membrane deterioration leading to MDA leakage from inside the membrane to outside the membrane. Moreover, Fig. 2c, d demonstrates that during leaf senescence, JA treatment accelerated, while 6-BA treatment retarded the increases in the electrolyte leakage and MDA content, and the accelerating effects of 10 lM JA on the electrolyte leakage and MDA content were completely nullified by 1 lM 6-BA. Leaf senescence is accompanied by increased SAGs which play important roles in regulating leaf senescence (Lim and others 2007). SAGs such as Osl20, Osh36, and Osl43 have been described previously (Lee and others 2001). The transcription level of Osl20 that encodes a branched-chain a-keto dehydrogenase for amino acid metabolism was found to be significantly enhanced during dark-induced senescence and natural senescence. Based on

123


this evidence, Lee and others proposed that Osl20 was associated with dark-induced leaf senescence and natural leaf senescence (Lee and others 2001). Osh36 and Osl43 encoding an aminotransferase and a stress-induced protein, respectively, were associated with dark-induced leaf senescence but not with natural leaf senescence (Lee and others 2001). These phenomena indicated that certain SAGs are differentially regulated when leaf senescence is induced by different senescence-inducing factors. Results in the present work demonstrated that after 6 days of different treatments in flag leaf segments, JA treatment up-regulated while 6-BA treatment significantly down-regulated the transcription levels of Osl20, Osh36, and Osl43. However, the up-regulation of 10 lM JA was nullified by the downregulation of 1 lM 6-BA on the transcription levels of these SAGs. Microarray analysis revealed that after 3 h of treatments in 7-day-old light-grown rice seedlings, transcription levels of 50 genes were antagonistically regulated by JA and CK treatments. However, the changes of transcription levels of Osl20, Osh36, and Osl43 were not detected (Garg and others 2012). The differences between our result and previous results might result from different treatment stages/or different treatment durations. Several genes involved in the regulation of leaf senescence can also be antagonistically regulated by JA and CK. Expression of SAGs is regulated by senescence-associated transcriptional factors such as MYB factors and AP2 domain proteins (Buchanan-Wollaston and others 2005). Expression of SAGs leads to massive degradation of proteins and macromolecules, such as chlorophylls and lipids (Lim and others 2007). In rice, exogenous applications of JA and CK can antagonistically regulate the expression levels of MYB (LOC_Os11g45740) and AP2 (LOC_Os04g44670) (Garg and others 2012). Our result demonstrated that exogenous applications of JA and CK can antagonistically regulate the expression levels of CDRGs including OsSGR and OsRCCR1. Proteases and protease inhibitors are involved in regulating protein degradation antagonistically (Solomon and others 1999), and phospholipase D (PLD) plays an important role in lipid degradation (Fan and others 1997). Microarray analysis revealed that exogenous applications of JA and CK can antagonistically regulate the expression levels of protease genes (LOC_Os09g38920), protease inhibitor genes (LOC_Os10g40480 and LOC_Os03g57980), and PLD genes (LOC_Os06g40180 and LOC_Os06g40170) (Garg and others 2012). In addition, the results in Fig. 1c demonstrated that the accelerating effect of JA on flag leaf senescence was weakened by 6-BA, the higher concentration of 6-BA was accompanied by the higher degree of weakening, and a certain concentration of 6-BA was able to nullify the accelerating effect of JA on flag leaf senescence. On the


other hand, the retarding effect of 6-BA on flag leaf senescence was weakened by JA, the higher concentration of JA was accompanied by the higher degree of weakening, and a certain concentration of JA was able to nullify the retarding effect of 6-BA on flag leaf senescence (Fig. 1d). These results suggest that the progression of rice flag leaf senescence might not only depend on the level of JA or CK but also depend on the balance between JA and CK. The higher ratio between JA and CK resulted in the stronger promotion of flag leaf senescence, whereas the lower ratio between JA and CK resulted in the stronger retardation of flag leaf senescence. This suggestion is consistent with previous results that JA levels are increased, while CK levels are decreased in senescing leaves of Arabidopsis (He and others 2002; Gan and Amasino 1995). Premature senescence may reduce crop yield when it is induced under adverse environmental conditions (Gregersen and others 2013), whereas delaying leaf senescence may increase yield by maintaining the supply of assimilated carbon to grain during the grain-filling period. Our result indicated that exogenous 6-BA can delay flag leaf senescence significantly, so it is possible to improve rice yield by delaying flag leaf senescence through the application of exogenous 6-BA. This possibility is supported by evidence that when kinetin (a natural CK) was applied to rice flag leaves, flag leaf senescence was delayed and grain yield per plant was increased through the increase of sink activity, duration of sink capacity as well as photosynthetic ability of the glumes (Biswas and Mondal 1986). In conclusion, the results indicated that exogenous application of JA accelerated flag leaf senescence, while exogenous application of CK retarded flag leaf senescence, and that the senescence-accelerating effect of JA was nullified by the senescence-retarding effect of CK at a certain concentration. The results also indicated that JA and CK were able to antagonistically regulate the progression of flag leaf senescence by mediating chlorophyll degradation through the mediation of CDRGs expression, by mediating membrane deterioration through the mediation of lipid peroxidation and membrane permeability, and by mediating SAGs expression. In addition, the results suggested that the progression of flag leaf senescence might not only depend on the level of JA or CK but also depend on the balance between JA and CK. Acknowledgments We thank Dr. Su-sheng Gan (Cornell University) for constructive discussions and suggestions during preparation of this manuscript, Dr. Jin-gui Chen (Oak Ridge National Laboratory) and Dr. Kai Xia (Nanjing Agricultural University) for critical reading of the manuscript. This work was supported by the Fundamental Research Funds for the Central Universities (Project No. 2014PY058 and 2011PY014) and the Scientific Research Foundation for Returned Scholars, Ministry of Education of China.

375

References Biswas AK, Mondal SK (1986) Regulation by kinetin and abcisic acid of correlative senescence in relation to grain maturation, sourcesink relationship and yield of rice (Oryza sativa L.). Plant Growth Regul 4:239–245 Breeze E, Harrison E, McHattie S, Hughes L, Hickman R, Hill C, Kiddle S, Kim YS, Penfold CA, Jenkins D, Zhang C, Morris K, Jenner C, Jackson S, Thomas B, Tabrett A, Legaie R, Moore JD, Wild DL, Ott S, Rand D, Beynon J, Denby K, Mead A, Buchanan-Wollaston V (2011) High-resolution temporal profiling of transcripts during Arabidopsis leaf senescence reveals a distinct chronology of processes and regulation. Plant Cell 23:873–894 Brown JH, Paliyath G, Thompson JE (1991) Physiological mechanisms of plant senescence. In: Steward FC (ed) Plant physiology, A treatise. Academic press, San Diego, pp 227–275 Buchanan-Wollaston V, Page T, Harrison E, Breeze E, Lim PO, Nam HG, Lin JF, Wu SH, Swidzinski J, Ishizaki K, Leaver CJ (2005) Comparative transcriptome analysis reveals significant differences in gene expression and signalling pathways between developmental and dark/starvation-induced senescence in Arabidopsis. Plant J 42:567–585 Dhindsa RS, Plumb-dhindsa P, Thorpe TA (1981) Leaf senescence: correlated with increased levels of membrane permeability and lipid peroxidation, and decreased levels of superoxide dismutase and catalase. J Exp Bot 32:93–101 Fan L, Zheng S, Wang X (1997) Antisense suppression of phospholipase Da retards abscisic acid- and ethylene-promoted senescence of postharvest Arabidopsis leaves. Plant Cell 9:2183–2196 Gan S, Amasino RM (1995) Inhibition of leaf senescence by autoregulated production of cytokinin. Science 270:1986–1988 Gan S, Amasino RM (1996) Cytokinins in plant senescence: from spray and pray to clone and play. BioEssays 18:557–565 Garg R, Tyagi AK, Jain M (2012) Microarray analysis reveals overlapping and specific transcriptional responses to different plant hormones in rice. Plant Signal Behav 7(8):951–956 Gregersen PL, Culetic A, Boschian L, Krupinska K (2013) Plant senescence and crop productivity. Plant Mol Biol 82:603–622 He Y, Fukushige H, Hildebrand DF, Gan S (2002) Evidence supporting a role of jasmonic acid in Arabidopsis leaf senescence. Plant Physiol 128:876–884 Heath RL, Packer L (1968) Photoperoxidation in isolated chloroplasts: i. Kinetics and stoichiometry of fatty acid peroxidation. Arch Biochem Biophys 125:189–198 Ho¨rtensteiner S (2009) Stay-green regulates chlorophyll and chlorophyll-binding protein degradation during senescence. Trends Plant Sci 14:155–162 Jakhar S, Mukherjee D (2014) Chloroplast pigments, proteins, lipid peroxidation and activities of antioxidative enzymes during maturation and senescence of leaves and reproductive organs of Cajanus cajan L. Physiol Mol Biol Plants 20:171–180 Jiang HW, Li MR, Liang NT, Yan HB, Wei YB, Xu XL, Liu J, Xu ZF, Chen F, Wu GJ (2007) Molecular cloning and function analysis of the stay green gene in rice. Plant J 52:197–209 Jibran R, Hunter DA, Dijkwel PP (2013) Hormonal regulation of leaf senescence through integration of developmental and stress signals. Plant Mol Biol 82:547–561 Jung C, Lyou SH, Yeu S, Kim MA, Rhee S, Kim M, Lee JS, Choi YD, Cheong JJ (2007) Microarray-based screening of jasmonateresponsive genes in Arabidopsis thaliana. Plant Cell Rep 26:1053–1063 Khush GS (2005) What it will take to feed 5.0 billion rice consumers in 2030. Plant Mol Biol 59:1–6

123

376 Kim HJ, Ryu H, Hong SH, Woo HR, Lim PO, Lee IC, Sheen J, Nam HG, Hwang I (2006) Cytokinin-mediated control of leaf longevity by AHK3 through phosphorylation of ARR2 in Arabidopsis. Proc Natl Acad Sci USA 103:814–819 Lee RH, Wang CH, Huang LT, Chen SCG (2001) Leaf senescence in rice plants: cloning and characterization of senescence upregulated genes. J Exp Bot 52:1117–1121 Liang C, Wang Y, Zhu Y, Tang J, Hu B, Liu L, Ou S, Wu H, Sun X, Chu J, Chu C (2014) OsNAP connects abscisic acid and leaf senescence by fine-tuning abscisic acid biosynthesis and directly targeting senescence-associated genes in rice. Proc Natl Acad Sci USA 111(27):10013–10018 Lim PO, Kim HJ, Nam HG (2007) Leaf senescence. Annu Rev Plant Biol 58:115–136 Liu P, Sun F, Gao R, Dong H (2012) RAP2.6L overexpression delays waterlogging induced premature senescence by increasing stomatal closure more than antioxidant enzyme activity. Plant Mol Biol 79:609–622 Lutts S, Kinet JM, Bouharmont J (1996) NaCl-induced senescence in leaves of rice (Oryza sativa L.) cultivars differing in salinity resistance. Ann Bot 78:389–398 Mackinney G (1941) Absorption of light by chlorophyll solutions. J Biol Chem 140:315–322 Masferrer A, Arro´ M, Manzano D, Schaller H, Fernańdez-Busquets X, Moncaleań P, Fernańdez B, Cunillera N, Boronat A, Ferrer A (2002) Overexpression of Arabidopsis thaliana farnesyl diphosphate synthase (FPS1S) in transgenic Arabidopsis induces a cell death/senescence-like response and reduced cytokinin levels. Plant J 30:123–132 Matile P (2000) Biochemistry of Indian summer: physiology of autumnal leaf coloration. Exp Gerontol 35:145–158 Miao Y, Laun T, Zimmermann P, Zentgraf U (2004) Targets of the WRKY53 transcription factor and its role during leaf senescence in Arabidopsis. Plant Mol Biol 55:853–867 Nam HG (1997) The molecular genetic analysis of leaf senescence. Curr Opin Biotechnol 8:200–207 Noodeń LD, Singh S, Letham DS (1990) Correlation of xylem sap cytokinin levels with monocarpic senescence in soybean. Plant Physiol 93:33–39 Park SY, Yu JW, Park JS, Li JJ, Yoo SC, Lee NY, Lee SK, Jeong SW, Seo HS, Koh HJ, Jeon JS, Park YI, Paek NC (2007) The senescence-induced staygreen protein regulates chlorophyll degradation. Plant Cell 19:1649–1664 Rong H, Tang Y, Zhang H, Wu P, Chen Y, Li M, Wu G, Jiang H (2013) The Stay-Green Rice like (SGRL) gene regulates chlorophyll degradation in rice. J Plant Physiol 170:1367–1373 Sato Y, Morita R, Katsuma S, Nishimura M, Tanaka A, Kusaba M (2009) Two short-chain dehydrogenase/reductases, NON-

123

J Plant Growth Regul (2016) 35:366–376 YELLOW COLORING 1 and NYC1-LIKE, are required for chlorophyll b and light-harvesting complex II degradation during senescence in rice. Plant J 57:120–131 Schelbert S, Aubry S, Burla B, Agne B, Kessler F, Krupinska K, Ho¨rtensteiner S (2009) Pheophytin pheophorbide hydrolase (pheophytinase) is involved in chlorophyll breakdown during leaf senescence in Arabidopsis. Plant Cell 21:767–785 Seltmann MA, Stingl NE, Lautenschlaeger JK, Krischke M, Mueller MJ, Berger S (2010) Differential impact of lipoxygenase 2 and jasmonates on natural and stress-induced senescence in Arabidopsis. Plant Physiol 152:1940–1950 Solomon M, Belenghi B, Delledonne M, Menachem E, Levine A (1999) The involvement of cysteine proteases and protease inhibitor genes in the regulation of programmed cell death in plants. Plant Cell 11:431–443 Tang Y, Li M, Chen Y, Wu P, Wu G, Jiang H (2011) Knockdown of OsPAO and OsRCCR1 cause different plant death phenotypes in rice. J Plant Physiol 168:1952–1959 Ueda J, Kato J, Yamane H, Takahashi N (1981) Inhibitory effect of methyl jasmonate and its related compounds on kinetin-induced retardation of oat leaf senescence. Physiol Plant 52:305–309 van der Graaff E, Schwacke R, Schneider A, Desimone M, Flu¨gge UI, Kunze R (2006) Transcription analysis of Arabidopsis membrane transporters and hormone pathways during developmental and induced leaf senescence. Plant Physiol 141:776–792 Wardlaw IF (1990) The control of carbon partitioning in plants. New Phytol 116:341–381 Yamada Y, Furusawa S, Nagasaka S, Shimomura K, Yamaguchi S, Umehara M (2014) Strigolactone signaling regulates rice leaf senescence in response to a phosphate deficiency. Planta 240:399–408 Yan J, Zhang C, Gu M, Bai Z, Zhang W, Qi T, Cheng Z, Peng W, Luo H, Nan F, Wang Z, Xie D (2009) The Arabidopsis CORONATINE INSENSITIVE1 protein is a jasmonate receptor. Plant Cell 21:2220–2236 Yin C, Gan L, Ng D, Zhou X, Xia K (2007) Decreased paniclederived indole-3-acetic acid reduces gibberellin A1 level in the uppermost internode, causing panicle enclosure in male sterile rice Zhenshan 97A. J Exp Bot 58:2441–2449 Zhang CJ, Chu HJ, Chen GX, Shi DW, Zuo M, Wang J, Zhang CJ, Chu HJ, Chen GX, Shi DW, Zuo M, Wang J, Lu CG, Wang P, Chen L (2007) Photosynthetic and biochemical activities in flag leaves of a newly developed superhigh-yield hybrid rice (Oryza sativa) and its parents during the reproductive stage. J Plant Res 120:209–217