BIOLOGY OF REPRODUCTION 74, 375–382 (2006) Published online before print 26 October 2005. DOI 10.1095/biolreprod.105.043190
Exogenous Nitric Oxide Stimulates Cell Proliferation via Activation of a MitogenActivated Protein Kinase Pathway in Ovine Fetoplacental Artery Endothelial Cells1 Jing Zheng,2,3 YunXia Wen,3 Jason L. Austin,3 and Dong-bao Chen4 Department of Obstetrics and Gynecology, Perinatal Research Laboratories,3 University of Wisconsin, Madison, Wisconsin 53715 Department of Reproductive Medicine, Division of Maternal-Fetal Medicine,4 University of California, San Diego, California 92093 arginine analog, potentiates vasoconstriction of human stem villous fetoplacental arteries [3] and increases ovine umbilical vascular resistance, resulting in reduction in umbilical blood flow [4]. In addition, inhibition of NO-induced guanylate cyclase activation increases the perfusion pressure of human fetoplacental circulation [5]. Besides its vasodilatory effect, NO can function as a key mediator for angiogenesis [6] and as an antiapoptotic signal for endothelial cells [7]. The participation of NO in in vivo angiogenesis was first recognized by Pipili-Synetos et al. [8]. This phenomenon was later confirmed by a series of studies by Ziche and colleagues, who have demonstrated that sodium nitroprusside (SNP) stimulates endothelial cell DNA synthesis, proliferation, and migration in vitro and enhances in vivo angiogenic responses [9–11]. The active role of NO in regulating angiogenesis is supported by the observations that adenovirus-mediated delivery of NO synthase 3 (NOS3) into adductor muscles in a rat model of hind limb ischemia results in significant increases in regional capillary density and blood flow [12]. Moreover, it has been proposed that vascular endothelial growth factor (VEGF)-induced angiogenesis is mediated via the NO/cyclic guanosine monophosphate (cGMP) pathway [11, 13]. NO, as a downstream signal in VEGFinduced angiogenesis, is further confirmed by the observations made in a rabbit ischemia model [14], NOS3 double knockout mice [15], and NOS3 overexpressed rats [16]. On the other hand, NO also acts as a crucial signal in in vitro angiogenic response to fibroblast growth factor 2 (FGF2) by promoting endothelial cell differentiation into capillary-like tube formation while terminating the endothelial cell proliferation in both human umbilical vein and calf pulmonary artery endothelial cell lines [17]. Thus, it is reasonable to infer that NO may differentially mediate FGF2- and VEGF-induced angiogenesis at different steps (i.e., proliferation/migration vs. capillary-like tube formation). Both FGF2- and VEGF-promoted angiogenesis can be mediated via activation of multiple intracellular cell protein kinases including mitogen-activated protein kinase 3/1 (MAPK3/1) and v-akt murine thymoma viral oncogene homolog 1 (AKT1). MAPK3/1 are phosphorylated and activated predominantly by its upstream kinase, MAP2K1/2, in the cytoplasm. Once activated, MAPK3/1 translocate into the nucleus and subsequently stimulates transcription of early response genes. AKT1 is one of major downstream targets of phosphoinositide 3-kinase (PI3K). Available evidence has implicated that NO is a key mediator in activation of these signaling pathways. For example, in bovine postcapillary endothelial cells, NO lies upstream of MAPK3/1 in VEGFpromoted angiogenesis [11, 18]. Souttou et al. [19] also reported that VEGF- but not FGF2-induced proliferation of human umbilical vein endothelial cells is mediated via
ABSTRACT Sodium nitroprusside (SNP), a nitric oxide (NO) donor and a nitrovasodilator drug used for patients with hypertensive crisis, has been shown to promote angiogenesis. However, direct evidence showing the involvement of NO in the SNP-induced angiogenesis is not available. Accordingly, we assessed whether NO generated from SNP-stimulated ovine fetoplacental artery endothelial (OFPAE) cell proliferation via activation of mitogenactivated protein kinase 3/1 (MAPK3/1, also termed ERK1/2). We observed that SNP dose dependently stimulated (P , 0.05) cell proliferation with a maximal effect at 1 lM and that SNP rapidly (15 min) phosphorylated (P , 0.05) MAPK3/1 but not v-akt murine thymoma viral oncogene homolog 1 (AKT1). Treatment of cells with SNP caused a rapid increase in NO levels in media. These increased NO levels were inhibited (P , 0.05) by 2-phenyl4,4,5,5 tetramethylimidazoline-1-oxyl 3-oxide (PTIO), a NO scavenger. The SNP-induced cell proliferation and MAPK3/1 phosphorylation were attenuated (P , 0.05) by both PTIO and PD98059, a specific mitogen-activated protein kinase kinase 1 and 2 (MAP2K1/2, also termed MEK1/2) inhibitor. Using a semiquantitative RT-PCR analysis, we also showed that up to 12 h of treatment, SNP and NG-monomethyl-L-arginine (L-NMMA, a NOS inhibitor) did not alter mRNA expression of VEGF, FGF2, and their major receptors in OFPAE cells. The SNP’s stimulatory effects on OFPAE cell proliferation and MAPK3/1 activation were confirmed in a human placental artery endothelial (HPAE) cell line. These data indicate that exogenous NO generated from SNP is able to stimulate fetoplacental artery endothelial cell proliferation at least partly via activation of the MAP2K1/2/MAPK3/1 cascade. These data also suggest that SNP could potentially be used to modulate placental angiogenesis. cell proliferation, MAPK3/1, nitric oxide, placenta, placental endothelial cells, pregnancy, signal transduction, SNP
INTRODUCTION Nitric oxide plays an active role in regulating placental vascular tone and blood flow during pregnancy [1, 2]. This is supported by the observations that inhibition of nitric oxide (NO) synthase with NG-monomethyl-L-arginine (L-NMMA), an 1
Supported in part by National Institutes of Health grants HL64703 and HD38843S2 (J.Z.) and HL74947 and HL70562 (D.B.C.). 2 Correspondence: Jing Zheng, Department of Obstetrics and Gynecology, Perinatal Research Laboratories, University of Wisconsin, Atrium Basement Meriter Hospital, 202 S. Park St., Madison, WI 53715. FAX: 608 257 1304; e-mail:
[email protected] Received: 25 April 2005. First decision: 12 May 2005. Accepted: 24 October 2005. Ó 2006 by the Society for the Study of Reproduction, Inc. ISSN: 0006-3363. http://www.biolreprod.org
375
376
ZHENG ET AL.
activation of the PI3K/NOS3/NO pathway. The observations that exogenous NO donors promote angiogenesis via activation of the MAP2K1/2/MAPK3/1 [11, 13] and PI3K/AKT1 cascades [12] in bovine and human endothelial cells further support the concept that NO is critical for activation of multiple signaling cascades in the angiogenic process. We have demonstrated that in ovine fetoplacental artery endothelial (OFPAE) cells, FGF2 increases NOS3 expression via activation of the MAP2K1/2/MAPK3/1 signaling cascade [20]. More recently, we have observed that in OFPAE cells, activation of both MAPK3/1 and AKT1 mediates FGF2- and VEGFstimulated cell proliferation and migration (unpublished data). However, whether exogenous NO can directly regulate placental endothelial cell proliferation and, if so, by what signaling pathways is currently unknown. SNP is a nitrovasodilator drug (Nipride or Nitropress) commonly used for the emergency treatment of high blood pressure and severe heart failure to reduce heart workload and for generation of controlled hypotension in anaesthetized patients during surgery [21, 22]. Moreover, SNP has also been widely used to study NO regulation of in vitro and in vivo angiogenesis [9–11, 13, 23]. However, as far as we are aware, direct evidence showing the participation of NO in the SNPinduced angiogenesis is still lacking. Accordingly, in this study, we examined in OFPAE cells 1) if SNP generated NOstimulated cell proliferation, 2) if SNP activated MAPK3/1 and AKT1 pathways, 3) if SNP generated NO-mediated SNPinduced cell proliferation via activation of the MAP2K1/2/ MAPK3/1 cascade, and 4) if exogenous and endogenous NO regulate mRNA expression of FGF2, VEGF, and their major receptors. Additionally, the effects of SNP on cell proliferation and activation of MAPK3/1 and AKT1 were confirmed in an HPAE cell line. MATERIALS AND METHODS Endothelial Cell Culture A primary OFPAE cell line, established and validated in our laboratory [20, 24–27], was used in this study. All OFPAE cells used in this study were at passages 8–10. A primary HPAE cell line was also established from the secondary and tertiary branches of umbilical arteries of a normal term placenta using collagenase digestion [28]. These HPAE cells were validated by their expression of platelet/endothelial cell adhesion molecule (or termed as CD31), vascular endothelial cadherin, and NOS3 (three endothelial cell markers) as well as positive uptake of acetylated low-density lipoprotein (not shown) [27, 28]. All HPAE cells used in this study were at passages 5–7. Protocols for endothelial isolation and experimental procedures were approved by the Research Animal Care Committees of both the Medical School and the College of Agriculture and Life Sciences and by the Institutional Review Board, University of Wisconsin, Madison.
Cell Proliferation Assay Cell proliferation assay was conducted as described previously [20, 26]. OFPAE cells were plated in 96-well plates (4000 cells/well) in Dulbecco MEM (DMEM; containing 400 lM L-arginine) supplemented with 10% fetal bovine serum (FBS), 10% calf serum (CS), and 1% penicillin-streptomycin (P/S) All these reagents were purchased from Invitrogen (Carlsbad, CA). After overnight culture, media were changed to serum-free DMEM for 24 h. Cells were then treated with fresh-prepared SNP (Sigma, St. Louis, MO) solution at 0 (control), 0.001, 0.01, 0.1, 1, or 10 lM in serum-free DMEM (6 wells/concentration). After an additional 72 h of culture, the number of cells was determined [20, 26]. Wells containing known cell numbers (0, 5000, 10 000, 20 000, or 40 000 cells/ well; 6 wells/cell density) were treated in a similar fashion to establish standard curves. To verify the roles of NO and the MAP2K1/2/MAPK3/1 cascade in SNP-induced cell proliferation, additional OFPAE cells (2000 cells/well) were plated and cultured in DMEM containing 10% FBS, 10% CS, and 1% P/S for 48 h. After 24 h of serum starvation, cells were treated with SNP (1 lM) in the absence or presence of 2-phenyl-4,4,5,5 tetramethylimidazoline-1-oxyl 3-oxide (PTIO), a potent NO scavenger (1-h pretreatment; Sigma) or PD98059,
a specific MAP2K1/2 inhibitor (1-h pretreatment; CalBiochem, La Jolla, CA) for an additional 48 h. HPAE cells were cultured in MCDB131 media (Invitrogen) and treated similarly as OFPAE cells to confirm SNP effects on placental artery endothelial cell proliferation.
Western Blot Analysis for MAPK3/1 and AKT1 Western blot analysis was performed as described previously [20, 24–26]. After 16 h of serum deprivation, OFPAE and HPAE cells grown in 60-mm culture dishes were treated with SNP for 0, 5, 10, 15, 30, or 60 min. The cells were washed twice with cold PBS, then harvested and lysed by sonification in a lysis buffer (4 mM sodium pyrophosphate, 50 mM HEPES, pH 7.5, 100 mM NaCl, 10 mM EDTA, 10 mM sodium fluoride, 2 mM sodium orthovanadate [Na3VO4], 1 mM PMSF, 1% Triton X-100, 5 lg/ml leupeptin, 5 lg/ml aprotinin). The cell lysates were centrifuged at 12 000 3 g for 10 min at 48C, and protein concentrations of the supernatant were determined using a BCA protein assay (Sigma). Proteins (10 or 15 lg/sample) were separated on 12% SDS-PAGE gels, electroblotted onto the Immobilon-P membranes (Millipore, Bedford, MA), immunoblotted with the rabbit antibody against phosphorspecific or total MAPK3/1 (1:2000) or phosphor-specific or total AKT1 (Ser493) (1:1000) (all antibodies were purchased from Cell Signaling Technology, Beverly, MA), and detected with ECL detection systems (Amersham Biosciencs, Piscataway, NJ). To verify the role of NO in SNPactivated MAPK3/1, additional OFPAE cells were treated with SNP (1 lM) in the absence or presence of PTIO (50 lM, 1-h pretreatment) or PD98059 (20 lM, 1-h pretreatment).
Immunolocalization of Phosphorylated MAPK3/1 Immunolocalization of phosphorylated MAPK3/1 in OFPAE cells was performed as described [20, 26]. After 16 h of serum starvation, cells grown in the eight-well chamber slides were treated with 1 lM of SNP for 0, 5, 10, 15, 30, or 60 min. Cells were rinsed in ice-cold PBS, fixed, and stained with the rabbit phospho-specific MAPK3/1 antibody (1:250; Cell Signaling Technology). After immunostaining, cells were counterstained with hematoxylin.
Real-Time Detection of NO Generated from SNP The NO generated from SNP was determined by a sensitive real-time NO detection method using a fluorescence probe, 4-amino-5-methylamino- 2N,7Ndifluorescein (DAF-FM; Molecular Probes, Eugene, OR). In this assay, in the presence of NO, DAF-FM is converted into a fluorescent product that can be detected. Briefly, OFPAE cells were grown on 96-well, clear-bottom plates in DMEM containing 10% FBS, 10% CS, and 1% P/S. After reaching 70%–80% confluent, cells were washed once and incubated in fresh modified KrebsRinger phosphate buffer, pH 7.4. After 1 h of equilibration, DAF-FM (final concentration at 1 lM) and SNP (final concentrations at 1 and 10 lM) were added. Additional cells were treated with 1 lM SNP in the presence of PTIO at 50 lM. Fluorescent signals were detected every 10 min up to 2 h, using a Synergy microplate fluorescence reader (Bio-TEK Instrument, Winooski, VT) with excitation/emission wavelength 485/528 nm. All data reported were corrected by subtracting the relative fluorescent unit (RFU) obtained from the cells treated with DAF-FM only.
Semiquantitative RT-PCR Analysis To examine whether exogenous and endogenous NO modulates expression of VEGF, the four VEGF receptors (VEGFR1, VEGFR2, neuropilin 1 [NP1], and 2 [NP2]), FGF2, and FGF receptor 1 (FGFR1), semiquantitative RT/PCR analysis was performed as described [29]. OFPAE cells were grown in six-well plates in DMEM containing 10% FBS, 10% CS, and 1% P/S until 70%–80% confluence. After 16 h of serum starvation, cells were treated with SNP (1 lM), L-NMMA (5 mM; CalBiochem) or D-NMMA (an inactive enantiomer of LNMMA; 5 mM). After 0, 6, and 12 h of treatment, cells were collected for total RNA extraction. For L- and D-NMMA treatments, cells were cultured in a specially formulated DMEM containing only 25 lM L-arginine during serum starvation and experiments. In the preliminary study, we have observed that 5 mM L-NMMA but not D-NMMA did block VEGF-induced NO production and significantly inhibited FGF2- and VEGF-promoted OFPAE cell proliferation, whereas both L- and D-NMMA alone at this dose did not alter OFPAE cell morphology and viability even after 48 h of treatments (unpublished data). Additionally, we found that 25 lM L-arginine was a minimal concentration required for maintaining normal cell morphology and FGF2-stimulated cell proliferation in OFPAE cells. Total RNA was extracted using an RNeasy Kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. The RT-PCR assays were performed using a Multiplex PCR (MPCR) optimizer kit (Maxim Biotech,
377
NO STIMULATES ENDOTHELIAL PROLIFERATION
FIG. 1. Dose responses of OFPAE (A) and HPAE (B) cell proliferation to SNP. Cells (4000 and 5000 cells/well for OFPAE and HPAE cells, respectively) were plated in 96well plates. After 24 h of serum starvation, cells were treated with SNP or vehicle control for another 72 h. Data are expressed as means 6 SEM percentage of the control from three (for OFPAE cells) or four (for HPAE cells) independent experiments. Numbers of cells per well in control after 72 h of SNP treatments were 3194 6 785.1 and 4647 6 446.4 for OFPAE and HPAE cells, respectively. Means with different letters differ significantly (P , 0.05).
San Francisco, CA) following the manufacturer’s instructions as described [29]. Briefly, a total RNA sample (1 lg), oligo primer (20 pmol), dNTP mix (2 ll; 5 mM each), and reverse transcriptase (1 ll; Omniscript Reverse Transcriptase, Qiagen) were used to generate cDNA. Since each primer pairs had its unique PCR conditions, the PCR reaction for each primer pairs was first optimized in the preliminary studies. The primers with similar PCR conditions were divided into four sets. The basic reaction was carried out at 958C, 15 sec, and 588C, 4 min (annealing and extension), for 26 cycles after denaturing at 958C for 5 min with some modifications for each primer set. For the primer set I including VEGF, FGFR1, and b-actin, MPCR buffer 2 was used with annealing and extension at 608C for 1 min. For primer set II including FGF2, NP2, and bactin and primer set III including VEGFR2, NP1, and b-actin, MPCR buffers 8 and 4 were used, respectively. For primer set IV including VEGFR1 and bactin, MPCR buffer 4 was used and ran for 28 cycles. At the end of reaction, a sample (1.5 ll) of PCR products was separated on 2% agarose gels containing 0.5 mg/ml ethidium bromide. The signals of each cDNA band were quantified by densitometry. All data for each cDNA examined were within its linear range. Data reported were normalized to b-actin cDNA. These DNA fragments were also gel-purified and confirmed by DNA sequencing as described [30]. The primers were designed for VEGF, FGF2, VEGFR1, VEGFR2, NP1, NP2, FGFR1, and b-actin using Primer Express 2.0 (Applied Biosystems, Foster City, CA; Table 1). The primer pairs for VEGF were designed to detect all VEGF isoforms. The estimated sizes of RT-PCR products for VEGF, FGF2, VEGFR1, VEGFR2, NP1, NP2, FGFR1, and b-actin were 81, 292, 298, 553, 364, 389, 94, and 152 bp, respectively.
Statistical Procedures Data were analyzed using one-way ANOVA (SigmaStat; Jandel Co., San Rafael, CA). When an F-test was significant, data were compared with their respective control by the Dunnett multiple comparisons or Student t-test.
RESULTS Effect of SNP on Cell Proliferation SNP dose dependently stimulated (P , 0.05) OFPAE and HPAE cell proliferation (Fig. 1). For OFPAE cells, the
stimulatory effect of SNP was observed in all doses studied and was biphasic with an approximately 1-fold increase above control at 1 nM, reaching its maximum (;2.5-fold) at 0.1 and 1 lM and then decreasing (;1-fold) at 10 lM (Fig. 1). For HPAE cells, SNP significantly (P , 0.05) stimulated cell proliferation only at 100 lM and 1 mM (P , 0.05) (Fig. 1B), and this stimulatory effect was less potent (;36% and 22% above control) as compared with that on OFPAE cells (Fig. 1B). The SNP-stimulated OFPAE cell proliferation was attenuated (P , 0.05) by PTIO, a potent NO scavenger, in a dose-dependent manner with a maximal inhibitory effect at 25 and 50 lM (Fig. 2A). PD98059, a specific MAP2K1/2 inhibitor, also dose dependently inhibited (P , 0.05) the SNPstimulated OFPAE cell proliferation with a significant inhibitory effect observed at 20 and 40 lM (Fig. 2B). PTIO alone, up to 50 lM, and PD98059 alone, up to 40 lM, did not significantly alter cell numbers as compared with the control (Fig. 2, A and B). Phosphorylation of MAPK3/1 and AKT1 by SNP Phosphorylation of MAPK3/1 and AKT1 by SNP in OFPAE and HPAE cells was first determined by Western blot analysis (Fig. 3). For MAPK3/1, two bands were detected at 44 and 42 kDa, corresponding to the reported molecular masses of ERK1 and ERK2, respectively. For AKT1, a single band was observed at 60 kDa, corresponding to the reported molecular masses of AKT1. SNP rapidly induced phosphorylation of MAPK3/1 in OFPAE (15 min) and in HPAE ( 5min) cells (Fig. 3). For OFPAE cells, SNP at 1 lM significantly (P , 0.05) elevated MAPK3/1 phosphorylation levels after 15 min of treatment (;3-fold above control), and this elevated MAPK3/1 phosphorylation reached its maximal level (;5–7-
TABLE 1. Sequences of primers used for semiquantitative RT-PCR. Transcript VEGF VEGFR1 VEGFR2 NP1 NP2 FGF2 FGFR1 b-actin
Forward (5’-3’)
Reverse (5’-3’)
Size (bp)
TGCAGATTATGCGGATCAAACC CTATAGCACCAAGAGCGACGTG GGAGTTTTTGGCATCACGGAAGT CTACCAGAAGCCAGAGGAGT ACCTTTCACACGGACATGGC ACCCTCACATCAAACTACAACTT CTGCCTTATGTCCAGATCTTGAAG ATGAAGTGTGACGTGGACAT
TGCATTCACATTTGTTGTGCTGTAG GGCGTTGAGCGGAATGTAG GGAAACAGGTGAGGTAGGCAGAG GATGATGGTGATGAGGATGGGGT TGCCGGTACACCATCCAGTC TTAGCAGACATTGGAAGAAAAAG CGTCCTCAAAGGAGACATTTCTTAA GGAGGAGCAATGATCTTGAT
81 298 553 364 359 292 94 152
GenBank accession no. AB021221 AF233077 AF233076 AF395335 XM_027765 L36136 NM_000604 NM_001101
378
ZHENG ET AL.
FIG. 2. Effects of PTIO and PD98059 on SNP-stimulated OFPAE cell proliferation. Cells (2000 cells/well) were plated in 96well plates and cultured for 48 h in DMEM containing 20% serum. After 24 h of serum starvation, cells were treated with SNP (1 lM) in the absence or presence of PTIO (A) or PD98059 (1-h pretreatment; B) for another 48 h. Data are expressed as means 6 SEM percent of the controls from three independent experiments. Number of cells per well in control after 48 h of treatment was 10 086 6 1180.9. Means with different letters differ significantly (P , 0.05).
fold) after 30 min and declined slightly after 60 min (Fig. 3A). SNP at 1 lM did not alter phosphorylation of AKT1 up to 1 h of treatment in OFPAE cells (Fig. 3A). For HPAE cells, SNP at 100 lM elevated (P , 0.05) MAPK3/1 phosphorylation levels after 5 min of treatment (; 1.2-fold; Fig. 3B). This SNPinduced MAPK3/1 phosphorylation started to decline at 10 min and returned to the basal level after 15 min of treatment. In contrast to OFPAE cells, SNP time dependently phosphorylated (P , 0.05) AKT1 in HPAE cells (Fig. 3B). SNP-induced AKT1 phosphorylation in HPAE cells was first observed after 10 min of treatment (; 0.5-fold) and maintained up to 1 h of treatment (Fig. 3B). SNP did not change total MAPK3/1 and AKT1 protein levels in both OFPAE and HPAE cells, up to 1 h of treatments (Fig. 3). The SNP-induced MAPK3/1 phosphorylation in OFPAE cells was further confirmed by using immunocytochemistry (Fig. 4). Parallel to those changes observed in Western blot analysis (Fig. 3A), SNP induced an intracellular translocation of phosphorylated MAPK3/1, a critical step for the MAPK3/1 FIG. 3. Western blot analyses for phosphorylation of MAPK3/1 and AKT1 in response to SNP in OFPAE (A) and HPAE (B) cells. After 16 h of serum starvation, cells were treated with SNP (1 and 100 lM for OFPAE and HPAE cells, respectively) for 0, 5, 10, 15, 30, or 60 min. Proteins (10 or 15 lg/sample) were separated on SDS-PAGE gels. Phosphorylated and total MAPK3/1 and AKT1 were detected using a phosphorspecific or total MAPK3/1 or AKT1 (Ser473) antibody. Data are expressed as means 6 SEM-fold of the control from three independent experiments. pMAPK3/1, Phosphorylated MAPK3/1; MAPK3/1, total MAPK3/1; pAKT1, phosphorylated AKT1; AKT1, total AKT1. Asterisks and double daggers indicate significant (P , 0.05) differences from the corresponding time 0 control for pMAPK3/1 and pAKT1, respectively.
cascade in growth factor-induced cell growth and differentiation [31]. Positive phosphorylated MAPK3/1 staining was not observed in any cell compartment at time 0 treatment; it first appeared in cytoplasm of some cells after 5 min of treatment, accumulated in the nuclei of most cells after 10 min of treatment, and maintained in nuclei after 60 min. SNP-induced MAPK3/1 phosphorylation in OFPAE cells was greatly inhibited (P , 0.05) by PTIO and blocked (P , 0.05) by PD98059 (Fig. 5). Treatment of OFPAE cells with PTIO or PD98059 alone did not alter total MAPK3/1 protein levels (not shown). NO Generated from SNP NO generated from SNP on OFPAE cells was determined by a real-time NO detection method using DAF-FM (Fig. 6). SNP at both 1 and 10 lM started to release NO almost immediately after its addition into the wells, and this NO release exhibited a time-dependent manner, up to 2 h. SNP at
NO STIMULATES ENDOTHELIAL PROLIFERATION
FIG. 4. Immunolocalization of phosphorylated MAPK3/1 induced by SNP in OFPAE cells. After 16 h of serum starvation, cells cultured in the eight-well chamber slides were treated with SNP (1 lM) for 0, 5, 10, 15, 30, or 60 min. Cells were fixed and stained with a phospho-specific MAPK3/1 antibody. Note: Brown staining indicates positive phosphorylated MAPK3/1. Blue nuclear staining is hematoxylin counterstaining. No positive staining was observed in control wells in the absence of the primary antibody or in wells as stained with preimmune rabbit IgG (not shown). Original magnification is 320.
10 lM released much more NO than 1 lM SNP (Fig. 6). For example, NO generated from 10 lM SNP was approximately 6.2-fold above that at 1 lM SNP at time 0 (note: there was ; 1 min of delay before the reading was started after addition of SNP) (Fig. 6). For 1 lM SNP, the increase in NO levels reached significance at 10 min (;1.6-fold of its time 0 control; P , 0.05) and maintained rising, up to 2 h (;5.9-fold of control; Fig. 6). These increased NO levels from both 1 and 10 lM of SNP were greatly inhibited (P , 0.05) by PTIO (Fig. 6), while NO was undetectable in the wells incubated with PTIO alone, up to 2 h.
379
FIG. 5. Effects of PTIO and PD98059 on SNP-induced MAPK3/1 phosphorylation in OFPAE cells. After 16 h of serum starvation, cells cultured in the six-well plates were treated with SNP (1 lM) in the absence or presence of PTIO (50 lM, 1-h pretreatment) or PD98059 (20 lM, 1-h pretreatment) for 15 min. Proteins (15 lg/sample) were separated, and phosphorylated MAPK3/1 were detected using a phospho-specific MAPK3/1 antibody. Lane 1: control; lane 2: PTIO; lane 3: PD98059; lane 4: SNP; lane 5: SNP þ PTIO; lane 6: SNP þ PTIO. Data are expressed as means 6 SEM-fold of the controls from three independent experiments. Asterisks denote significant (P , 0.05) differences from the control within each isoform.
FGF2, and their major receptors studied, as compared with time 0 control. No difference was observed between L-NMMA and D-NMMA treatments (not shown). Since no time (0–12 h)dependent changes were observed in control (DMEM), SNP, LNMMA, and D-NMMA, the data were pooled within each treatment group across the time studied (Table 2).
Semiquantitative RT-PCR Analysis
DISCUSSION
As NO may regulate angiogensis by altering the expression of angiogenic factors and their receptors, we determined if exogenous (SNP) and endogenous NO affect mRNA expression of total VEGF, FGF2, the four VEGF receptors (VEGFR1, VEGFR2, NP1, and NP2), and one major FGF receptor (FGFR1) in OFPAE cells using the semiquantitative RT-PCR analysis. As illustrated in Figure 7, one band for each mRNA product studied was observed at the estimated size as shown in Table 1. The RT/PCR analysis demonstrated that treating cells with 1 lM SNP, 5 mM L-NMMA, and 5 mM D-NMMA for 6 or 12 h did not significantly alter the mRNA levels of VEGF,
Herein we have demonstrated that the NO donor, SNP, stimulates cell proliferation and activates the MAP2K1/2/ MAPK3/1 signaling cascade in OFPAE and HPAE cells. These SNP-induced cell responses (proliferation and MAPK3/1 activation) and NO generated from SNP in OFPAE cells are inhibited by PTIO, indicating that NO generated from SNP indeed accounts for these SNP-induced cellular responses. These data also demonstrate that like FGF2 and VEGF, exogenous NO can directly stimulate cell proliferation and activate MAPK3/1 in fetoplacenta-derived endothelial cells. Moreover, our findings that PD98059 inhibits these SNP-
380
ZHENG ET AL.
FIG. 6. Effects of PTIO on NO generated from SNP on OFPAE cells. Cells were grown on 96-well plates in DMEM containing 20% serum until 70%–80% confluence. Cells were equilibrated in modified Krebs-Ringer phosphate buffer for 1 h, followed by addition of DAF-FM. Cells then were treated with 1 or 10 lM SNP in the absence or presence of PTIO at 50 lM. Fluorescent signals were recorded every 10 min before and after addition of sample, up to 2 h using a fluorescence reader. Data are corrected by subtracting the basal fluorescence from the cells treated with DAF-FM alone at each corresponding time point, averaged from four independent experiments, and expressed as means 6 SEM of relative fluorescent units (RFU). Asterisks denote that means in SNP treatment differ (P , 0.05) from control (10 min before addition of sample) and from the corresponding SNP þ PTIO treatments at each time point.
induced OFPAE cell responses and that SNP induces MAPK3/ 1 activation in both OFPAE and HPAE cells suggest that the exogenous NO-induced fetoplacental endothelial cell proliferation is mediated at least partly via activation of MAP2K1/2/MAPK3/1. Finally, SNP-induced fetoplacental endothelial cell proliferation appears not to be mediated by altering the expression of angiogenic factors and their receptors since SNP and L-NMMA do not alter the mRNA levels of VEGF, FGF2, and their major receptors in OFPAE cells. Placental NO production increases during normal pregnancy. In ewes, two production peaks of placental NO production occur approximately on Days 60 and 130 of gestation [25, 32]. These increases in NO production are associated with elevations in expression of angiogenic factors, vascular density, blood flow to placentas, and placental growth and development [33]. Moreover, NO production in ovine placentas is correlated to protein expression of NOS3 but not NOS2A [25], and NO generation from NOS3 is a primary
FIG. 7. Effects of SNP and L-NMMA on mRNA expression of VEGF, FGF2, and their receptors in OFPAE cells. After 16 h of serum starvation, cells were treated with SNP (1 lM), L-NMMA (5 mM), or D-NMMA (5 mM) for 0, 6, or 12 h. The total RNA (1 lg/sample) was used for generating cDNA, and PCR products were run on 4% agarose gels. The estimated sizes of RT-PCR products for VEGF, FGF2, VEGFR1, VEGFR2, NP1, NP2, FGFR1, and bactin were 292, 81, 298, 553, 364, 389, 94, and 152 bp, respectively.
mediator responsible for VEGF-induced angiogenesis and vascular permeability in vivo [14, 15]. Thus, the results of the current study suggest that NO generated from placental endothelial cells could play a critical role in mediating placental angiogenesis and endothelial functions through an autocrine and/or a paracrine fashion. NO has been showed to have an antiapoptotic effect on endothelial cells [7]. The increase in the cell number after SNP treatment however, is not due primarily to decreased cell apoptosis because the cell number after 72 h of SNP treatment is more than that plated (Fig. 1). For example, the number of OFPAE cells after 72 h of 1-lM SNP treatment is approximately 2.5-fold above that plated (4000 cells/well), while the cell number in control wells decreased by only approximately 20% even after overall 96 h of serum starvation. Thus, these results suggest that in OPFAE cells, NO increases the cell number largely via promoting cell proliferation, as observed in other nonplacental endothelial cells [9]. The stimulatory effect of SNP on OFPAE cell proliferation is biphasic, increasing from 1 nM to 1 lM and then declining at 10 lM (note: even at this dose, the stimulatory effect still remained significant) (Fig. 1). This pattern appears to be associated with the amount of NO released from SNP because NO levels at 10 lM of SNP is about ; 3.6–7.1-fold higher than those at 1 lM of SNP over the period studied (Fig. 6). This decreased stimulatory effect of SNP at the relatively
TABLE 2. Semiquantitative RT-PCR analysis for VEGF, FGF2, and their major receptors in OFPAE cells treated with SNP and L-NMMA. SNP treatmenta Control VEGF VEGFR1 VEGFR2 NP1 NP2 FGF2 FGFR1 a
0.28 0.09 0.77 0.79 0.15 0.49 0.42
6 6 6 6 6 6 6
0.018 0.009 0.060 0.036 0.026 0.056 0.017
L-NMMA
SNP (1 lM) 0.25 0.08 0.87 0.76 0.18 0.40 0.40
6 6 6 6 6 6 6
0.042 0.021 0.288 0.203 0.038 0.063 0.058
Data are expressed as means 6 SEM from three independent experiments.
Control 0.34 0.09 0.60 0.70 0.22 0.61 0.35
6 0.062 6 0.021 60.093 6 0.103 6 0.134 6 0.165 6 0.057
treatmenta L-NMMA
0.29 0.13 0.56 0.78 0.28 0.56 0.35
6 6 6 6 6 6 6
(5 mM) 0.054 0.031 0.137 0.110 0.113 0.147 0.077
NO STIMULATES ENDOTHELIAL PROLIFERATION
higher concentration is not surprising since NO is known to have different actions on the same cellular responses, depending on its levels [18, 34]. For example, at the relatively lower levels, NO is proangiogenic, as shown by the current study and other investigators [34], while at the relatively high levels, NO may act as antiangiogenic factor because of its reaction with superoxidants, which in turn forms peroxynitrite, causing cytostasis and apoptosis [34]. Compared with its effects on OFPAE cells, SNP only slightly promotes cell proliferation at relatively high concentrations (100 lM and 1 mM; Fig. 1B) in association with a much weaker MAPK3/1 activation by SNP in HPAE cells (Fig. 3B). These data suggest that these two types of endothelial cell lines have different sensitivities in response to SNP, which is possibly in part due to differences in basal levels of MAPK3/1 phosphorylation between OFPAE and HPAE cells (Fig. 3). Whether these discrepancies resulted from species differences is unclear, particularly since these two types of cells are maintained and treated under different media (i.e., DMEM for OFPAE cells and MCDB131 for HPAE cells). Our findings of the current study are consistent with the previous reports that SNP-promoted angiogenesis is mediated partly via activating the MAP2K1/2/MAPK3/1 pathway [13, 18]. More important, the inhibition of PTIO on SNP-induced cell proliferation and MAPK3/1 activation confirms that NO is indeed a major molecule responsible for these SNP-induced cellular responses since cyanide, one of SNP byproducts after NO release, is also able to elevate generation of reactive oxygen species [35, 36], which in turn can activate the MEK/ MAPK3/1 cascade in endothelial cells [37], including OFPAE cells [38]. Thus, together with the observation that PD98059 significantly reduces SNP-stimulated cell proliferation, these data indicate that NO generated from SNP- and the NOinduced MAP2K1/2/MAPK3/1 activation are required for SNP-induced cell proliferation. It is unclear how exogenous NO activates the MAP2K1/2/MAPK3/1 cascade in OFPAE and HPAE cells. However, several studies have postulated that NO can do so via nitrosylating the MAP2K1/2 upstream kinases, such as p21ras [39, 40]. It is noteworthy that SNP only activates MAP2K1/2/ MAPK3/1 but not PI3K/AKT1 in OFPAE cells. This observation is contradictory to the findings in HPAE cells, in which SNP activates both MAPK3/1 and AKT1 (Fig. 3B), and the previous report showing that NO donors (S-nitosol-Lglutathion and S-nitroso-N-penicillamine) promote migration and angiogenesis of human and bovine endothelial cells via activation of soluble GC (sGC)/cGMP/PI3K/AKT1 pathway [12]. This discrepancy could be attributed to the different origins (i.e., species and blood vessels) of these endothelial cells and the NO donors used since different NO donors are known to differently affect the cellular responses, plausibly because of the amount and duration of NO generation [6]. Moreover, OFPAE cells used in the current study do not have detectable sGC activity and do not produce cGMP in response to SNP [41]. Thus, it is more likely that the lack of sGC activity in OFPAE cells could lead to uncoupling of NO to sGC/cGMP/ PI3K/AKT1 pathway. It also suggests that SNP-induced activation of MAPK3/1 in OFPAE cells is not mediated via sGC activation. NO has been shown to promote in vivo angiogenesis through increasing VEGF expression [16, 42]. Several groups have also shown that NO increases VEGF expression in numerous cell types, including vascular smooth muscle cells in vitro [6, 43, 44]. Conversely, NO can suppress hypoxiaupregulated mRNA expression of VEGF and its receptors (VEGFR1 and 2) in tissues ex vivo and in vivo [45, 46] and in vascular smooth muscle cells in vitro [47]. To date, little is
381
known regarding the effect of NO on FGF2 expression in endothelial cells [48]. Thus, unlike those reported data derived from nonendothelial cells as described previously, our findings indicate that in OFPAE cells, SNP at doses effectively stimulating cell proliferation and L-NMMA at doses effectively inhibiting FGF2- and VEGF-induced cell proliferation (unpublished data) do not significantly alter mRNA expression of VEGF, FGF2, and their receptors studied. Our results on the effect of NO on FGF2 expression are also different from the observation that exogenous NO promotes cell proliferation by inducing endogenous FGF2 expression [48]. These discrepancies may result from different cell types, NO donors, and concentrations of NO donors used [6]. It is also possible that endogenous NO produced from endothelial cells may enhance expression of angiogenic factors in their neighboring cells, such as vascular smooth muscle cells, and that these increased expression angiogenic factors in turn act on endothelium, thus affecting endothelial functions. It should be noted that although SNP fails to change the expression of those angiogenic factors and their receptors in OFPAE cells, other NO donors may do so since different NO donors may cause very distinct cellular responses [6]. In conclusion, our findings of the current study that SNP induces cell proliferation and MAPK3/1 activation in both OFPAE and HPAE cells support the concept that exogenous NO generated from SNP mediates cell proliferation primarily via transient activation of signaling pathways but not through the augmentation of local expression of angiogenic factors and their receptors. These data also suggest that basal NO levels may not play a role in maintaining the expression of VEGF, FGF2, and their receptors in fetoplacental artery endothelial cells. ACKNOWLEDGMENTS The authors appreciate Dr. Jin-Young Chung, University of Wisconsin, Madison, for technical support for RT-PCR assays.
REFERENCES 1. Morris NH, Eaton BM, Dekker G. Nitric oxide, the endothelium, pregnancy and pre-eclampsia. Br J Obstet Gynecol 1996; 103:4–15. 2. Sladek SM, Magness RR, Conrad KP. Nitric oxide and pregnancy. Am J Physiol 1997; 272:R441–R463. 3. McCarthy AL, Woolfson RG, Evans BJ, Davies DR, Raju SK, Poston L. Functional characteristics of small placental arteries. Am J Obstet Gynecol 1994; 170:945–951. 4. Chang JK, Roman C, Heymann MA. Effect of endothelium-derived relaxing factor inhibition on the umbilical-placental circulation in fetal lambs in utero. Am J Obstet Gynecol 1992; 166:727–734. 5. Myatt L, Brewer A, Brockman DE. The action of nitric oxide in the perfused human fetal-placental circulation. Am J Obstet Gynecol 1991; 164:687–692. 6. Dulak J, Jozkowicz A. Regulation of vascular endothelial growth factor synthesis by nitric oxide: facts and controversies. Antioxid Redox Signal 2003; 5:123–132. 7. Hida A, Kawakami A, Miyashita T, Yamasaki S, Nakashima K, Tanaka F, Izumi Y, Tamai M, Huang M, Ida H, Nakamura H, Origuchi T, et al. Nitric oxide acts on the mitochondria and protects human endothelial cells from apoptosis. J Lab Clin Med 2004; 144:148–55. 8. Pipili-Synetos E, Sakkoula E, Maragoudakis ME. Nitric oxide is involved in the regulation of angiogenesis. Br J Pharmacol 1993; 108:855–857. 9. Ziche M, Morbidelli L, Masini E, Granger HJ, Geppetti P, Ledda F. Nitric oxide promotes DNA synthesis and cycle GMP formation in endothelial cells from postcapillary venules. Biochem Biophys Res Commun 1993; 192:1198–1203. 10. Ziche M, Morbidelli L, Masini E, Amerini S, Granger HJ, Maggi CA, Geppetti P, Ledda F. Nitric oxide mediates angiogenesis in vivo and endothelial cell growth and migration in vitro promoted by substance P. J Clin Invest 1994; 94:2036–2044. 11. Ziche M, Morbidelli L, Choudhuri R, Zhang HT, Donnini S, Granger HJ,
382
12.
13.
14.
15.
16.
17. 18. 19. 20.
21. 22. 23. 24. 25.
26.
27. 28. 29.
ZHENG ET AL. Bicknell R. Nitric oxide synthase lies downstream from vascular endothelial growth factor-induced but not basic fibroblast growth factorinduced angiogenesis. J Clin Invest 1997; 99:2625–2634. Kawasaki K, Smith RS Jr, Hsieh CM, Sun J, Chao J, Liao JK. Activation of the phosphatidylinositol 3-kinase/protein kinase Akt pathway mediates nitric oxide-induced endothelial cell migration and angiogenesis. Mol Cell Biol 2003; 23:5726–5737. Parenti A, Morbidelli L, Cui XL, Douglas JG, Hood JD, Granger HJ, Ledda F, Ziche M. Nitric oxide is an upstream signal of vascular endothelial growth factor-induced extracellular signal-regulated kinase 1/2 activation in postcapillary endothelium. J Biol Chem 1998; 273:4220– 4226. Murohara T, Asahara T, Silver M, Bauters C, Masuda H, Kalka C, Kearney M, Chen D, Symes JF, Fishman MC, Huang PL, Isner JM. Nitric oxide synthase modulates angiogenesis in response to tissue ischemia. J Clin Invest 1998; 101:2567–2578. Fukumura D, Gohongi T, Kadambi A, Izumi Y, Ang J, Yun CO, Buerk DG, Huang PL, Jain RK. Predominant role of endothelial nitric oxide synthase in vascular endothelial growth factor-induced angiogenesis and vascular permeability. Proc Natl Acad Sci U S A 2001; 98:2604–2609. Namba T, Koike H, Murakami K, Aoki M, Makino H, Hashiya N, Ogihara T, Kaneda Y, Kohno M, Morishita R. Angiogenesis induced by endothelial nitric oxide synthase gene through vascular endothelial growth factor expression in a rat hindlimb ischemia model. Circulation 2003; 108: 2250–2257. Babaei S, Teichert-Kuliszewska K, Monge JC, Mohamed F, Bendeck MP, Stewart DJ. Role of nitric oxide in the angiogenic response in vitro to basic fibroblast growth factor. Circ Res 1998; 82:1007–1015. Jones MK, Tsugawa K, Tarnawski AS, Baatar D. Dual actions of nitric oxide on angiogenesis: possible roles of PKC, ERK, and AP-1. Biochem Biophys Res Commun 2004; 318:520–528. Souttou B, Raulais D, Vigny M. Pleiotrophin induces angiogenesis: involvement of the phosphoinositide-3 kinase but not the nitric oxide synthase pathways. J Cell Physiol 2001; 187:59–64. Zheng J, Bird IM, Melsaether AN, Magness RR. Activation of the mitogen-activated protein kinase cascade is necessary but not sufficient for basic fibroblast growth factor- and epidermal growth factor-stimulated expression of endothelial nitric oxide synthase in ovine fetoplacental artery endothelial cells. Endocrinology 1999; 140:1399–1407. Prisant LM, Carr AA, Hawkins DW. Treating hypertensive emergencies: controlled reduction of blood pressure and protection of target organs. Postgrad Med 1993; 93:92–96, 101–104, 108–110. Stevenson LW. Advanced congestive heart failure: inpatient treatment and selection for cardiac transplantation. Postgrad Med 1993; 94:97–100, 103– 107, 112. Morbidelli L, Donnini S, Ziche M. Role of nitric oxide in tumor angiogenesis. Cancer Treat Res 2004; 117:155–167. Zheng J, Magness RR, Bird IM. A cell model for studying expression of feto-placental artery endothelial cell angiotensin II type-1 receptors and nitric oxide synthase. Medical Biochemistry 1998; 1:57–64. Zheng J, Li Y, Weiss AR, Bird IM, Magness RR. Expression of endothelial and inducible nitric oxide synthase and nitric oxide production in the ovine placental and uterine tissues during late pregnancy. Placenta 2000; 21:516–524. Zheng J, Wen YX, Chen DB, Bird IM, Magness RR. Angiotensin II elevates nitric oxide synthase 3 expression and nitric oxide production via a mitogen-activated protein kinase cascade in ovine fetoplacental artery endothelial cells. Biol Reprod 2005; 72:1421–1428. Zheng J, Bird IM, Chen DB, Magness RR. Angiotensin II regulation of fetoplacental artery endothelial functions. J Physiol 2005; 565:59–69. Bird IM, Zheng J, Cale MJ, Magness RR. Pregnancy induces an increase in angiotensin II type 1-receptor expression in uterine but not systemic artery endothelium. Endocrinology 1997; 138:490–498. Chung JY, Song Y, Wang Y, Magness RR, Zheng J. Differential expression of vascular endothelial growth factor (VEGF), endocrine gland derived-VEGF, and VEGF receptors in human placentas from normal and preeclamptic pregnancies. J Clin Endocrinol Metab 2004; 89:2484–2490.
30. Tsoi SC, Wen Y, Chung JY, Chen D, Magness RR, Zheng J. Co-expression of vascular endothelial growth factor and neuropilin-1 in ovine fetoplacental artery endothelial cells. Mol Cell Endocrinol 2002; 196:95–106. 31. Denhardt DT. Signal-transducing protein phosphorylation cascades mediated by Ras/Rho proteins in the mammalian cell: the potential for multiplex signalling. Biochem J 1996; 318:729–747. 32. Kwon H, Wu G, Meininger CJ, Bazer FW, Spencer TE. Developmental changes in nitric oxide synthesis in the ovine placenta. Biol Reprod 2004; 70:679–686. 33. Reynolds LP, Redmer DA. Angiogenesis in the placenta. Biol Reprod 2001; 64:1033–1040. 34. Fukuo K, Inoue T, Morimoto S, Nakahashi T, Yasuda O, Kitano S, Sasada R, Ogihara T. Nitric oxide mediates cytotoxicity and basic fibroblast growth factor release in cultured vascular smooth muscle cells: a possible mechanism of neovascularization in atherosclerotic plaques. J Clin Invest 1995; 95:669–676. 35. Sun P, Rane SG, Gunasekar PG, Borowitz JL, Isom GE. Modulation of the NMDA receptor by cyanide: enhancement of receptor-mediated responses. J Pharmacol Exp Ther 1997; 280:1341–1348. 36. Shou Y, Gunasekar PG, Borowitz JL, Isom GE. Cyanide-induced apoptosis involves oxidative-stress-activated NF-kappaB in cortical neurons. Toxicol Appl Pharmacol 2000; 164:196–205. 37. Bogatcheva NV, Dudek SM, Garcia JG, Verin AD. Mitogen-activated protein kinases in endothelial pathophysiology. J Investig Med 2003; 51: 341–352. 38. Chen DB, Li SM, Qian XX, Moon CS, and Zheng J. Tyrosine phosphorylation of caveolin 1 by oxidative stress is reversible and dependent on the CSK but not mitogen-activated protein kinase pathways in placental artery endothelial cells. Biol Reprod 2005; 73:761–772. 39. Lander HM, Jacovina AT, Davis RJ, Tauras JM. Differential activation of mitogen-activated protein kinases by nitric oxide-related species. J Biol Chem 1996; 271:19705–19709. 40. Lander HM, Hajjar DP, Hempstead BL, Mirza UA, Chait BT, Campbell S, Quilliam LA. A molecular redox switch on p21(ras): structural basis for the nitric oxide-p21(ras) interaction. J Biol Chem 1997; 272:4323–4326. 41. Itoh H, Zheng J, Bird IM, Nakao K, Magness RR. Basic fibroblast growth factor down-regulates the expression of clearance receptor of natriuretic peptides via mitogen-activated protein kinase cascade in ovine fetoplacental artery endothelial cells. Am J Physiol 1999; 277:R541–R547. 42. Zhang R, Wang L, Zhang L, Chen J, Zhu Z, Zhang Z, Chopp M. Nitric oxide enhances angiogenesis via the synthesis of vascular endothelial growth factor and cGMP after stroke in the rat. Circ Res 2003; 92:308– 313. 43. Chin K, Kurashima Y, Ogura T, Tajiri H, Yoshida S, Esumi H. Induction of vascular endothelial growth factor by nitric oxide in human glioblastoma and hepatocellular carcinoma cells. Oncogene 1997; 15: 437–442. 44. Frank S, Stallmeyer B, Kampfer H, Schaffner C, Pfeilschifter J. Differential regulation of vascular endothelial growth factor and its receptor fms-like-tyrosine kinase is mediated by nitric oxide in rat renal mesangial cells. Biochem J 1999; 338:367–374. 45. Tuder RM, Flook BE, Voelkel NF. Increased gene expression for VEGF and the VEGF receptors KDR/Flk and Flt in lungs exposed to acute or to chronic hypoxia: modulation of gene expression by nitric oxide. J Clin Invest 1995; 95:1798–1807. 46. Tsurumi Y, Murohara T, Krasinski K, Chen D, Witzenbichler B, Kearney M, Couffinhal T, Isner JM. Reciprocal relation between VEGF and NO in the regulation of endothelial integrity. Nat Med 1997; 3:879–886. 47. Liu Y, Christou H, Morita T, Laughner E, Semenza GL, Kourembanas S. Carbon monoxide and nitric oxide suppress the hypoxic induction of vascular endothelial growth factor gene via the 5N enhancer. J Biol Chem 1998; 273:15257–15262. 48. Ziche M, Parenti A, Ledda F, Dell’Era P, Granger HJ, Maggi CA, Presta M. Nitric oxide promotes proliferation and plasminogen activator production by coronary venular endothelium through endogenous bFGF. Circ Res 1997; 80:845–852.
