Exploiting Stokes and anti-Stokes type emission

DOI: 10.1002/slct.201801008 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57

Full Papers

z Biological Chemistry & Chemical Biology

Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications Meral Yu¨ce,*[a] Hasan Kurt,[b] Babar Hussain,[c] Cleva W. Ow-Yang,[a, c] and Hikmet Budak[c, d] Multiplex biosensing of four types of bacterial food pathogens in one pot is described. Stokes and anti-Stokes type photoluminescence (PL) of two quantum dots (QD) and two upconverting nanoparticles (UCNP) were utilised for realisation of the multiplex detection. The biosensing system was composed of aptamer-functionalized QD and UCNP nanoprobes that were conjugated with partially complementary DNAmodified magnetic beads for separation. PL signals of the conjugates were collected before and after incubation with target pathogens in one pot through the sequential excitations

1. Introduction Exposure to contaminated food with micro-organisms can cause common illnesses such as flu, diarrhoea, poisoning and cancer. For example, diarrhoea caused by Escherichia coli, Salmonella spp. and Campylobacter spp. results in 160,000320,000 deaths annually while the total number of infections related to foodborne toxins amount to ca. 46 million per annum.[1] Detection of bacterial food contamination could be challenging due to pathogen’s widespread habitat and ability to multiply rapidly. Although the foodborne pathogens can be monitored by conventional culture-dependent methods, antibody-based tests and polymerase chain reaction (PCR)-based assays, such techniques are laborious and time-consuming, requiring specialised instruments.[2] For example, antibodybased pathogen detection methods, for instance as enzymelinked immunosorbent assay (ELISA), have been employed in the identification of a range of pathogens including E. coli,[3] Salmonella spp.,[4] Campylobacter spp and Listeria monocyto-

[a] M. Yce, C. W. Ow-Yang Sabanci University SUNUM Nanotechnology Research Centre, 34956, Istanbul, Turkey Tel.: + 90 536 382 6105 E-mail: [email protected] [b] H. Kurt School of Engineering and Natural Sciences, Istanbul Medipol University, 34810, Istanbul, Turkey [c] B. Hussain, C. W. Ow-Yang, H. Budak Faculty of Engineering and Natural Sciences, Sabanci University, 34956, Istanbul, Turkey [d] H. Budak Cereal Genomics Lab, Montana State University, Bozeman, MT, USA Supporting information for this article is available on the WWW under https://doi.org/10.1002/slct.201801008

ChemistrySelect 2018, 3, 5814 – 5823

Wiley VCH 1821 / 113579

at 335 nm for QD probes and 980 nm for UCNP probes. The limit of detection values achieved were 28, 15, 12 and 25 cfu·mL 1 for Listeria monocytogenes, Staphylococcus aureus, Salmonella typhimurium and Pseudomonas aeruginosa, respectively. Efforts for extending the multiplex detection up to five pathogens were also presented even though the PL signal cross-talk of a third QD nanoprobe hindered the detection. This work empowers co-deployment of QDs and UCNPs and paves the way for future studies in multiplex sensing, labelling, and bioimaging fields. genes.[5] These assay-based methods rely on antibodies for target sensing, which is sensitive to temperature and pH changes, and are thus prone to structural degradation and malfunction. Another approach for pathogen detection is standard PCR, which has been used for identifying single pathogens like Salmonella typhimurium,[6] as well as various pathogens in a single test tube. For example, the simultaneous identification of Staphylococcus aureus, Shigella flexneri, Salmonella enteritidis, L. monocytogenes and E. coli O157:H7 in contaminated pork samples was achieved previously by the multiplex-PCR technique.[7] Meanwhile, quantitative PCR (qPCR) has been used for Shiga toxin sensing in minced meat and dairy products[8] for the detection of L. monocytogenes and Ecoli O157:H7 in minimally processed vegetables.[9] However, these methods are based on a complex sequence of steps, requiring durations of several hours to days for validation of bacterial contamination.[10] Therefore, robust and multiplexed strategies are necessary to maintain the food safety standards reliably and practically. The development of aptamers for a broad range of food safety biomarkers has revolutionised the sensing field. Aptamers are short ssDNA, RNA or peptide molecules selected from combinatorial libraries against targets ranging from small molecules to entire cells.[11–14] The long shelf-life of aptamers is one of the key advantages over the conventional antibodies, enabling development of stable, durable, and cost-effective sensing platforms that are suitable for on-site measurements.[15] Aptamer-functionalized nanomaterials, such as silver nanoparticles, mesoporous silica nanoparticles, gold nanoparticles, graphene oxide, carbon nanotubes, upconverting nanoparticles (UCNPs) and quantum dots (QDs), have already been used for a broad spectrum of sensing purposes, including food safety monitoring.[12,13,16–18] Among these, the luminescent nanopar5814

2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Freitag, 01.06.2018 [S. 5814/5823]

1

Full Papers 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57

ticles, such as QDs[19] and UCNPs,[20] have been successfully applied to the multiplex detection platforms, based on the available distinct fluorescence emission characteristics of the particles. QDs offer size-dependent optical properties in the visible spectrum, allowing spectral multiplexing of several QDs at once with a single excitation source.[21] However, the broad emission profiles of ODs with small Stokes shifts limit their application for multiplexed sensing systems, due to fluorescence signal overlap. UCNPs, on the other hand, offer dopant-dependent colour properties, sharp emission profiles with significant anti-Stokes shifts upon excitation with an infrared light source.[22] QDs and UCNPs have been independently reported for spectral multiplexing purposes in the current literature. For example, the simultaneous detection of S. typhimurium and S. aureus was achieved by using UCNPs that were responsive in two different colours, each functionalized with different targetspecific aptamers.[23] Three pathogens, S. aureus, V. parahemolyticus, and S. typhimurium, were successfully detected simultaneously by using aptamer-functionalized UCNPs active at different spectral emissions.[20] Likewise, V. parahaemolyticus and S. typhimurium were detected in a one-pot assay using two different “colours” of QDs that were functionalized with targetspecific aptamers.[24] Simultaneous detection of three different bacteria with three different QDs was also reported using a similar aptamer-based strategy.[25] In a recent study, four different foodborne pathogens were detected by a sandwich assay comprising of antibody-labelled magnetic beads and aptamer labelled QDs, but a significant level of fluorescent signal overlap was observed, due to the broad fluorescence emission profiles of the QDs.[26] In summary, the use of the luminescent nanoparticles for multiplexed sensing purposes has been limited due to signal crosstalk issues in the case of QDs and inherently poor quantum yields or limited colour options in the case of UCNPs. A list of previously reported nanomaterial-based methods and other conventional detection methods for multiplex foodborne pathogen detection is summarised in Table 1, while comprehensive descriptions of the molecular diagnostic methods and commercial assays for the detection of food contaminants can be found in the recent review articles by Umesha et al.[27] and Valderrama et al.,[28] respectively. Our group previously reported the dual-excitation strategy, harnessing the emission behaviours of up-conversion and down-conversion nanoparticles in a single test tube, while avoiding signal crosstalk issues.[29] As a proof of the concept, the Stokes type fluorescence of QDs and anti-Stokes fluorescence type of UCNPs were exploited together for simultaneous detection of S. aureus and S. typhimurium. In the current study, we have extended the reported sensing strategy to its limits—i) an increase in the number of aptamerfunctionalized luminescent nanoparticles and ii) demonstrated synchronised multiplex detection of four foodborne pathogens, for which we used two different types of QDs and two different types of UCNPs in a single pot. Extension of the multiplex detection up to five pathogens was also investigated experimentally. Our results underscore the dual excitation strategy as


Wiley VCH 1821 / 113579

a promising method for future multiplex biosensing platforms, as well as bioimaging applications.

2. Results and Discussion Analyses ranging from UV-visible absorption spectroscopy, CD spectroscopy to electron microscopy were performed to characterise and confirm the realisation of the luminescent aptamer-NP probes, MB-cDNA structures and the final conjugates. Here we presented the characterisation data for one type of UCNP-545 (for L. monocytogenes detection), one type of QD-720 (for P. aeruginosa detection) and their MB conjugates. We confirmed the binding of the target-specific aptamers to the nanoparticles, cDNA modification of the magnetic beads, and the formation of final fluorescent conjugates for multiplex detection. A schematic was presented in Figure S1 for aptamer-nanoparticle probe development process. The characterisation of the remaining QD-510 and UCNP-800 aptamer probes that were previously published by our group,[29] was shown in Figure S2 and S3, respectively. Fluorescence spectrometry was performed to collect the luminescence data that was used to calculate the LOD values for each conjugate. Specificity and reproducibility measurements and real sample performances were also investigated. 2.1 Characterization of aptamer-functionalized NPs and cDNA-functionalized MBs UV-visible and CD spectroscopic analyses were conducted to confirm the presence of aptamers and cDNA oligomers on the nanoparticles following the EDC-NHS carbodiimide reaction. The characteristic absorption of ssDNA molecules occurs at ca. 260 nm. Despite the strong absorption by QDs in the UV spectrum, the absorption shoulder by the ssDNA aptamer adsorbed on the QD nanoprobes was detectable, as shown in Figure 1a. In contrast, the ssDNA absorption peak could be seen clearly on the aptamer-functionalized UCNP samples (Figure 1b), because the relatively high band gap of host NaYF4 nanocrystals did not overlap with the absorption by ssDNA. In the case of cDNA-functionalized MB capture probes, cDNA absorption was visible at the wavelength of 260 nm, as a result of the low UV-absorption of the MBs (Figure 1c), which consisted of a small (~ 26 w%) iron-based small core and predominantly polymeric surfactant molecules. Although we detected the presence of the designated ssDNA aptamers and cDNA oligomers on the signal transmitter and magnetic capture probes with UV-visible absorption spectroscopy, it was imperative to validate the preservation of oligonucleotide’s unique secondary structures and stability. In this context, CD spectroscopy, which uncovers the differential absorption of right- and left-circularly polarised light in chiral samples,[37] was well suited for analysing the chiral properties of the molecular structures upon binding to the nanoparticles.[12] Since the absorption of QDs and UCNPs does not differentiate between right- and left-handed circularly polarised light, these nanomaterials do not actively contribute to the CD spectra of the biological entities, such as aptamers and cDNAs.[12,38] In 5815


Freitag, 01.06.2018 [S. 5815/5823]

1

Full Papers 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57

Table 1. Previously reported methods for foodborne pathogen detection Nanoparticle-based methods Target Pathogens Method

Staphylococcus aureus Salmonella typhimurium Pseudomonas aeruginosa Listeria monocytogenes Escherichia coli O157: H7 Staphylococcus aureus Listeria monocytogenes Salmonella typhimurium Salmonella typhimurium Shigella flexneri Escherichia coli O157: H7 Staphylococcus aureus Vibrio parahaemolyticus Salmonella typhimurium Salmonella typhimurium Escherichia coli O157: H7 Listeria monocytogenes Campylobacter jejuni Listeria monocytogenes Salmonella spp. Staphylococcus aureus Salmonella typhimurium Staphylococcus aureus Salmonella enterica Escherichia coli O157:H7 Salmonella spp.

NPs

LOD (cfu·mL 1)

Ref

Two types of QDs, and two types of UCNPs in a single pot, all four coupled with target-specific aptamers to construct the signal probes. MBs-coupled with the corresponding cDNAs were used as the capture probes for conjugation with the fluorescent signal probes.

QDs UCNPs

15 12

*

MBs

25

Antibody immobilised magnetic beads, and aptamer labelled QDs were used as the capture and the signal probes.

QDs

28 80

[26]

MBs

100 47 160

Fluorescence

QDs

103

[30]

Antibody sandwich immunoassay

g-Fe2O3 MNPs

Three colour luminescence probes, aptamer hybridisation, was applied for magnetic separation

UCNPs Fe3O4 MNPs

25 10 15

[20]

Fluorescence

QDs

20-50

[25]

Antibody sandwich immunoassay

MNBs

Immunobead array method

Fluorescently barcoded and antibody-labelled microspheres QDs UCNPs MBs UCNPs Fe3O4 MNPs Antibody-immobilized poly (carboxy betaine acrylamide) on the SPR chip

1

[31]

16

[29]

1 pg/mL genomic DNA (5 cfu/ 25 g) 1.2 3 102 4.0 3 102 5.4 3 102 1 3 103

Dual-excitation strategy using one QD and one UCNP, both coupled with target-specific aptamers. MBs combined with the corresponding cDNAs were used for separation. Two colour luminescence, magnetic NPs were used as the concentrators through the coupled aptamers Gold nanoparticle-enhanced Surface Plasmon Resonance (SPR) technique

28 8 5 57 7.4 3 103

[23]

[32]

Other methods Universal

Universal primer mediated multiplex asymmetric PCR

-

Salmonella spp. Listeria monocytogenes Salmonella typhimurium Escherichia coli O157:H7 Listeria monocytogenes Salmonella typhimurium Escherichia coli O157:H7 Listeria monocytogenes Staphylococcus aureus Yersinia enterocolitica Escherichia coli O157:H7 Salmonella spp.

Multiplex real-time PCR

-

Multiplex PCR

-

Multiplex PCR

-

Antibody array

-

105–106 106–107

[33]

[34]

[35]

[36]

*** Current study, UCNPs: Upconverting nanoparticles, QDs: Quantum dots, MNPs: Magnetic nanoparticles, MBs: Magnetic beads, SPR: Surface plasmon resonance

Figure 2a and 2 b, the CD spectra of the naı¨ve nanoparticles, free ssDNA aptamers, and aptamer-functionalized nanoparticles are presented. The nanoparticles did not show polarizationdependent absorption in 200–340 nm spectral region since ChemistrySelect 2018, 3, 5814 – 5823

Wiley VCH 1821 / 113579

their polymeric surface coating was not chiral. We only observed changes in the secondary structures of biomolecules, stemming from the anchoring of the free ssDNA aptamers,

5816


Freitag, 01.06.2018 [S. 5816/5823]

1

Full Papers 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57

Figure 1. UV-visible absorption spectrophotometry measurements of the signal and capture probes before and after DNA coupling. a) QD-720 probe and PAaptamer-coupled QD-720 signal probe, b) UCNP-545 probe and LM-aptamer-coupled UCNP-545 signal probe, c) Magnetic beads, a PA-cDNA-coupled magnetic capture probe and LM-cDNA-coupled magnetic capture probe. All spectra were collected at room temperature in 1X PBS buffer.

which resulted in the loss of the free 5’-NH2 end of the aptamers. As presented in Figure 2c and 2 d, the unmodified MBs exhibited a limited chirality in the 200–300 nm spectral range, which was negligible compared to the cDNA-functionalized MBs. The chiral response remained stable in the 260–300 nm range. We only observed the changes of chirality for anchored cDNA oligomers in the 200–240 nm spectral range. This slight change can be attributed to the lower stability of the secondary structure, due to the small number of the nucleotides in comparison to the longer aptamer sequences. Considering the rate of NHS-EDC reaction, we used an excessive amount of amino-modified ssDNA aptamer and cDNA oligomer in preparing the solutions. The unreacted free oligomers were discarded using centrifugation stepwise and magnetic separation for QDs/UCNPs and MBs, respectively. Bacteria detected by the aptamer-functionalized UCNPs formed a system well-suited for Z-contrast imaging, due to the substantial difference in the average atomic number of the bacteria and that of the NaYF4: Yb,Er UCNPs. High-resolution TEM (HRTEM) images presented in Figure 3a and 3 b revealed the presence of aptamer-functionalized CdTe quantum dots in the 1X PBS buffer solution. The particle size of ca. 1 nm diameter can be estimated from a noise-filtered image, using a noise-filtering mask generated from the FFT of the raw image in Figure 3c, 3 d and 3 e. In order not to perturb the interaction of the aptamer-functionalized QD/UCNP nanoprobes with the target pathogens, all measurements were performed in 1X PBS buffer solution which leads to the unavoidable formation of NaCl crystal. Especially in HRTEM and STEM studies, the highly beam-sensitivity of biological samples hindered the recording of high-resolution images of QD/UCNP nanoprobes on the target pathogens. The morphology of the target pathogens changed dramatically under the 200 keV beam and high vacuum (ca. 1 3 10 5 Pa) conditions. We supplemented these results by additionally analysing images recorded in a fieldemission scanning electron microscope, as presented in Figure S4, S5, and S6. The higher average atomic number of the UCNPs resulted in higher scattered intensity, as shown in ChemistrySelect 2018, 3, 5814 – 5823

Wiley VCH 1821 / 113579

Figure 3f and 3 g, contrasting with the bacteria on which the UCNP’s had adsorbed. 2.2 Luminescence-based multiplex biosensing using the aptamer-functionalized QD and UCNP nanoprobes The sensing strategy employed in this study was illustrated in Figure 4. The preparation and characterization of the target specific luminescent conjugates (a) were followed by the measurement of initial fluorescence signals from the conjugates (b), incubation of the conjugates with target bacteria at different concentrations (c), liberation of the NP-aptamers from MB conjugates to bind to the specific bacterial targets (d), separation of the remaining unbound conjugates with magnet (e) and final measurement of the remaining luminescence signals from the conjugates (f). The decrease in the initial fluorescent signal was found to be proportional to the amount of the target in solution. While QDs provide numerous advantages over conventional organic dyes as the signal transducers in biosensing applications,[39] such as size-tunable emission profiles,[40] prominent quantum efficiencies[21] and high signal-to-noise (S/N) ratios; UCNPs offer even higher S/N ratios, sharper emission profiles and elimination of the sample autofluorescence.[41] However, there is only a limited number of lanthanide dopants for tuning the emission profile of UCNPs,[42] while QDs can be tuned through their size-dependent band gap energy.[43] On the other hand, colloidal QDs suffer from the size distribution-dependent broadening of their emission peak.[44] QDs have attracted considerable attention in luminescence-based biosensing and imaging applications, but their broad emission profiles have limited their use in multiplex applications, even though a broad spectrum of QDs is commercially available. Similarly, the utilisation of UCNPs in multiplex applications has been limited to two or three types of analyte detection at most,[23,45,46] as discussed earlier in the introduction section. We aimed to remedy these pitfalls of the QDs and UCNPs in the pursuit of multiplex detection of a higher number of analytes in the same solution. The fundamental difference in 5817


Freitag, 01.06.2018 [S. 5817/5823]

1

Full Papers 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57

Figure 2. CD spectroscopy results were presented. a) CD spectra of unmodified CdTe QD-720, P. aeruginosa aptamer (PA-Apt) and PA aptamer functionalized QD-720, b) CD spectra of unmodified NaYF4:Yb,Er UCNPs (UCNP545), L. monocytogenes aptamer (LM-Apt) and LM aptamer functionalized UCNP-545, c) CD spectra of the nave magnetic beads (MB), P. aeruginosa cDNA (PA-cDNA) and cDNA functionalized MBs, d) CD spectra of the nave magnetic beads (MB), L. monocytogenes cDNA (LM-cDNA) and cDNA functionalized MBs. All spectra were collected at room temperature in 1X PBS buffer.

the excitation profiles of QDs and UCNPs enabled us to exploit the lack of interaction between these two types of nanoparticles by using a dual-excitation strategy that we reported previously for simultaneous detection of S. aureus and S. typhimurium.[29] QDs exhibit a Stokes-type of the excitationemission profile. A high-energy photon excites a valence band electron to the conduction band and, following ground level decay of the excited electron, leads to a lower-energy photon emission at a higher wavelength. Thus, QDs down-convert the incoming high-energy photons, surpassing their band gap to the lower energy photon, in relation to their size-dependent band gap energy. In contrast to QDs, UCNPs exhibit an AntiStokes type of excitation-emission profile. The Yb + 3 dopant absorbs the incoming NIR 980 nm radiation and transfers the excited electron to the visible/NIR emission centres, like Er + 3 ChemistrySelect 2018, 3, 5814 – 5823

Wiley VCH 1821 / 113579

and Tm + 3. Effectively, UCNPs up-convert two or more low energy photons to a single higher energy photon at a lower wavelength. The emission profile of UCNPs can be tuned by using different emission centre dopants, like Er + 3 for prominent 545 nm emission and Tm + 3 for prominent 800 nm emission. Although the quantum efficiency of this type of upconversion is currently limited, the sharp emission profiles related to atomic energy level transitions provide compelling benefits in biosensing applications. In this report, we have developed two novel nanoprobes: i) P. aeruginosa specific aptamer-functionalized CdTe QDs with the emission of 720 nm (PA-Apt-QD720) and ii) L. monocytogenes specific aptamer-functionalized NaYF4:Yb,Er UCNPs with the emission of 545 nm (LM-Apt-UCNP545). Additionally, we have reconfigured the previously optimised S. aureus-specific 5818


Freitag, 01.06.2018 [S. 5818/5823]

1

Full Papers 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57

remained unsensitized (Figure 5a). Subsequently, the same samples were illuminated with an infrared laser at 980 nm, and only the UCNP conjugates luminesced as expected, while the QD conjugates remained unsensitized (Figure 5b). Upon incubation with the bacterial targets at logarithmically increasing concentrations, we observed a concurrent decrease in luminescence intensity of the conjugates (DI = I0-I) (Figure 5c). In our previous work, LOD values of 16 and 28 cfu·mL 1 were obtained for S. aureus and S. typhimurium, respectively.[29] In the current study, LOD for the same targets were found as 15 cfu·mL 1 for S. aureus and 12 cfu·mL 1 for S. typhimurium, by using a PMT-integrated fluorometer. Moreover, P. aeruginosa and L. monocytogenes targets were concurrently detected with LODs of 25 and 28 cfu·mL 1, respectively. The extracted linear regression parameters and corresponding LOD values for all targets were tabulated in Table S2. 2.3 Specificity and reproducibility assays

Figure 3. HRTEM images of SA-aptamer-functionalized QDs-510 (a and b). HRTEM images of SA-aptamer-functionalized QDs-510: c) unprocessed highresolution image, the inset shows the fast Fourier transform (FFT) of the region outlined in red in the unprocessed image; d) noise-filtering mask generated from the FFT; e) noise-filtered HRTEM image. STEM-ADF (f) and HRTEM (g) images of ST-aptamer-functionalized UCNPs-800 nanoprobes with target pathogen S. typhimurium.

aptamer-functionalized CdTe QDs with the emission of 510 nm (SA-Apt-QD510), and S. typhimurium aptamer-functionalized NaYF4:Yb,Tm UCNPs with the emission of 800 nm (ST-AptUCNP800) for simultaneous detection of the pathogens in one pot. Because NaYF4:Yb,Er UCNPs exhibited two emission peaks at 545 nm and 655 nm upon excitation at 980 nm, the dominant emission peak of 545 nm was employed for quantification of the sensing. In Figure 5, we present the luminescence profiles of the target-specific conjugates after incubation with the bacterial targets at logarithmically increasing concentrations (10-106 cfu·mL 1). We have exploited the Stokes-type excitation in two QD conjugates, and the Anti-Stokes type of excitation in two UCNP conjugates, which allowed us to use the optical spectrum twice. Upon excitation with a 335 nm ultraviolet light source, only the QD conjugates luminesced, and the UCNP conjugates ChemistrySelect 2018, 3, 5814 – 5823

Wiley VCH 1821 / 113579

To confirm the selectivity characteristics of the aptamerfunctionalized QD/UCNP nanoprobes, we evaluated each conjugate type against the remaining target pathogens and additionally with E. coli OH157:H7 at a constant bacterial concentration of 104 cfu·mL 1. The specificity results are presented in Figure 5d, in which the drop in the luminescence signal was normalised with the target-specific signal drop. The specificity assay indicated that the PA-Apt-QD720 nanoprobes showed significantly higher specificity, whereas the SA-AptQD510 probes showed the highest relative non-specific interaction in comparison to the other nanoprobes. The observed specificity was found sufficient for the multiplex detection, based on the y-intercept values of the linear calibration equations that were comparable to the non-specific, reduced luminescence values. The aptamer-functionalized QD/UCNP nanoprobes were also tested in drinking water and diluted skimmed milk samples that were spiked with known concentrations of the bacterial targets (102-104 cfu·mL 1). The spiked concentrations of the bacterial targets and the detected concentrations are tabulated in Table S3. In accordance with the specificity assay results, P. aeruginosa specific aptamer-functionalized QD720 nanoprobes showed the lowest detection error in drinking water and skimmed milk samples. At a fixed 103 cfu·mL 1 concentration of bacterial targets, the measurements revealed the detection of (1.03 0.09) 3 103 cfu·mL 1, (1.08 0.11) 3 103 cfu·mL 1, (1.08 0.24) 3 1 3 1 3 10 cfu·mL and (1.03 0.11) 3 10 cfu·mL for S. aureus, P. aeruginosa, L. monocytogenes and S. typhimurium pathogens, respectively. The reproducibility of the sensing method was also tested using a constant concentration of the bacteria and all four conjugates in the same sample tube. An example of a single measurement is presented in Figure S7. Based on the fluorescence signals from 12 samples, the standard deviation and coefficient of variation values (all below 0.1) were calculated and are summarized in Table S4.

5819


Freitag, 01.06.2018 [S. 5819/5823]

1

Full Papers 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57

Figure 4. Illustration of the multiplex-detection procedure. a) Luminescent UCNP and QD conjugates, b) Luminescence emission profiles of the conjugates before interaction with the targets, c) Addition of the targets into the conjugate solution, d) Binding of the luminescent aptamer-NP probes to the targets, e) Separation of the unbound conjugates, f) Luminescence emission profiles of the conjugates after interaction with the targets.

2.4 Testing the upper limit in the number of nanoparticle species for multiplex biosensing Our initial design was to implement three QDs with emissions of 510, 600 and 720 nm, along with two UCNPs for multiplex detection of five different pathogens. The use of a greater number of fluorescent nanoparticles to enable the detection of five analytes simultaneously was attempted by introducing yet another QD-600 nm aptamer probe (targeting Escherichia coli O157:H7) into the system. The primary limiting factor was the overlap in fluorescence signals, particularly, in the case of QDs, which displayed relatively broader Gaussian-type emissions, due to their near-band-edge states and size distributiondependent broadening of band gap distribution. Further chemical modification with the aptamers broadened their fluorescence emission signals and led to an overlap between different QD-based nanoprobes. The simultaneous fluorescence emission profiles of the QDs did not overlap strongly in the electromagnetic spectrum before aptamer-functionalization. However, after aptamer functionalization, the tails of the QD emission centred at 510 nm and 720 nm overlapped with the QD emission centred at 600 nm, as shown in Figure 6a and Figure 6b. The aptamer-functionalization resulted in higher full-width half-maximum (FWHM) values of the fluorescence signals, as also presented in Table S5. The increased FWHM values led to the overlap of QD600 emission with the emission tails of QD510 and QD720. In that case, accurate quantification of QD600 was not possible from the peak intensity values. In Figure 6c and Figure 6d, we show the emission of QD nanoprobes under 335 nm excitation and the emission profiles of ChemistrySelect 2018, 3, 5814 – 5823

Wiley VCH 1821 / 113579

UCNP nanoprobes under 980 nm excitation, in a sample containing all five aptamer-functionalized nanoprobes. However, the increase in the FWHM values of the QDs upon aptamer functionalization resulted in signal overlap that reduced spectral resolution and prevented the detection of fluorescence. Thus, the dual excitation procedure was limited by four-analyte detection with the utilised nanomaterials and under the optimised experimental conditions. In a similar study conducted by Xu et al., the authors used CdSe/ZnS core/shell QDs with the emission of 528, 572, 621 and 668 nm for the detection of four different food pathogens, simultaneously.[26] However, core/shell QDs could only cover a limited spectral range between 470 and 670 nm, unlike CdTe QDs (510-780 nm). Thus a significant level of emission overlap was detected in that study. For the case of UCNPs, the emission characteristics are based on the rare-earth dopants like Er and Tm. Currently, there are two to three types of UCNPs commercially available, due to the limited number of emissive rare-earth dopants, and the current UCNPs lead to multiple emissions, as can be seen in Figure 6d. On the other hand, UCNPs that are specifically designed with single emission peaks could provide better results in multiplexed sensing platform, as previously shown by Wu et al.[20] Those researchers had successfully used NaYF4:Yb, Tm, NaYF4:Yb, Ho and Mn + 2-doped NaYF4:Yb,Er for multiplexed foodborne pathogen sensing, in which Mn and Ho-doped UCNPs provided single emission profiles through the quenching of other emission peaks. Further research on the synthesis of UCNPs with different colours and single emission peaks could improve the prospect of the multiplexed type biosensors based on both singleexcitation and dual-excitation. In our study, we only used the 5820


Freitag, 01.06.2018 [S. 5820/5823]

1

Full Papers 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57

Figure 5. Luminescence intensity readouts a) under an excitation wavelength of 335 nm, b) under an excitation wavelength of 980 nm during the multiplex detection of four food pathogens (S. aureus, P. aeruginosa, L. monocytogenes and S. typhimurium). c) Calibration curves for multiplex detection of four target pathogens. The drop in the luminescence intensity of target-specific luminescent nanoprobes was plotted versus the logarithmically increased concentrations of S. aureus, P. aeruginosa, L. monocytogenes and S. typhimurium under excitation wavelengths of 335 and 980 nm. d) Target specificity evaluation through the measurement of the drop in the luminescence intensity (DI). Each conjugate was incubated with the target pathogens and the non-target pathogen individually at a fix bacteria concentration of 104 cfu·mL 1. E. coli O157: H7 pathogen was used as an independent non-specific pathogen for the samples.

commercially available NaYF4:Yb,Er, and NaY4:Yb,Tm UCNPs to show the applicability of the sensing methodology.

3. Conclusion In this study, multiplex detection of four different foodborne pathogens was realised by combining the unique excitation profiles of two QDs and two UCNPs. Co-deployment of the QD and UCNP nanoprobes in one pot enabled efficient use of the visible-NIR electromagnetic spectrum for detection under different excitation conditions. Target pathogens S. aureus, P. aeruginosa, L. monocytogenes and S. typhimurium were detected in a linear regime of 102-106 cfu·mL 1 with LOD values of 15, 25, 28 and 12 cfu·mL 1, respectively. High affinity and specificity of the utilised aptamers provided a robust, costeffective and sensitive detection strategy compared to the conventional methodologies such as PCR and ELISA. The limited colour options of UCNPs and the broad emission profiles of QDs were the main limiting factors preventing the simultaneous use of a higher number of the ChemistrySelect 2018, 3, 5814 – 5823

Wiley VCH 1821 / 113579

luminescent nanoparticles. Efforts for extending the multiplex detection up to five analytes in the system were hindered by significant signal crosstalk of the QDs, due to the emission broadening upon oligonucleotide functionalization. The employment of core-shell structure QDs with sharper emission profiles may enable simultaneous use of a higher number of the affinity probes.[26] Further development of commercial UCNPs with single band emissions and different rare-earth dopants (i. e., Mn and Ho) could also serve to improve the multiplexing capabilities of the proposed detection technique. With the proposed improvements, the reported strategy can be applied for in situ detection of other analytes such as illicit drugs, doping agents, disease biomarkers or microorganisms. Supporting Information Summary Experimental procedures, optical characterisation of nanoprobes targeting S. aureus and S. typhimurium, scanning electron micrographs of nanoprobes, biosensor calibration results, detection of food pathogens in drinking water and skimmed 5821


Freitag, 01.06.2018 [S. 5821/5823]

1

Full Papers 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57

Figure 6. a) Normalised fluorescence emission profiles of naive and aptamer-functionalized CdTe QDs with three different sizes; b) Summation of the unprocessed and aptamer-functionalized fluorescence emission profiles of QD510, QD600, and QD720; c) Measured fluorescence emission spectra from a solution containing aptamer-functionalized QDs (three different ones) and upconverting nanoparticles (two different ones) under an excitation of 335 nm, arbitrary amounts of the aptamer-functionalized nanoprobes were used; d) Measured fluorescence emission spectra of a solution containing the aptamerfunctionalized QDs (three different ones) and up-converting nanoparticles (two different ones) under an NIR excitation of 980 nm, arbitrary amounts of the aptamer-functionalized nanoprobes were used.

milk samples, fluorescence measurements of control, spiked and retrieved samples are available in the supporting information.

Conflict of Interest

Acknowledgement

Keywords: Aptamers · Biosensor · Foodborne Pathogens · Quantum Dots · Upconverting Nanoparticles

The authors acknowledge the Scientific and Technological Research Council of Turkey (TUBITAK), Grant ID: 114Z379 for the financial support. B.H. acknowledges TUBITAK 2215 Graduate Scholarship Program. The authors would like to thank PhD candidates, Tug˘dem Muslu (Sabanci University) and Kadriye Kahraman (Sabanci University) for maintenance of the bacterial cultures and Assist. Prof. Hayriye U¨nal (Sabanci University) for providing access to the PMT-integrated fluorescence spectrometer. M.Y. owes special thanks to Assist. Prof. Tolga Su¨tlu¨ (Sabanci University) for the administrative support.


Wiley VCH 1821 / 113579

The authors declare no conflict of interest.

[1] WHO, 2015, 1–3. [2] A. K. Bhunia, Adv. Food Nutr. Res. 2008, 54, 1–44. [3] R. N. Carvalho, A. N. De Oliveira, A. J. De Mesquita, C. Silva, A. Q. De Mesquita, R. Alfredo, M. Romero, Brazilian J. Microbiol. 2014, 10, 7– 10. [4] K.-M. Lee, M. Runyon, T. J. Herrman, R. Phillips, J. Hsieh, Food Control 2015, 47, 264–276. [5] M. Gmez-govea, L. Sols-soto, N. Heredia, S. Garca, G. Moreno, O. Tovar, Food, Agric. Environ. 2012, 10, 152–156. [6] A. B. Khan, K. H. Sahir, M. Ahmed, S. I. Khan, J. Food Saf. 2014, 34, 79–86. [7] J. Chen, J. Tang, J. Liu, Z. Cai, X. Bai, J. Appl. Microbiol. 2012, 112, 823– 830.

5822


Freitag, 01.06.2018 [S. 5822/5823]

1

Full Papers 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57

[8] S. Derzelle, a. Grine, J. Madic, C. P. de Garam, N. Vingadassalon, F. Dilasser, E. Jamet, F. Auvray, Int. J. Food Microbiol. 2011, 151, 44–51. [9] P. Russo, G. Botticella, V. Capozzi, S. Massa, G. Spano, L. Beneduce, Biomed Res. Int. 2014, 2014, 1–9. [10] a K. Biswas, N. Kondaiah, K. N. Bheilegaonkar, a S. R. Anjaneyulu, S. K. Mendiratta, C. Jana, H. Singh, R. R. Kumar, Meat Sci. 2008, 80, 418–22. [11] M. Yce, H. Kurt, B. Hussain, H. Budak, yn Biomed. Appl. Funct. Nanomater. (Goln.: B. Sarmento, J. Das Neves), Elsevier, 2018, tt. 211– 243. [12] M. Yce, H. Kurt, RSC Adv. 2017, 7, 49386–49403. [13] B. Hussain, M. Yce, N. Ullah, H. Budak, yn Nanobiosensors (Gol.: A. Grumezescu), Elsevier, 2017, tt. 93–127. [14] M. Yce, N. Ullah, H. Budak, Analyst 2015, DOI 10.1039/C5AN00954E. [15] A. D. Keefe, S. Pai, A. Ellington, Nat. Rev. Drug Discov. 2010, 9, 537–550. [16] J. Wu, Y. Zhu, F. Xue, Z. Mei, L. Yao, X. Wang, L. Zheng, J. Liu, G. Liu, C. Peng, et al., Microchim. Acta 2014, 181, 479–491. [17] S. Upadhyay, M. K. Sharma, R. Das, J. Narayanan 2016, 1, 32–55. [18] M. Kavruk, O. Celikbicak, V. C. Ozalp, B. A. Borsa, F. J. Hernandez, G. Bayramoglu, B. Salih, M. Y. Arica, Chem. Commun. 2015, 51, 8492–8495. [19] B. Wang, Q. Wang, Z. Cai, M. Ma, LWT - Food Sci. Technol. 2015, 61, 368– 376. [20] S. Wu, N. Duan, Z. Shi, C. Fang, Z. Wang, Anal. Chem. 2014, 86, 3100– 3107. [21] U. Resch-Genger, M. Grabolle, S. Cavaliere-Jaricot, R. Nitschke, T. Nann, Nat. Methods 2008, 5, 763–775. [22] F. Wang, Y. Han, C. S. Lim, Y. Lu, J. Wang, J. Xu, H. Chen, C. Zhang, M. Hong, X. Liu, Nature 2010, 463, 1061–1065. [23] N. Duan, S. Wu, C. Zhu, X. Ma, Z. Wang, Y. Yu, Y. Jiang, Anal. Chim. Acta 2012, 723, 1–6. [24] N. Duan, S. Wu, Y. Yu, X. Ma, Y. Xia, X. Chen, Y. Huang, Z. Wang, Anal. Chim. Acta 2013, 804, 151–158. [25] H. Wang, Y. Li, A. Wang, M. Slavik, J. Food Prot. 2011, 74, 2039–47. [26] L. Xu, Z. T. Callaway, R. Wang, H. Wang, M. F. Slavik, A. Wang, Y. Li, Trans. ASABE 2015, 58, 891–906. [27] S. Umesha, H. M. Manukumar, Crit. Rev. Food Sci. Nutr. 2016, 8398, 00–00. [28] W. B. Valderrama, E. G. Dudley, S. Doores, C. N. Cutter, Crit. Rev. Food Sci. Nutr. 2016, 56, 1519–1531. [29] H. Kurt, M. Yce, B. Hussain, H. Budak, Biosens. Bioelectron. 2016, 81, 280–286.


Wiley VCH 1821 / 113579

[30] Y. Zhao, M. Ye, Q. Chao, N. Jia, Y. Ge, H. Shen, J. Agric. Food Chem. 2009, 57, 517–524. [31] R. Charlermroj, M. Makornwattana, I. R. Grant, C. T. Elliott, N. Karoonuthaisiri, Int. J. Food Microbiol. 2016, 224, 47–54. [32] H. Vaisocherov-Lsalov, I. Vsˇov, M. L. Ermini, T. Sˇpringer, X. C. Song, J. Mrzek, J. Lamacˇov, N. Scott Lynn, P. Sˇedivk, J. Homola, Biosens. Bioelectron. 2016, 80, 84–90. [33] A. Garrido, M.-J. Chapela, B. Romn, P. Fajardo, J. Lago, J. M. Vieites, A. G. Cabado, Food Control 2013, 30, 76–85. [34] Y. Yang, F. Xu, H. Xu, Z. P. Aguilar, R. Niu, Y. Yuan, J. Sun, X. You, W. Lai, Y. Xiong, et al., Food Microbiol. 2013, 34, 418–424. [35] Z. P. Guan, Y. Jiang, F. Gao, L. Zhang, G. H. Zhou, Z. J. Guan, Eur. Food Res. Technol. 2013, 237, 627–637. [36] N. Karoonuthaisiri, R. Charlermroj, U. Uawisetwathana, P. Luxananil, K. Kirtikara, O. Gajanandana, Biosens. Bioelectron. 2009, 24, 1641–1648. [37] J. Kypr, I. Kejnovska, D. Renciuk, M. Vorlickova, Nucleic Acids Res. 2009, 37, 1713–1725. [38] J. H. Choi, K. H. Chen, M. S. Strano, J. Am. Chem. Soc. 2006, 128, 15584– 15585. [39] I. L. Medintz, H. T. Uyeda, E. R. Goldman, H. Mattoussi, Nat. Mater. 2005, 4, 435–446. [40] V. I. Klimov, A. A. Mikhailovsky, S. Xu, A. Malko, J. A. Hollingsworth, C. A. Leatherdale, H. Eisler, M. G. Bawendi, Science (80-. ). 2000, 290, 314–317. [41] W. Zheng, P. Huang, D. Tu, E. Ma, H. Zhu, X. Chen, Chem. Soc. Rev. 2015, 44, 1379–1415. [42] Z. Li, Y. Zhang, S. Jiang, Adv. Mater. 2008, 20, 4765–4769. [43] H. Kurt, E. Alpaslan, B. Yildiz, A. Taralp, C. W. Ow-Yang, J. Colloid Interface Sci. 2017, 488, 348–355. [44] P. Jorge, M. A. Martins, T. Trindade, J. L. Santos, F. Farahi, Sensors 2007, 7, 3489–3534. [45] H. H. Gorris, O. S. Wolfbeis, Angew. Chemie Int. Ed. 2013, 52, 3584–3600. [46] M. Wu, R. Kempaiah, P.-J. J. Huang, V. Maheshwari, J. Liu, Langmuir 2011, 2731–2738.

Submitted: April 5, 2018 Revised: May 16, 2018 Accepted: May 20, 2018

5823


Freitag, 01.06.2018 [S. 5823/5823]

1

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57

Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2018

Exploiting Stokes and anti-Stokes type emission profiles of aptamer-functionalized luminescent nanoprobes for multiplex sensing applications Meral Yu¨ce,* Hasan Kurt, Babar Hussain, Cleva W. Ow-Yang, and Hikmet Budak

Materials and Methods Reagents Carboxylic group-modified magnetic beads (MBs, MHP-800) and carboxylic groupfunctionalized UCNPs doped with thulium and erbium (NaYF4:Yb,Tm λems= 800 nm, and NaYF4:Yb,Er λems= 545 nm) were purchased from Ocean NanoTech (San Diego, CA, USA). CdTe QDs modified with carboxylic acid groups (PL-QDN-510±5 nm, PL-QDN-600±5 nm, and PL-QDN-720±5 nm) were obtained from PlasmaChem GmbH (Berlin, Germany). The general buffer ingredients, N-Hydroxysulfosuccinimide sodium salt (Sulpho-NHS) and N-(3Dimethylaminopropyl)-N′-ethyl carbodiimide hydrochloride (EDC) were obtained from Sigma (USA) unless otherwise stated. Listeria monocytogenes (ATCC® 19115™), Pseudomonas aeruginosa (ATCC® 27853™), Salmonella enterica subsp. enterica serovar typhimurium (ATCC® 14028™), Staphylococcus aureus (ATCC® 29213™), and Escherichia coli O157: H7 (ATCC® 25922™) were purchased from American Type Culture Collection (ATCC, USA). Single-stranded DNA aptamers specific to the food pathogens were selected from the literature. The DNA aptamer sequences and their partially complementary DNA sequences (cDNA) were purchased from Integrated DNA Technologies, all with 5′-NH2-C6 modifications (IDT DNA, USA). The list of target pathogens, target-specific DNA aptamers, and cDNA sequences were presented in Table S1. Table S1. Pathogens, NPs, target specific aptamer sequences and the respective cDNA sequences used in this report Targets & NPs

Aptamers (5’-NH2-C6)

cDNAs (5’-NH2-C6)

Staphylococcus aureus

TCCCTACGGCGCTAACCCCCCCAGTCCGT CCTCCCAGCCTCACACCGCCACCGTCCTA CAAC

TGGCGGTGTGAGGCTGG GAGGACGGACTGG

[1]

TACTATCGCGGAGACAGCGCGGGAGGCA CCGGGGA

GGTGCCTCCCGCGCTGT CTC

[2]

Pseudomonas aeruginosa (ATCC® 27853™) (QD-720)

CCCCCGTTGCTTTCGCTTTTCCTTTCGCTT TTGTTCGTTTCGTCCCTGCTTCCTTTCTTG

AAACGAACAAAAGCGA AAGGAAAAGCGAAA

[3]

Salmonella typhimurium

TATGGCGGCGTCACCCGACGGGGACTTG ACATTATGACAG

ATAATGTCAAGTCC CCGTCGGG

[4]

CCGGACGCTTATGCCTTGCCATCTACAGA GCAGGTGTGACGG

CCTGCTCTGTAGATGGC AAGGC

(ATCC® 29213™) (QD-510)

Listeria monocytogenes

Ref

(ATCC® 19115™) (UCNP-545)

(ATCC® 14028™) (UCNP-800) Escherichia coli O157:H7

[5,6]

(ATCC® 25922™) (QD-600)

1

Preparation of microbial cultures Bacterial swabs were initially spread on Nutrient Agar plates and incubated at 37°C overnight. After a single colony was transferred into the Nutrient Broth media, the cultures were incubated overnight at 37°C.[7] Optical density (OD) measurements of the bacterial cultures at 600 nm revealed colony-forming density in terms of colony-forming units (cfu) per mL of the sample, by using the Bio-Rad Smart Spec Plus spectrophotometer (Bio-Rad Laboratories Inc., USA). The pellets, obtained by centrifugation at 10,000 rpm, were washed twice with 1X PBS buffer and dispersed in the same buffer for further analysis. The purity of the cultures was tested through simple staining and microscopy analyses. Preparation of target-specific luminescent nanoprobes The fabrication of luminescent probes was demonstrated in Figure S1. All luminescent nanoparticles and the magnetic beads were functionalized with oligonucleotides according to the procedure described earlier by our group.[8] Briefly, a heating period of 4 min at 95°C was applied to the 100 µM stock solutions of the aptamers, followed by 4 min of cooling on ice. A resting step at room temperature was applied to allow the formation of the minimum energy structures that enable the target-specific binding.

Figure S1. Luminescent nanoprobe preparation; a) Functionalization of nanoparticles (UCNP or QD) with the target-specific aptamer, b) Modification of the magnetic beads with cDNAs, c) Conjugation of each aptamer-nanoparticle and magnetic bead-cDNA unit through the partially complementary nucleotides. Sulpho-NHS (2 mg mL−1), and EDC (10 mg mL−1) solutions were prepared in 2-(Nmorpholino) ethane sulfonic acid (MES) buffer. One milliliter solution of each nanoparticle (at 1 mg mL−1 final concentration) was dispersed in MES buffer (25 mM, pH 6.0). Carbodiimide chemistry was used to form a covalent bond between the surface carboxylic groups of the nanomaterials and the free amine group of the oligonucleotides.[9] To this end, 32 µL of EDC solution was added to each of the NP dispersions, followed by 30 s of vigorous 2

mixing to activate the carboxyl groups on the NP surface. Subsequently, Sulpho-NHS solution (80 µL each) was added to all nanoparticle solutions, followed by 10 min of mixing. 50 µL of each aptamer stock solution was added to the corresponding surface-activated nanoparticle solution and held overnight at room temperature. Two consecutive centrifugation steps were performed to remove the free, non-interacted aptamers, and the final aptamerfunctionalized QDs and UCNPs pellets were dissolved in 1X PBS buffer for further use. MBs (0.5 mg mL−1) were washed twice with Milli-Q water and once with MES buffer using a commercial magnetic stand (DynaMagTM-2 magnet, Thermo Fisher Scientific), which was followed by dispersion in 25 mM MES buffer. EDC and Sulpho-NHS reaction were used to activate the surface carboxyl groups of the MBs, and the coupling of the surface-activated MBs with the corresponding cDNA solution (50 µL from 100 µM stock) took place overnight at room temperature. The unreacted, free cDNA molecules were removed by magnetic separation. cDNA-coupled MBs were washed twice with Milli-Q water and once with 1X PBS, and finally dispersed in 1X PBS buffer for further use. For conjugation of the aptamer-NPs with the cDNA-MBs, all NP-aptamer solutions and their respective MB-cDNA solutions were incubated at 37°C for 2h under lateral mixing at 250 rpm. For saturation of the MB surface, NP-aptamers and MB-cDNAs were incorporated at a 3:1 (v/v) ratio. Conjugated NP-aptamer-cDNA-MBs were separated from the nonhybridized reagents using the magnetic separation stand, and the conjugates were dispersed in 1X PBS. Finally, five types of fluorescent nanoprobes were obtained. The use of metal-chelating salts (e.g. EDTA) in the buffer solutions was avoided, to protect the luminescence properties of the QD samples. Although luminescence in UCNPs is highly resistant to the various type of metal-chelating agents, QDs could ultimately lose their luminescence in the presence of EDTA.[10] Characterization of target-specific luminescent nanoprobes A UV–visible–NIR spectrophotometer (Shimadzu UV-3150, Kyoto, Japan) was used to measure the absorption spectrum of the samples in UV-compatible quartz cuvettes (QuartzSuprasil, Hellma GmbH & Co. KG, Mulheim, Germany) for precise measurements between 200 and 300 nm. The samples were diluted 100 times to avoid multiple-scattering events during the spectrophotometric measurements. PBS buffer was used as blank/background of the spectra. The circular dichroism (CD) spectropolarimeter, J-815 (Jasco International Co., Tokyo, Japan), was used for spectral analysis of the chiral DNA samples under the N2 atmosphere. Quartz cuvettes with a 1.0 mm path length were used for ensuring high resolution, along with a 100 nm/min scanning speed. PBS buffer was used as blank/background of the spectra. Analysis of the functionalized CdTe QDs and NaYF4:Yb,Er UCNPs was performed using a spherical aberration-corrected scanning transmission electron microscope (STEM) (JEMARM 200CF; JEOL, Tokyo, Japan). High-resolution TEM images (HRTEM) and Z-contrast images were recorded using an accelerating voltage of 200 keV. Z-contrast images were 3

obtained from a ca. 2 Å diameter probe and a collection semi-angle range of 53.4-214 mrad. We supplemented these results by performing imaging also in a field-emission scanning electron microscope (SEM, Leo Supra 35VP, Oberkochen, Germany). Sensing measurements The spectral luminescence profiles of the final conjugates were collected with a fluorescence spectrophotometer equipped with a xenon flash lamp and a photomultiplier (PMT) (Cary Eclipse, Agilent, USA). For UV excitation at 335 nm, excitation and emission slit widths were set to 5 nm, and a 600 V bias was applied to the PMT. For near-infrared excitation at 980 nm, a 500-mW continuous wave (CW) diode laser (Dragon Lasers, China) was aligned perpendicular to the detection plane. The bio/chemiluminescence mode was used with a gate time of 5 ms. All spectra were collected between 400-900 nm, and the specimens were placed in Hellma Suprasil quartz cuvettes. For the reproducibility assays, a constant concentration of bacteria (104 cfu/mL) was incubated with known quantities of all four conjugates, separated with the magnetic strand and their fluorescence signals measured. For this experiment, fresh sets of aptamernanoparticle solutions and conjugates were prepared for 12 samples. 12 identical conjugate samples were separately incubated with the target, as described above. Based on the fluorescence signals from 12 samples, the standard deviation and coefficient of variation were calculated. The fluorescence intensity values of QD/UCNP-MB conjugates may vary from batch to batch, due to the NHS-EDC covalent linkage reaction efficiency. However, we did not observe any discrepancies between nanoprobes within the same batch.

Figure S2. UV-visible spectrophotometry measurements of the signal and capture probes before and after DNA coupling. a) QD-510 probe and SA-aptamer-coupled QD-510 signal probe, c) UCNP-800 probe and ST-aptamer-coupled UCNP-800 signal probe, b) Magnetic beads, an SA-cDNA-coupled magnetic capture probe and ST-cDNA-coupled magnetic capture probe. All spectra were collected at room temperature in 1X PBS buffer. Also available in Ref [8]

4

Figure S3. CD spectroscopy results of the probes were presented. a) CD spectra of unmodified CdTe QD-510, S. aureus aptamer (SA-Apt) and SA aptamer-functionalized QD510, b) CD spectra of unmodified NaYF4:Yb,Tm UCNPs (UCNP-800), S. typhimurium aptamer (ST-Apt) and ST aptamer-functionalized UCNP-800, c) CD spectra of the naïve magnetic beads (MB), S. aureus cDNA (SA-cDNA) and cDNA-functionalized MBs, d) CD spectra of the naïve magnetic beads (MB), S. typhimurium cDNA (ST-cDNA) and cDNAfunctionalized MBs. All spectra were collected at room temperature in 1X PBS buffer. Also available in Ref [8]

5

Figure S4. Secondary electron images recorded in a scanning electron microscope of NaYF4:Yb,Er (a) and NaYF4:Yb,Tm (b) up-conversion nanoparticles. Scale bars represent 200 nm.

Figure S5. SEM images of aptamer-functionalized QDs and UCNPs with respective target food pathogens: a) SA-QD510 nanoprobe with S. aureus, b) PA-QD720 nanoprobe with P. aeruginosa, c) LM-UCNP545 nanoprobe with L. monocytogenes and d) ST-UCNP800 nanoprobe with S. typhimurium. Scale bars represent 200 nm.

6

Figure S6. SEM pictures of cDNA-functionalized magnetic beads (left column) and QD/UCNP conjugated magnetic beads (right column) with respective nanoprobes: a) SAcDNA-MB, b) SA-QD510-MB, c) PA-cDNA-MB, d) PA-QD720-MB, e) LM-cDNA-MB, f) LM-UCNP545-MB, g) ST-cDNA-MB and e) ST-UCNP800-MB. Scale bars represent 200 nm. 7

Table S2. LOD values calculated for the targeted foodborne pathogens 𝑹𝟐𝒂𝒅𝒋

Linear Range [cfu∙mL-1]

y=83.21x+59.22

0.9798

102-106

Limit of Detection [cfu∙mL-1] * 15

P. aeruginosa

y=84.62x+84.87

0.9918

102-106

25

L. monocytogenes

y=16.37x+5.53

0.9919

102-106

28

Target Pathogen

Linearity Equation

S. aureus

S. typhimurium

y=17.65x+13.83

0.9918

2

10 -10

6

12

*Limit of detection values were approximated to the nearest higher integral number. The standard method published by Clinical and Laboratory Standards Institute was used to calculate the limit of detection (LOD) values.[11]

Table S3. Evaluation of the sensing system in drinking water and skimmed milk samples Spiked Concentration [cfu∙mL-1] Drinking 102 Water

Measured Concentration [cfu∙mL-1] S. aureus

P. aeruginosa

L. monocytogenes

S. typhimurium

(0.95±0.05) ×102

(1.10±0.06) ×102

(1.23±0.21) ×102

(1.09±0.17) ×102

Drinking Water

103

(1.06±0.14) ×103

(1.08±0.08) ×103

(0.97±0.17) ×103

(1.08±0.12) ×103

Drinking Water

104

(1.06±0.26) ×104

(1.10±0.08) ×104

(1.06±0.05) ×104

(1.18±0.07) ×104

Skimmed Milk

102

(0.92±0.06) ×102

(1.05±0.05) ×102

(0.96±0.11) ×102

(1.03±0.06) ×102

Skimmed Milk

103

(1.03±0.09) ×103

(1.08±0.11) ×103

(1.08±0.24) ×103

(1.03±0.11) ×103

Skimmed Milk

104

(0.99±0.21) ×104

(1.06±0.07) ×104

(1.07±0.23) ×104

(0.91±0.05) ×104

8

Figure S7. Fluorescence measurement of the prepared nanoprobes in bacterial solution, before and after the bacteria detection. The solution contains four designated food pathogens with a concentration of 104 cfu/mL each.

Table S4. Fluorescence intensity mean values, standard deviation, and coefficient of variation of the magnetically retrieved MB-NP conjugates and nanoprobes remained in bacterial solution. 12 identical bacterial solutions contained four types of designated food pathogens with a concentration of 104 cfu/mL each. Control Fluorescence Readings

Mean (µ)

QD510 QD720 UCNP545 UCNP800

541 425 128 129

Bacterial Solution Standard Coefficient Mean Deviation of Variation (µ) (σ) (cv) 250.16 13.82 0.0552 219.50 12.14 0.0553 66.16 6.62 0.1000 70.08 5.65 0.0798

Mean (µ) 155.08 120.83 53.25 48.66

Retrieved MB-NP Standard Coefficient of Deviation Variation (cv) (σ) 9.97 0.0642 8.06 0.0667 3.60 0.0676 3.90 0.0801

Table S5. Full-width half-maximum values of unprocessed and aptamer functionalized CdTe quantum dots with three different sizes. Nanoparticle Type

FWHM (nm) Naive QDs

Aptamer-functionalized QDs

QD510

44.0

53.8

QD600

56.4

64.5

QD720

72.9

78.1

9

References [1]

Y.-C. Chang, C.-Y. Yang, R.-L. Sun, Y.-F. Cheng, W.-C. Kao, P.-C. Yang, Sci. Rep. 2013, 3, 1863.

[2]

N. Duan, X. Ding, L. He, S. Wu, Y. Wei, Z. Wang, Food Control 2013, 33, 239–243.

[3]

K.-Y. Wang, Y.-L. Zeng, X.-Y. Yang, W.-B. Li, X.-P. Lan, Eur. J. Clin. Microbiol. Infect. Dis. 2011, 30, 273–278.

[4]

R. Joshi, H. Janagama, H. P. Dwivedi, T. M. A. Senthil Kumar, L.-A. Jaykus, J. Schefers, S. Sreevatsan, Mol. Cell. Probes 2009, 23, 20–28.

[5]

W.-H. Wu, M. Li, Y. Wang, H.-X. Ouyang, L. Wang, C.-X. Li, Y.-C. Cao, Q.-H. Meng, J.-X. Lu, Nanoscale Res. Lett. 2012, 7, 658.

[6]

J. G. Bruno, J. Chanpong, Methods of Producing Competitive Aptamer FRET Reagents and Assays, 2012.

[7]

M. Yüce, H. Nazir, G. Dönmez, N. Biotechnol. 2011, 28, 356–361.

[8]

H. Kurt, M. Yüce, B. Hussain, H. Budak, Biosens. Bioelectron. 2016, 81, 280–286.

[9]

D. Bartczak, A. G. Kanaras, Langmuir 2011, 27, 10119–10123.

[10]

Z. Tang, Y. Wang, S. Shanbhag, N. A. Kotov, J. Am. Chem. Soc. 2006, 128, 7036–7042.

[11]

D. A. Armbruster, T. Pry, Clin. Biochem. Rev. 2008, 29 Suppl 1, S49-52.

10