Expression and activity of hexokinase in the early mouse embryo. F.D.Houghton1-3, B.Sheth2, B.Moran2, H.J.Leese1 and T.P.Fleming2 department of Biology ...
Molecular Human Reproduction vol.2 no.10 pp. 793-798, 1996
Expression and activity of hexokinase in the early mouse embryo
F.D.Houghton1-3, B.Sheth2, B.Moran2, H.J.Leese1 and T.P.Fleming2 department of Biology, University of York, PO Box 373, York YO1 5YW, and department of Biology, University of Southampton, Bassett Crescent East, Southampton SO16 7PX, UK ^o whom correspondence should be addressed
Introduction Pyruvate is required to support the first cleavage division of mouse preimplantation embryos and is the predominant energy substrate utilized until the morula stage (Brinster, 1965a; Biggers et al., 1967; Whitten and Biggers, 1968; Leese and Barton, 1984; Gardner and Leese, 1986). Glucose as the sole energy source is unable to support development until the 4— 8-cell stage (Brinster, 1965b; Brinster and Thomson, 1966) but becomes the main substrate at the blastocyst stage. The switch from pyruvate to glucose occurs at ~99 h after human chorionic gonadotrophin (HCG) administration (Martin and Leese, 1995). Immediately after implantation, glucose remains the predominant energy substrate and the majority of glucose consumed can be accounted for by lactate appearance in embryos from the mouse (Clough and Whittingham, 1983; Houghton et al., 1996) and rat (Ellington, 1987). The glucose transporter, GLUT 1, is present throughout mouse preimplantation development and glucose entry into the cell is unlikely to be impeded (Hogan, 1991). Thus, the block to glucose utilization during early preimplantation development is more likely to reside with the enzymatic control of glucose metabolism. Three enzymes of glycolysis, which catalyse reactions far from equilibrium, are traditionally thought to be rate limiting; hexokinase, phosphofructokinase and pyruvate kinase (Newsholme and Start, 1973; Newsholme and Leech, 1989). In the mammalian embryo, measurements of maximal enzyme activity have suggested a possible regulatory role for hexo© European Society for Human Reproduction and Embryology
kinase, the first enzyme of glycolysis, in glucose utilization, while regulation by phosphofructokinase cannot be disregarded due to its allosteric properties (Barbehenn et al., 1974, 1978). In the mouse, hexokinase activity increases from the 8—16cell to the blastocyst stage (Hooper and Leese, 1989; Ayabe, 1994), a rise coincident with that of glucose uptake (Leese and Barton, 1984). The low activity of hexokinase during the early preimplantation stages has been suggested as an explanation of the inability of these embryos to consume glucose (Brinster, 1968; Barbehenn, 1974, 1978; Hooper and Leese, 1989). There are four isoenzymes of hexokinase in mammalian tissues; types I-IV, but biochemical measurements of enzyme activity are unable to differentiate between the various types. Hexokinase I—III are 100 kDa proteins with a low Michaelis constant, KM, for glucose, whereas hexokinase IV is a 50 kDa protein with a high KM for glucose (Preller and Wilson, 1992). The relative proportions of the isoenzymes vary in different tissues: hexokinase I is the predominant isoenzyme in glucosedependent tissues such as the brain (Schwab and Wilson, 1989); hexokinase II predominates in skeletal muscle (Thelen and Wilson, 1991) and other insulin-sensitive tissues; hexokinase III, with the exception of pig erythrocytes (Magnani et al., 1983; Stocchi et al, 1983), has not been found to predominate in any cell type; hexokinase IV (glucokinase) is found only in liver (Katzen and Schimke, 1965) and pancreatic fj-cells (Magnuson and Shelton, 1989). It is thought that the 100 kDa proteins have evolved from gene duplication and 793
Downloaded from molehr.oxfordjournals.org by guest on July 13, 2011
The maximal activity and Michaelis constant. KM, of hexokinase have been measured in the peri-implantation mouse embryo using an ultramicrofluorescence technique. In addition, transcript detection of the predominant isoenzyme hexokinase I has been determined in single preimplantation mouse embryos at successive stages of development using reverse transcriptase-mediated cDNA amplification. Maximal hexokinase activity decreased dramatically peri-implantation, from 0.97 ± 0.19 nmol/ng protein/h at the blastocyst stage to 0.31 ± 0.05 nmol/|i.g protein/h on day 6.5. The KM remained relatively low and constant over this period (0.23-0.39 mM), indicating the absence of the hexokinase type IV isoenzyme. The pattern of hexokinase activity resembled that of glucose consumption suggesting a possible regulatory role for the enzyme during this period of development. Hexokinase I mRNA was detected in the oocyte and all preimplantation stages of development. The blastocyst polymerase chain reaction (PCR) product, when cloned and sequenced was found to be 98% homologous with mouse tumour hexokinase I. Taken together, these data suggest that the hexokinase gene is not under transcriptional control during early mouse embryo development but plays a significant role in the regulation of glucose consumption. A role for hexokinase in the phosphate-induced inhibition of early embryo development is also proposed. Key words: enzyme activity/hexokinase/mouse embryo/polymerase chain reaction
F.D.Houghton et al.
Materials and methods Ovulation was stimulated in virgin mice, 6-8 weeks old of the strain CBA/Ca using 5 IU (0.1 ml) pregnant mare's serum gonadotrophin (PMSG, Folligon; Intervet, Cambridge, UK) administered by i.p. injection between 1200-1400 h. This was followed 48 h later by an i.p. injection of 5 IU (0.1 ml) of HCG (Chorulon; Intervet). Females were immediately placed with MF1 males and the presence of a vaginal plug the following morning was taken as an indication that mating had occurred. Embryo recovery Embryos were recovered from the dam at 1400 h on day 2 postfertilization when they were at the 2-cell stage. Embryos were retrieved by flushing the oviducts with H6, a HEPES-buffered medium before being transferred into T6 medium (Whittingham, 1971) containing 5.5 mM glucose, 0.25 mM pyruvate and 2.5 mM lactate, and cultured under pre-equilibrated paraffin oil at 37°C in a humidified atmosphere of 5% CO2 in air. Extraction of poly (A)* mRNA mRNA was extracted from single preimplantation mouse embryos according to the method of Sheardown (1992). To avoid the amplification of any contaminating DNA all solutions were subjected to 5000X100 UJ/cm of UV-irradiation (Spectrolinker XL-1000; Scotlab, Strathclyde, UK). Embryos were removed from culture and placed onto 2 mm squares of messenger affinity paper (MAP; Amersham International, Amersham, UK) in a minimal volume of T6 medium. The RNA was extracted from the embryos by the addition of 10 (J.1 Tris-buffered 4 M guanidinium isothiocyanate (pH 7.5) containing 1% (J-mercaptoethanol, dispensed in 1 u.1 droplets. The samples were 794
1
51l
4
- N-tennlnal half
-X-
Sequences
poly A tail
C-tamliul half • Position
1 - CACACAACATCGTGCACG
344-361
2 - CATTACGAATTCGATCACGTCCCTG
382-394
3 - CATTACCAATTCCATGTAGCAAGC
706-716
4 - GTCGATGTGTCGCACTTC
721-738
Figure 1. Primers used for DNA amplification designed to mouse hepatoma hexokinase I cDNA (Arora et al., 1990). Arrowheads mark the position of primers (sequences below) and direction of cDNA synthesis. Nested primers were designed with EcoRl restriction sites underlined, for cloning of products. A hydrophobic domain ( • ) , ATP binding domains (•) and glucose binding domains (0) are also indicated. washed by vortexing three times in 400 ul NaCl followed by two washes in 80% ethanol before being stored under ethanol at -70°C for a maximum of 2 weeks. Reverse transcription The production of a first strand cDNA template and product amplification were conducted according to the method of Collins and Fleming (1995). First strand cDNA synthesis was performed in a total volume of 20 ul. The reaction mixture contained 50 mM Tris-HCl pH 8.3, 75 mM KC1, 3 mM MgCl2, 10 mM dithiothreitol (DTT), 1 mM of each dNTP, 1 uM outer antisense hexokinase primer 4 (Figure 1), 35 IU RNAguard ribonuclease inhibitor (Pharmacia, St Albans, UK) and 200 IU Moloney-murine leukaemia virus (M-MLV) reverse transcriptase (Gibco-BRL, Paisley, UK). The samples were incubated for 10 min at 27°C followed by 45 min at 37°C and 5 min at 95°C. First stage cDNA amplification Amplification of the first strand cDNA product was performed using outer hexokinase primers 1 and 4 (Figure 1) in a total volume of 45 ul. The reagents were added above solidified Dynawax (Flourgen Instruments Ltd, Lichfield, UK) and contained 4.5 u.1 10X Vent buffer (100 mM KC1, 100 mM (NH^SC^, 200 mM Tris-HCl pH 8.8, 20 mM MgSO4, 1% Triton X-100) as supplied with Vent DNA polymerase (New England Biolabs, Hitchin, UK), 0.6 uM of the outer antisense and 1 uM of the sense outer primer. The first strand template (20 u.1) was added and the samples heated to 65°C for 5 min (hot start). After cooling the samples on ice, false priming was eliminated by adding 1 IU of Vent polymerase in 5 (il IX Vent buffer above solidified wax. The reaction was cycled 30 times at 95°C for 30 s, 72°C for 60 s and 56°C for 60 s. Second stage cDNA amplification Further amplification of the first stage product was performed using nested hexokinase primers 2 and 3 (Figure 1). For each sample, a 43 uJ reaction mixture was prepared containing 4.5 ul 10X Vent buffer, 10 mM dNTPs, 1 uM of each primer and 2 ul of the first stage template. 1 IU of Vent polymerase was again added above solidified wax using hot start as described above. The reaction was cycled 30 times at 95°C for 30 s, 72°C for 60 s and 56°C for 60 s. Two control samples were performed concurrently with each experiment; a MAP control conducted in the absence of an embryo and a reagent control performed in the absence of MAP. These eliminate any potential involvement of environmentally introduced DNA contamination of samples. The technique has also been shown
Downloaded from molehr.oxfordjournals.org by guest on July 13, 2011
fusion of an ancestral form of the yeast hexokinase (Ureta, 1982). Hexokinase I has been the most extensively studied (largely in the rat) and is the only isoenzyme whose DNA sequence is available for mouse, derived from tumour tissue (Arora et al., 1990). The gene consists of two structural halves, both coding for proteins containing an ATP and a glucose binding site (Arora et al, 1990). The C-terminal half provides the catalytic function (Schirch and Wilson, 1987; White and Wilson, 1989) with the A'-terminal half providing enzyme regulation by binding glucose-6-phosphate (White and Wilson, 1990). There is also a hydrophobic region, necessary for binding hexokinase to the outer mitochondrial membrane. To date, there have been no reports on the gene expression of hexokinase in preimplantation embryos. We have investigated maximal hexokinase activity in single mouse blastocysts and in single postimplantation embryos on 6.5 and 7.5 days of gestation using an ultramicrofluorescence assay based on that of Martin et al. (1993). The enzyme kinetics of hexokinase have also been examined to determine the A"M and V,™,, during the peri-implantation period to discover whether the type IV (high KM) isoenzyme is present. In addition, hexokinase I mRNA analysis in single mouse embryos at successive stages of preimplantation development has been determined by reverse transcriptase-mediated cDNA amplification using a technique based on that of Collins and Fleming (1995). The polymerase chain reaction product from blastocysts was cloned, sequenced and sequence homology with mouse tumour hexokinase I cDNA determined.
Hexokinase in the mouse embryo to eliminate genomic DNA contamination from the embryos (Collins and Fleming, 1995). Amplified cDNA products were analysed on 1% agarose gels in Tris borate EDTA (pH 8.0) buffer, stained with 1 (ig/ml ethidium bromide and photographed using a Polaroid DS34 instant camera on 667 Polaroid film. Cloning and sequencing reaction The cDNA amplification product from blastocysts was digested with EcoRl, purified on a Wizard polymerase chain reaction (PCR) column (Promega, Southampton, UK) and ligated into a pGEX:lXT vector (Pharmacia). The ligation reaction was dialysed over 10% glycerol before being electroporated into DH5ct competent cells (Cambridge Bioscience, Cambridge, UK). The transformed cells were grown and plasmid DNA purified using an alkaline lysis method (Sambrook et al., 1989). The orientation of the insert was determined by digestion with BamHl and Bsaml. A total of five clones with the insert in both the correct and incorrect orientation were further purified using a Wizard miniprep purification system (Promega) and sequenced using the sequenase version 2.0 kit (Amersham, Little Chalfont, UK) with a 5' pGEX primer (CTGGCAAGCCACGTTTGGTG). Sequences were read in both directions and analysed using a DNAStar computer programme (DNAStar Ltd, London, UK).
Measurement of maximal hexokinase (EC 2.7.1.1) activity After thawing on ice, the embryo extract was expelled under oil on a siliconized microscope slide. A 0.2-1.0 |il sample of the embryo extract was placed on a clean siliconized microscope slide and 0.20.5 ul of reaction media (5 mM MgCl2, 5 mM ATP, 1.5 mM NADP + , I mM glucose, 100 mM triethanolamine, 5 IU/ml glucose-6-phosphate dehydrogenase, pH 7.6) added. This was immediately taken up in a 5 |il microcapillary tube and the ends sealed with parafilm. The rate of reaction was assessed with time by measuring the appearance of NADPH. The samples were excited at 340 nm and the emitted light collected at 459 nm and above using a Fluovert fluorescence microscope with photomultiplier and photometer attachments (Leica, Milton Keynes, UK). Reactions were conducted at 20°C over a period of ~60 min. There was a linear rate of reaction and an increase in fluorescence as the reaction proceeded due to the reduction of NADP + to NADPH. For each measurement of maximal enzyme activity a control sample was also run, using a reaction mixture containing all the reagents with the exception of the enzyme substrate. This allowed any endogenous oxidation or reduction of co-factors to be determined. The increase in fluorescence was measured against an NADH standard curve over the range of 0-0.2 mM. Kinetic experiments were performed to calculate the KM and V ^ of hexokinase at the blastocyst, day 6.5 and 7.5 stage, using reaction mixtures containing glucose in the range O-l.O mM. Data were expressed as LineweaverBurk plots; l/s versus l/v.
2-c*ll
8-ctU
moral* bUatocyit day 6J
dxy 7.5
Figure 2. Relationship between maximal hexokinase activity ( • ) and glucose consumption (O) by the early mouse embryo. Values of hexokinase activity for the oocyte to morula stage embryos are taken from Hooper and Leese (1989), the figures for glucose consumption from Houghton et al. (1996). Values are the mean of between six and nine observations ± SEM.
Statistical analysis Maximal enzyme activities were expressed as pmol/embryo/h or pmol/ng protein/h. Values of protein content for blastocysts were those of Sellens et al. (1981) and for postimplantation embryos, from Houghton et al. (1996). Hexokinase activity between stages was compared by one-way analysis of variance; differences between individual means were compared by Fisher's test.
Results Maximal hexokinase activity has been determined in extracts of single blastocysts, day 6.5 and 7.5 embryos. Hexokinase activity increased from 0.025 ± 0.005 nmol/embryo/h on day 4 to 1.33 ± 0.22 on day 6.5 before increasing significantly (P < 0.01) to 7.92 ± 0.87 nmol/embryo/h on day 7.5. To compare the activity between the peri-implantation stages, it was necessary to take into account the protein content of these embryos. Figures for protein content at the blastocyst stage were obtained from Sellens et al. (1981); those at day 6.5 and 7.5 from Houghton et al. (1996), who found an increase in protein of 170-fold and 4.5-fold between the blastocyst and day 6.5 embryo, and the day 6.5 and day 7.5 embryos respectively. When this was performed, hexokinase activity decreased significantly {P
