Expression and Putative Function of Kisspeptins and Their Receptors ...

REPRODUCTION-DEVELOPMENT

Expression and Putative Function of Kisspeptins and Their Receptors During Early Development in Medaka K. Hodne, F.-A. Weltzien, Y. Oka, and K. Okubo Department of Basic Sciences and Aquatic Medicine (K.H., F.-A.W.), Weltzien Laboratory, The Norwegian School of Veterinary Science, 0033 Oslo, Norway; Department of Molecular Biosciences (K.H., F.-A.W.), The University of Oslo, 0316 Oslo, Norway; Department of Biological Sciences (Y.O.), Graduate School of Science, The University of Tokyo, Bunkyo, Tokyo 113– 0033, Japan; and Department of Aquatic Bioscience (K.H., K.O.), Graduate School of Agricultural and Life Sciences, The University of Tokyo, Bunkyo, Tokyo 113– 8657, Japan

Kisspeptins (Kiss1 and Kiss2) and their receptors (putatively Gpr54 –1 and Gpr54 –2) have emerged as key players in vertebrate reproduction owing to their stimulatory effect on the brain-pituitarygonadal axis. Virtually nothing is known, however, about their role during embryogenesis. Using medaka (Teleostei) as a model system, we report, for the first time in vertebrates, an early developmental expression and putative function of kisspeptins. Expression analyses and knockdown experiments suggest that early actions of kisspeptins are probably mediated by binding to maternally supplied Gpr54 –1 and late action by both Gpr54 –1 and Gpr54 –2. Knockdown of maternally provided kiss1 and gpr54 –1 arrested development during gastrulation, before establishment of any germ layers, whereas knockdown of zygotically provided kiss1 and gpr54 –1 disrupted brain development. A similar phenotype was observed for gpr54 –2 knockdown embryos, suggesting a critical role for kiss1, gpr54 –1, and gpr54 –2 in neurulation. These data demonstrate that kisspeptin signaling is active both maternally and zygotically and is involved in embryonic survival and morphogenesis. (Endocrinology 154: 3437–3446, 2013)

ver the last decade, kisspeptins (Kiss) and their putative receptors (Gpr54; we use this nomenclature rather than Kissr because of the uncertain relationship between Kiss ligands and their receptors at present; see, eg, Refs. 1, 2) have emerged as major gatekeepers of reproduction because of their central role in regulating the brain-pituitary-gonadal (BPG) axis (reviewed by 3). The current model in mammalian systems suggests that major endogenous and environmental signals act through Kiss neurons, which then directly or indirectly provide an integrated signal to the hypophysiotropic GnRH neurons. Kisspeptins are RFamides of variable lengths (4), whereas their putative cognate receptors belong to the rhodopsin family of G protein– coupled receptors (5– 8). The product of the Kiss gene was first discovered as a metastasis suppressor and therefore termed metastin (9). The importance of the Kiss system as a regulator of the

O

BPG axis emerged after observations that mutations in Gpr54 –1 lead to idiopathic hypogonadotropic hypogonadism (10, 11). Since then, knockout (KO) mice for both ligand and receptor have been established (12, 13). Both KO models lead to infertility, with Gpr54 –1 KO inducing a more severe phenotype than Kiss1 ligand KO (13, 14). Besides its role as a tumor suppressor and regulator of the BPG axis, the Kiss system has been reported to have several additional roles, including vasoconstriction (15, 16), neuronal migration, and increased synaptic transmission (17, 18). For example, Fiorini and Jasoni (19) showed that stimulation with KISS increased neurite growth in GnRHpositive neurons in vitro. Although detailed mechanisms of action are still lacking, these seemingly pleiotropic roles may reflect the diversity of intracellular signaling pathways that can be triggered by Kiss receptor activation (3, 20).

ISSN Print 0013-7227 ISSN Online 1945-7170 Printed in U.S.A. Copyright © 2013 by The Endocrine Society Received January 15, 2013. Accepted June 20, 2013. First Published Online July 3, 2013

Abbreviations: BPG, brain-pituitary-gonadal; dpf, days postfertilization; hpf, hours postfertilization; qPCR, quantitative PCR; WMISH, whole-mount in situ hybridization.

doi: 10.1210/en.2013-1065

Endocrinology, September 2013, 154(9):3437–3446

endo.endojournals.org

3437

3438

Hodne et al

Kiss and Gpr54 During Early Development

Despite these accumulating data, virtually nothing is known regarding the potential expression and function of the kiss system during embryogenesis. This knowledge gap is mostly due to the lack of suitable model systems. Because Kiss or Gpr54 KO mice are infertile, homozygous offspring need to be established from heterozygous parents. This means that the possibility of maternal transfer of transcripts, including that of Kiss and Gpr54, cannot be excluded in this system. Furthermore, because mammals are viviparous, studying embryonic development in vivo is difficult. Most teleost species are oviparous, generally producing high numbers of transparent eggs. This fact, in combination with gene knockdown techniques, means that teleosts are more suitable than mammals as model systems for developmental studies (21). The functionality of the BPG axis is very similar among vertebrate classes, with all the major hormones similarly regulated (22). In a number of teleost species, 2 paralogous genes have been identified for both kiss ligand and receptor (23–25), including medaka (Oryzias latipes) (1, 2, 26), whereas 3 receptor genes recently were identified from the European eel genome (27). The 2 medaka gpr54 paralogs will be referred to as gpr54 –1 and gpr54 –2 in this work, although other authors refer to them as gpr54 –3 and gpr54 –2, respectively (27). The purpose of this study was to investigate the expression pattern and function of kiss ligand and receptor genes during embryonic development in medaka, exploiting the advantages of the teleost model system. To the best of our knowledge, this is the first report showing distinct expression and putative function of kiss ligands and receptors during vertebrate embryogenesis.

Materials and Methods Medaka Fish of the medaka d-rR strain were used. All fish and embryos were maintained on a 14:10-hour light-dark cycle at 28°C

Table 1.


and were fed Artemia nauplii and dry feed (Special Diets Services, Essex, UK) 3 to 5 times per day. Embryo age is given either as stage (28) or as hours postfertilization (hpf) or days postfertilization (dpf).

Quantitative PCR (qPCR) Total RNA was extracted from medaka embryos at 0 to 24hpf using QIAzol Lysis Reagents (QIAGEN, Valencia, California) in combination with an RNeasy MinElute Cleanup Kit (QIAGEN) and from medaka embryos of 24 hpf onward using an RNeasy Lipid Tissue Kit (QIAGEN). Before cDNA synthesis, the RNA was DNase-treated using DNase I (Invitrogen, Carlsbad, California). A 2-␮g volume of total RNA was reverse-transcribed using random hexamers and an Omniscript RT Kit (QIAGEN). A real-time qPCR was performed using a LightCycler 480 System II (Roche Applied Science, Indianapolis, Indiana). A 5-␮L cDNA template (diluted 1:20) was used in a total volume of 20 ␮L containing 0.4 ␮M concentrations each of the forward and reverse primers and 10 ␮L of LightCycler SYBR Green I Master (Roche Applied Science). qPCR primers were designed using Primer3Plus software (http://www.bioinformatics.nl/cgibin/ primer3plus/primer3plus.cgi) using default values except that the GC value was set to 60% (Table 1). The qPCR was performed using 45 cycles of 10 seconds at 95°C, 10 seconds at 60°C, and 6 seconds at 72°C, followed by melting curve analysis to confirm the specificity of the assay. To confirm amplicon size and identity, qPCR products were analyzed by gel electrophoresis and sequencing, respectively. Relative gene expression was calculated relative to ␤-actin. Finding suitable reference genes for gene expression experiments during early embryogenesis is difficult because of the massive increase in cell number/body size and the transition from maternal to zygotic transcripts. We have tested several candidates and found ␤-actin to be most stably expressed during medaka embryogenesis. For further details, see Refs. 29 and 30).

Antisense knockdown Negatively charged antisense peptide nucleic acids (31–33) were designed to overlap the translational start sites of kiss1, kiss2, gpr54 –1, and gpr54 –2 (gripNA; Active Motif, Carlsbad, California) (Table 2). This ATG-targeted approach was expected to inhibit translation of all prepropeptides and thus inhibit translation of both maternal and zygotic transcripts. Morpholino antisense oligos (Gene Tools, Philomath, Oregon) (Table 2) were used for targeting splice sites of kiss1. This splice site–targeted approach was expected to shift the codon frame

qPCR Primers

Target Gene

Direction

Sequence 5ⴕ 3 3ⴕ

kiss1

F R F R F R F R F R

ATCTGATGGAGGGACTCCAATG TGGCGTTTCTTTATAGCCACAG TGAAGCTCCCTCTGATGTCC CCACCCACATGTCCTTGAC ATCTGGACGAGGATGAGGAG CGAGAAGAACAAAGGGACCA CTTCTGTCCATCCCTGTGGT TCGCTGCAGTAAATCTGTGG CCCCACCCAAAGTTTAG CAACGATGGAGGGAAAGACA

kiss2 gpr54-2 gpr54-1 bactin

Abbreviations: F, forward; R, reverse.

Amplicon Size, nt

Efficiency

76

1.97

82

1.95

77

1.99

77

1.94

125

1.98

doi: 10.1210/en.2013-1065

Table 2.


3439

Antisense Probes

Target Gene

GripNA (Translational Start Site Blocking)

Morpholino (Splice Site Blocking)

kiss1 kiss2 gpr54-2 gpr54-1

CCCATTATCACAGCAACT GCAGCCTGAGAGCTGCTC GCAGACATCCTGGTTTTG AGGAGTGCATGGTGTCAG

GACAGCACGCACTACCTTACCTTTC TGAACGCAGCACGTCGCTCACCTGT

and thus block the native prepropeptide synthesis, thereby inhibiting translation only of zygotic transcripts. GripNA and morpholino oligos were solubilized in PBS (pH 7.5) and injected in various concentrations: gripNA, 0.1 to 0.2 mM (low), 0.5 mM (moderate), and 1.9 mM (high); and morpholino, 0.85 mM. A scrambled morpholino oligo with 5 mispairs (ACAtTcCAcAGcAACTcTACCTTCA) with respect to the kiss1 morpholino oligo was also used to control for possible toxic or off-target effects. Volumes of 0.5 to 1.0 nL were injected into the cytoplasm of 1-cell–stage embryos. The embryos were kept on ice until injection to arrest development (maximum 2 hours).

Evaluation of splice site knockdown efficiency To assay the splice site knockdown efficiency of the kiss1 and kiss2 genes, 15 eggs subjected to splice site morpholino knockdown were harvested at stage 26, and RNA was extracted using phenol-chloroform (kiss1: ISOGEN; Nippon Gene, Tokyo, Japan; kiss2: TRIzol; Invitrogen). RNA was DNase-treated (DNase I; Invitrogen) before being reverse-transcribed (Superscript III; Invitrogen) using 1 ␮g of total RNA in a final volume of 20 ␮L. PCR primers (kiss1 forward 5⬘-CGGCTCCACTAATAGTTGCTG-⬘3 and reverse 5⬘-CAGGTCCTGGCGT TTCTTTA-⬘3; kiss2 forward 5⬘-AGCTCTCAGGCTGCAGGATG-⬘3 and reverse 5⬘-GTGGGCACCTCCTGAAACAG-⬘3) were designed on neighboring exons to allow the detection of possible intron retention. The number of PCR cycles was set to 40, with a primer annealing temperature of 60°C for kiss1 and 50°C for kiss2. The extension time was set to 60 and 150 seconds for kiss1 and kiss2, respectively. The total reaction volume was 20 ␮L, including 2 ␮L of 20⫻ diluted cDNA. A positive genomic DNA control was used for identifying the correct size of amplified cDNA containing the intron. All samples were run on a 1% agarose gel stained with ethidium bromide. The shift in size and intensity of the band was used as a control of the knockdown. The expected size of spliced mRNA was 254 bp for kiss1 and 361 bp for kiss 2. Unspliced mRNA was 738 bp for kiss1 and 2563 bp for kiss2.

Phenotype rescue To rescue the phenotype of morphant embryos, 5⬘ capped kiss1 mRNA (100 ng/␮L) was mixed with 0.1 mM gripNA and injected as described above. The mRNA was synthesized by T7 polymerase using mMESSAGE mMACHINE (Ambion, Austin, Texas), whereupon the DNA template was removed using TURBO DNase (Ambion) and the capped mRNA was purified using an RNeasy Mini Kit (QIAGEN).

Whole-mount in situ hybridization (WMISH) The effect on brain development of low dose (0.1– 0.2 mM) gripNA knockdown of kiss1, gpr54 –1, or gpr54 –2 was analyzed by WMISH. Knockdown and control embryos (1–3 dpf) were

fixed in 4% paraformaldehyde in PBS and dechorionated before being permeabilized by proteinase K for 20 minutes at 37°C. The sense and antisense probes for brain development markers, six3 and dlx2, were synthesized by in vitro transcription using DIG RNA Labeling Mix (Roche) according to the manufacturer’s instructions. WMISH was carried out following a standard protocol, and hybridization signals were visualized using 5-bromo4-chloro-3-indolyl phosphate/nitroblue tetrazolium as substrate. Hybridization with sense probes (negative controls) gave no signals. Micrographs were taken using either an SZX-ZB12 stereomicroscope equipped with a DP70 camera (Olympus, Tokyo, Japan) or an AZ100 microscope with a Ds-Ri1 camera (Nikon, Tokyo, Japan).

Statistics One-way ANOVA, followed by a Tukey posttest when significant difference was detected, was performed using GraphPad Prism version 4.00 for Mac (GraphPad Software Inc, San Diego, California). The level of significance was set to P ⬍ .05.

Results kiss ligands (kiss1 and kiss2) and gpr54 –1 were maternally expressed, whereas gpr54 –2 was not detected until premidgastrula (stage 14 –15) Both Kiss ligand (kiss1 and kiss2) and receptor (gpr54 –1 and gpr54 –2) genes were expressed during embryonic development, but with different expression profiles (Figure 1). kiss1 and kiss2, in addition to gpr54 –1, were all expressed at the 1- to 2-cell stages (stage 2–3), indicating maternal provision of these 3 genes. The 2 Kiss ligand genes showed similar expression levels and profiles, with a significant 3-fold increase at the onset of neurulation followed by a reduction to preneurulation levels at the 22-somite stage (stage 26). The expression pattern of the gpr54 paralogs differed notably. For gpr54 –1, the level of maternally provided transcripts (stage 2–3) was high (based on Cq values, about 17 times higher than those for kiss1 and kiss2) but declined significantly between the morula stage (stage 8 –9) and the 2-somite stage (stage 19), after which the expression level remained at low levels. The expression profile of gpr54 –2 was almost the opposite to that of gpr54 –1, with no detectable expression until after gastrulation (stage 15), at which time we would

3440

Hodne et al


expect the first zygotic expression to appear. gpr54 –2 expression increased significantly from the time of somite completion (stage 33) before leveling off 1 day or 2 days before hatching (stage 36 –38). gpr54 –2 levels remained far lower than gpr54 –1 levels throughout embryonic development (Figure 1). To determine the spatial expression pattern during embryogenesis, WMISH was attempted for both kiss ligands and receptors. However, we could not distinguish a specific signal for any of the tested riboprobes. kiss1 knockdown reveals a dual role during embryogenesis To elucidate the possible significance of the early expression of kiss, we conducted a series of knockdown experiments. We based the experiments on 2 independent techniques, the novel form of negatively charged peptide nucleic acids called gripNA and the well-established morpholino technology. We first set out to knock down the kiss1 ligand using gripNA to block the translation initiation site of the transcript, thereby preventing translation of the intrinsic protein (independent of its source, maternal or zygotic). Interestingly, a low concentration (0.2 mM) of gripNA arrested further development in 97% (146 of 150) of the


embryos during a 2- to 3-hour window around stage 11– 12, just before gastrulation. At this stage, the embryonic cells normally start to divide asynchronously and to migrate. Thus, the effect of maternal kiss1 knockdown occurs around the time of the initial embryonic cell migration before the formation of the 2 germ layers, epiblast and hypoblast. Next, zygotic expression was specifically hindered by morpholino splice site knockdown (maternally provided mRNA does not contain introns), enabling us to distinguish between the zygotic and the maternal significance of kiss1. A high concentration (0.85 mM, n ⫽ 185) of morpholino antisense blocking splicing of kiss1 revealed no significant increase in mortality compared with that of uninjected embryos (on average, 25%–30% die during the first 48 hpf). However, the morpholino-injected embryos had severe morphological defects, particularly in the forebrain region including anophthalmia (Figure 2C). Besides preventing the synthesis of protein from zygotic transcripts, the splice site approach allows the knockdown efficiency to be assayed by PCR. The PCR assay demonstrated efficient targeting of the splice site with a highintensity band around 738 bp, similar to the genomic control, and only a very weak band, around 254 bp, similar to

Figure 1. Gene expression profile during embryogenesis in medaka. Relative gene expression was analyzed using qPCR at different developmental stages (mean ⫾ SEM; n ⫽ 7). The abscissae represent key developmental stages. The ordinates represent gene expression levels relative to a reference gene (␤-actin), expressed as fold change of the expression level of kiss1 at developmental stage 2–3 (1- to 2-cell stage). All genes were detected from stage 2–3, except gpr54 –2, which was first detected at stage 15 (midgastrula) with a significant increase in expression from stage 33 (completion of notochord and vacuolization). Different letters indicate significant differences (P ⬍ .05).

doi: 10.1210/en.2013-1065

the wild-type control. Based on the shift in PCR product size and the intensity of the ethidium bromide band, we conclude that zygotically expressed kiss1 was efficiently knocked down (Figure 2A). The effect of zygotic kiss1 knockdown was confirmed in 3 subsequent control experiments. First, to permit progression through gastrulation, gripNA concentration was reduced to 0.1 mM (n ⫽ 120). At this concentration, probably resulting only in partial knockdown, all embryos developed beyond gastrulation (stage 15), but showed a phenotype similar to those undergoing splice site knockdown (Figure 3). The second control was rescue of phenotype by coinjecting 0.1 mM gripNA together with 100 ng/␮L 5⬘capped kiss1 mRNA (Figure 4). The results showed that embryo mortality was not different from that of uninjected embryos (about 26%–29%; excluded from the data). With use of this approach, it was possible to reduce the number of morphant embryos from 70% (0.1 mM gripNA; n ⫽ 119) to 20% (0.1 mM gripNA and capped kiss1 mRNA; n ⫽ 70). The incidence of a severe phenotype involving impaired body development was reduced from

Figure 2. Antisense knockdown (KD) targeted to kiss1 or kiss2 splice sites. Specific targeting of zygotically expressed kiss1 and kiss2 was achieved by using splice site KD leaving the already spliced maternal mRNA unaffected. The splice site morpholino KD efficiency was evaluated using PCR with primer pairs targeting exon 2 and exon 3 of kiss1 (A) or kiss2 (B). Comparing morpholino (0.85 mM; KD)–injected medaka embryos with uninjected wild-type (Wt) embryos demonstrated a shift in the PCR band indicative of efficient splice site KD. C, Comparing 3-dpf Wt embryos with zygotically expressed kiss1 KD embryos revealed the fundamental role of kiss1 during eye and brain development. Arrowheads point to the area of the developing eyes. ⫺RT, control without reverse transcriptase; DNA, genomic DNA; M, DNA ladder.


3441

20% to 3% after rescue (Figure 4). The third control involved testing for potential off-target effects by injecting a kiss1 5-base mismatch morpholino control oligo (34, 35). Even at a high concentration (0.85 mM), this control oligo had no apparent effect on the embryos (n ⫽ 70, data not shown). The embryonic gene expression levels of kiss1 and kiss2 were essentially identical (Figure 1). However, in contrast to knockdown of kiss1, we found no morphological changes or increased mortality compared with the wild type using either of the 2 knockdown strategies on kiss2 (data not shown). As shown for kiss1, efficient splice site knockdown of kiss2 was confirmed by PCR (Figure 2B). Kiss receptor (gpr54 –1 and gpr54 –2) knockdown inhibits normal development Further evidence for a functional role of the Kiss system during development was provided through Kiss receptor knockdown experiments. Expression of gpr54 –2 was not detected until stage 14 –15, ie, after transition from maternal to zygotic expression (Figure 1C). In agreement with this, targeting gpr54 –2 with 0.5 mM gripNA showed no abnormal phenotype until stage 16. At this stage, gas-

Figure 3. Antisense knockdown (KD) targeted at the kiss1 translational initiation site. To permit progression through gastrulation, a low dose (0.1 mM) of kiss1-specific gripNA was injected into 1-cellstage medaka embryos. The embryos had a phenotype comparable to that of splice site KD (see Figure 2) with impaired eye and brain development. Compared with wild-type (Wt) embryos, the eye development of kiss1 KD embryos was already impaired at 1 dpf (top right). At 3 dpf, there was no development of the forebrain after kiss1 KD (bottom right). Scale bars correspond to 50 ␮m (top images) or 100 ␮m (bottom images). Arrowheads point to the area of the developing eyes.

3442

Hodne et al


Figure 4. Rescue of kiss1 knockdown (KD) by coinjection of kiss1 mRNA. By using 100 ng/␮L of capped kiss1 mRNA coinjected with 0.1 mM gripNA, the morphant phenotype of kiss1 KD was reduced from 70% (n ⫽ 119) to 20% (n ⫽ 70). Severe phenotypes, including impaired body development, were reduced from 20% to 3%.


most likely partial gpr54 –2 knockdown was still more severe than kiss1 or gpr54 –1 (see below) knockdown, as the embryos showed no visible craniofacial development and lacked any visible neurocranium, dermatocranium, and associated viscera, although the inner ear seemed to develop normally (Figure 5). As shown in the gene expression profile, gpr54 –1 was already highly expressed at stage 2–3 of development (Figure 1D). Using a moderate concentration (0.5 mM) of gpr54 –1-specific gripNA, we observed close to 100% mortality around stage 11–12, just before gastrulation. This is during the same time window as when arrested development was observed after kiss1 gripNA knockdown (0.2 mM). Embryos exposed to a lower concentration (0.25 mM) of gpr54 –1 gripNA developed beyond the midgastrula (stage 15). However, similar to the observations after low doses of kiss1 knockdown, morphological changes to the brain region, including improper forebrain development and anophthalmia, were observed (Figure 5).

dlx2 expression is affected by knockdown of kiss or gpr54, whereas six3 expression is not The morphant phenotypes of kiss1, gpr54 –1, and trulation (stages 12–16) completes, and the embryonic gpr54 –2 knockdown were further investigated by body is visible as a thin streak. Subsequently, the eyes and WMISH (Figure 6). Because of the anophthalmia and brain develop. However, we observed that further devel- other gross abnormalities in the head region after knockopment was halted following gpr54 –2 knockdown, and down, we investigated the patterning of the homeobox the embryos died before stage 17. After the concentration gene related to distal-less, dlx2 (36, 37) and of six3 (38), of gripNA was reduced to 0.25 mM, development pro- a homolog of the Drosophila homeobox gene sine oculis. Knockdown of either kiss1, gpr54 –1, or gpr54 –2 disceeded beyond stage 16 –17. However, the effect of this rupted the expression of dlx2. In wild-type medaka embryos, dlx2 showed distinct segmented expression in both the forebrain and mid-/ hindbrain at 2 dpf (stage 25). Strikingly, none of the knockdown embryos had any dlx2 expression in the forebrain at 2 dpf. However, in the mid-/hindbrain, the dlx2 expression pattern of kiss1 knockdown embryos was similar to that of wild-type embryos, whereas the pattern was less clear-cut in gpr54 –1 and gpr54 –2 knockdowns. At 3 dpf, dlx2 expression after all knockdowns was observed both in the forebrain and mid-/hindbrain but with Figure 5. Antisense knockdown (KD) targeted at gpr54 –1 and gpr54 –2 translational initiation sites. Efficient KD of gpr54 –1 and gpr54 –2 was achieved using 0.5 and 0.25 mM gripNA, stronger expression in the forebrain. respectively, injected into 1-cell-stage medaka embryos. The morphant embryos resembled those Knockdown of either kiss1, of kiss1 KD with severe defects particularly in the forebrain and eye area. Scale bars correspond gpr54 –1, or gpr54 –2 did not noticeto 50 ␮m (top images) or 100 ␮m (bottom images). Arrowheads point to the area of the ably affect the expression of six3. In developing eyes. Wt, wild type.

doi: 10.1210/en.2013-1065

wild-type embryos, six3 was expressed in the forebrain and the eye, with first detection at 1 dpf (stage 16 –18). The same pattern and onset of expression were observed in all the different knockdowns.

Discussion Since the discovery of their involvement as gatekeepers of hypothalamic GnRH secretion and pubertal development a decade ago (10, 11), the functionality and regulation of kisspeptins and their receptors have been intensively investigated (for reviews, see, eg, Refs. 3, 39). Emerging evidence suggests that kisspeptins may be involved at earlier stages of development, although data in any vertebrate taxon are very scarce (40). The aim of the present work was to investigate the potential presence and functional role of Kiss ligands and receptors in medaka during embryonic development. Expression profiles for each gene were characterized using qPCR, and function was assessed by antisense knockdown experiments on both ligands and receptors. The rationale behind this work was 2-fold. First, to the best of our knowledge, there is currently no report describing the Kiss system during early embryonic development in vertebrates. Second, although Kiss1 and Gpr54 –1 KO mice are powerful models to investigate how Kiss systems regulate pubertal development and fertility (12, 13), these models are poorly suited for studying the contribution of potentially maternally provided Kiss and Gpr54


3443

because the 2 KO models are infertile and offspring are produced from heterozygous parents. The gene expression profiles revealed maternally provided Kiss systems involving the 2 kiss ligands (kiss1 and kiss2) and one of the receptors (gpr54 –1), indicating the possibility of functional Kiss receptor-ligand systems at very early stages. gpr54 –2, on the other hand, was not detected until after the zygotic phase, at stage 15, with a significant increase in expression levels between stage 30 and stage 36. In zebrafish (Danio rerio), kiss1 and kiss2 gene expression has been reported in 24-hpf (30 somite stage) embryos (26), but earlier stages were not investigated. This is equivalent to medaka stage 28 (64 hpf), ie, long after zygotic expression has commenced. In another teleost, the cobia (Rachycentron canadum), gpr54 –1 expression was detected at 1 day posthatching (41). In mammals, kiss1 gene expression has been detected in hypothalamic areas during the late fetal period in mouse (stage embryonic day 13.5) (42), and both gene expression and peptide have been detected in rat (stage embryonic day 14.5) (40). gpr54 –1 gene expression has also been detected in stage embryonic day 13.5 prenatal mice (42), indicating the possibility of a functional ligand-receptor system from this stage on. Maternally provided Kiss ligands or receptors have, however, not been reported. As a qualitative support to the gene expression analyses, we sought to determine the spatial expression pattern of kiss ligands and receptors during embryogenesis. How-

Figure 6. WMISH for dlx2 and six3 on embryos after zygotic knockdown (KD). WMISH was conducted at 1 to 3 dpf on both wild-type (Wt) and KD embryos using 2 of the key genes regulating brain development, dlx2 and six3. A, dlx2 was detected in Wt embryos in the forebrain and mid-/ hindbrain regions from 2 dpf. B–D, In KD embryos at 2 dpf, dlx2 was detected predominantly in the mid/hindbrain. F–H, In KD embryos at 3 dpf, dlx2 expression was also detected in the forebrain, although its spatial pattern was somewhat different from that of Wt embryos (E). six3 was detected from around 1 dpf. At this stage, there were no apparent differences in expression pattern of six3 between Wt (I) and KD (J–L) embryos. M–P, six3 continued to be expressed in all 3 dpf embryos, again with no clear differences between Wt and KD.

3444

Hodne et al


ever, the WMISH could not distinguish any specific signal for any of the tested riboprobes. The functional roles of the early expressed kiss and gpr54 transcripts were analyzed in a series of knockdown experiments, indicating the possibility of several independent kiss systems during embryonic development. We targeted maternal and zygotic expression separately, by either targeting the knockdown probe at the translational initiation site using gripNA (maternal and zygotic knockdown) or at a splice site using morpholino oligos (zygotic knockdown only). The results reveal a critical role for both maternally and zygotically expressed kiss1 and gpr54 –1. However, the functions of the maternally and zygotically expressed transcripts are quite distinct. Knockdown of maternal kiss1 and gpr54 –1 led to developmental arrest and subsequent death around the blastula stage (stage 10 – 11), suggesting that this early expressed system could be involved in regulation of either early asynchronous cell division or early cell migration. The downstream factors controlled by kiss1/gpr54 –1 signaling are not known. However, cell migration during blastulation and gastrulation is dependent on sdf1/cxcr4 chemotaxis. This signaling pathway is also known to be important during bone-directed migration of GPR54-positive breast cancer cells (43), and kisspeptin can indirectly regulate sdf1/ cxcr4 through desensitization of cxcr4 by preventing rise in intracellular Ca2⫹ levels after sdf1 stimulation (44, 45). In zebrafish, knockdown of sdf1/cxcr4 inhibits migration of endodermal cells during gastrulation (45). Moreover, sdf1 signaling is crucial for survival in mice, and individuals lacking either receptor or ligand have defective hematopoiesis, developmental lymphoid tissue, vascularization of the gastrointestinal tract, migration of neuronal cells, and patterning in the central nervous system and die prenatally (46, 47). Zygotic knockdown of kiss1 and gpr54 –1, on the other hand, allowed the embryos to survive gastrulation, and seemingly normal development continued until completion of neurulation (stage 18). At this point, early eye development is normally observed. However, after zygotic knockdown with either morpholino or a low dose of gripNA, eye development was interrupted, and further brain development was severely disrupted. We also demonstrated that the expression pattern of a brain developmental marker, dlx2, was affected by all Kiss ligand and receptor gene knockdowns, but the effect varied between stages (2 vs 3 dpf). In contrast, the expression of another marker of brain and eye development, six3, seemingly was not affected by any kiss ligand or receptor knockdown. Although further studies are needed, these results indicate that Kiss is implicated with dlx2 in brain development. Surprisingly, knockdown of kiss2, which was expressed at


levels similar to those of kiss1, did not produce any increased mortality or malformed embryos. Unless kiss1 takes over the role of kiss2 after kiss2 knockdown, kiss2 does not seem to be critical for proper development. If kiss2 is translated and active before zygotic activation, our results indicate that it does not work through gpr54 –1 (which is not expressed at this point) but possibly through gpr54 –2 (although knockdown leads to developmental arrest and 100% mortality) or through other, currently unknown, RFamide receptors. The different effects observed after kiss1 and kiss2 knockdown suggest the possibility of a very early separation of the 2 functional systems during embryonic development. One system, comprising Kiss1 and Gpr54 –1, has a functional role important for survival during the maternal stage of development. This system continues to function throughout embryonic development, although it seems more important for regulating brain development at later embryonic stages. A second system seems to comprise Kiss2 and Gpr54 –2 or other unknown RFamide receptors. The possible function of this second system remains to be clarified. Contrary to the observed phenotypes after zygotic knockdown of kiss1 and gpr54 –1, the moderate dose (0.5 mM) gripNA knockdown of gpr54 –2 arrested further development at stage 16 (late gastrula). This phenotype resembled that of maternal kiss1 and gpr54 –1 knockdowns. However, because gpr54 –2 is first detected after the transition to zygotic gene expression, new questions arise as to why a similar phenotype was not also observed after zygotic kiss1 and gpr54 –1 knockdown. One reasonable explanation is that the 2 receptors are functionally separated. If they are involved in similar functions, our results indicate that the actions of Gpr54 –1 may be partly compensated for by those of Gpr54 –2, whereas Gpr54 –2 cannot be functionally replaced by Gpr54 –1. In line with the more severe phenotypes observed in this work after receptor knockdown, Lapatto et al (13) described a more severe phenotype after Gpr54 –1 KO compared with Kiss1 KO mice. Because mice possess only the one Gpr54 paralog, one of several suggestions was a possible weak activation of Gpr54 –1 by other ligands. Our results and those of Lapatto et al (13) suggest that Kiss and other RFamides may promiscuously bind to different RFamide receptors (21, 48, 49). Knockdown and KO experiments allow us to target specific gene(s) while other genes of the same cell continue to be expressed. A recent study has investigated the possibility of ablating entire cells expressing Kiss1 and Gpr54 –1 in female mice (50). Interestingly, these animals were able to reach puberty and were shown to be fertile when mated with wild-type males. Acute ablation of Kiss1 neurons in adult mice, on the other hand, leads to infer-

doi: 10.1210/en.2013-1065

tility. These results suggest that Kiss is not essential for puberty and that there is compensation for removal of Kiss neurons early in development. However, based on the report by Mayer and Boehm (50), it is difficult to assess how the maternally deposited transcripts are affected. We suggest that it would be worthwhile to test this ablation system in a teleost model, which allows detailed embryonic development to be investigated in vivo. In summary, we have established gene expression profiles, including the initial onset, of both kiss ligands and gpr54 receptors throughout embryonic development in medaka. Furthermore, we have demonstrated the presence of functionally independent Kiss systems being established early during embryonic development, in line with the 2 brain systems described in the adult medaka (21, 51) and zebrafish (52). Before zygotic transition, a system comprising Kiss1 and Gpr54 –1 seems essential for survival, because knockdown of either gene resulted in 100% mortality before gastrulation and a second system comprising Kiss2 in combination with an unidentified RFamide receptor (not Gpr54 –2). The former system seems to be important before gastrulation, whereas the latter system apparently serves an as yet unknown function during this phase. After zygotic gene activation, knockdown of gpr54 –2 resulted in 100% mortality just after gastrulation, whereas zygotic knockdown of either kiss1 or gpr54 –1 produced similar phenotypes with impaired brain development. Knockdown of kiss2 did not produce a clear phenotype or increase mortality at any stage. We thus cannot conclude whether kiss2 is translated during embryogenesis, kiss1 can mimic its function, or kiss2 knockdown results in a yet to be identified phenotype.

Acknowledgments We thank Dr R. Nourizadeh-Lillabadi for technical assistance and Drs S. Dufour, L. Robertson, and D. Baker for valuable discussions. Financial support was provided by the Norwegian School of Veterinary Science PhD student exchange program (to K.H.), the Research Council of Norway (Grant 184851 to F.A.W.), the Bio-oriented Technology Research Advancement Institution (Program for Promotion of Basic Research Activities for Innovative Biosciences of Japan) (to Y.O.), and the Ministry of Education, Culture, Sports, Science and Technology in Japan (Grant-in-Aid for Scientific Research on Innovative Areas) (to K.O.). Address all correspondence and requests for reprints to: F.-A. Weltzien, Department of Basic Sciences and Aquatic Medicine, Weltzien Laboratory, The Norwegian School of Veterinary Science, 0033 Oslo, Norway. E-mail: [email protected]; or K. Okubo, Department of Aquatic Bioscience, Graduate School of Ag-


3445

ricultural and Life Sciences, The University of Tokyo, Bunkyo, Tokyo 113-8657, Japan. E-mail: [email protected]. K.H., F.-A.W., and K.O. planned the project. K.H. performed most of the experimental procedures, including qPCR, knockdown, and in situ hybridization experiments. K.H., F.-A.W., Y.O., and K.O. analyzed the data and wrote the paper. Disclosure Summary: The authors have nothing to disclose.

References 1. Kanda S, Akazome Y, Matsunaga T, et al. Identification of KiSS-1 product kisspeptin and steroid-sensitive sexually dimorphic kisspeptin neurons in medaka (Oryza latipes). Endocrinology 2008; 149:2467–2476. 2. Felip A, Zanuy S, Pineda R, Pinilla L, Carrillo M, Tena-Sempere M, Gómez A. Evidence for two distinct KiSS genes in non-placental vertebrates that encode kisspeptins with different gonadotropin-releasing activities in fish and mammals. Mol Cell Endocrinol 2009; 312:61–71. 3. Oakley AE, Clifton DK, Steiner RA. Kisspeptin signaling in the brain. Endocr Rev 2009;30:713–743. 4. West A, Vojta PJ, Welch DR, Weissman BE. Chromosome localization and genomic structure of the KiSS-1 metastasis suppressor gene (KISS1). Genomics 1998;54:145–148. 5. Clements MK, McDonald TP, Wang R, et al. FMRFamide-related neuropeptides are agonists of the orphan G-protein-coupled receptor GPR54. Biochem Biophys Res Commun 2001;284:1189 –1193. 6. Kotani M, Detheux M, Vandenbogaerde A, et al. The metastasis suppressor gene KiSS-1 encodes kisspeptins, the natural ligands of the orphan G protein-coupled receptor GPR54. J Biol Chem 2001; 276:34631–34636. 7. Muir AI, Chamberlain L, Elshourbagy NA, et al. AXOR12, a novel human G protein-coupled receptor, activated by the peptide KiSS-1. J Biol Chem 2001;276:28969 –28975. 8. Ohtaki T, Shintani Y, Honda S, et al. Metastasis suppressor gene KiSS-1 encodes peptide ligand of a G-protein-coupled receptor. Nature 2001;411:613– 617. 9. Lee JH, Welch DR. Suppression of metastasis in human breast carcinoma MDA-MB-435 cells after transfection with the metastasis suppressor gene, KiSS-1. Cancer Res 1997;57:2384 –2387. 10. de Roux N, Genin E, Carel JC, Matsuda F, Chaussain JL, Milgrom E. Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc Natl Acad Sci USA 2003;100:10972–10976. 11. Seminara SB, Messager S, Chatzidaki EE, et al. The GPR54 gene as a regulator of puberty. N Engl J Med 2003;349:1614 –1627. 12. Funes S, Hedrick JA, Vassileva G, et al. The KiSS-1 receptor GPR54 is essential for the development of the murine reproductive system. Biochem Biophys Res Commun 2003;312:1357–1363. 13. Lapatto R, Pallais JC, Zhang D, et al. Kiss1⫺/⫺ mice exhibit more variable hypogonadism than Gpr54⫺/⫺ mice. Endocrinology 2007; 148:4927– 4936. 14. Prentice LM, d’Anglemont de Tassigny X, McKinney S, et al. The testosterone-dependent and independent transcriptional networks in the hypothalamus of Gpr54 and Kiss1 knockout male mice are not fully equivalent. BMC Genomics 2011;12:209. 15. Mead EJ, Maguire JJ, Kuc RE, Davenport AP. Kisspeptins: a multifunctional peptide system with a role in reproduction, cancer and the cardiovascular system. Br J Pharmacol 2007;151:1143–1153. 16. Sawyer I, Smillie SJ, Bodkin JV, et al. The vasoactive potential of kisspeptin-10 in the peripheral vasculature. PLoS One 2011;6: e14671. 17. Arai AC, Orwig N. Factors that regulate KiSS1 gene expression in the hippocampus. Brain Res 2008;1243:10 –18.

3446

Hodne et al


18. Arai AC. The role of kisspeptin and GPR54 in the hippocampus. Peptides 2009;30:16 –25. 19. Fiorini Z, Jasoni CL. A novel developmental role for kisspeptin in the growth of gonadotrophin-releasing hormone neurites to the median eminence in the mouse. J Neuroendocrinol 2010;22:1113–1125. 20. Castaño JP, Martínez-Fuentes AJ, Gutiérrez-Pascual E, Vaudry H, Tena-Sempere M, Malagón MM. Intracellular signaling pathways activated by kisspeptins through GPR54: Do multiple signals underlie function diversity? Peptides 2009;30:10 –15. 21. Kanda S, Oka Y. Evolutionary insights into the steroid sensitive kiss1 and kiss2 neurons in the vertebrate brain. Front Endocrinol (Lausanne) 2012;3:28. 22. Weltzien FA, Andersson E, Andersen Ø, Shalchian-Tabrizi K, Norberg B. The brain-pituitary-gonad axis in male teleosts, with special emphasis on flatfish (Pleuronectiformes). Comp Biochem Physiol A Mol Integr Physiol 2004;137:447– 477. 23. Biran J, Ben-Dor S, Levavi-Sivan B. Molecular identification and functional characterization of the kisspeptin/kisspeptin receptor system in lower vertebrates. Biol Reprod 2008;79:776 –786. 24. Li S, Zhang Y, Liu Y, et al. Structural and functional multiplicity of the kisspeptin/GPR54 system in goldfish (Carassius auratus). J Endocrinol 2009;201:407– 418. 25. Shi Y, Zhang Y, Li S, et al. Molecular identification of the Kiss2/ Kiss1ra system and its potential function during 17␣-methyltestosterone-induced sex reversal in the orange-spotted grouper, Epinephelus coioides. Biol Reprod 2010;83:63–74. 26. Kitahashi T, Ogawa S, Parhar IS. 2009. Cloning and expression of kiss2 in the zebrafish and medaka. Endocrinology 150:821– 831. 27. Pasquier J, Lafont AG, Jeng SR, et al. Multiple kisspeptin receptors in early osteichthyans provide new insights into the evolution of this receptor family. PLoS One 2012;7:11. 28. Iwamatsu T. Stages of normal development in the medaka Oryza latipes. Mech Dev 2004;121:605– 618. 29. Hodne K, Haug TM, Weltzien FA. Single-cell qPCR on dispersed primary pituitary cells—an optimized protocol. BMC Mol Biol 2010;11:82. 30. Weltzien FA, Pasqualini C, Vernier P, Dufour S. A quantitative realtime RT-PCR assay for European eel tyrosine hydroxylase. Gen Comp Endocrinol 2005;142:134 –142. 31. Efimov VA, Buryakova AA, Chakhmakhcheva OG. Synthesis of polyacrylamides N-substituted with PNA-like oligonucleotide mimics for molecular diagnostic applications. Nucleic Acids Res 1999; 27:4416 – 4426. 32. Parker LH, Schmidt M, Jin SW, et al. The endothelial-cell-derived secreted factor Egfl7 regulates vascular tube formation. Nature 2004;428:754 –758. 33. Wickstrom E, Urtishak KA, Choob M, et al. Downregulation of gene expression with negatively charged peptide nucleic acids (PNAs) in zebrafish embryos. Methods Cell Biol 2004;77:137–158. 34. Gerety SS, Wilkinson DG. Morpholino artifacts provide pitfalls and reveal a novel role for pro-apoptotic genes in hindbrain boundary development. Dev Biol 2011;350:279 –289. 35. Robu ME, Larson JD, Nasevicius A, et al. p53 activation by knockdown technologies. PLoS Genet 2007;3:e78. 36. Alunni A, Blin M, Deschet K, Bourrat F, Vernier P, Rétaux S. Clon-


37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

50. 51.

52.

ing and developmental expression patterns of Dlx2, Lhx7 and Lhx9 in the medaka fish (Oryza latipes). Mech Dev 2004;121:977–983. Ishikawa Y, Yamamoto N, Yoshimoto M, et al. Developmental origin of diencephalic sensory relay nuclei in teleosts. Brain Behav Evol 2007;69:87–95. Loosli F, Köster RW, Carl M, Krone A, Wittbrodt J. Six3, a medaka homologue of the Drosophila homeobox gene sine oculis is expressed in the anterior embryonic shield and the developing eye. Mech Dev 1998;74:159 –164. Akazome Y, Kanda S, Okubo K, Oka Y. Functional and evolutionary insights into vertebrate kisspeptin systems from studies of fish brain. J Fish Biol 2010;76:161–182. Desroziers E, Droguerre M, Bentsen AH, et al. Embryonic development of kisspeptin neurones in rat. J Neuroendocrinol 2012;24: 1284 –1295. Mohamed JS, Benninghoff AD, Holt GJ, Khan IA. Developmental expression of the G protein-coupled receptor 54 and three GnRH mRNAs in the teleost fish cobia. J Mol Endocrinol 2007;38:235– 244. Constantin S, Caligioni CS, Stojilkovic S, Wray S. Kisspeptin-10 facilitates a plasma membrane-driven calcium oscillator in gonadotropin-releasing hormone-1 neurons. Endocrinology 2009;150: 1400 –1412. Olbrich T, Ziegler E, Türk G, Schubert A, Emons G, Gründker C. Kisspeptin-10 inhibits bone-directed migration of GPR54-positive breast cancer cells: evidence for a dose-window effect. Gynecol Oncol 2010;119:571–578. Navenot JM, Wang Z, Chopin m, Fujii N, Peiper SC. Kisspeptin10-induced signaling of GPR54 negatively regulates chemotactic responses mediated by CXCR4: a potential mechanism for the metastasis suppressor activity of kisspeptins. Cancer Res 2005;65: 10450 –10456. Mizoguchi T, Verkade H, Heath JK, Kuroiwa A, Kikuchi Y. Sdf1/ Cxcr4 signaling controls the dorsal migration of endodermal cells during zebrafish gastrulation. Development 2008;135:2521–2529. Ma Q, Jones D, Borghesani PR, et al. Impaired B-lymphopoiesis, myelopoiesis, and derailed cerebellar neuron migration in CXCR4and SDF-1-deficient mice. Proc Natl Acad Sci USA 1998;95:9448 – 9453. Nagasawa T, Tachibana K, Kishimoto T. A novel CXC chemokine PBSF/SDF-1 and its receptor CXCR4: their functions in development, hematopoiesis and HIV infection. Semin Immunol 1998;10: 179 –185. Lyubimov Y, Engstrom M, Wurster S, et al. Human kisspeptins activate neuropeptide FF2 receptor. Neuroscience 2010;170:117– 122. Oishi S, Misu R, Tomita K, et al. Activation of neuropeptide FF Receptors by kisspeptin receptor ligands. ACS Med Chem Lett 2011;2:53–57. Mayer C, Boehm U. Female reproductive maturation in the absence of kisspeptin/GPR54 signaling. Nat Neurosci 2011;14:704 –710. Mitani Y, Kanda S, Akazome Y, Zempo B, Oka Y. Hypothalamic Kiss1 but not Kiss2 neurons are involved in estrogen feedback in medaka (Oryza latipes). Endocrinology 2010;151:1751–1759. Servili A, Le Page Y, Leprince J, et al. Organization of two independent kisspeptin systems derived from evolutionary-ancient kiss genes in the brain of zebrafish. Endocrinology 2011;152:1527– 1540.