Contrary to cyclosporin A, corticosteroids such as prednisolone and budesonide potently .... phosphate-buffered saline, explants were incubated with 0.5 mg/ml ...
Expression and Release of Tumor Necrosis Factor-Alpha by Explants of Mouse Cornea Maki Sekine-Okano,* Rudolf Lucas^ Duri Rungger,X Toon De Kesel,% Georges E. Grau,^ Peter M. Leuenberger* and Elisabeth Rungger-Brandle*
Purpose. To elucidate a possible target of immunosuppressive agents widely used in the treatment of corneal disorders, the authors determined whether corneal cells are capable of expressing and releasing tumor necrosis factor-alpha (TNFa) on lipopolysaccharide (LPS) stimulation, and they investigated whether TNFa production can be modulated by pharmacologic agents. Methods. Trephined central corneas from C57BL/6 mice were kept in culture for 3 days. Release of TNFa after a 24-hour stimulation with LPS (1 ^g/ml) into the culture medium was determined both by bioassay and by enzyme-linked immunosorbent assay. Expression of TNFa mRNA after 6-hour stimulation was examined by polymerase chain reaction. Immunofluorescent staining on cryostat sections of cultured corneas was performed to localize TNFa in the tissue. Corneal explants were pretreated with immunosuppressive agents (prednisolone, budesonide, cyclosporin A) for 48 hours, followed by 6- or 24-hour stimulation with LPS in the continuous presence of the agents. Results. Lipopolysaccharide stimulated TNFa release into the culture medium. The addition of budesonide (10~7 M) or prednisolone (10~b M) significantly inhibited LPS-induced TNFa release, whereas cyclosporin A (10~7—10~5 M) had no marked effect. Levels of TNFa mRNA in corneal explants increasedfivefoldafter stimulation with LPS. Immunohistochemical staining revealed that TNFa was expressed in the epithelial cells. Budesonide markedly decreased mRNA expression and abolished immunostaining of TNFa stimulated by LPS. Conclusions. TNFa is produced and released by the epithelial cells of mouse central cornea in response to LPS. Contrary to cyclosporin A, corticosteroids such as prednisolone and budesonide potently inhibit TNFa production. Invest Ophthalmol Vis Sci. 1996; 37:13021310.
1 umor necrosis factor-alpha (TNFa), a cytokine that is produced mainly by activated macrophages and T lymphocytes, exists as a membrane-bound form of 26.5 kDa and a secreted trimeric form of 51 kDa. TNFa is known to play a pivotal role in a variety of physiological and pathologic situations, such as normal immune
reaction and acute and chronic inflammatory-immunologic disorders (septic shock, cerebral malaria, allograft rejection, ischemia-perfusion injury, cancer, and cachexia). 1 " 3 It binds with high affinity to two distinct receptors, existing in both membrane-bound and soluble form, found on most somatic cells except erythrocytes, nonactivated T lymphocytes, and plate1 lets. From the* Electron Microscopy Laboratory, Department of Ophthalmology, University Hospital; the ~f Department of Aneslhesiology, Pharmacology, and Surgical Intensive Considering the wide cellular distribution and Care, University Medical Center, Geneva; the ^Department of Animal Biology, pleiotropy of TNFa, it is likely that this cytokine exerts University of Geneva, Chene-Bougeries, Switzerland; and the §Innogenetics N.V., Ziuijnaarde, Belgium. its effect on ocular tissues and intervenes in various Supported by a grant from Sandoz Research Foundation (Basel, Switzerland), and eye disorders. Indeed, TNFa was found to be impliIry grants of the Swiss National Science Foundation 37-37374.93 (DR), 32cated in autoimmune uveitis.4~h Expression of TNFa 28822.90 (CEG), and 31-32047.91 (FJi-B). Submitted for publication August 21, 1995; revised February 19, 1996; accepted mRNA in ocular tissues including the cornea has been February 20, 1996. reported,7""' but detailed studies with respect to prohoprietary interest category: N. Reprint requests: Elisabeth Rungger-Brandle, Laboratoire de Microscopie tein production and release from the normal and inElectronu/ue, Clinir/ue d'Ophlhalmologie, HCUG, 22, rue Aldde-Jentzer, CH-1211 jured cornea have not yet been performed. Gena/e 14, Switzerland.
1302
Investigative Ophthalmology & Visual Science, June 1996, Vol. 37, No. 7 Copyright © Association for Research in Vision and Ophthalmology
TNF a in Cornea The importance of TNFa as a proinflammatory cytokine and immunoregulator prompted us to investigate the possibility that corneal cells produce this cytokine. Putative producers of TNFa in the peripheral cornea are the immunocompetent Langerhans cells. 10 " It is, however, unknown whether the principal cell types constituting the cornea, namely epithelial cells, stromal keratocytes, and endothelial cells, are also capable of TNFa production. To answer this question, we examined the production and release, as well as the mRNA expression, of TNFa in short-term cultured explants of central mouse cornea after stimulation with bacterial lipopolysaccharide (LPS), one of the potent stimuli of this cytokine.' This in vitro assay has the advantage of excluding a possible interaction with infiltrating monocytes after LPS treatment in situ. We show that central corneal explants indeed express and release TNFa. Moreover, we examined the effect of corticosteroids and cyclosporin A. Corticosteroids efficiently inhibit TNFa production in macrophages and monocytes12"14 and, as shown here, have a similar effect in the cornea. Cyclosporin A has no marked effects, although the TNFa promoter carries a cyclosporin A-sensitive element. 13
MATERIALS AND METHODS Explants of Central Mouse Cornea Female C57BL/6 mice (4 to 6 weeks of age), were obtained from a breeding colony at the animal facility of the Medical Faculty of Geneva. They were kept and treated in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and by the Swiss law on animal experimentation. Trephined explants measuring 1.3 mm in diameter were prepared from the central cornea under sterile conditions. The culture medium was a mixture (1:1) of Ham 12 and Dulbecco's modified Eagle's medium containing 10% fetal calf serum, mouse epidermal growth factor (1 ng/ml) (Boehringer Mannheim, Rotkreuz, Switzerland), 200 U/ml penicillin, and 200 //g/ml streptomycin. The explants (5 or 10 explants per well) were rinsed in the medium and placed with the epithelial side up on 10-mm tissue culture inserts (Gibco-BRL, Basel, Switzerland) in 18-mm tissue culture wells. Then, the explants were left for approximately 15 minutes in the culture hood to facilitate attachment before 1 ml of the medium was added. After 2 days (37°C, 5% CO 2 -95% air), the culture medium was replaced by 380 fA of fresh medium with or without 1 fig/ml of LPS derived from Escherichia coli 055:B5 (Difco, Detroit, MI) and incubated for the time specified. The explants were kept at —80°C until determination of mRNA and immunohistochemical
1303 analysis were performed. To measure TNFa release, the culture medium was collected and stored at —20°C. For the experiments with immunosuppressive agents, budesonide (Sigma, Buchs, Switzerland), prednisolone (Sigma), or cyclosporin A (kindly provided by Sandoz, Basel, Switzerland) was continuously present throughout the culture period at the concentrations indicated. Viability of corneal cells was estimated by the 3(4,5-dimethylthiazol-2-yl)-2,5 tetrazolium bromide (MTT) colorimetric assay.16 After washing twice with phosphate-buffered saline, explants were incubated with 0.5 mg/ml MTT for 30 minutes in modified Krebs-Ringer bicarbonate-HEPES buffer (10 raM HEPES, pH 7.4, 0.5 raM NaH 2 PO 4 , 2 mM NaHCO 3 , 140 mM NaCl, 3.6 mM KC1, 0.5 mM MgSCX,, 1.5 mM CaCl-i) containing 0.1% bovine serum albumin and 11.2 mM glucose. Then, cells were solubilized with an extraction solution containing 20% sodium dodecyl sulfate and 50% N,N-dimethylformamide. Optical density was measured at 550 mm with a Labsystems Multiscan MS (BioConcept, Allschwil, Switzerland).
Determination of Tumor Necrosis Factor-Alpha Release by Enzyme-Linked Immunosorbent Assay Immunoreactive mouse TNFa level was quantified in corneal supernatants by enzyme-linked immunosorbent assay (ELISA) using the Innobasics-10 mouse TNFa kit (Innogenetics, Ghent, Belgium). This method is based on a sandwich-type enzyme immunoassay. Mouse TNFa was bound by polyclonal rabbit anti-mouse TNFa antibodies on the microtiter plate. Simultaneously, biotinylated polyclonal rabbit antimouse TNFa antibodies were added. This antibody binds to the mouse TNFa antibody complex present in the microtiter plate. Excess biotinylated antibody was removed by washing, followed by the addition of horseradish peroxidase-conjugated streptavidin. After removal of nonbound horseradish peroxidase-conjugated streptavidin, substrate solution containing tetramethylbenzidine-chromogen was added. The reaction was terminated by the addition of a stop solution (2N H 2 SO 4 ). Colorimetric results were read at 450 nm using a Titertek Multiscan Plus ELISA reader (BioConcept). The detection limit was ^ 1 5 pg/ml.
Determination of Tumor Necrosis Factor-Alpha Release by Bioassay Bioactivity of TNFa released from the cultured corneal explants was determined by an MTT-test using a highly TNFa-sensitive fibrosarcoma cell line, WEHI 164 subclone 13 (kindly provided by Dr. Espevik, Trondheim, Norway).17 The cells (6 X 105 cells/ml) were incubated for 18 hours at 37°C with the samples or with mouse TNFa standards in the presence of 1
1304
Investigative Ophthalmology & Visual Science, June 1996, Vol. 37, No. 7
/zg/ml of the transcriptional inhibitor actinomycin D (Sigma). After the addition of 50 //I/well of MTT solution (5 mg/ml MTT in 0.9% NaCl), the cells were incubated for another 4 hours. The supernatant was decanted, and the cells were lysed and dissolved in isopropanol-HCl. Optical density values were measured at 570 nm in an ELISA reader. The detection limit was ^ 1 pg/ml. Tumor Necrosis Factor-Alpha Release From Macrophages Peritoneal macrophages were obtained from thioglycollate-activated female C57BL/6 mice as previously reported. 18 After 3 days, peritoneal exudate cells were collected by lavage with Dulbecco's modified Eagle's medium, and nonadherent cells were removed after 4 hours in culture plates. Adherent macrophages (106 cells/well) were incubated for 24 hours with LPS (1 //g/ml) in the absence or presence of the immunosuppressive agents as indicated. Supernatants were harvested to determine TNFa levels as described above. Analysis of Tumor Necrosis Factor-Alpha mRNA by Polymerase Chain Reaction Total RNA was extracted from five corneal explants in Trizol reagent according to manufacturer's indications (Life Technologies, Basel, Switzerland). Reverse transcription using random primers was performed on DNase-treated RNA. After RNase treatment, phenol extraction, and precipitation, the resuspended cDNA was quantified by optical density, and all samples were adjusted to 0.2 //g/ml. The primers used for PCR reactions were ATGAGCACAGAAAGCATGATC and TACAGGCTTGTCACTCGAATT, yielding a TNFa fragment of 276 bp. As internal standards, we used /?-actin (230 bp) and glyceraldehyde-phosphate dehydrogenase (260 bp). Hybridization temperatures were calculated according to Baldino et al,19 and a temperature of 55°C empirically was found suitable for all reactions. Linearity range of the reaction was determined for each of the three RNAs running 20 to 40 cycles in fivecycle intervals in a PTC-100 programmable thermal controller (MY Research, BioConcept). Amounts of different mRNAs were determined in separate reactions (32 cycles) in a volume of 50 //I containing 5 ^1 of cDNA solution, 0.2 mM NTPs, 0.25 //M of the respective primers, 2 //Ci[a-32P]ATP and 2 U of DynaZyme DNA polymerase in IX reaction buffer (BioConcept) . Polymerase chain reaction of series 3A+B was run in hot start assays (M/?P; Catalys, Wallisellen, Switzerland). The samples were precipitated in the presence of the glycogen carrier and run on 2% agarose gels. Ethidium bromide-stained gels were photographed as an inverted picture on an Appligene Imager (Kontron, Lausanne, Switzerland), and the bands
were cut from the gel and counted in Optiphase HiSafe II scintillator (MBV, Vevey, Switzerland). Immunohistochemistry Cultured central corneas were embedded in TissueTek OCT Compound (Bayer, Zurich, Switzerland) and frozen immediately in melting isopentane. Cryostat sections cut at 7 fig were mounted on glass slides coated with poly-L-lysine. The sections were then preincubated in Tris-buffered saline (30 mM Tris-HCl, pH 8, 150 mM NaCl) containing 3% bovine serum albumin and 0.1% saponin (blocking buffer) for 30 minutes, and sequentially incubated with a rat monoclonal anti-mouse TNFa immunoglobulin (Ig) M antibody (concentration, 6.6 //g/ml) 2 0 in blocking buffer at 4°C overnight and with goat anti-rat IgG-IgM coupled to form red (dilution 1:400; Jackson Immunoresearch/Milan Analytica, La Roche, Switzerland) in Tris-buffered saline containing 0.1% saponin for 30 minutes at room temperature. After each incubation with the antibody, three washes were made with Trisbuffered saline, one of which was performed in the presence of 0.5 M NaCl. The sections were mounted in Mowiol 4-88 (Pluss-Staufer AG, Oftringen, Switzerland) and were viewed and photographed with a Zeiss Axiophot fluorescence microscope. The following controls were performed: Primary anti-TNFa antibody was omitted, rat anti-mouse interleukin (IL)-la IgM (nonneutralizing) antibody (Innogenetics) was used as irrelevant primary antibody of the same Ig class. Under conditions identical to those used to visualize TNFa, no immunostaining for IL-la could be detected. This antibody has a detection limit of 1 ng in Western blot analysis and ELISA, and, thus, we could not exclude minor production of IL-la, as evidenced by other methods and following Herpes simplex virus type-1 infection.21'22 Epithelial cells were identified with anti-cytokeratin 14 monoclonal antibody (mAb) LL002,23 T lymphocytes with anti-Thy-1.2 mAb (30-H12),24 B lymphocytes with anti-mouse fxm chain mAb (LO-MM-9),25 Langerhans cells with antiI-Ab mAb (25-9-17S),26 and macrophages with antiMac-1 mAb.27 In addition, anti-dinitrophenyl mAb (IgG 3 ) 28 was used as a control for LL002. These antibodies were kindly provided by Dr. S. Izui (Geneva, Switzerland) except LL002, which was a gift from Dr. E. B. Lane (Dundee, UK). Statistical Analysis Results are presented as mean ± SEM for the number of preparations. Statistical significance was determined by the unpaired Student's t-test. Differences between experimental and control groups were considered significant at P < 0.05.
TNF a in Cornea
1305
RESULTS Identification of Cell Types in Explants of Central Cornea After 3 days of culture, explants of trephined central cornea showed complete closure of the wounded edge and epithelialization of the endothelial side. Epithelial cells were identified by mAb LL002 recognizing cytokeratin 14 (Fig. 1). Specificity of this antibody was confirmed using anti-dinitrophenyl mAb of the same isotype (IgG3) as control (Fig. lc). Electron microscopic examination further revealed that the epithelial cells migrated onto Descemet's membrane and eventually supplanted the endothelial cells (not shown). Thus, central corneal explants virtually consisted of only two cell types, namely epithelial cells and keratocytes. The possible presence of T and B lymphocytes, Langerhans cells, and macrophages was examined by immunohistochemical staining for specific cellular markers, because these cells could be a source of TNFa production in cornea. On 20 cryostat sections examined, as few asfiveT lymphocytes or Langerhans cells and no B cells or macrophages were detected (data not shown). Release of Tumor Necrosis Factor-Alpha From Corneal Explants No TNFa release was detected by ELISA from unstimulated corneal explants during a 24-hour incubation (Fig. 2a). However, exogenous LPS markedly stimulated TNFa release up to 120 pg/ml. To examine whether TNFa release by the LPS-stimulated corneal explants was bioactive, a bioassay using TNFa-sensitive WEHI 164 subclone 13 cells was performed on the same samples. Explants stimulated with 1 Mg/ m ' LPS were found to release 20.2 ±1.5 pg/ml TNFa, corresponding to one sixth the total TNFa detected by ELISA (Table 1, Fig. 2a). In the following experiments, the effects of immunosuppressive agents on TNFa release from corneal tissues were tested. Two corticosteroids, budesonide and prednisolone, as well as cyclosporin A, were applied, of which the latter two are widely used for the treatment of various immunologic diseases of the eye. These agents were added at the beginning of the culture, 48 hours before stimulation with LPS. The viability of the corneal cells, as evaluated by the MTT colorimetric assay at the end of the stimulation, was not affected significantly by any of these agents (Table 2). Both budesonide and prednisolone significandy reduced TNFa release from corneas stimulated by LPS by 71% and 41%, respectively (Fig. 2a). By contrast, cyclosporin A did not significantly affect release of TNFa at any of the concentrations tested (Fig. 2a). In macrophages (Fig. 2b), however, cyclosporin A slightly inhibited LPS-stimulated TNFa release, although this
1. Indirect immunofluorescent staining of trephined central mouse cornea, cultured for 3 days in the presence of lipopolysaccharide. (a,b) The monoclonal antibody (mAb) LL002 to cytokeratin 14 identifies epithelial cells (EP) grown around the wound edge and covering part of the endothelial (EN) side (a, bottom). S = stroma. (c) Control staining with anti-DNP mAb of the same isotype as LL002. Bars = 100 FIGURE
inhibition was not dose dependent. Indeed, at 10 r> M, no effect was observed (see ref. 29). Steady State Levels of Tumor Necrosis FactorAlpha mRNA in Corneal Explants To verify whether TNFa expression is regulated on the transcriptional level and whedier budesonide acts
1306
Investigative Ophthalmology 8c Visual Science, June 1996, Vol. 37, No. 7
160
TABLE l.
TNF Release From Corneal Explants Detected by Bioassay
r
140 -
Culture Condition
TNF(pg/ml)*
P Value
="120 S100
No addition LPS alone LPS + Bud (10- 7 M) LPS + PSL (10~6 M) LPS + CsA (10~7 M) LPS + CsA (10" 6 M) LPS + CsA (10~5 M)
-
40 20 -
w <
w < 0)
o
C < (0
00
+ LPS
1000 900 800 1 700
3 600 IS 500
.2 £ 400 u. Z 300
II
200
0
|
^2 ^2 2 2 2
§,2
? o o •?o "9o o ^
^
« O Z
-o _j 3 (0 CQ Q .
w«
T^
W
(A
o u
