Expression of a senescence-associated cysteine protease gene ...

Plant Cell Tiss Organ Cult (2009) 98:281–289 DOI 10.1007/s11240-009-9561-7

ORIGINAL PAPER

Expression of a senescence-associated cysteine protease gene related to peel pitting of navel orange (Citrus sinensis L. Osbeck) Jing Fan Æ Ying-Wu Yang Æ Xue Gao Æ Wei Deng Æ Vasiliki Falara Æ Angelos K. Kanellis Æ Zheng-Guo Li

Received: 15 April 2009 / Accepted: 26 June 2009 / Published online: 9 July 2009 Ó Springer Science+Business Media B.V. 2009

Abstract Previously, a suppression subtractive hybridization library was constructed to identify differentially expressed genes in peel pitting of navel orange fruit and a cDNA fragment sharing high similarities to cysteine protease genes was identified. In this study, we cloned its fulllength cDNA sequence, designated CsCP, using the Rapid amplification of cDNA ends approach. It consists of 1,409 nucleotides and its ORF encodes 361 amino acids predicted to have an N-terminal signal peptide. Phylogenetic analysis revealed that CsCP belonged to the aleurain group in papain family of cysteine proteases. According to quantitative RT-PCR, the expression of CsCP was enhanced during the development of postharvest peel pitting concomitant with senescence, although it was detectable in all tested tissues including root, leaf, flower and peel of fruit. RNA gel blot analysis showed that the CsCP expression was induced by hypoxia (3% O2), but repressed by anoxia (0% O2), wounding, ethylene and high temperature (40°C). Conclusively, the CsCP is a senescence-associated gene and up-regulated during the development of citrus postharvest peel pitting, which provides a basis to understand its role in citrus peel pitting. J. Fan Y.-W. Yang X. Gao W. Deng Z.-G. Li (&) Genetic Engineering Research Center, Bio-Engineering College, Chongqing University, Shapingba Shazheng Street 174#, 400030 Chongqing, China e-mail: [email protected]; [email protected] J. Fan Y.-W. Yang X. Gao W. Deng Z.-G. Li Key Lab of Functional Gene and New Regulation Technologies under Chongqing Municipal Education Commission, 400030 Chongqing, China V. Falara A. K. Kanellis Department of Pharmaceutical Sciences, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece

Keywords Citrus sinensis Osbeck Cysteine protease Expression Peel pitting Abbreviations ORF Open reading frame PI Pitting index PMF Peel of mature and healthy fruit PPF Peel of pitting fruit PYF Peel of young fruit qPCR Quantitative RT-PCR RACE Rapid amplification of cDNA ends RT Reverse transcription SSH Suppression subtractive hybridization

Introduction Cysteine proteases participate in many processes in plants, including degradation of storage proteins, programmed cell death, and turnover of proteins in response to abiotic and biotic stresses (Avrova et al. 1999; Forsthoefel et al. 1998; Palma et al. 2002; Solomon et al. 1999). Stresses such as wounding, low or high temperatures, drought, high salinity and diseases have been shown to alter the expression of cysteine protease genes (Kruger et al. 2001; Linthorst et al. 1993; Schaffer and Fischer 1990; Shin et al. 2001; Ueda et al. 2000). Expression of rice cysteine protease gene, OsEP3A, is regulated by multiple mechanisms: it is hormonally regulated in germinating seeds, spatially and temporarily regulated in vegetative tissues and nitrogen regulated in suspension-cultured cells (Ho et al. 2000). In various senescing plants, a number of cDNA clones encoding cysteine proteases are up-regulated: Arabidopsis

123

282

SAG2 and SAG12, Brassica BnSAG12, Zea mays See1, Lycopersicon esculentum SENU2 and SENU3, Solanum melongena SnCP and Nicotiana tabacum NTCP-23 (Chen et al. 2002). The navel orange (Citrus sinensis L. Osbeck) fruit is prone to develop peel pitting, which affects the quality and decreases the market value of fruits. Many efforts have been made in the past towards factors triggering peel pitting, but little is known about the molecular basis of peel pitting development (Fan et al. 2007). In previous work, we have constructed a suppression subtractive cDNA library to screen differentially expressed genes in citrus peel pitting, in which the pitting peel and nonpitting peel were used as tester and driver, respectively (Gao et al. 2006). By screening this library, we expected to find some genes which might play key roles in the development of peel pitting. Characterization of these genes could provide us some facilitated strategies to reduce the citrus peel pitting by altering their expression levels, e.g. treating with or preventing from specific biotic/abiotic stimulus. The screening of differentially expressed sequences in citrus peel pitting area led to the isolation of a cDNA fragment showing significant similarities to cysteine protease genes from other species. As a first step, in order to clarify the role of citrus cysteine protease in citrus peel pitting, we have isolated its full-length cDNA from navel orange fruit. Furthermore, its expression patterns were examined during the development of peel pitting, in different citrus tissues and in response to various external stimuli related to senescence and citrus peel pitting (Alferez et al. 2003; Lafuente and Sala 2002; Li et al. 2006; Petracek et al. 1998) i.e. wounding, anoxia or hypoxia, high temperature, and exposure to ethylene.

Materials and methods Plant material and treatments ‘Fengjie’ navel orange (Citrus sinensis L. Osbeck) fruits were obtained from local orchards. The mature fruits and young fruits used in this study were 75 ± 5 and 36 ± 3 mm in diameter, respectively. For quantitative RT-PCR analysis, peel of young fruit (PYF), peel of mature and healthy fruit (PMF) and peel of pitting fruit (PPF) were stripped and frozen immediately in liquid nitrogen, and then stored at -80°C. Roots, leaves and flowers were also sampled. For stress treatments, three replicates of five fruits as a set were placed at 20°C (control) and 40°C (high temperature), respectively. Fruits of another set were wounded using a sharp knife and held at 20°C. The fourth set of fruits were dipped in ethrel (600 mg kg-1) and held at

123

Plant Cell Tiss Organ Cult (2009) 98:281–289

20°C. The last two sets of fruits were placed in airtight 30 L barrels and exposed to a constant gas flow of 600 mL min-1 containing 100% N2 and 0% O2 and 97% N2 and 3% O2 at 20°C, respectively. All sets of fruits were held for 0, 6, 12 and 24 h under stresses. Then the peels were stripped from the fruits, cut into small pieces with knife, frozen immediately in liquid nitrogen and stored at -80°C. RNA extraction was performed as described by Griffiths et al. (1999) and used for further RNA gel blot analysis. Measurement of peel pitting index Three replicates of 15 mature and healthy fruits initially placed at 15°C, and 85% relative humidity (RH) were used to measure pitting index (PI) according to Lafuente and Sala (2002). Fruits were inspected and rated on a scale of zero (no pitting) to three (severe), based on extent of browning and injury. PI was calculated using the following P formula: (Pitting scale (0–3) 9 number of fruits within each class)/total number of fruits. The data representing the mean and standard error was determined from triplicate samples at each time point. A P value B 0.05 was considered to be significant. Statistical analysis was performed using SAS 9.1 (SAS institute, Carey, NC, USA). For quantitative RT-PCR analysis, the fruit peels were sampled at 0, 15, 35, 55-day, respectively. Amplification of the full-length CsCP cDNA Total RNA was isolated from peel tissue of navel orange using Trizol reagent (Dingguo, China). mRNA was purified by Quick PrepTM Micro mRNA Purification Kit (Amersham Biosciences, USA). A 279 bp cDNA fragment with significant similarities to cysteine protease genes was isolated from our previously constructed peel pitting subtraction library of navel orange fruit (Gao et al. 2006), in which the pitting peel and non-pitting peel were used as tester and driver, respectively. Rapid amplification of cDNA ends (RACE) was performed to amplify its unknown 50 and 30 ends using the 50 and 30 -Full Race Core Set (TaKaRa, Japan). The 50 end sequence was amplified by primers CsCPRT, CsCPS1, CsCPS2, CsCPA1 and CsCPA2, and the 30 end with the primer CsCPP3 (Table 1). PCR conditions were as following: for 50 RACE, predenaturation at 94°C for 5 min, followed by 35 cycles at 94°C for 40 s, 52°C (for CsCPS1/A1) or 56°C (for CsCPS2/A2) for 40 s and 72°C for 1.5 min, and one cycle of final extension at 72°C for 10 min; for 30 RACE, predenaturation at 94°C for 5 min, followed by 35 cycles at 94°C for 40 s, 50°C for 40 s and 72°C for 1.5 min, and one cycle of final extension at 72°C for 10 min. The PCR


283

Table 1 Primers used in the amplification of the CsCP gene Primer

Primer sequence (50 –30 )

Orientation

CsCPRT

CACTCTTGTAAAATC

Antisense

CsCPS1

TGTGAGTGTGGCATTTGAAG

CsCPS2

GGATTCCGATTTTACAAGAGTG

CsCPA1 CsCPA2 CsCPP3

CACCCAAGGTAATGTTGACTG TGGACGCCAACATTTTCAG ATGCCGTCGTTGCTGTTG

Table 2 Cysteine protease amino acid sequences used in the phylogenetic analysis MEROPS accession

Group name

Source

Sense

MER11062

Aleurain

Arabidopsis thaliana

Sense

MER02243

Aleurain

Lycopersicon esculentum

Antisense

MER12035

Aleurain

Nicotiana tabacum

Antisense

MER00724

Aleurain

Oryza sativa

Sense

MER88853

Aleurain

Triticum aestivum

MER03739

Brassicain


MER00649 MER03238

Brassicain Brassicain

Brassica napus Nicotiana tabacum

MER02265

Brassicain

Phaseolus vulgaris

MER04894

Cathepsin B


MER01385

Cathepsin B

Nicotiana tabacum

MER48533

Cathepsin B

Oryza sativa

MER45657

Cathepsin B

Solanum tuberosum

MER02375

Cathepsin B

Triticum aestivum

MER00647

Papain

Carica papaya

MER05116

Legumain

Mus musculus

products were cloned into pMD18-T vector (TaKaRa, Japan) and sequenced. Sequence analysis Identification of nucleotide sequence was established using the NCBI BLAST program (http://www.ncbi.nlm.nih.gov/ BLAST, Altschul et al. 1997). The bioinformatics tools at the website (http://www.expasy.org) were used to analyze the deduced protein. The mature protein localization site was predicted using PSORT (http://psort.ims.u-tokyo.ac. jp). Structural domains and features were annotated according to the MEROPS database (http://merops.sanger. ac.uk, Rawlings et al. 2006). Sequence alignment was performed using the DNAMAN program version 5.2.2 with default parameters. Phylogenetic analysis Cysteine protease amino acid sequences in peptidase family C1 (papain family) and a legumain cysteine protease amino acid sequence (clan CD) used as an outgroup, were retrieved from MEROPS database, and their accession numbers and sources are listed in Table 2. Using MEGA version 4 (Tamura et al. 2007), the sequences were aligned with default parameters and the unrooted phylogenetic tree was generated. The tree was constructed with the distance matrix using the neighbor-joining method. Poisson correction with the complete deletion of gaps was used to calculate protein distances. Bootstrap values were based on 100 iterations. Quantitative RT-PCR Total RNA was extracted from tested tissues of navel orange using Trizol reagent (Dingguo, China), and then treated with DNase I (TaKaRa, Japan). Reversed transcription (RT) was performed on 1 lg DNase-treated total RNA using M-MLV Reverse Transcriptase (Promega) according to the manufacturer. Quantitative RT-PCR (qPCR) was carried out using iCyclerTM Real Time PCR System (Bio-Rad, USA). The citrus RNA polymerase II

gene (GenBank accession no. EF174422, Liu et al. 2008) was amplified as reference gene in parallel with the target gene allowing gene expression normalization and to provide quantification. Primer sequences were as follows: CRPII-F 50 -TAACAACAAATGCTGATGG-30 and CRPIIR 50 -CGAGATGGAATAGCGTGTG-GAT-30 for reference gene; CsCP-F 50 -TCATCTGAAAATGTTGGCG-30 and CsCP-R 50 -AACAGCAACGACGGCAT-30 for target gene. qPCR was done using the SYBRÒ Premix Ex TaqTM Master mix kit (TaKaRa, Japan) following the manufacture’s recommendations. Reaction mixtures (25 lL) consisted of 2 9 SYBRÒ Premix Ex TaqTM Master mix, 0.5 lM of each primer of CRPII or 0.2 lM of each primer of CsCP, 1 lL template (the equivalent of 50 ng total RNA). qPCR conditions comprised of one cycle at 95°C for 30 s, followed by 42 cycles at 95°C for 10 s, 55°C for 30 s and 72°C for 20 s. For each sample, reactions were set up in triplicate to ensure the reproducibility of the results. At the end of qPCR, melting curves were performed to verify the specificity of amplification products. PCR efficiency of reference and target genes were determined by generating standard curves based on serial dilutions of plasmids containing reference gene and target gene, respectively. The amplification efficiency was automatically calculated using iCyclerTM software version 3.0. The quantification of the relative expression levels was performed using the comparative CT method (Livak and Schmittgen 2001). The relative expression of CsCP gene in each sample was normalized against citrus RNA polymerase II gene

123

284

and calculated according to 2-DDCT, where DDCT = (CT,CsCP - CT,CRP)stressed - (CT,CsCP - CT,CRP)control. The calibrator whose relative expression was arbitrarily set as equal to one was defined as the sample giving the highest DCT(DCT = CT,CsCP - CT,CRP) value which corresponded to the lowest level of expression. The mean and standard error were calculated from the triplicate samples from each time point/tissue. A P value B 0.05 was considered to be significant. Statistical analysis was performed using SAS 9.1 (SAS institute, Carey, NC, USA). RNA gel blot analysis For RNA gel blot analysis, total RNA was extracted from peels of navel orange and then denatured at 65°C and separated on 1% (w/v) formaldehyde denatured agarose gel (10 lg per lane). The RNA was transferred to a HybondN? membrane (Amersham Biosciences, USA) and fixed on the membrane using a UV Crosslinker (Syngene, USA). Blots were prehybridized in Church buffer (Church and Gilbert 1984) (7% SDS, 300 mM sodium phosphate pH 7.4, 1 mM EDTA) at 65°C for at least 1 h. The DNA probe consisting of the 30 -UTR of CsCP was labeled to high specific activity by random priming at 37°C with [32P]-dCTP according to Random Primer Labeling Kit (Invitrogen, USA). The membranes were hybridized as described by Church and Gilbert (1984). After a 20 h hybridization period, the membrane was washed three times with 0.5 9 SSC and 0.1% SDS at 65°C, and exposed to autoradiography film at -80°C.


glycosylation sites were also predicated at amino acid position 128 and 257 of CsCP protein. Conserved domain analysis showed that the N-terminus of CsCP protein contained a Cathepsin propeptide inhibitor domain acting as a propeptide which is classified as I29 by MEROPS peptidase database (http://merops.sanger.ac.uk, Rawlings et al. 2006). I29 is essential not only for preventing unwanted proteolysis before the enzyme reaches its targeted location, but also acts as a chaperone required for correct folding and targeting of the peptidase (Wiederanders 2000). In addition, amino acid residues (144–361) were annotated as peptidase unit, which contained characteristic features of peptidase family C1 such as the catalytic residues (162Q, 168C, 308H and 328N) (Rawlings et al. 2006), and the S2 subsites (212L, 213P, 279A, 306V, 309A and 354C) (Fig. 1). Blast search in MEROPS database revealed that the putative CsCP protein was mostly homologous to aleurain cysteine proteases (subfamily C1A in family C1 in clan CA). Peptidase unit of CsCP (144–361 amino acid residues) was aligned with that of other aleurain proteins retrieved from MEROPS database, including Arabidopsis thaliana MER11062 and MER12044; Brassica napus MER79846; Medicago sativa MER80415; Triticum aestivum MER88853; Oryza sativa MER00724; Zea mays MER01405; Petunia hybrida MER01718; Lycopersicon esculentum MER02243; Nicotiana tabacum MER12035; Brassica oleracea MER19080. As shown in Fig. 2, the peptidase unit of CsCP protein revealed high identities, ranged from 79.8 to 87.2%, with that of other aleurain cysteine proteases, and shared active site residues (Q, C, H and N).

Results and discussion Phylogenetic analysis of putative CsCP protein Cloning and sequence analysis of CsCP Previously, Gao et al. (2006) used navel orange as experimental material to screen differentially expressed genes in citrus peel pitting by SSH, in which the pitting and nonpitting peels were performed as tester and driver, respectively. Based on the 279 bp cysteine protease-like cDNA fragment retrieved as a differential expressed sequence from this SSH cDNA library, the full-length cDNA of this gene was isolated using 50 and 30 RACE and designated as CsCP (GenBank accession no. EF690284). The cDNA of CsCP is 1,409 bp in length with an 1,086 bp open reading frame (ORF) encoding a polypeptide of 361 amino acids. The complete nucleotide sequence and deduced amino acid sequence of CsCP are shown in Fig. 1. Sequence analysis of the deduced protein indicated an N-terminal signal peptide spanning amino acids 1–23, which was predicted to be responsible for the localization of the mature protein in the endoplasmic reticulum. Two potential

123

To confirm the phylogenetic relationship between the CsCP protein and other cysteine proteases in peptidase family C1 (papain family), a comparison was made between CsCP and other cysteine proteases in peptidase family C1 (papain family), as well as a legumain cysteine protease (clan CD) that served as an outgroup. Here, overall amino acid sequences were used for phylogenetic analysis. For simplicity and facility to comparison, only major groups were shown in Fig. 3. Apparently, CsCP was classed into the aleurain group of the papain family, which indicated its similar function. Expression of CsCP gene during the development of peel pitting and in different tissues Quantitative RT-PCR was performed to determine the expression pattern of CsCP gene during the development of peel pitting. Citrus RNA polymerase II gene was used as


285

Fig. 1 Nucleotide and deduced protein sequence of CsCP. The predicted hydrophobic N-terminal signal peptide is underlined. The propeptide inhibitor domain I29 and putative glycosylation sites are highlighted. The catalytic amino acid residues are marked with pentacles. Diamonds indicate the S2 subsites

the reference gene. The absence of non-specific PCR products and primer dimers were checked by melting curves which showed a single peak for both target and reference gene-specific primer pairs (data not shown). Before using the comparative CT method (Livak and Schmittgen 2001), we verified that PCR efficiency of target and reference gene was approximately equal. The range of expression level of CsCP during the development of navel orange’s peel pitting was showed in Fig. 4. To calculate the relative expression of CsCP, the sample at 0-day of storage with the lowest expression level

was taken as calibrator and its relative expression was set as equal to one. During the storage time, the peel pitting index increased significantly. Meanwhile, the expression of CsCP was enhanced. About twofold increase of CsCP transcript level was observed at 35-day of storage, and was followed by a slightly lower expression at 55-day of storage. Tissue-specific expression of CsCP was also performed by quantitative RT-PCR. As shown in Fig. 5, the relative expression of CsCP in root that showed the lowest expression level was set as equal to one. CsCP transcripts

123

286


Fig. 2 Sequence alignment of putative peptidase unit of CsCP with that of other aleurain cysteine proteases retrieved from MEROPS database, including Arabidopsis thaliana MER11062 and MER12044; Brassica napus MER79846; Medicago sativa MER80415; Triticum aestivum MER88853; Oryza sativa MER00724; Zea mays MER01405; Petunia hybrida MER01718; Lycopersicon esculentum MER02243; Nicotiana tabacum MER12035; Brassica oleracea MER19080. The identical amino acid residues are highlighted in black. The active site residues are marked with triangles

were detected in all tested tissues and showed the highest level in peel of pitting fruit. The relative expression of CsCP was higher in peel of mature fruit than that of young fruit. Results of Li et al. (2000) demonstrated that expression of See1 in Lolium multiflorum, which was highly homologous to barley aleurain, was strongly enhanced during leaf senescence and reduced by cytokinin which delayed senescence. In addition, an aleurain-like protein, BoCP5, was up-regulated during harvest-induced senescence in broccoli floret and leaf tissue, and its expression was reduced under senescence-delaying treatments (Eason et al. 2005). Anth17, an Anthurium cysteine protease gene, was significantly induced during senescence of mature leaves (Hayden and Christopher 2004). The primary role of cysteine proteases in plant senescence is thought to be in the turnover and remobilization of cellular materials out of dying cells into other actively growing tissues. In this

123

work, quantitative RT-PCR showed that the CsCP mRNA accumulated with the development of peel pitting during fruit storage (Fig. 4). It is likely that CsCP is involved in the remobilization and turnover of proteins in pitting peel. In addition, the expression level of CsCP in peel of mature/ pitting fruit was higher than that of green fruit (Fig. 5). Thus, CsCP in addition to its peel pitting-associated function was also developmentally regulated and for that it can be related to senescence associated phenomena. Expression of CsCP gene response to abiotic stresses and ethylene by RNA gel blot analysis RNA gel blot analysis was performed to elucidate the expression patterns of CsCP gene under postharvest stresses such as wounding, anoxia/hypoxia (0% O2, 3% O2), high temperature (40°C), and exposure to plant hormone ethylene (Fig. 6). The results showed that CsCP


287

Fig. 3 Phylogenetic relationship between CsCP protein and other cysteine proteases in the papain family according to MEROPS (http:// merops.sanger.ac.uk, Rawlings et al. 2006). Mus musculus legumain (MER05116) was included as an outgroup. This tree was setup with the distance matrix using the neighbor-joining method. Poisson correction with the complete deletion of gaps was used to calculate protein distances. Bootstrap values were based on 100 iterations. Numbers at the nodes indicate the bootstrap values over 75. The CsCP protein is boxed

expression was strongly and transiently induced by hypoxia (3% O2). However, the level of CsCP expression was down-regulated by wounding, anoxia (0% O2), high temperature (40°C) and ethylene. More specifically, wounding temporarily decreased the transcript level of CsCP, and then returned it to normal level at 24 h compared to the control. High temperature (40°C) did not reduce CsCP expression level until 24 h after treatment. Additionally, expression of CsCP was rapidly and strongly reduced at the early stage of exposure to ethylene. Petracek et al. (1998) have reported that pitting of grapefruit increased with applied waxes and decreasing internal O2 level. It is estimated that low O2 may stimulate anaerobic respiration. Compounds produced by anaerobiosis such as alcohols and aldehydes may then stimulate pitting (Petracek et al. 1998). In previous work, wax application could significantly increase navel orange postharvest peel pitting due to the decreasing of internal O2 level (Li et al. 2006). In this study, the CsCP expression was rapidly and strongly enhanced by hypoxia (3% O2) (Fig. 6), which suggests its role at early stage of peel pitting induced by low O2. It is likely that the hypoxia stress results in increasing of alcohols and aldehydes which take toxic actions to plant cells; in response to it, CsCP might be soon up-regulated in order to remobilize the cellular materials out of the damaged cells. Plant cysteine protease could be induced by wounding such as Nicotiana tabacum NTCYP-7 and NTCYP-8, whereas NTCP-23 was found to be the first cysteine protease repressed by wounding (Ueda et al. 2000). Together with CsCP in this study whose transcript level was also

Fig. 4 Quantitative RT-PCR analysis of CsCP and the pitting index during the storage of navel orange fruits. HThe calibrator whose relative expression was arbitrarily set as equal to one was defined as the sample giving the highest DCT value which corresponded to the lowest level of expression. The quantification of the relative expression levels was performed using the comparative CT method. Different letter above the column indicated the significant difference (P \ 0.05)

reduced by wounding, it suggests that a group of wounding-repressed cysteine protease genes may exist in plant. In addition, the repression of transcription by ethylene, anoxia and high temperature suggests that the expression of CsCP mRNA could be suppressed by several external stimuli. Since ethylene treatment could reduce the peel pitting of orange fruit (Lafuente and Sala 2002; Cajuste and Lafuente 2007), the down-regulation of CsCP by ethylene might contribute to the suppression of peel pitting. In conclusion, this work reported the cloning of a cysteine protease gene CsCP from navel orange and showed that it was associated with senescence and correlated to citrus peel pitting, which gives us basic information to understand its role in the development of this physiological

123

288


References

Fig. 5 Quantitative RT-PCR analysis of CsCP in different tissues of navel orange. R root; L leaf; F flower; PYF peel of young fruit; PMF peel of mature and healthy fruit; PPF peel of pitting fruit. HThe calibrator whose relative expression was arbitrarily set as equal to one was defined as the sample giving the highest DCT value which corresponded to the lowest level of expression. The quantification of the relative expression levels was performed using the comparative CT method. Different letter above the column indicated the significant difference (P \ 0.05)

Fig. 6 RNA gel blot analysis of CsCP in response to wounding, 0% O2, 3% O2, exposure to ethylene and 40°C at 0, 6, 12 and 24 h. 10 lg of total RNA was loaded. Equal loading, integrity, and transfer were observed by methylene blue staining of ribosomal RNA

disorder. However, the cause-result relationship between CsCP and peel pitting is yet to be further verified. Moreover, the interaction between different peel pitting-related genes would be an interesting aspect in elucidating the molecular mechanism of citrus peel pitting. Acknowledgments We thank Dr. John Yang and Dr. Chunxian Chen for critically reading this manuscript. This work was supported by grants (No30371006; No30471214) from National Nature Science Foundation of China, and from Committee of Science and Technology of China (No2006BAD22B01) and Chongqing (CSTC, 2007AA1018), Chinese-Greek Cooperative Program (2003-63).

123

Alferez F, Agusti M, Zacaras L (2003) Postharvest rind staining in Navel oranges is aggravated by changes in storage relative humidity: effect on respiration, ethylene production and water potential. Postharvest Biol Technol 28:143–152 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402 Avrova AO, Stewart HE, De Jong WD, Heilbronn J, Lyon GD, Birch PR (1999) A cysteine protease gene is expressed early in resistant potato interactions with Phytophthora infestans. Mol Plant Microbe Interact 12:1114–1119 Cajuste JF, Lafuente MT (2007) Ethylene-induced tolerance to nonchilling peel pitting as related to phenolic metabolism and lignin content in ‘Navelate’ fruit. Postharvest Biol Technol 45: 193–203 Chen GH, Huang LT, Yap MN, Lee RH, Huang YJ, Cheng MC, Chen SC (2002) Molecular characterization of a senescence-associated gene encoding cysteine proteinase and its gene expression during leaf senescence in sweet potato. Plant Cell Physiol 43:984–991 Church GM, Gilbert W (1984) Genomic sequencing. Proc Natl Acad Sci USA 81:1991–1995 Eason JR, Ryan DJ, Watson LM, Hedderley D, Christey MC, Braun RH, Coupe SA (2005) Suppression of the cysteine protease, aleurain, delays floret senescence in Brassica oleracea. Plant Mol Biol 57:645–657 Fan J, Gao X, Yang YW, Deng W, Li ZG (2007) Molecular cloning and characterization of a NAC-like gene in ‘‘Navel’’ orange fruit response to postharvest stresses. Plant Mol Biol Rep 25:145–153 Forsthoefel NR, Cushman MAF, Ostrem JA, Cushman JC (1998) Induction of a cysteine protease cDNA from Mesembryanthemum crystallinum leaves by environmental stress and plant growth regulators. Plant Sci 136:195–206 Gao X, Li ZG, Fan J, Yang YW (2006) Screening and expression of differentially expressed genes for peel pitting of citrus fruit. Acta Hortic 712:473–479 Griffiths A, Barry C, Alpuche-Solis AG, Grierson D (1999) Ethylene and developmental signals regulate expression of lipoxygenase genes during tomato fruit ripening. J Exp Bot 50:793–798 Hayden DM, Christopher DA (2004) Characterization of senescenceassociated gene expression and senescence-dependent and -independent cysteine proteases differing in microsomal processing in Anthurium. Plant Sci 166:779–790 Ho SL, Tong WF, Yu SM (2000) Multiple mode regulation of a cysteine proteinase gene expression in rice. Plant Physiol 122: 57–66 Kruger J, Thomas CM, Golstein C, Dixon MS, Smoker M, Tang S, Mulder L, Jones JD (2001) A tomato cysteine protease required for cf-2-dependent disease resistance and suppression of autonecrosis. Science 296:744–747 Lafuente MT, Sala JM (2002) Abscisic acid levels and the influence of ethylene, humidity and storage temperature on the incidence of postharvest rindstaning of ‘Navelina’ orange (Citrus sinensis L. Osbeck) fruit. Postharvest Biol Technol 25:49–57 Li Q, Bettany AJ, Donnison I, Griffiths CM, Thomas H, Scott IM (2000) Characterisation of a cysteine protease cDNA from Lolium multiflorum leaves and its expression during senescence and cytokinin treatment. Biochim Biophys Acta 1492:233–236 Li ZG, Gao X, Fan J, Yang YW, Li DG, Kanellis AK (2006) The relationship between activity and gene expression of phenylalanine ammonia-lyase and peel pitting in ‘Fengjie’ navel orange fruits. J Plant Physiol Mol Biol 32:381–386 (in Chinese)

Plant Cell Tiss Organ Cult (2009) 98:281–289 Linthorst HJ, van der Does C, Brederode FT, Bol JF (1993) Circadian expression and induction by wounding of tobacco genes for cysteine proteinase. Plant Mol Biol 21:685–694 Liu HG, Wang ZK, Cao YQ, Xia YX, Ying YP (2008) Detection of Citrus tristeza virus using conventional and fluorescence quantitative RT-PCR assays. Acta Phytopathol Sin 38:24–30 (in Chinese) Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402–408 Palma MJ, Sandalio ML, Javier CF, Romero-Puertas CM, McCathy I, del Rio AL (2002) Plant proteases, protein degradation, and oxidative stress: role of peroxisomes. Plant Physiol Biochem 40:521–530 Petracek PD, Dou H, Pao S (1998) The influence of applied waxes on postharvest physiological behaviour and pitting of grapefruit. Postharvest Biol Technol 14:99–106 Rawlings ND, Morton FR, Barrett AJ (2006) MEROPS: the peptidase database. Nucleic Acids Res 34:D270–D272

289 Schaffer MA, Fischer RL (1990) Transcriptional activation by heat and cold of a thiol protease gene in tomato. Plant Physiol 93:1486–1491 Shin R, Lee GJ, Park CJ, You JS, Nam YW, Paek KH (2001) Isolation of pepper mRNAs differentially expressed during the hypersensitive response to tobacco mosaic virus and characterization of a proteinase inhibitor gene. Plant Sci 161:727–737 Solomon M, Belenghi B, Delledonne M, Menachem E, Levine A (1999) The involvement of cysteine proteases and protease inhibitor genes in the regulation of programmed cell death in plants. Plant Cell 11:431–444 Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596–1599 Ueda T, Seo S, Ohashi Y, Hashimoto J (2000) Circadian and senescence-enhanced expression of a tobacco cysteine protease gene. Plant Mol Biol 44:649–657 Wiederanders B (2000) The function of propeptide domains of cysteine proteinases. Adv Exp Med Biol 477:261–270

123