Expression of Connexin 43 Gap Junction Messenger Ribonucleic Acid

BIOLOGY OF REPRODUCTION 50, 336-348 (1994)

Expression of Connexin 43 Gap Junction Messenger Ribonucleic Acid and Protein during Follicular Atresia JANE F. WIESEN' and A. REES MIDGLEY, JR Reproductive Sciences Program, National Centerfor Infertility Research at Michigan, and Cellular and Molecular Biology Program, University of Michigan, Ann Arbor, Michigan 48109 ABSTRACT The process of atresia is an all-or-none phenomenon in that an entire follicle either undergoes atresia or continues along the developmental pathway. The absence of pockets of atresia adjacent to healthy areas of granulosa cells suggests the existence of a coordinating influence within the entire follicular unit during the process of atresia. Gap junctions interconnect the granulosa cells and the oocyte in the ovarian follicle, forming a metabolic syncytium. Intercellular communication provided via the gap junctions may play a role in coordinating the process of atresia. This study addresses the potential hormonal regulation of the gap junction gene during the process of atresia. Immature female rats were given an estradiol (E,) implant to induce follicular development, and after 48 h the E, was withdrawn to induce atresia. The ovary is an extremely heterogeneous tissue with multiple cell types and many follicles at different stages of development. Therefore, in situ hybridization and immunocytochemistry were ideal techniques to localize gap junction gene expression precisely to specific cells in the ovary. Observations resulting from these studies revealed that while the granulosa cells of healthy, developing, pre-antral and antral follicles expressed large amounts of connexin 43 (cx43) gap junction mRNA and protein, this expression was greatly reduced in atretic follicles. In the follicles undergoing atresia, the levels of cx43 gap junction mRNA and protein were reduced as early as 6 h after the withdrawal of E,. The levels of cx43 mRNA and protein continued to decrease as atresia progressed, and at 11 h after withdrawal of E, very little cx43 mRNA or protein was seen. These results indicate that gap junction mRNA and protein are decreased in association with atresia and support the hypothesis that a loss of gap junctional communication plays a coordinating role in the process of atresia.

INTRODUCTION In the ovarian follicle, intercellular communication occurs via aggregates of transmembrane channels known as gap junctions. Each gap junction channel is composed of six identical subunits, or connexins, which are arranged to form a central pore. Molecules of less than 1000 daltons in size can pass from the cytoplasm of one cell through this hydrophilic pore to the neighboring cell [1, 2]. To date, the only type of gap junction known to be expressed in the ovary is connexin 43 (cx43) or oa [3, 4]. Vast numbers of gap junctions interconnect the mural and cumulus granulosa cells to the oocyte [5-8]. Within the ovarian follicle, intercellular communication via gap junctional channels may play a coordinating role in determining whether a given follicle continues its growth and development or becomes atretic. Intrafollicular gap junctions probably serve several important functions. One crucial role is to permit the transfer of metabolites such as nucleotides, amino acids, and sugars from the granulosa cells to the oocyte as needed for growth and development [9, 10]. This provision of nutrients is necessary for oocyte growth and development. Intercellular communication via gap junctions may also be very imporAccepted September 21, 1993. Received January 25, 1993. 'Correspondence and current address: Dr. Jane F. Wiesen, Reproductive Endocrinology Center, Department of Obstetrics, Gynecology, and Reproductive Sciences, University of California San Francisco, San Francisco, CA 94143-0556. FAX: (415) 753-3271.

tant in signal transduction. Second messengers such as cAMP and Ca2+ can pass through the gap junction channel to neighboring cells, thereby propagating signals induced by hormonal stimulation [11, 12]. This propagation of second messengers may be an important mechanism whereby the follicle can coordinate its responses to hormonal stimuli. For example, the cAMP produced in response to FSH can be transferred throughout the entire follicle via gap junctions [13]. Therefore, intercellular communication via gap junctions may be an important mechanism whereby the whole follicle can act as a synchronized, coordinated unit. The process of atresia is an all-or-none phenomenon in that an entire follicle undergoes atresia, or continues along the developmental pathway. One does not see pockets of atresia adjacent to healthy areas of granulosa cells, and this suggests the existence of a coordinating influence within the entire follicular unit during the process of atresia. The early work of Hay et al. suggests a loss of gap junctions in atretic follicles of sheep [14]. Our objective was to examine the early time points during the process of atresia to determine whether changes in the expression of gap junctions are correlated with atresia. Use of an immature rat model in which estradiol (E2) was administered to induce follicular development, or withdrawn to induce atresia, permitted examination of gap junction gene expression during the process of atresia. Since the ovary is a very heterogeneous tissue with numerous follicles at various stages of development, in situ hybridization and immunocytochemistry were used to localize the expression of cx43 gap junction mRNA and protein precisely to specific cells in the 336

EXPRESSION OF GAP JUNCTIONS DURING FOLLICULAR ATRESIA

337

FIG. 1. a) A dark-field photomicrograph demonstrating expression of cx43 mRNA in the granulosa cells of ovarian follicles after 48 h of E2treatment. b) Ovarian cx43 mRNA expression in an immature rat. Scale bar: 250 tim.

338

WIESEN AND MIDGLEY

FIG. 2. Conexin 43 mRNA was expressed in granulosa cells (G) but not in theca cells (T) as seen in these a) dark-field and b) bright-field photomi crographs. Scale bar: 25 irm.


339

FIG. 3. a) Conexin 43 mRNA was expressed in the granulosa cells of follicles after 48 h of E2 treatment. b) This adjacent section demonstrates that negligible amounts of cx32 mRNA were seen in follicles after 48 h of E2 treatment. Scale bar: 25 Im.

340

WIESEN AND MIDGLEY

FIG. 4. Conexin 43 mRNA continued to be expressed in the granulosa cells at 2 h after E2 withdrawal. Scale bar: 250 rm.

ovary. Therefore, the study reported here addresses the potential hormonal regulation of gap junction gene expression during the process of atresia. MATERIALS AND METHODS Animals and Tissues Animals were kept on a 14L:10D cycle, with food and water provided ad libitum. Immature (23-day-old) female rats each received a 3-cm E2 capsule to induce follicular development by stimulating proliferation of granulosa cells and preventing atresia [15]. Although the increment in concentrations of estradiol achieved by this treatment was not determined, Legan et al. [16] reported concentrations of approximately 100 pg/ml with single, 1-cm implants in adult, ovariectomized rats weighing 250-300 g. Since the immature rats in our experiments weighed five times less, and the implants were three times longer, the concentrations of estradiol achieved were much higher, presumably greater than 1 ng/ml. This higher concentration was necessary to deliver to the ovary concentrations of estradiol that more closely approached intrafollicular concentrations and followed the exact procedure used previously to achieve maximal numbers of viable granulosa cells that could respond

in vitro to FSH by the induction of LH receptor [15]. After 48 h of E2 treatment, the capsules were removed (t = 0). Ovaries were removed at 0, 2, 6, and 11 h. Control groups received continued or no hormone treatment throughout the experimental period. Upon removal from the animal, one ovary was immediately frozen in O.C.T. embedding compound (Miles Labs., Naperville, IL) and stored at -80°C for use in the in situ hybridization and immunocytochemical studies. For histological analysis of the incidence of follicular atresia, the contralateral ovary was fixed for 24 h in 2.5% glutaraldehyde:2% formaldehyde immediately upon removal. The tissues were dehydrated and embedded in glycol methacrylate. Sections 3 ,um in thickness were stained with hematoxylin and eosin. Atretic follicles were identified by the presence of pyknotic nuclei, "beading" of the granulosa cells along the basement membrane, pockets of necrosis, and the presence of cellular debris in the lumen. In Situ Hybridization Cryosections of 8 jzm were mounted on acid-washed slides coated with 2% 3-amino-triethoxysilane (Sigma Chemical Co., St. Louis, MO) and stored at -80°C until use. Tissue sections were fixed in 4% (w/v) paraformaldehyde (J.T. Baker, Phillipsburg, NJ) for 1 h rinsed with PBS (0.2

EXPRESSION O F GAP JUNCTIONS DURING FOLLICULAR ATRESIA

FIG. 5. a) The healthy (H) follicles expressed cx43 mRNA, while follicles that were starting to undergo atresia (A) showed remarkably lower levels of cx43 expression at 6 h after E, withdrawal. Scale bar: 250 pm. b) The same healthy (H) and an atretic (A) follicles from Figure 5a at higher magnification. Scale bar: 25 pm. The atretic follicle clearly shows a reduced amount of cx43 mRNA as compared to the healthy follicle.

342

WIESEN AND MIDGLEY

FIG. 6. At 11 h after E2 withdrawal, the atretic follicles (A) show diminished expression of cx43 mRNA. Scale bar: 250 m.

M potassium), and then digested with Proteinase K (1 ,Rg/ ml; Boehringer-Mannheim, Indianapolis, IN) at 37°C for 10 min. Control slides were treated with RNAse A (200 pLg/ml, Boehringer-Mannheim) for 30 min at 37 0C. Sections were treated with acetic anhydride (Sigma, 0.25% in 0.1 M triethanolamine) for 10 min and then dehydrated through an ethanol series. Oligonucleotide probes (cx43: GCTTGGGGTGATGAACAGTCTGCCTTTCGCTGTAACACT; cx32: CCAGTGCCAGGACTGCGGCGCAGTATGTCTITCAGAGAGC) were 3' end-labeled with 35S-dATP by use of terminal deoxynucleotidyl transferase (Boehringer-Mannheim). Specificity of the oligonucleotide probes was verified by Northern analysis. The oligonucleotide probes recognized the mRNA of the expected size when hybridized to total heart, liver, and ovarian RNA under stringent conditions (data not shown). The labeled probe was added to the tissue sections at a concentration of 1 x 106 cpm/30 izl hybridization buffer (50% formamide, 10% dextran sulfate, 3-strength SSC [single-strength SSC = 0.15 M NaCI, 0.015 M Na Citrate], 50 mM Na phosphate, single-strength Denhardt's solution, and 0.1 mg/ml yeast tRNA). Coverslips were applied to each slide and surrounded with rubber cement. The slides were then placed in a sealed, moist chamber and incubated overnight at 42°C. Rubber cement and coverslips were discarded, slides were washed in double-strength SSC

and single-strength SSC for 10 min each at room temperature, and then washed in 0.5-strength SSC at 42 ° for 1 h, with a final rinse in 0.5-strength SSC for 5 min at room temperature. The slides were dehydrated through a graded series of ethanol, air-dried, and stored in a desiccator. Slides were dipped into Kodak NTB-2 photographic emulsion (diluted 1:1 with water) at 41°C, set vertically to dry, and then placed into light-tight boxes with desiccant and stored at 4°C for 7-10 days of exposure. Slides were developed in Kodak D-19 for 4.5 min, fixed for 7 min in Kodak fixer, stained with hematoxylin and eosin, and sealed with a coverslip. Photography was done by means of a dark-field condenser on a Leitz microscope (kindly provided by Dr. Kent Christensen), or on an M420 Wild Makroscope (courtesy of Dr. Stanley Watson) using Kodak T-Max 100 film. Immunocytochemisty In order to localize the gap junctional protein(s), 8-R1m cryosections of ovary, heart, or liver were incubated with 3% BSA, 3% normal goat serum (Vector Laboratories, Burlingame, CA) in PBS (10 mM Na phosphate, pH 7.5, 0.9% NaCl) for 1 h at room temperature to reduce nonspecific binding. After rinsing in PBS, the slides were dried and then incubated overnight at 4°C in a light-tight humidified box with either preimmune rabbit IgG (7.5 jIg/ml) or the an-


343

FIG. 7. This dark-field photomicrograph demonstrates cx43 mRNA expression when the animal was maintained with E2 for the entire experimental period (60 h). The majority of follicles were healthy (H) and continued to express cx43 mRNA; however, some of the large preovulatory follicles that were not able to ovulate underwent atresia (A) and exhibit low levels of cx43 mRNA expression. Scale bar: 250 pim.

tibodies (7.5 [itg/ml) specific for the a, gap junctional protein (cx43),and the P, protein (cx32) [4]. (The and P, antibodies and preimmune serum were kindly provided by Dr. N.B. Gilula of The Research Institute of Scripps Clinic, La Jolla, CA). The sections were washed in PBS three times for 15 min each and then incubated with an fluorescein isothiocyanate (FITC)-conjugated F(ab')2 goat anti-rabbit IgG (Cappel Laboratories, West Chester, PA) diluted 1:100 in PBS for 1 h at room temperature in light-tight humidified boxes. The slides were washed in PBS; then coverslips were mounted by use of 0.1% N, N, N', N',-tetramethyl-p-phenylenediamine, 90% glycerol in PBS. Photographs were taken on a Leitz UV microscope with Kodak T-MAX 400 film.

bridization, or hybridized with a heterologous probe (cx32) showed no specific localization to any cells (Fig. 3b). Two hours after withdrawal of E2, the follicles continued to express high levels of cx43 gap junction mRNA (Fig. 4). However, as early as 6 h after removal of E2, several follicles that were in the process of undergoing atresia displayed reduced amounts of cx43 mRNA (Fig. 5). A greater proportion of follicles were atretic by 11 h after E2 withdrawal and exhibited markedly lower levels of cx43 mRNA (Fig. 6). In contrast, ovaries maintained with E2 throughout the experimental period continued to express high levels of cx43 gap junction mRNA in the numerous healthy, developing follicles (Fig. 7).

RESULTS

Immunocytochemistry The pattern of protein expression mirrored the pattern of mRNA expression. The granulosa cells of the healthy, developing follicles possessed high levels of the cx43 (a1 ) gap junction protein (Fig. 8a) and negligible amounts of the cx32 (P1) gap junction protein (Fig. 8b). Additionally, the preimmune serum exhibited no specific immunofluorescence in any cell type (Fig. 8c). The theca cells exhibited negligible levels of cx43 (a1 ) gap junction protein and were clearly

In Situ Hybridization After E2 treatment, cx43 gap junction mRNA was abundant in the granulosa cells of healthy, developing pre-antral and antral follicles (Fig. 1). The theca cells expressed very little cx43 mRNA (Fig. 2), whereas the cx43 gap junction mRNA was very abundant in the granulosa cells (Figs. 2 and 3a). Negative control slides treated with RNAse before hy-

344

WIESEN AND MIDGLEY


345

FIG. 8. Left and above: a) Conexin 43 (a,) gap junction protein is seen in the granulosa cells by FITC fluorescence after 48 h of E2 treatment, while in (b) only negligible levels of cx32 (1) gap junction protein are seen in any follicle. Likewise, sections treated with preimmune serum (c) exhibited negligible levels of fluorescence. Scale bar: 25 Lm.

seen as a dark band of cells surrounding the granulosa cells (Fig. 8a). As early as 6 h after E2 withdrawal, the amount of cx43 (a,) protein expressed in atretic follicles was decreased relative to that in healthy follicles (Fig. 9). HistologicalAnalysis An increased incidence of atresia was seen at 6-11 h after withdrawal of E2 compared with that in controls. The pyknotic nuclei, "beading" of the granulosa cells along the basement membrane, pockets of necrosis, and cellular debris in the lumen can clearly be seen in Figure 10. Since the ovaries were not completely serially sectioned, a quantitative assessment of the proportion of atretic to healthy follicles was not obtained. However, two independent observers each formed the clear impression that a greater proportion of follicles per section of ovary were undergoing atresia at 6-11 h after E2 withdrawal than were control follicles. DISCUSSION Intercellular communication via gap junctions may play a coordinating role in the process of atresia. Our results

indicate that cx43 gap junction mRNA and protein decrease rapidly during the early onset of atresia. As early as 6 h after withdrawal of E2, reduced amounts of cx43 gap junction mRNA were seen in follicles undergoing atresia. A loss of intercellular communication would have profound effects on the transfer of second messengers and metabolites within the follicle, and on the meiotic status of the oocyte. Whether or not gap junctions play an integral role in the early stages of atresia, however, remains to be determined. The model selected for induction of atresia was based on earlier observations that exogenous estrogen (estradiol or diethylstilbestrol) can act directly on ovaries of hypophysectomized and intact rats over a period of at least three days to stimulate granulosa cell proliferation and reduce atresia [15, 17-19]. Removal of the capsule and thereby the estrogen stimulus on Day 2, one day in advance of the time over which estrogen is known to sustain granulosa cell proliferation [15], provided a sharply defined point for initiation of atretogenic events. Estrogen-induced, daily surges of LH have been reported in adult, ovariectomized rats exposed to far lower concentrations of estradiol [16]. If such an event were to occur in these intact, immature rats exposed to far higher concentrations of estradiol, it would be expected to be of little consequence since the large num-

346

WIESEN AND MIDGLEY

FIG. 9. At 6 h after E2 withdrawal, the expression of cx43 (a,) gap junction protein was greatly reduced in the atretic follicles (A). Scale bar: 25 Am.

ber of ovarian follicles stimulated by the estradiol have not progressed beyond the pre-antral stage and their contained granulosa cells have not acquired receptor for LH [15]. Other models of induced atresia have revealed morphological or functional changes in atretic follicles within hours of withdrawal of gonadotropin support. Hubbard and Greenwald [20] reported the presence of pyknotic nuclei in cumulus granulosa cells 4 h after administration of an antiserum to eCG in hypophysectomized, eCG-treated hamsters, while the mural granulosa cells exhibited pyknoses at 12 h following anti-eCG treatment. In another report using the same model, Greenwald [21] found that DNA synthesis dropped sharply between 12 and 18 h after the antieCG treatment. In rats, Kaneko et al. [22] found that within 6 h of hypophysectomy fewer follicles responded to an ovulatory dose of hCG. By 12 h after hypophysectomy, all large and medium-sized follicles (200-400 Rm in diameter) exhibited morphological signs of atresia, and most follicles failed to respond to hCG treatment. Therefore, dramatic changes occur during the atretic process within several hours of hormonal withdrawal. Little is known about the hormonal regulation of the cx43 gap junction gene in the ovary. Risek et al. [4] examined cx43 mRNA levels by Northern analysis during pregnancy in the rat and found a large increase in the cx43 mRNA

levels on the day before delivery when progesterone fell to undetectable levels. Since this increased the estrogen/ progesterone ratio, they postulated that the formation of cx43 gap junctions was an estrogen-dependent process. The myometrium of the uterus contains the cx43 type of gap junction, which may function to coordinate and synchronize contractions during the onset of parturition [23, 24]. Hendrix et al. examined the expression, trafficking and assembly of cx43, and demonstrated that functional gap junctions are necessary for the onset of labor [25]. The work of Garfield and Puri has revealed that gap junctions form in uterine myometrium in response to estrogen and decrease in response to progesterone [23, 24]. A similar type of regulation may also occur in the ovary during the process of atresia. A change in the pattern of steroidogenesis has been associated with atretic follicles of the rat [26, 27], cow [2831], sheep [14], and pig [32, 33]. This shift in the estrogen/ progesterone ratio within a follicle may decrease the expression of the gap junction gene, thereby shutting down intercellular communication between the granulosa cells and the oocyte, and cause the follicle to drop out of the developmental pathway. To dissociate the sequence of events during the early stages of the process of atresia, an early marker of the atretic process that occurs before any morphological signs of atre-


347

FIG. 10. At 11 h after E 2 withdrawal, there were numerous atretic follicles as identified by cellular morphology. The beading of the granulosa cells along the basement membrane (B), and pyknotic nuclei (P) are clearly seen in these atretic follicles. Scale bar: 250 im.

sia is needed. Recent reports from Hughes and Gorospe [34] and Tilly et al. [35] have demonstrated that a Ca2+/ Mg2+-dependent endonuclease initiated apoptosis, resulting in DNA cleavage before any morphological signs of death. Examination of the cx43 gap junction mRNA levels together with an index of apoptosis at frequent intervals after the initiation of atresia may permit further dissociation of the sequence of the early events of atresia. Further investigation into the hormonal regulation of the cx43 gap junction gene is now warranted as one means of providing additional insight into the involvement of intercellular communication via gap junctions in the processes of follicular development and atresia. The results reported here do not determine whether the changes in gap junction mRNA and protein cause or result from atresia.

ACKNOWLEDGMENTS The authors would like to thank the Laboratory Animal Core Facility and Kaye Brabec of the Morphology Core Facility of the Center for the Study of Reproduction for their assistance (NIH P30 HD18258). This work was performed as part of the NICHD's National Cooperative Program on Infertility Research and supported in part by the Reproductive Sciences Program and the Cellular and Molecular Biology Program of the University of Michigan, and by grants U54 HD29184 and R01 HD18018.

REFERENCES 1. Bennett MVL, Goodenough DA. Gap junctions, electrotonic coupling and intercellular communication. Neurosci Res Bull 1978; 16:373-386. 2. Pitts JD, Simms JW. Permeability of junctions between animal cells. Intercellular transfer of nucleotides but not macromolecules Exp Cell Res 1977; 104:153-163. 3. Beyer EC, Paul DL, Goodenough DA Connexin43: a protein from rat heart homologous to a gap junction protein from liver. J Cell Biol 1987; 105:2621-2629. 4. Risek B, Guthrie S, Kumar N, Gilula NB. Modulation of gap junction transcript and protein expression during pregnancy in the rat. J Cell Biol 1990; 110:269282. 5. Larsen WJ, Wert SE. Roles of cell junctions in gametogenesis and in early embryonic development. Tissue &Cell 1988; 20:809-848. 6. Larsen WJ, Wert SE, Brunner GD. Differential modulation of rat follicle cell gap junction populations at ovulation. Dev Biol 1987; 122:61-71. 7. Anderson E, Albertini DF. Gap junctions between the oocyte and companion follicles cells in the mammalian ovary. J Cell Biol 1976; 71:680-686. 8. Gilula NB, Epstein ML, Beers WH. Cell-to-cell communication and ovulation. J Cell Biol 1978; 8:58-75. 9. Zamboni L. Fine morphology of the follicle wall and follicle-oocyte association. Biol Reprod 1974; 10:125-149. 10. Peters H, McNatty KP. A correlation of structure and function in mammals. In: The Ovary. Berkely: University of California Press; 1980: 17. 11. Lawrence TS, Beers WH, Gilula NB. Transmission of hormonal stimulation by cell-to-cell communication. Nature 1978; 272:501-506. 12. Saez JC, Connor JA, Spray DC, Bennett MV. Hepatocvte gap junctions are permeable to the second messenger, inositol 1,4,5-trisphosphate, and to calcium ions. Proc Natl Acad Sci USA 1989; 86:2708-2712. 13. Lindner HR, Amsterdam A, Salomon Y, Tsafriri A, Nimrod A, Lamprecht SA, Zor U, Koch Y. Intraovarian factors in ovulation: determinants of follicular response to gonadotropins. J Reprod Fertil 1977; 51:215-235.

348

WIESEN AND MIDGLEY

14. Hay MF, Moor RM, Cran DG, Dott HM. Regeneration of atretic sheep follicles in vitro. J Reprod Fertil 1979; 55:195-207. 15. Sanders MM, Midgley ARJr. Rat granulosa cell differentiation: an in vitro model. Endocrinology 1982; 111:614-624. 16. Legan SJ, Coon GA, Karsch FJ. Role of estrogen as initiator of daily LH surges in the ovariectomized rat. Endocrinology 1975; 96:50-56. 17. Goldenberg RL, Reiter FO, Ross GT. Follicle response to exogenous gonadotropins: an estrogen-mediated phenomenon. Fertil Steril 1973; 24:121-125. 18. Harman SM, Louvet JP, Ross GT. Interaction of estrogen and gonadotropins on follicular atresia. Endocrinology 1975; Endocrinology 96:1145-1152. 19. Rao MC, Midgley ARJr, Richards JS. Hormonal regulation of ovarian cellular proliferation. Cell 1978; 14:71-78. 20. Hubbard CJ, Greenwald GS. Morphological changes in atretic graafian follicles during induced atresia in the hamster. Anat Rec 1985; 212:353-357. 21. Greenwald GS. Temporal and topographic changes in DNA synthesis after induced follicular atresia. Biol Reprod 1989; 41:175-181. 22 Kaneko H, Taya K, Sasamoto S. Changes in the secretion of inhibin and steroid hormones during induced follicular atresia after hypophysectomy in the rat. Life Sci 1987; 41:1823-1830. 23. Garfield RE. Gap junction formation in myometrium: control by estrogens, progesterone, and prostaglandins. Am J Physiol 1980; 238:C81-C89. 24. Purl CP, Garfield RE. Changes in hormone levels and gap junctions in the rat uterus during pregnancy and parturition. Biol Reprod 1982; 27:967-975. 25. Hendrix EM, Mao SJT, Everson W, Larsen WJ. Myometrial connexin 43 trafficking and gap junction assembly at term and in preterm labor. Mol Reprod Dev 1992; 33:27-38. 26. Tsafriri A, Eckstein B. Changes in follicular steroidogenic enzymes following the preovulatory surge of gonadotropins and experimentally induced atresia. Biol Reprod 1986; 34:783-787.

27. Dhanasekaran N, Moudgal NR. Studies on follicular atresia: role of gonadotropins and gonadal steroids in regulating cathepsin-D activity of preovulatory follicles in the rat. Mol Cell Endocrinol 1989; 63:133-142. 28. Grimes RW, Manton P, Ireland J. A comparison of histological and non-histological indices of atresia and follicular function. Biol Reprod 1987; 37:82-88. 29. Spicer LJ, Matton P, Echternkamp SE, Convey EM, Tucker HA. Relationships between the histological signs of atresia, steroids in follicular fluid, and gonadotropin binding in individual bovine antral follicles during postpartum anovulation. Biol Reprod 1987; 36:890-898. 30. Mukhopadhyay AK, Holstein K, Szudlinski M, Brunswig-Spickenheier B, Leidenberger FA The relationship between prorennin levels in follicular fluid and follicular atresia in bovine ovaries. Endocrinology 1991; 129:2367-2375. 31. Henderson KM, McNatty KP, Smith P, Gibb M, O'Keeffe LE, Lun S, Heath DA, Prisk MD. Influence of follicular health on the steroidogenic and morphological characteristics of bovine granulosa cells in vitro. J Reprod Fertil 1987; 79:185193. 32. Westhof G, Westhof KF, Braendle WL, diZerega GS. Differential steroid and gonadotropin response by individual tertiary porcine follicles in vitro. Possible physiologic role of atretic follicles. Biol Reprod 1991; 44:461-468. 33. Maxson WS, Haney AF, Schomberg DW. Steroidogenesis in porcine atretic follicles: loss of aromatase activity in isolated granulosa and theca. Biol Reprod 1985; 33:495-501. 34. Hughes FM, Gorospe WC. Biochemical identification of apoptosis (programmed cell death) in granulosa cells: evidence for a potential mechanism underlying follicular atresia. Endocrinology 1991; 129:2415-2422. 35. TillyJL, Kowalski KI, Johnson AL, Hseuh AJW. Involvement of apoptosis in ovarian follicular atresia and post ovulatory regression. Endocrinology 1991; 129:27992801.