Presented in part at the annual meeting of the Association for Research in Vision ... accordance with the ARVO Statement for the Use of. Animals in Ophthalmic ...
Expression of Inducible Nitric Oxide Synthase in the Eye From Endotoxin-Induced Uveitis Rats Edith Jacquemin* Yvonne de Kozak,^ Brigitte Thillaye,^ Yves Courtois* and Olivier Goureau*
Purpose. Inducible nitric oxide (NO) synthase (iNOS) has been implicated in the pathogenesis of endotoxin-induced uveitis (EIU). This study was undertaken to localize the cells, in the eye, which express iNOS during EIU in the rat. Methods. EIU was induced in Lewis rats by a single foot pad injection of 150 /ig lipopolysaccharide (LPS) from Salmonella typhimurium. At different time intervals after LPS injection, the authors evaluated ocular inflammation (slit lamp observation), iNOS localization by in situ hybridization, and comparison of OX-42- and EDl-positive cell appearance and of glial response by specific immunohistochemistry. Results. iNOS mRNA was not detected in the iris-ciliary body nor in the retina of control rats. It was detected strongly in the epithelial cells of the iris-ciliary body at 6 hours and also in stromal cells of the ciliary processes at 16 hours after LPS injection. In the neuroretina, iNOS mRNA was observed in the inner layers 16 hours after LPS injection. iNOS-positive cells were also present in the vitreous at this time. At 6 and approximately 16 hours after LPS injection, immunohistochemistry experiments revealed a large number of OX-42- and ED1positive cells (microglia, macrophages, or polymorphonuclear leukocytes) colocalized in part with some iNOS-positive cells in the ciliary body and in the retina. Furthermore, expression of iNOS in Miiller cells cannot be excluded. Conclusions. These observations confirm that subcutaneous injection of endotoxin dramatically induces NOS mRNA expression in the eye, and they demonstrate that epithelial cells of the iris-ciliary body and cells infiltrating the anterior segment of the eye and the retina are the major source of NO. These results support the hypothesis that both inflammatory and resident ocular cells are involved in iNOS expression during EIU. Invest Ophthalmol Vis Sci. 1996;37:1187-1196.
JLmmunologic and inflammatory stimuli induce the production of nitric oxide (NO) by the expression of the inducible isoform of the nitric oxide synthase (NOS).1'2 In contrast to the constitutive system, where NO is produced in small amounts by neurons and endothelial cells,2'3 NO is released over longer periods
From the *Laboratoire de Developpement, Vieillissement et Pathologie de la Retine, and the f Uiboraloire d'Immunopalhologie de I'Oeil, Institut National de. la Sanle et de la Recherche Medicate, Paris, France. Presented in part at the annual meeting of the Association for Research in Vision and Ophthalmology, Fort lMuderdale, Florida, 1995. Supported by grants from INSERM and from the Association Francaise de la Retinile Pigmentaire. Submitted for publication September 8, 1995; revised December 11, 1995; accepted January 17, 1995. Proprietary interest category: N. Reprint requests: Olivier Goureau, U 450, Laboratoire de Developement, Vieillissement et Pathologie de la Retine, INSERM, 29 rue Wilhem, 75016 Paris, France.
Investigative Ophthalmology & Visual Science, May 1996, Vol. 37, No. 6 Copyright © Association for Research in Vision and Ophthalmology
by inducible NOS (iNOS) and exerts cytotoxic and cytostatic effects not only against invading agents, but also against healthy cells.24 There is increasing evidence that NO is involved in different inflammatory processes such as experimental diabetes mellitus,5 arthritis,6'7 glomerulonephritis7'8 and during ileitis or ulcerative colitis.910 The iNOS-NO pathway also could be involved in some inflammatory central nervous system diseases, such as experimental autoimmune encephalomyelitis1112 or choriomeningitis.13 In the eye, it has been suggested14"16 that NO could participate in the pathogenesis of endotoxininduced uveitis (EIU) in rats, a model for certain types of human ocular inflammation collectively termed uveitis, that appears in Reiter's and dysentery syndromes or Crohn's and Behcet's disease.17 In this context, we recently demonstrated that NO could be one
1187
1188
Investigative Ophthalmology & Visual Science, May 1996, Vol. 37, No. 6
of the proinflammatory mediators of EIU, by direct evidence of the expression of inducible NOS mRNA in the iris-ciliary body and in the retina during EIU development. 18 The mRNA expression, detected by reverse transcription—polymerase chain reaction (RT-PCR), was correlated with nitrite release in the aqueous and vitreous humors. 18 Furthermore, treatment by intraperitoneal injections of L-NAME, which reduces the formation of nitrite in the eye,18 prevented the clinical and histologic signs of uveitis.14"16'18 Our RT-PCR experiments provided only information about iNOS expression at the tissue level. Kinetics studies suggested that ocular resident and infiltrating cells could express iNOS, because iNOS mRNA was detected before and during cellular infiltration, but the precise cellular localization remained to be determined. Therefore, in this study, we have investigated the localization of iNOS mRNA in EIU rats by in situ hybridization.
MATERIALS AND METHODS Animals Inbred male, adult, 8-week-old Lewis (INRA, Dr. J. P. Ravaut, Nouzilly, France) and Brown-Norway (Charles River, Saint—Aubin les Elbeuf, France) rats were used in this study. The animals were treated in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.
Protocol of Endotoxin-Induced Uveitis Induction and Experimental Design Lipopolysaccharide (LPS) from Salmonella typhimurium (Sigma, Saint-Quentin Fallavier, France) was dissolved in sterile pyrogen-free saline at 1 mg/ml. Rats received one injection of 150 fig LPS solution or one injection of saline (control rats) in one foot pad. Rats were examined with a slit lamp at different time intervals after LPS injection, and the severity of clinical EIU was graded from 0 to 4 as previously defined18'19 by a blinded investigator. Three series of experiments were performed, and, for each experiment, two rats were used for each time point (2, 6, 16, and 24 hours after LPS injection). At these times, rats were anesthetized by intraperitoneal injection of pentobarbital (40 mg/kg Nembutal; Abbott Laboratories, Saint-Remy sur Avre, France) and perfused with 2% paraformaldehyde, immediately after which the eyes were enucleated. Eyes were postfixed for 1 hour in 2% paraformaldehyde, rinsed in 5% sucrose for 6 hours and then overnight in 15% sucrose at 4°C, mounted in Tissue Tek as previously described, 20 and stored at —80°C. Sections (10 fim) were collected under RNAse-free conditions on sterile super frost/plus slides (Manze-
Glaser) for in situ hybridization or on slides coated with gelatin for immunohistochemistry. Preparation of Single-Strand DNA Probes cDNA fragments specific for iNOS, containing T3 or T7 promoter sequences, were generated by PCR18 from the murine iNOS cDNA plasmid (a gift from Dr. J. M. Cunningham) using specific primers for iNOS with additional sequence at 5' or 3' for T3 or T7 promoters respectively: T3-NO (GAAATTAACCCTCACTAAAGGCATGGCTTGCCCC) andT7-NO (TGTAATACGACTCACTATAGGGGCAGCATCCCCTCT). These fragments were transcribed with T3 or T7 polymerase, 20 and the transcripts served as a template for reverse transcription to generate single-strand DNA.21 Briefly, 0.5 fig of either sense or antisense RNA was incubated with 150 U Moloney murine leukemia virus reverse transcriptase (Gibco-Life Technologies, Eragny, France) for 1 hour at 37°C in 15 fi\ 50 mM Tris-HCl, pH 8.3, containing 1 \J/fi\ RNAase inhibitor, 40 Mg/ml Actinomycin D, 0.5 mM dCTP, 0.5 mM dTTP, 0.5 mM dGTP, 75 mM KC1, 3 mM MgCL2, 5 mM DTT, 30 pmol of each specific internal oligonucleotide primer, and 66 (id a33P-dATP (Amersham, Les Ulis, France). Reactions were stopped, and the RNA template was hydrolyzed by incubation in 0.2 M NaOH at 65°C for 10 minutes. After neutralization with 0.2 M HC1, samples were buffered with 1 M TrisHCl, pH 7.5. The probe was extracted by phenolchloroform, precipitated with ethanol, and redissolved in the desired volume of hybridization buffer. The nucleotide sequences of the oligonucleotide primers used for this radioactive retrotranscription were: iNOS antisense (TGTGTCTGCAGATGTGCTGAAAC) for T3 fragment and iNOS sense (TTTCTO TTCAAAGTCAAATCCTACCA) for T7 fragment. This probe corresponds to the 5' extremity of mouse macrophage iNOS sequence and is homologous with iNOS from rat astrocytes and macrophages. In Situ Hybridization Sections were treated for 2 hours in 1 X Denhardt/4 X SSC, then rinsed twice for 10 minutes with 4 X SSC at room temperature before dehydration. Air-dried sections were covered overnight at 42°C with hybridization buffer (1 X Denhardt, 750 mM NaCl, 25 mM Pipes, 50% formamide, 100 mM dithiothreitol, 0.2% sodium dodecyl sulfate, 5% sulfate dextran, 250 fig/ ml DNA, 250 fig/'ml tRNA) containing 5 X 106 cpm/ ml of 33P-labeled single-strand antisense DNA. On each slide, a control section was hybridized with labeled sense DNA under identical conditions. The next day, sections were washed twice for 15 minutes in 2 X SSC at room temperature, twice for 15 minutes with 0.1 X SSC at 55°C, and then rinsed in 0.1 X SSC at room temperature before dehydration. Autoradiogra-
Inducible NOS in EIU
1189
incubated either with biotinylated goat anti-rabbit immunoglobulin G or sheep anti-mouse immunoglobulin G (1:100 in PBS-1% skimmed milk) and then with Time (hours after LPS injection) Uveitis Grade extravidin-rhodamine-isothiocynate (1:100 in PBS1 % skimmed milk), for 1 hour at room temperature. 2 0.86 After washing, coverslips were mounted in PBS-glyc6 1.88 8 2.05 erol and viewed under a Leitz Aristophan (Leica, 16 3.40 Rueil-Malmaison, France) photomicroscope. Results 22-24 3.67 of control experiments using a rabbit preimmune se40 1.10 rum or omitting the first antibody were negative (data not shown). Values represent the mean grade of clinical endotoxin-induced
TABLE l. Ocular Inflammation at Different Time Intervals After Injection
uveitis observed in 12 to 16 rats, of which 6 per time point were used for in situ hybridization. No difference in the intensity of ocular inflammation was observed between the left and right eye. LPS = lipopolysaccharide.
RESULTS
phy and subsequent photographs were performed as previously described.20 For each time point of the three series of LPS treatments, three different hybridizations were performed using a new radiolabeled probe.
Signs of clinical uveitis, observed at slit lamp, were seen 6 hours after LPS injection. They increased after 8 hours and peaked at 16 to 24 hours, the time corresponding to maximal uveitis (Table 1) as previously described.141922 At 40 hours, a large decrease of inflammation was observed.
Immunohistochemistry Sections on gelatin-coated slides were washed with phosphate-buffered saline (PBS), fixed in 4% paraformaldehyde, rinsed, and incubated for 1 hour at 37°C with PBS containing 5% skimmed milk. The sections were then incubated with either polyclonal antiglial fibrillary acidic protein (GFAP) antibody (Dako S.A., Trappes, France), monoclonal OX-42 antibody (anti C3b receptor) or monoclonal EDI antibody (Serotec, Oxford, UK), each diluted 1:100 in PBS1 % skimmed milk. After washing in PBS, sections were
l. In situ dark-field autoradiographs from retinal sections of Lewis rat eyes hybridized with specific iNOS antisense probe (A to C) or with control iNOS sense probe (D) at different intervals after lipopolysaccharide (LPS) injection. No cells were labeled in sections from rat after saline treatment (A) and 6 hours after LPS injection (B). Sixteen hours after LPS injection, iNOS-positive cells were detected in the ganglion cell, inner plexiform, and inner nuclear layers (C). Bars = 50 /im. FIGURE
Localization of iNOS mRNA in the Retina From EIU Lewis Rat Using in situ hybridization, we localized cells expressing iNOS mRNA. Figure 1C shows that iNOS mRNA was detected 16 hours after LPS injection, mainly in the inner layers of the retina—the inner nuclear layer (INL), inner plexiform layer (IPL), and ganglion cell layer (GCL). In contrast, no signal was detected in the retina 2 hours (data not shown) and 6 hours after LPS injection (Fig. IB) or in rats injected with saline (Fig. 1A). In control experiments using the sense probe,
1190
Investigative Ophthalmology & Visual Science, May 1996, Vol. 37, No. 6
FIGURE 2. Sections from vitreous near the optic nerve head of Lewis rat eyes 16 hours after lipopolysaccharide injection. Dark-field autoradiography, obtained after hybridization with specific iNOS antisense probe, revealed iNOS-positive cells in the vitreous (A). Phase contrast (B). OX-42-positive cells were detected in the vitreous and in the optic nerve (C). Bars = 50
no signal was detected in the retina of LPS-treated rats (Fig. ID). A large number of cells also were labeled in the vitreous humor, near the optic nerve, 16 hours after LPS injection (Fig. 2A). In addition to the retina, iNOS mRNA was detected in a few cases in the choroid, but no signal was obtained in the retinal pigment epithelium or in the sclera 16 hours after LPS treatment (data not shown). To clarify what type of cells (resident or infiltrating) could be at the origin of iNOS expression in the retina, an immunohistochemical study was performed using either OX-42 antibody (anti-C3b receptor), a marker for microglia, activated macrophages, dendritic cells, and polymorphonuclear leukocytes (PMNL), or EDI antibody, a marker for monocytesmacrophages and dendritic cells.23 The retina of saline-treated rats did not show any EDI- (Fig. 3A) or OX-42- (Fig. 3D) positive cells. Very few EDl-positive (Fig. 3B) and OX-42-positive cells (Fig. 3E) were detected 6 hours after LPS injection; however, their numbers markedly increased 16 hours after LPS treatment (Fig. 3C, 3F). The immunoreactivity in the retina for both OX-42 and EDI essentially was localized
in the IPL and in the GCL, the two layers that contained iNOS-positive cells as shown in Figure 1G. In the INL, where some iNOS-positive cells were present 16 hours after LPS treatment (Fig. 1C), only rare cells labeled with EDI antibody were detected at this time (Fig. 3C). At the same time, many OX-42-positive cells were found in the vitreous humor, near the optic nerve head (Fig. 2C). To assess retinal glial response during EIU, we analyzed GFAP expression by immunohistochemistry. In saline-treated Lewis rats, GFAP labeling was limited to astrocytes in the GCL (Fig. 3G). GFAP-immunoreactive Muller radial glial profiles were detected 6 hours after LPS treatment (Fig. 3H) and increased in number and immunoreactivity at 16 hours after LPS injection (Fig. 31).
Localization of iNOS mRNA in the Iris and Ciliary Body From Endotoxin-Induced Uveitis Lewis Rat In the iris, iNOS labeling was located in the epithelium 6 hours after LPS injection (Figs. 4A, 5A) and less intensively after 16 hours, with rare isolated cells
1191
Indudble NOS in EIU
stained in the stroma (Fig. 4B). No clear labeling was detected in the iris 24 hours after LPS treatment (data not shown). Results of a control experiment for nonspecific labeling, using the sense probe on sections of the iris from rats 6 hours after LPS treatment, were negative (Fig. 4C). Few OX-42- (Fig. 4E) or EDI- (Fig. 4G) positive cells were detected, and then only in the stroma, 6 hours after LPS injection. The number of these cells increased in the stroma and were present as well in the anterior chamber 16 hours after LPS injection, whereas no labeling was detected in the epithelium (Figs. 4F, 4H). At the same time, some OX-42and EDl-positive cells were detected in the anterior chamber, near the corneal endothelium (Figs. 4F, 4H). The detection of iNOS-positive cells was uncommon in this part of the eye (data not shown). In the ciliary body, iNOS mRNA was detected 6 hours after LPS injection in the epithelium and in the stroma (Figs. 5B, 6R), whereas no signal was detected in control rats injected with saline (Fig.
ED
FIGURE 3. Detection of ED1-
(A to C), OX-42- (D to F), and giial fibrillary acidic protein- (G to I) positive cells on retinal sections of Lewis rat eyes after saline treatment (AAG), 6 hours (B,E,H), and 16 hours (C.FJ) after lipopolysaccharide injection. Bars = 50 /xm,
GFA
5A) and 2 hours after LPS treatment (data not shown). At 16 hours after LPS injection, the labeling was located in the stromal tissue of the ciliary body and in some infiltrating inflammatory cells neighboring the ciliary body in the posterior chamber (Figs. 5C, 6C). An immunohistochemical study revealed that in control Lewis rat eyes, OX-42-positive cells were absent from the ciliary body (Fig. 6D), whereas EDI antibody labeled some cells in the ciliary body base and processes (Fig. 6G). Six hours after LPS injection, OX-42 labeling began to be detected (Fig. 6E), as was a large increase of EDlpositive cells (Fig. 6H). Interestingly, at this time, the number of OX-42-positive cells was variable depending on the rat used (corresponding to a variable degree of EIU). Sixteen hours after LPS injection, infiltration by OX-42 or EDI immunoreactive cells became more pronounced in the ciliary body (Figs. 6F, 61), and OX-42 labeling also was detected along the surface of the ciliary body (Fig. 6F).
1192
Investigative Ophthalmology & Visual Science, May 1996, Vol. 37, No. 6
16h
NOS
FIGURE 4. View of iris sections
of Lewis rat eyes hybridized with iNOS probe or labeled with either OX-42 or EDI antibody, 6 or 16 hours after Iipopolysaccharide injection, as indicated. Hybridization with specific iNOS antisense C OX42 probe essentially labeled the epithelium (A,B), whereas no cells were detected with control iNOS sense probe (C). iNOS-positive cells infiltrating the stroma of the iris are indicated by the arrows (B). Phase contrast (D). OX42-positive cells are detected ED1 in the stroma and in the anterior chamber (E,F). The same location has been obtained for EDl-positive cells (G,H). Bars = 50 ftm. Localization of iNOS mRNA and OX-42Positive Cells in the Brown-Norway Rat Eye After Iipopolysaccharide Injection No clear hybridization for iNOS mRNA has been detected in the iris-ciliary body or in the retina of EIUresistant Brown-Norway rats injected with LPS (Figs. 7A, 7B), confirming the results of our previous R T PCR experiments. 18 Immunohistologic analysis of the eyes of Brown-Norway rats examined 16 hours after LPS injection revealed that few OX-42-positive cells were detected in the iris (Fig. 7C) and in the retina (Fig. 6D). A small number of GFAP-immunoreactive cells was detected at the edge of the GCL, and occasional signals in the INL from the retina of BrownNorway rats treated with saline or with LPS were observed (data not shown). DISCUSSION The current study provides, for the first time, the localization of iNOS in the anterior and the posterior parts
of the eye from EIU rats and confirms the in vivo induction of the NO pathway in EIU.18 In situ hybridization experiments demonstrate the specific localization of iNOS mRNA in the iris-ciliary body, in the retina, and in some cells in the aqueous and vitreous humors. In the anterior part of the eye, labeling of iNOS mRNA was particularly intense in the posterior epithelium of the iris and in the ciliary body (stroma and epithelium). In the posterior segment, iNOS-positive cells were located principally in the GCL and the IPL and, in a few cases, in the INL of the retina and in the vitreous. The source of NO is of some interest. Although all the cells expressing iNOS mRNA have not been identified by double-labeling procedures, our immunohistochemical experiments give some indications concerning the identity of iNOS-positive cells. In the retina and in the vitreous of Lewis rats 16 hours after LPS injection, the appearance and localization of OX42- and ED-1-positive cells were similar to those of iNOS mRNA, suggesting that these cells (infiltrating
Indudble NOS in EIU
1193 was detected in the retina 2 and 6 hours after LPS treatment by RT-PCR, 18 whereas iNOS mRNA was not detected by in situ hybridization, confirming that R T PCR is more sensitive than in situ hybridization. By using GFAP antibody, we demonstrated that a reactive gliosis of Muller cells occurred in the Lewis rat retina after LPS injection, a phenomenom that has been described in different types of retinal degeneration. 24 In this context, we cannot exclude that activated Muller glial cells after LPS injection could express iNOS and release large amounts of NO in the retina. This speculation is reinforced by the fact that Muller glial cells from humans with cytomegalovirus retinitis express iNOS25 in vitro, after LPS and cytokine stimulation.26 On the other hand, astrocytes detected with GFAP antibody in the peripheral part of the GCL, where the majority of iNOS-positive cells are detected, also could be a source of NO. It is interesting to note that retinal pigmented epithelial cells, which are able to express iNOS in vitro27'28 were never labeled with the iNOS mRNA probe during EIU. This discrepancy between in vitro and in vivo results could be explained by the fact that the retina could release endogenous inhibitory factors of iNOS expression, such as growth factors.27'29 On the other hand, the absence of inflammation in the outer part of the retina and in the choroid could support the absence of iNOS in RPE cells during EIU.
FIGURE 5. In situ bright-field autoradiographs from sections of iris (A) and ciliary processes (B,C) of Lewis rat eyes hybridized with specific iNOS antisense probe at different intervals after lipopolysaccharide (LPS) injection. (A3) Epithelial cells, indicated by arrows, are particularly labeled 6 hours after LPS injection. (C) Sixteen hours after LPS injection, positive signal (dosed triangles) was detected in the ciliary body stromal tissue as well as in the epithelium. Bars = 20 /mi.
macrophages, PMNL, and/or microglia) were the major source of NO in the retina during EIU. The absence of OX-42- and iNOS-positive cells in the retina from EIU resistant Brown-Norway rats is in favor of this hypothesis. It must be noted that iNOS mRNA
In the anterior part of the eye, we demonstrated iNOS expression by the posterior epithelium of the iris, particularly at the beginning of the uveitis, whereas no labeling was observed with OX-42 and EDI antibodies in this epithelial layer. These iNOS-positive cells in the epithelium are not monocytes-macrophages, dendritic cells, or PMNLs, because they are OX-42 and EDI negative. Furthermore, bright-field photographs suggest that they are more probably resident epithelial cells. The rare iNOS-positive cells in the stroma of the iris could be infiltrating cells, detected with OX-42 and EDI antibodies. In the ciliary body, the exact localization of iNOS is more complex, and the nature of iNOS-positive cells is difficult to determine because no double-labeling procedure has been used. At the beginning of uveitis (6 hours after LPS injection), when few infiltrating OX-42- and ED1positive cells are detected, numerous cells expressed iNOS in the ciliary body, particularly in the epithelium. The absence or relatively low staining obtained with OX-42 and EDI antibodies in the epithelium suggests that probably the ciliary body epithelial cells themselves, as in the iris, could produce NO. At the time of maximal uveitis (16 to 24 hours after LPS treatment), iNOS-positive cells are present in the epithelium and are located in the stroma and die vitreous, and this labeling partially corresponds to the staining obtained with OX-42 and EDI antibodies.
1194
Investigative Ophthalmology 8c Visual Science, May 1996, Vol. 37, No. 6
ED1
Saline
FIGURE 6.
Ciliary body sections of Lewis rat eyes after lipopolysaccharide (LPS) injection, hybridized with specific iNOS antisense probe (A to C) or labeled with either OX-42 (D to F) or EDI (G to I) antibody at different times after LPS injection, as indicated. Bars = 50 fjm.
These results suggest that at the time of maximal inflammation, NO could be produced by OX-42- or EDIpositive cells, such as macrophages or PMNL, that are able to express iNOS in vitro.1'1'30 In summary, our results suggest that at the onset of uveitis, NO could be produced by activated-resident epithelial cells of the iris-ciliary body and that at the time of maximal inflammation, "infiltrating" OX-42-and EDl-positive cells could be a new source of NO release as well as of activated epithelial cells. The mechanism by which LPS induces iNOS gene expression in vivo in the eye is unknown; however, the upregulation of different cytokines during EIU31"34 could lead to the induction of NOS activity. In this context, tumor necrosis factor alpha (TNFa), which can induce NOS expression in vitro2 and can be produced in vitro by stimulated retinal Muller glial cells,3'' seems a good candidate because high intraocular levels of TNFa are detected at the onset of EIU.SI>M
The elevated release of NO during EIU could lead to a substantial decrease in intraocular pressure and could disturb the regulation of aqueous humor dynamics because NO has been described as a potential mediator of intraocular pressure 36 (unpublished data, 1995). In the posterior part of the eye, we speculate that large amounts of NO could also affect NO-dependent neurotransmission between retinal cells" and could diffuse to the RPE cells, decreasing their phagocytic activity, as described in vitro. 38 Therefore, because NO acts as a proinflammatory compound in EIU, treatments based on the inhibition of iNOS could provide new prospects for uveitis. Key Words epithelial cells, in situ hybridization, iris—ciliary body, macrophages, retina
1195
Inducible NOS in EIU
FIGURE 7. Iris and ciliary body sections (A,C) of Brown-Norway rat eyes 6 hours after lipopolysaccharide (LPS) injection. Retinal sections (B,D) of Brown-Norway rat eyes 16 hours after LPS injection. Sections were hybridized with specific iNOS antisense probe (A,B) or were incubated with OX-42 antibody (C,D). Bars = 50 fxm.
Acknowledgments The authors thank Dr. J. M. Cunningham (HematologyOncology division, Harvard Medical School, Boston, Massachusetts) for the kind gift of murine macrophage iNOS cDNA, J. C. Jeanny and J. M. Philippe for helpful suggestions, L. Jonet for technical assistance, and Herve Coet for photographic work. References 1. Nussler AK, Billiar TR. Inflammation, immunoregulation, and inducible nitric oxide synthase. J Leukoc Biol. 1993; 54:171-178. 2. Nathan CF, Xie F. Regulation of biosynthesis of nitric oxide. JBiol Chem. 1994;269:13725-13728. 3. Bredt DS, Snyder SH. Nitric oxide, a physiologic messenger molecule. Annu Rev Biochem. 1994; 63:175-195. 4. Nathan CF, HibbsJBJr. Role of nitric oxide synthesis in macrophage antimicrobial activity. Curr Opin Immunol, 1991; 3:65-70. 5. Kleemann R, Rothe H, Kolb-Bachofen V, et al. Transcription and translation of inducible nitric oxide synthase in the pancreas of prediabetic BB rats. FEBS Lett. 1993;328:9-12. 6. McCartney-Francis N, Allen JB, Mizel DE, et al. Suppression of arthritis by an inhibitor of nitric oxide synthase./£*/> Med. 1993; 178:749-754. 7. Weinberg JB, Granger DL, Pisetsky DS, et al. The role of nitric oxide in the pathogenesis of spontaneous murine autoimmune disease: Increased nitric oxide production and nitric oxide synthase expression in
8.
9. 10. 11.
12.
13.
14.
MRL-lpr/lpr mice, and reduction of spontaneous glomerulonephritis and arthritis by orally administered Nc-monomethyl-L-arginine./£jc/> Med. 1994; 179:651 660. Cook HT, Ebrahim H, Jansen AS, Foster GR, Largen P, Cattell V. Expression of the gene for inducible nitric oxide synthase in experimental glomerulonephritis in the rat. Clin Exp Immunol. 1994;9:315-320. Seago ND, Thompson JH, Zhang XJ, et al. Inducible nitric oxide synthase and guinea-pig ileitis by adjuvant. Medlnflamm. 1995; 4:19-24. Middleton SJ, Shorthouse M, Hunter JO. Increased nitric oxide synthesis in ulcerative colitis. Lancet. 1993; 341:465-466. Cross AH, Misko TP, Lin RF, Hickey WF, Trotter JL, Tilton RG. Aminoguanidine, an inhibitor of inducible nitric oxide synthase, ameliorates experimental autoimmune encephalomyelitis in SJL mice. / Clin Invest. 1994;93:2684-2690. Van Dam AM, Bauer J, Man-A-Hing WKH, Marquette C, Tilders FJH, Berkenbosch F. Appearance of inducible nitric oxide synthase in the rat central nervous system after rabies virus infection and during experimental allergic encephalomyelitis but not after peripheral administration of endotoxin.y Neurosd Res. 1995;40:251-260. Campbell IL, Samimi A, Chang CS. Expression of the inducible nitric oxide synthase: Correlation with neuropathology and clinical features in mice with lymphocytic choriomengitis. J Immunol. 1994; 153:3622-3629. Parks DJ, Cheung MK, Chan CC, Roberge FG. The
1196
15.
16.
17.
18.
19.
20.
21.
Investigative Ophthalmology 8c Visual Science, May 1996, Vol. 37, No. 6 role of nitric oxide in uveitis. Arch Ophthalmol. 1994; 112:544-546. Tilton RG, Chang K, Corbett JA, et al. Endotoxininduced uveitis in the rat is attenuated by inhibition of nitric oxide production. Invest Ophthalmol Vis Sci. 1994; 35:3278-3288. Mandai M, Yoshimura N, Yoshida M, Iwaki M, Honda Y. The role of nitric oxide synthase in endotoxin-induced uveitis: Effect of NG-nitro Lrarginine. Invest Ophthalmol Vis Sci. 1994; 35:3673-3680. Rosenbaum JT, MacDevitt HO, Guss RB, Egbert PR. Endotoxin-induced uveitis in rats as a model for human disease. Nature (Lond). 1980; 286:611-613. Goureau O, Bellot J, Thillaye B, Courtois Y, de Kozak Y. Increased nitric oxide production in endotoxininduced uveitis: Reduction of uveitis by an inhibitor of nitric oxide synthase. / Immunol. 1995; 154:61586523. Ruiz - Moreno JM, Thillaye B, de Kozak Y. Retino-choroidal changes in endotoxin-induced uveitis. Ophthalmic Res. 1992;24:162-168. Jacquemin E, Jonet L, Oliver L, et al. Developmental regulation of acidic fibroblast growth factor expression in bovine retina. IntJDevBiol. 1993; 37:417-423. Schnurch H, Risau W. Differentiating and mature neurons express die acidic fibroblast growth factor gene during chick neural development. Development.
28.
29.
30.
31.
32.
33.
22. Hoekzema R, Verhagen C, van Haren M, Kijlstra A. Endotoxin-induced uveitis in the rat: The significance 34. of intraocular interleukin-6. Invest Ophthalmol Vis Sci. 1992;33:532-539. 23. McMenamin PG, Crewe J. Endotoxin-induced uveitis: Kinetics and phenotype of the inflammatory cell infiltrate and the response of the resident tissue macro35. phages and dendritic cells in the iris and ciliary body. Invest Ophthalmol Vis Sci. 1995; 36:1949-1959. 24. Sarthy PV. Reactive gliosis in retinal degenerations. In: Anderson RE, Hollyfield JG, LaVail MM, eds. Retinal 36. Degenerations. Boca Raton: CRC Press; 1992:109-115. 25. Digheiro P, Reux I, Hauw JJ, Fillet AM, Courtois Y, Goureau O. Expression of inducible nitric oxide syn37. thase in cytomegalovirus-infected glial cells of retinas from AIDS patients. Neurosci Lett. 1994; 166:31-34. 26. Goureau O, Hicks D, Courtois Y, de Kozak Y. Induction and regulation of nitric oxide synthase in retinal 38. Muller glial cells. /Neurochem. 1994;69:310-317. 27. Goureau O, Lepoivre M, Becquet F, Courtois Y. Differential regulation of inducible nitric oxide synthase
by basic fibroblast growth factors and transforming growth factor ft in bovine retinal pigmented epithelial cells: Inverse correlation with cellular proliferation. Proc Natl Acad Sci USA. 1993;90:4276-4280. Iiversidge J, Grabowski P, Rallston S, Benjamin N, Forrester JV. Rat retinal pigment epithelial cells express an inducible form of nitric oxide synthase and produce nitric oxide in response to inflammatory cytokines and activated T cells. Immunology. 1994; 83:404-409. Vodovotz Y, Bogdan C. Control of nitric oxide syntfiase expression by transforming growth factor /3: Implications for homeostasis. Prog Growth Factor Res. 1994; 5:341-351. McCall T, Palmer RMJ, Moncada S. Induction of nitric oxide synthase in rat peritoneal neutrophils and its inhibition by dexamethasone. Eur J Immunol. 1991:21:2523-2527. De Kozak Y, Hicks D, Chatenoud L, Bellot J, Thillaye B, Faure JP. Intraocular TNF in endotoxin- and Santigen-induced uveitis: In vitro synthesis of TNF by retinal Muller glial and pigment epidielial cells. Reg Immunol. 1994; 6:76-80. Planck SR, Huang X, Robertson JE, Rosenbaum JT. Cytokine mRNA in rat ocular tissues after systemic endotoxin treatment. Invest Ophthalmol Vis Sci. 1994; 35:924-930. Yoshida M, Yoshimura N, Hangai M, Tanihara H, Honda Y. Interleukin-la, interleukin-1/? and tumor necrosis factor gene expression in endotoxin-induced uveitis. Invest Ophthalmol Vis Sci. 1994; 35:1107-1113. De Vos AF, van Haren MAC, Verhagen C, Hoekzema R, Kijlstra A. Kinetics of intraocular tumor necrosis factor and interleukin-6 in endotoxin-induced uveitis in the rat. Invest Ophthalmol Vis Sci. 1994; 35:11001107. De Kozak Y, Naud MC, Bellot J, Faure JP, Hicks D. Differential tumor necrosis factor expression by resident retinal cells from experimental uveitis-susceptible and -resistant rat strains. /Neuroimmunol 1994;55:l-9. Nathanson JA. Nitrovasodilatators as a new class of ocular hypotensive agents. / Pharmacol Exp Ther. 1992:260:956-965. Ahmad I, Leinders-Zufall T, Kocsis JD, Sheperd GM, Zufall F, Barnstable CJ. Retinal ganglion cells express a cGMP-gated cation conductance activable by nitric oxide donors. Neuron. 1994; 12:155-165. Becquet F, Courtois Y, Goureau O. Nitric oxide decreases in vitro phagocytosis of photoreceptor outer segments by bovine retinal pigmented epithelial cells. J Cell Physiol. 1994; 159:256-262.
