Expression of inducible nitric oxide synthase (NOS) in bone ... - Nature

Leukemia (1999) 13, 699–703  1999 Stockton Press All rights reserved 0887-6924/99 $12.00 http://www.stockton-press.co.uk/leu

Expression of inducible nitric oxide synthase (NOS) in bone marrow cells of myelodysplastic syndromes M Kitagawa1, M Takahashi2, S Yamaguchi2, M Inoue1, S Ogawa2, K Hirokawa1 and R Kamiyama2 1

Department of Pathology and Immunology, and 2Division of Morphological Technology, Allied Health Sciences, Faculty of Medicine, Tokyo Medical and Dental University, Tokyo, Japan

Nitric oxide (NO) is a biological mediator which is synthesized from L-arginine by a family of nitric oxide synthases (NOS). We have studied the expression of the inducible NOS (iNOS) by bone marrow cells from the patients with myelodysplastic syndromes (MDS) at the mRNA level by RT-PCR assay and at the protein level by immunohistochemical staining using a specific anti-iNOS monoclonal antibody. The iNOS message was present in 92% of bone marrow tissues from MDS patients (11 out of 12) by an examination using RT-PCR. Basically, iNOS message was negative or very weak in control (1/9) and AML (0/7) cases. This was supported by immunohistochemical findings that the iNOS was positive in most of the bone marrow samples from MDS patients (9 out of 12), while bone marrow cells of control (0 out of 12) and AML (0 out of 5) cases were basically negative. Double immunostaining for CD68 antigen, which is a marker for macrophage lineage cells, and iNOS was performed on MDS bone marrow sections. iNOS was dominantly localized to bone marrow macrophages, although a part of myeloid cells were also positively stained with anti-iNOS antibody in a part of cases. These results indicated that there is some in vivo induction of iNOS expression for local NO production that might be involved in the dysregulation of hematopoiesis in bone marrow of MDS. Keywords: myelodysplastic syndromes; iNOS; bone marrow

regulated in the bone marrow cells from patients with MDS.16 In MDS bone marrow, TNF-␣, as well as IFN-␥, was mainly localized to the stromal cells, such as bone marrow macrophages. Therefore not only the proliferation of MDS clone cells but also the abnormal function of stromal cells of the bone marrow may be involved in mechanisms causing cytopenias in MDS through disturbed regulation of the expression and production of growth factors and cytokines. Induction of nitric oxide synthase (NOS) and production of the toxic metabolite nitric oxide (NO) is one of the TNF-␣ and IFN-␥ regulated effector mechanisms that can lead to apoptosis of hematopoietic progenitor cells.17 Fas-receptor (FAS) expression can be stimulated by TNF-␣ and IFN-␥. It has been shown that transactivation of inducible NOS (iNOS), and possibly Fas promotors, by interferon regulatory factor-1 expressed in response to IFN-␥ may be a part of the iNOS transduction pathway. This study therefore attempted to investigate the disturbed regulatory mechanisms of hematopoiesis in MDS in vivo by defining up-regulation of iNOS production using RT-PCR and then to immunohistochemically demonstrate the localization of the iNOS producing cells in the bone marrow.

Introduction Myelodysplastic syndromes (MDS) are a heterogeneous group of hematological malignancies affecting mainly the middle aged and elderly.1–4 The majority of affected patients die within 1–2 years due to overt leukemic transformation or the complication of cytopenias. The development of cytopenias despite the presence of cellular marrow is thought to be due to ineffective hematopoiesis probably associated with frequent apoptosis of hematopoietic cells.5,6 The Fas antigen, as well as Fas-ligand, was over-expressed by bone marrow cells of MDS patients.6 The expression of Fas antigen by hematopoietic cells would result in the induction of apoptosis of these cells. In vitro examination revealed that the proliferation, as well as death, of hematopoietic cells is regulated by various proteins with stimulatory and inhibitory activities.1 Colony-stimulating factors (CSFs)7–10 and several cytokines8–12 are known to have proliferative effects on hematopoietic progenitor cells, while several substances such as tumor necrosis factor (TNF)8,9,13–15 and interferons (IFNs)14 were demonstrated to inhibit hematopoietic cell growth. Although the exact function of these substances in vivo has not yet been elucidated, overexpression of certain soluble factors by bone marrow cells may disrupt hematopoiesis by exerting profound inhibitory effects on hematopoietic progenitor cells. We have previously demonstrated that the expression of TNF-␣ and IFN-␥ was upCorrespondence: M Kitagawa, Department of Pathology and Immunology, Faculty of Medicine, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113, Japan; Fax: 81 3 5803 0123 Received 22 September 1998; accepted 25 January 1999

Materials and methods

Patients Bone marrow samples of trephin biopsy and partly autopsy material were taken from 14 patients with MDS; three with refractory anemia (RA), one with RA with ring sideroblasts (RARS), four with RA with excess of blasts (RAEB), four with RAEB in transformation (RAEB-T) and two with chronic myelomonocytic leukemia (CMMoL). The samples were embedded in OCT compound (purchased from Sakura, Tokyo, Japan), frozen using liquid nitrogen, cryosectioned and investigated for the expression of iNOS. A diagnosis of MDS was based on FAB criteria.1 None of the patients had received specific therapeutic agents prior to the study. The range of age in MDS patients was 44–83 (60.8 ± 11.6, mean ± s.d.) and male:female ratio was 10:4. Bone marrow samples from 15 individuals with no hematological disorders were used as controls (age range 21–84, mean ± s.d., 62.1 ± 17.1; male:female, 10:5) and additionally, seven patients with de novo AML (M2 or M4 by FAB classification, age range 56–76, mean ± s.d., 66.6 ± 7.3; male:female, 6:1) were also analyzed.

Preparation of RNA samples and amplification method RNA was isolated from frozen bone marrow samples by a guanidium isothiocyanate solubilization/LiCl precipitation procedure. Tissue RNA (100 ng) was used as a template for

iNOS in MDS bone marrow M Kitagawa et al

700

the amplification reactions. Oligonucleotides as specific primers and probes for iNOS were synthesized by a commercial laboratory (Life Technologies Oriental, Tokyo, Japan). As a control reaction of PCR, ␤-actin was also detected in each run. The sequences of primers were as follows: iNOS: 5⬘ PCR primer CGGTGCTGTATTTCCTTACGAGGCGAAGAAGG, 3⬘ PCR primer GGTGCTACTTGTTAGGAGGTCAAGTAAAGGGC; ␤-actin: 5⬘ PCR primer AAGAGAGGCATCCTCACCCT, 3⬘ PCR primer TACATGGCTGGGGTGTTGAA. The expected sizes of the PCR products were 257 bp for iNOS and 218 bp for ␤-actin. Complementary (c) DNA was synthesized by using Rous-associated virus reverse transcriptase (Takara Biomedicals, Kyoto, Japan). The PCR reaction was performed as described elsewhere.18–20 Briefly, 100 ng of the RNA was used for RT-PCR. For cDNA synthesis, 100 ng in 4 ␮l of sample RNA solution was heated at 65°C for 5 min and cooled rapidly. After adding 20 U of ribonuclease inhibitor (Takara), 1 ␮l of 1.25 mm dNTP (dATP, dCTP, dGTP, dTTP, Pharmacia, Uppsala, Sweden) and 20 U of Rous-associated virus reverse transcriptase (Takara), the mixture was incubated at 40°C for 30 min, then heated at 94°C for 5 min and cooled rapidly. The PCR reaction mixture contained 10 ␮l of cDNA, 10 ␮l of 10 × PCR buffer, 11 ␮l of 20 mm MgCl2, 16 ␮l of 1.25 m dNTP, 42.5 ␮l of DEPC-water, 100 pm 5⬘- and 3⬘-primer, and 2.5 U of thermostable Taq polymerase (Perkin Elmer Cetus, Norwalk, CT, USA). The amplification was achieved with a DNA thermal cycler (Perkin Elmer Cetus). After denaturing at 94°C for 10 min, the amplification was conducted for 35 cycles at 94°C for 30 s, 55°C for 30 s and 72°C for 60 s. This was followed by re-extension for 10 min at 72°C. Ten-␮l aliquots of the product samples were analyzed by electrophoresis on a 1.8% agarose gel and visualized by UV fluorescence after staining with ethidium bromide. ␸X174/HaeIIIcut DNA was run in parallel as a molecular weight marker. Then the density of bands was measured by scanning imager, Image Quant (Molecular Dynamics, Sunnyvale, CA, USA).

Results

Immunohistochemistry

Cases

To examine the distribution of iNOS-producing cells in the bone marrow, polyclonal rabbit antibodies against iNOS (Santa Cruz Biotechnology, Santa Cruz, CA, USA) were applied on frozen sections. Sections were then incubated with fluorescein isothiocyanate (FITC)-conjugated anti-rabbit IgG antibody (DAKO, Glostrup, Denmark). On the same sections, the distribution of bone marrow macrophages was determined by double immunostaining with anti-CD68 antibody (KP-1, DAKO). This was followed by incubation with tetramethyl rhodamine isothiocyanate (TRITC)-conjugated anti-mouse IgG (DAKO). Control procedures included the substitution of equivalent concentrations of heavy chain-matched monoclonal antibody of irrelevant specificity and the staining of bone marrow sections from control as well as AML and CML cases.

Expression of mRNA for iNOS in the bone marrow So as to examine very low levels of iNOS mRNA expression in bone marrow cells, RT-PCR was performed using RNA from frozen bone marrow tissues. This method revealed the expression of iNOS mRNA, as defined by a 257 bp PCR product, in the bone marrow from patients with MDS. Control cases as well as AML and CML cases showed no expression or very weak expression of iNOS (Figure 1). The frequency of up-regulation of iNOS mRNA in bone marrow samples is summarized in Table 1. Most of the MDS cases expressed iNOS mRNA (11/12, 92%), while the majority of control (8/9) and all of the AML (7/7) samples did not show signal. Only one control case showed a very weak band indicating a low level of iNOS expression. Differences in the frequency of iNOS expression were statistically significant between MDS and control cases (Fisher’s exact test, P ⬍ 0.001). However, because very weak bands were observed in part of the control cases, we measured the density of bands for iNOS as well as ␤-actin and calculated the ratio of the density iNOS/␤-actin. In control cases, the ratio was 0.09 ± 0.03 (mean ± s.e.m.), while the ratio was 10.3 ± 7.4 in MDS cases. Difference was significant by Student’s t-test (P ⬍ 0.01).

Localization of iNOS in the bone marrow of MDS patients As the mRNA of iNOS was overexpressed in the bone marrow of MDS patients, distribution of iNOS producing cells was examined by immunohistochemical method. As shown in Fig-

Table 1 IMH)

Expression of iNOS in the bone marrow (RT-PCR and

No. of positive/total cases RT-PCR

IMH

MDS RA RARS RAEB RAEB-T CMMoL

11/12 3/3 ND 3/3 3/4 2/2

9/12 2/3 1/1 2/3 3/4 1/1

Control AML

1a/9 0/7

0/12 0/5

IMH, immunohistochemistry; ND, not determined because the sample was too small to get mRNA for RT-PCR. a Very weak band was observed in the bone marrow samples from one control case.

Figure 1 Detection of mRNAs for iNOS and ␤-actin by RT-PCR. Positive bands for iNOS (257 bp) were observed in MDS cases (lanes 1– 5) in contrast to negative signals in control cases (lanes 6–11). An RT-PCR reaction for ␤-actin (218 bp) was performed as an internal control, and positive signals were observed in all the samples examined.


ure 2a, iNOS in MDS bone marrow was localized in scattered cells with irregular shaped cytoplasm. The frequency of expression of iNOS in bone marrow samples is summarized in Table 1. As expected from the result of RT-PCR, iNOS was expressed only in MDS cases (9/12) and not in control (0/12) as well as AML (0/5) cases. From their shape, iNOS-positive cells in MDS bone marrow resembled bone marrow stromal cells and not hematopoietic cells. Thus, double immunostaining for iNOS and CD68 antigen, a marker for macrophagelineage cells, was performed on the frozen bone marrow sections. The staining clarified that the iNOS producing cells were basically CD68-positive suggesting that these cells were mainly of bone marrow macrophage lineage (Figure 2b and c). The majority of iNOS strongly positive cells were also CD68positive as indicated by yellow arrowheads in Figure 2c. However, not all of the CD68-positive cells were positive with antiiNOS immunostaining. The CD68 single positive cells were indicated by red arrowheads in Figure 2c. In some cases, iNOS was also positively stained in medium-sized round cells suggesting that part of the myeloid cells were also producing iNOS.

negative feedback mechanisms mediated by multiple soluble factors including CFSs7–10 and cytokines such as IL-1,8,10,25 IL3,12 IL-4,11 IL-6,10,26 TNF-␣8,9,13,27 and IFN-␥.14 Recently, an increased frequency of apoptosis was observed in bone marrow cells of MDS patients. To clarify the mechanism of apoptosis induced in MDS, several in vivo studies were performed to elucidate the influence of several of the growth factors. They have indicated that TNF-␣ and IFN-␥ would be the major cytokines that evoke apoptosis of hematopoietic cells probably via the Fas/Fas-ligand pathway.6,28,29 TNF-␣ and IFN␥ suppress hematopoietic progenitor cell proliferation30–32 and have been implicated in the mechanism of bone marrow failure.33–35 For example in aplastic anemia, aberrant production of IFN-␥ and upregulation of TNF in bone marrow likely induce apoptosis of hematopoietic stem cells and progenitor cells.33,34 TNF-␣ and IFN-␥ are known to suppress both early and late stages of hematopoiesis and induce programmed cell death.17 However, factors linking abnormal cytokine production of MDS bone marrow and an event of cell death have been still unclear. Nitric oxide has recently gained attention as a new class of molecule that serves as a variety of functions in different tissues.36–38 Nitric oxide is synthesized by the oxidation of larginine by a family of NO synthases (NOSs). When normal bone marrow or CD34+ cells were exposed to NO, inhibition of colony formation was dose-dependent and direct.39 Macrophages express iNOS in response to inflammatory stimuli such as TNF-␣, IFN-␥ or endotoxin.40 Involvement of TNF-␣ and IFN-␥ in the regulation of NO production suggested that NO

Discussion Bone marrow cells from MDS patients are known to have unbalanced growth characteristics21–24 but the underlying mechanisms causing them are still unclear. Generally, hematopoiesis is controlled by a complex interplay of positive and

a

b

c Figure 2 Immunohistochemical staining of MDS bone marrow with anti-iNOS and anti-CD68 antibodies on frozen bone marrow tissue sections. (a) The iNOS was positive (FITC, green) in irregular shaped cells (RAEB, original magnification ×200). (b) Localization of CD68-positive cells was also examined by immunohistochemical staining (RITC, red). (c) Double immunostaining clarified that the majority of iNOS-positive cells were CD68-positive bone marrow macrophages, although a part of the medium-sized round cells were also positively stained with antiiNOS antibody and indicated as green cells. The iNOS/CD68 double-positive cells were indicated as yellow cells (yellow arrowheads). The CD68-positive but iNOS negative cells were indicated as red cells (red arrowheads).

701


702

may influence the function of bone marrow cells and may be relevant for understanding the pathophysiology of hematologic diseases. The present study showed that bone marrow cells expressed iNOS in MDS patients. Our previous data have shown that TNF-␣, IFN-␥, Fas antigen and Fas-ligand were over-expressed in the bone marrow of MDS patients. Together with these findings we can speculate that disturbance in regulation of hematopoiesis including excess of apoptosis in the bone marrow cells of MDS may result from upregulation of TNF-␣ and IFN-␥ expression followed by iNOS production and then, by strong expression of Fas antigen in hematopoietic cells. As to the localization of iNOS in the bone marrow cells of MDS, we could demonstrate that the major source of iNOS production may be macrophage lineage cells. Other than macrophages, iNOS have also been demonstrated in CD34+ cells, myeloid cells and megakaryocytes in the bone marrow.39,41 However, expression of iNOS has been well documented in macrophages when the cells were stimulated with cytokines such as TNF and IFNs.42–44 The enhanced expression of NO production may be toxic to the surrounding cells or autotoxic. In the bone marrow of MDS patients, stromal cells could release NO in a paracrine fashion causing apoptosis of surrounding hematopoietic cells. Thus, induction of NO release by bone marrow stromal cells in vivo may have pathophysiologic implications on the regulation of bone marrow function such as apoptosis of hematopoietic cells of MDS cases. References 1 Delacretaz F, Schmidt P-M, Piguet D, Bachmann F, Costa J. The FAB classification (proposals) applied to bone marrow biopsy. Am J Clin Pathol 1987; 87: 180–186. 2 Jacobs A. Myelodysplastic syndromes: pathogenesis, functional abnormalities, and clinical implications. J Clin Pathol 1985; 38: 1201–1217. 3 Kitagawa M, Kamiyama R, Takemura T, Kasuga T. Bone marrow analysis of the myelodysplastic syndromes: histological and immunohistochemical features related to the evolution of overt leukemia. Virchows Arch B 1989; 57: 47–53. 4 Kitagawa M, Kamiyama R, Kasuga T. Expression of the proliferating cell nuclear antigen in bone marrow cells from patients with myelodysplastic syndromes and aplastic anemia. Hum Pathol 1993; 24: 359–363. 5 Raza A, Mundle S, Shetty V, Alvi S, Chopra H, Span L, Parcharidou A, Dar S, Venugopal P, Borok R, Gezer S, Showel J, Loew J, Robin E, Rifkin S, Alston D, Hernandez B, Shar R, Kaizer H, Gregory S. Novel insights into the biology of myelodysplastic syndromes: excessive apoptosis and the role of cytokines. Int J Hematol 1996; 63: 265–278. 6 Kitagawa M, Yamaguchi S, Takahashi M, Tanizawa T, Hirokawa K, Kamiyama R. Localization of Fas and Fas ligand in bone marrow cells demonstrating myelodysplasia. Leukemia 1998; 12: 486– 492. 7 Metcalf D. The molecular biology and functions of the granulocyte–macrophage colony-stimulating factor. Blood 1986; 67: 257–267. 8 Bot FJ, Schipper P, Broeders L, Delwel R, Kaushansky K, Loewenberg B. Interleukin-1␣ also induces granulocyte–macrophage colony-stimulating factor in immature normal bone marrow cells. Blood 1990; 76: 307–311. 9 Ulich TR, del Castillo J, Guo K, Souza L. The hematologic effects of chronic administration of the monokines, tumor necrosis factor, interleukin-1, and granulocyte colony-stimulating factor on bone marrow and circulation. Am J Pathol 1989; 134: 149–159. 10 Slack JL, Nemunaitis J, Andrews DF, Singer JW. Regulation of cytokine and growth factor gene expression in human bone marrow stromal cells transformed with simian virus 40. Blood 1990; 75: 2319–2327.

11 Peschel C, Green I, Paul WE. Interleukin-4 induces a substance in bone marrow stromal cells that reversely inhibits factor-dependent and factor-independent cell proliferation. Blood 1989; 73: 1130–1141. 12 Caux C, Sealand S, Farve C, Duvert V, Mannoni P, Banchereau J. Tumor necrosis factor-alpha strongly potentiates interleukin-3 and granulocyte–macrophage colony-stimulating factor-induced proliferation of human CD34+ hematopoietic progenitor cells. Blood 1990; 75: 2292–2298. 13 Murase T, Hotta T, Saito H, Ohno R. Effect of recombinant tumor necrosis factor on the colony growth of human leukemia progenitor cells and hematopoietic progenitor cells. Blood 1987; 69: 467–472. 14 Young MRI, Young ME, Wright MA. Myelopoiesis-associated suppressor-cell activity in mice with Lewis lung carcinoma tumors: interferon-␥ plus tumor necrosis factor-␣ synergistically reduce suppressor cell activity. Int J Cancer 1990; 46: 245–250. 15 Slordal L, Warren DJ, Moore MAS. Protective effects of tumor necrosis factor on murine hematopoiesis during cycle-specific cytotoxic chemotherapy. Cancer Res 1990; 50: 4216–4220. 16 Kitagawa M, Saito I, Kuwata T, Yoshida S, Yamaguchi S, Takahashi M, Tanizawa T, Kamiyama R, Hirokawa K. Overexpression of tumor necrosis factor (TNF)-␣ and interferon (IFN)-␥ by bone marrow cells from patients with myelodysplastic syndromes. Leukemia 1997; 11: 2049–2054. 17 Selleri C, Sato T, Raiola AM, Rotoli B, Young NS, Maciejewski JP. Induction of nitric oxide synthase is involved in the mechanism of Fas-mediated apoptosis in haematopoietic cells. Br J Haematol 1997; 99: 481–489. 18 Rappolee DA, Mark D, Banda MJ, Werb Z. Wound macrophages express TNF-␣ and other growth factors in vivo; analysis by mRNA phenotyping. Science 1988; 241: 708–712. 19 Kawasaki ES, Clark SS, Coyne MY, Smith SD, Champlin R, Witte ON, McCormick FP. Diagnosis of chronic myeloid and acute lymphatic leukemias by detection of leukemia-specific mRNA sequences amplified in vitro. Proc Natl Acad Sci USA 1988; 85: 5698–5702. 20 Saito I, Servenius B, Compton T, Fox RI. Detection of Epstein– Barr virus DNA by polymerase chain reaction in blood and tissue biopsies from patients with Sjo¨gren’s syndrome. J Exp Med 1989; 169: 2191–2198. 21 Faille A, Prosch C. Prognostic value of in vitro bone marrow culture in refractory anemia with excess of myeloblasts. Scand J Haematol 1987; 20: 286–288. 22 Francis GE, Wing MA, Miller EJ, Berney JJ, Wonke B, Hoffbrand AV. Use of bone marrow culture in prediction of acute leukaemic transformation in preleukaemia. Lancet 1983; i: 1409–1412. 23 Oloffson T, Olsson I. Biochemical characterization of a leukemiaassociated inhibitor (I.AI) suppressing normal granulopoiesis in vitro. Blood 1980; 55: 983–991. 24 Cukrova V, Neuwitova R, Vermak J, Neuwirt J. Inhibitor of normal granulopoiesis produced by cells of MDS patients. Neoplasia 1989; 36: 83–89. 25 Crown J, Jakubowski A, Gabrilove J. Interleukin-1: biological effects in human hematopoiesis. Leuk Lymphoma 1993; 9: 433– 440. 26 Wang S-Y, Ho C-K, Chen L-Y, Wang R-C, Huang M-H, CastroMalaspina H, Moore MAS. Down-regulation of myelopoiesis by mediators inhibiting the production of macrophage-derived granulomonopoietic enhancing activity (GM-EA). Blood 1988; 72: 2001–2006. 27 Lindemann A, Ludwig W-D, Oster W, Mertelsmann R, Herrmann F. High-level secretion of tumor necrosis factor-␣ contributes to hematopoietic failure in hairy cell leukemia. Blood 1989; 73: 880–884. 28 Raza A, Gezer S, Mundle S, Gao X-Z, Alvi S, Borok R, Rifkin S, Iftikhar A, Shetty V, Parcharidou A, Loew J, Marcus B, Khan Z, Chaney C, Showel J, Gregory S, Preisler H. Apoptosis in bone marrow biopsy samples involving stromal and hematopoietic cells in 50 patients with myelodysplastic syndromes. Blood 1995; 86: 268–276. 29 Bouscary D, Vos JD, Guesnu M, Jondeau K, Viguier F, Melle J, Picard F, Dreyfus F, Fontenay-Roupie M. Fas/Apo-1 (CD95) expression and apoptosis in patients with myelodysplastic syndromes. Leukemia 1997; 11: 839–845.


30 Raefsky EL, Platanias LC, Zoumbos NC, Young NS. Studies of interferon as a regulator of hematopoietic cell proliferation. J Immunol 1985; 135: 2507–2512. 31 Roodman GD, Bird A, Hutzler D, Montgomery W. Tumor necrosis factor-alpha and hematopoietic progenitors: effects of tumor necrosis factor on the growth of erythroid progenitors CFU-E and BFU-E and the hematopoietic cell lines K562, HL60, and HEL cells. Exp Hematol 1987; 15: 928–935. 32 Broxmeyer HE, Williams DE, Lu L, Cooper S, Anderson SL, Beyer GS, Hoffman R, Rubin BY. The suppressive influences of human tumor necrosis factors on bone marrow hematopoietic progenitor cells from normal donors and patients with leukemia: synergism of tumor necrosis factor and interferon-␥. J Immunol 1986; 136: 4487–4495. 33 Nakao S, Yamaguchi M, Shiobara S, Yokoi T, Miyawaki T, Taniguchi T, Matsuda T. Interferon-␥ gene expression in unstimulated bone marrow mononuclear cells predicts a good response to cyclosporine therapy in aplastic anemia. Blood 1992; 79: 2532– 2535. 34 Nitico A, Young NS. Gamma-interferon gene expression in the bone marrow of patients with aplastic anemia. Ann Intern Med 1994; 120: 463–469. 35 Rosselli F, Sanceau J, Gluckman E, Wietzerbin J, Moustacchi E. Abnormal lymphokine production: a novel feature of the genetic disease Fanconi anemia. II. In vitro and in vivo spontaneous overproduction of tumor necrosis factor ␣. Blood 1994; 83: 1216– 1225. 36 Moncada S, Higgs A. The l-arginine-nitric oxide pathway. New Engl J Med 1993; 329: 2002–2012.

37 Moncada S, Palmer RMJ, Higgs EA. Biosynthesis of nitric oxide from l-arginine: a pathway for the regulation of cell function and communication. Biochem Pharmacol 1989; 38: 1709–1715. 38 Nathan C. Nitric oxide as a secretory product of mammalian cells. FASEB J 1992; 6: 3051–3064. 39 Maciejewski JP, Selleri C, Sato T, Cho HJ, Keefer LK, Nathan CF. Nitric oxide suppression of human hematopoiesis in vitro: contribution to inhibitory action of interferon-␥ and tumor necrosis factor-␣. J Clin Invest 1995; 96: 1085–1092. 40 Lu L, Bonham CA, Chambers FG, Watkins SC, Hoffman RA, Simmons RL, Thomson AW. Induction of nitric oxide synthase in mouse dendritic cells by IFN-gamma, endotoxin, and interaction with allogeneic T cells: nitric oxide production is associated with dendritic cell apoptosis. J Immunol 1996; 157: 3577–3586. 41 Wallerath T, Gath I, Aulitzky WE, Pollock JS, Kleinert H, Forstermann U. Identification of the NO synthase isoforms expressed in human neutrophil granulocytes, megakaryocytes and platelets. Thromb Haemost 1997; 77: 163–167. 42 Wang W, Keller K, Chadee K. Entamoeba histolytica modulates the nitric oxide synthase gene and nitric oxide production by macrophages for cytotoxicity against amoebae and tumour cells. Immunology 1994; 83: 601–610. 43 Kiemer AK, Vollmar AM. Autocrine regulation of inducible nitricoxide synthase in macrophage by atrial natriuretic peptide. J Biol Chem 1998; 273: 13444–13451. 44 Drapier J-C, Wietzerbin J, Hibbs Jr JB. Interferon-␥ and tumor necrosis factor induce the l-arginine-dependent cytotoxic effector mechanism in murine macrophages. Eur J Immunol 1988; 18: 1587–1592.

703