Expression of mRNA encoding neurotrophins and neurotrophin ...

Expression of mRNA encoding neurotrophins and neurotrophin receptors in human granulocytes and bone marrow cells—enhanced neurotrophin-4 expression induced by LTB4 Maria Assunta Laurenzi,* Tommaso Beccari,† Leif Stenke,*‡ Mikael Sjo¨linder,* Sofia Stinchi,† and Jan A˚ke Lindgren* *Department of Medical Biochemistry and Biophysics, Division of Physiological Chemistry II, Karolinska Institutet, Stockholm, Sweden; †Department of Cellular and Molecular Biology, Perugia University, Perugia, Italy; and ‡Division of Hematology, Department of Medicine, Danderyd Hospital at Karolinska Institutet, Stockholm, Sweden

Abstract: The expression of neurotrophin and neurotrophin receptor mRNAs in human granulocytes and bone marrow cells was examined using ribonuclease protection assay and reverse transcription-polymerase chain reaction. The granulocytes expressed mRNA coding for nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), and neurotrophin-4 (NT-4), but not neurotrophin-3 (NT-3). Moreover, the inflammatory mediator leukotriene B4 (LTB4) up-regulated the expression of NT-4 mRNA in granulocytes, but did not affect the expression of other neurotrophin mRNAs. Granulocytes generally lacked expression of mRNA coding for neurotrophin receptors. In contrast, human bone marrow cells consistently expressed mRNA for trkB (the BDNF and NT-4 receptor) and displayed variable expression of mRNA coding for trkA (the tyrosine kinase NGF receptor) and LNGFR (the low-affinity NGF receptor), whereas mRNA for trkC (the NT-3 receptor) was not expressed. Contrary to granulocytes, normal bone marrow cells generally expressed only low levels of mRNA encoding BDNF and NT-4. Expression of mRNA encoding NGF and NT-3 was not detected. However, significantly increased expression of BDNF mRNA was observed when bone marrow cells from patients with chronic myeloproliferative disorders (MPD) were analyzed. The results suggest that neurotrophins may act as granulocyte-derived effector molecules and that human bone marrow cells may be targets for these compounds, in particular BDNF and NT-4. J. Leukoc. Biol. 64: 228–234; 1998. Key Words: chronic myeloproliferative disorders · brain-derived neurotrophic factor · trkB

INTRODUCTION The neurotrophins consist of four structurally related peptides, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), and neurotrophin-4 (NT-4) [1, 228

Journal of Leukocyte Biology

Volume 64, August 1998

2]. These neurotrophic factors regulate growth, survival, and differentiation of neurons and their effects are largely mediated via binding to cell surface receptors [1, 3]. Three high-affinity tyrosine kinase receptors, trkA (binding NGF), trkB (binding BDNF and NT-4), and trkC (binding NT-3), have been identified [reviewed in ref. 4]. In addition, a transmembrane glycoprotein, the low-affinity NGF receptor (LNGFR), binds all neurotrophins with similar low affinity [5, 6]. Although the physiological role of LNGFR is still a matter of controversy, this receptor has recently been associated with NGF-induced activation of programmed cell death in trkA-negative neurons [7]. Messenger RNAs for the neurotrophins are expressed at different levels, not only in the nervous system, but also in various peripheral non-neuronal tissues, in agreement with the role of neurotrophins as target-derived factors [8–14]. Thus the expression of NGF, which is required for development and survival of certain sympathetic neurons, has been demonstrated to correlate with the density of sympathetic innervation in effector organs [11]. Similarly, BDNF, NT-3, and NT-4 are expressed in several organs, e.g., lung and muscle, which are targets for distinct neuronal populations in the nodose ganglion and in the motor neurons, respectively [9, 10, 12]. Recently, the expression of neurotrophins and their receptors was reported also in white blood cells, suggesting that these peptides might have additional biological roles in addition to their neurotrophic functions. Thus, mRNAs for NGF, NT-3, NT-4 [13, 14], as well as trkA [14, 15] were identified in rodent lymphocytes, while rodent mast cells were reported to produce NGF [16]. In the human, trkA mRNA was expressed in monocytes [17], basophils [18], and undifferentiated hematopoietic cell lines [19]. Furthermore, functional studies have demonstrated that NGF, the rkA ligand, can modulate the prolifera-

Abbreviations: NGF, nerve growth factor; NT, neurotrophin; BDNF, brainderived neurotrophic factor; MPD, myeloproliferative disorders; LTB4, leukotriene B4; CML, chronic myelocytic leukemia; GM-CSF, granulocyte-macrophage colony-stimulating factor; RPA, ribonuclease protection assay; RT-PCR, reverse transcriptase-polymerase chain reaction. Correspondence: Jan A˚ke Lindgren, Department of Medical Biochemstry and Biophysics (MBB), Division of Physiological Chemistry II, Karolinska Institutet, 171 77 Stockholm, Sweden. E-mail: [email protected] Received February 8, 1998; revised March 24, 1998; accepted March 25, 1998.

tion and differentiation of B [20–23] and T [24, 25] lymphocytes and may operate as an autocrine survival factor for memory B lymphocytes [26]. In addition, NGF has also been reported to regulate cell differentiation as well as synthesis and release of inflammatory mediators, including leukotriene C4 (LTC4) in basophils [18, 27, 28] and proliferation of synovial mast cells [29]. Although these data suggest a pro-inflammatory role of NGF, our knowledge concerning expression or effects of neurotrophins in granulocytes is negligible. NGF-induced activation of murine neutrophils has been reported [30]. However, nothing is known concerning the expression and/or function of NGF in human granulocytes. It was therefore of interest to analyze the expression of mRNA encoding the four neurotrophins and their receptors in normal human granulocytes. In addition, we investigated bone marrow cells from healthy donors. Furthermore, additional bone marrow samples from patients with myeloproliferative disorders (MPD) were investigated. The characteristic hypercellularity of MPD bone marrows is believed to be due to deregulated myeloid cell proliferation and survival [31], abnormalities in which altered neurotrophin expression may theoretically be involved. We report that peripheral granulocytes expressed mRNA encoding neurotrophins, whereas the bone marrow cells mainly expressed mRNA for neurotrophin receptors. Furthermore, the inflammatory mediator leukotriene B4 (LTB4) up-regulated the expression of NT-4 mRNA in granulocytes but not in bone marrow cells.

MATERIALS AND METHODS Preparation of cell suspensions and incubation procedures Leukocyte concentrates from healthy blood donors were provided by the local blood bank (Karolinska Hospital). Bone marrow cells from six healthy volunteers and four patients with MPD were collected into heparinized tubes by needle aspiration from the iliac crest. All samples were collected with the informed consent of involved individuals. The procedure was approved by the Ethics Committee of Karolinska Institutet. Three of the MPD patients had Philadelphia chromosome-positive chronic myelocytic leukemia (CML) in chronic phase, whereas one had Philadelphia chromosome-negative MPD. The three CML patients received oral treatment with low-dose hydroxyurea; the remaining patient was without chemotheraphy. Granulocytes were isolated from leukocyte concentrates by dextran sedimentation, hypotonic ammonium chloride lysis, and Ficoll-Hypaque density centrifugation [32]. The pellet containing .98% granulocytes was washed and the cells were either immediately used for RNA extraction or resuspended in RPMI 1640 medium (GIBCO, Grand Island, NY) supplemented with 2 mM HEPES. The bone marrow samples were depleted of erythrocytes by centrifugation (900 g, 15 min) and incubation in hypotonic ammonium chloride. The remaining cells were either immediately used for RNA extraction or resuspended in RPMI medium containing 2 mM HEPES. Granulocyte and bone marrow cell suspensions (15 3 106 cells/mL) were incubated at 37°C in the presence or absence of 10-10 to 10-8 M LTB4 (Biomol Research Laboratories, Plymouth Meeting, PA). In addition, bone marrow cells were incubated with LTB4 in the presence of 1 nM granulocyte-macrophage colony-stimulating factor (GM-CSF; Amersham Laboratories, Buckinghamshire, England). After 1 h stimulation the cells were collected by centrifugation and used for RNA extraction.

RNA preparation and ribonuclease protection assay (RPA) Total RNA from granulocytes and bone marrow cells was purified by the acid guanidine isothiocyanate-phenol-chloroform extraction method [33]. RNA

Laurenzi et al.

integrity was tested by formaldehyde/agarose gel electrophoresis. RPA was performed with the Ambion RPA II kit (Ambion, Austin, TX) according to the manufacturer’s instructions. The NGF, NT-3, and NT-4 antisense cRNA probes were prepared by subcloning into pBSKS plasmids (Stratagene, La Jolla, CA), a 210-bp Pst I/Pst I fragment, a 268-bp Ava/Bst E II fragment, and 400-bp Xho I/Pvu II fragment from the human NGF, NT-3, and NT-4 cDNA, respectively. Template plasmids were linearized by the appropriate restriction enzymes (Sal I for NGF and NT-3; Cla I for NT-4) and transcribed with T7 RNA polymerase. The BDNF antisense cRNA probe was kindly provided by Dr Carlos Ibanez, Division of Molecular Neurobiology, Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Sweden. The probes were labeled with [a-32P]CTP and hybridized to 10–15 µg total RNA from granulocytes or bone marrow cells overnight at 45°C. The protected cRNA fragments were separated under denaturing conditions. Hybridization to yeast tRNA was used as a negative control, whereas RNA from human neuroblastoma tumor tissues (kindly provided by Dr. Thomas Miale, Division of Physiological Chemistry II, Department of Medical Biochemistry and Biophysics, Karolinska Institutet, Sweden) and human prostate tissue were used as positive controls for NGF and BDNF [34] and NT-3 and NT-4 [35], respectively. Gels were exposed to Kodak XAR-5 film for 5–7 days at 270°C and the autoradiograms were scanned using a Personal Densitometer SI (Molecular Dynamics, Sunnyvale, CA).

Reverse transcription-polymerase chain reaction (RT-PCR) cDNA was synthesized from 1 µg of total RNA using the 1st strand cDNA synthesis kit (Boehringer Mannheim, Mannheim, Germany) and subjected to PCR amplification. Specific primers (Table 1; synthesized by Scandinavian Gene Synthesis, Ko¨ping, Sweden) were selected from the cDNA sequences of the human LNGFR [5, 15], trkA [15, 36], and trkC [37, 38] and of the rat trkB [38, 39]. The primers for LNGFR and trkB amplified fragments common to the rat and the human cDNA sequences. PCR of b-actin cDNA served as control for RNA input and amplification. Moreover, non-reverse-transcribed RNA was always used as a negative control in PCR. Primers specific for b-actin were obtained from Clontech (Palo Alto, CA). PCR was performed using a PCR Master kit (Boehringer Mannheim). The final concentrations of primers were 0.4 µM for trkA and LNGFR; 0.5 µM for trkB and trkC; and 0.2 µM for b-actin. The PCR mixture was incubated in a thermal cycler (Eppendorf, Hamburg, Germany). The b-actin, trkB, and trkC sequences were amplified for 30 cycles, consisting of 30 s denaturation at 95°C, 30 s annealing at 54°C, and 1 min extension at 72°C. The trkA and LNGFR sequences were amplified for 35 cycles, consisting of 30 s denaturation at 95°C, 30 s annealing at 55°C, and 1 min extension at 72°C. A final extension time of 5 min at 72°C for one cycle was always used. PCR products were analyzed on ethidium bromide-stained 1.5% agarose gel. To confirm the authenticity of the obtained bands, the RT-PCR products were digested with appropriate restriction enzymes and subjected to electrophoresis in 1.5% agarose gel, blotted onto nitro-cellulose membranes, and hybridized with specific [g-32P]ATP-labeled DNA probes, according to standard methods [40].

TABLE 1.

mRNA

LNGFR trkA trkB trkC

Primer

58 38 58 38 58 38 58 38

Oligonucleotide Primers Used for RT-PCR

Sequence (58-38)

Localization in cDNA sequences

Amplified PCR product (bp)

AGCCAACCAGACCGTGTGTG 287–306 663 TTGCAGCTGTTCCACCTCTT 949–929 CCATCGTGAAGAGTGGTCTC 410–429 482 GGTGACATTGGCCAGGGTCA 885–865 CGACACTCAGGATTTGTATTGCC 1171–1195 518 TCCGTGTGATTGGTGACGTGTATT 1686–1663 CCCCCATTTGCGTTATATAAACC 533–555 546 CACACGTGGGGGATAGTAGACA 1076–1055

Neurotrophin and neurotrophin receptor mRNA in human granulocytes and bone marrow

229

RESULTS Expression of neurotrophin mRNA in human granulocytes and bone marrow cells RPA consistently demonstrated expression of mRNA encoding the neurotrophins NGF, BDNF, and NT-4 in human granulocyte preparations (n 5 5), whereas no expression of NT-3 mRNA could be observed (Fig. 1). When equal amounts of RNA were analyzed, the levels of mRNA coding for the respective neurotrophin did not vary significantly between cells from different donors. Moreover, the expression of NGF and NT-4 mRNA in the granulocytes was comparable to the expression of these neurotrophin mRNAs in the positive controls (neuroblastoma tumor tissue and prostate tissue, respectively). The level of BDNF mRNA in the granulocytes was approximately 70% of the level in a neuroblastoma tissue used as positive control. The cRNA antisense probe for BDNF protected two separate fragments. This finding has previously been reported and has been proposed to represent two differently spliced messages and/or messages using alternative polyadenylation signals [41–43]. The effect of the inflammatory mediator LTB4 on the expression of neurotrophin mRNAs in granulocyte suspensions was investigated. Incubation with LTB4 (10-10 M) for 1 h induced significantly enhanced levels of NT-4 mRNA with an approximately 50% increase compared with the levels observed in untreated cells (Fig. 2, A and B). When added at higher concentrations (10-8 M), LTB4 did not induce a significant

Fig. 2. Levels of NT-4 mRNA in blood granulocytes after stimulation with LTB4. Total RNA from granulocytes was analyzed for the expression of NT-4 mRNA by RPA as described in Materials and Methods. (A) Densitometric scanning was performed on autoradiograms from four independent experiments. The levels of NT-4 mRNA in unstimulated cells (0) and in cells stimulated with 10-10 M or 10-8 M LTB4 are reported as percentage of the levels of NT-4 mRNA in prostate tissue (used as positive control), which was arbitrarily set at 100%. Data represent the means 6 SD (Student’s t test; *P , 0.05; n.s., not significant). (B) Autoradiogram showing NT-4 mRNA expression in unstimulated and stimulated granulocytes. Hybridization to yeast tRNA was used as negative control and to total RNA from prostate tissue as positive control. Results from one representative experiment out of four are shown.

Fig. 1. Neurotrophin mRNA expression in blood granulocytes and bone marrow cells. Total RNA from granulocytes and bone marrow cells was analyzed by RPA as described in Materials and Methods. Hybridization to yeast tRNA was used as negative control, total RNAs from two different neuroblastoma tumor tissues (neuroblastoma-1, neuroblastoma-2) were used as positive controls for NGF and BDNF, respectively, and total RNA from prostate tissue as positive control for NT-3 and NT-4. Results from one representative experiment out of five are shown. The double band for BDNF has been reported before [41–43].

230



stimulatory effect. The expression of NGF and BDNF mRNA was not affected by LTB4 treatment (results not shown). Bone marrow cells from normal donors expressed low amounts of mRNA coding for BDNF and NT-4 (30 and 50% of the corresponding positive controls, respectively), whereas NGF and NT-3 mRNAs were absent (Fig. 1). It is interesting to note that the levels of BDNF mRNA were consistently higher in bone marrow cells from four patients with MPD compared with normal bone marrow cells (2.5-fold mean increase, P , 0.05, Fig. 3, A and B). In contrast, no differences between patients and normal controls were evident for the remaining neurotrophins. Treatment of bone marrow cells from normal controls or

Human granulocytes generally failed to express mRNA coding for neurotrophin receptors. Thus, granulocytes from only one of the seven donors expressed trkA and LNGFR mRNA, whereas one additional granulocyte preparation expressed trkA mRNA (Fig. 4, A and C’). Furthermore, no expression of mRNA for trkB or trkC could be observed (Fig. 4, B and C). Incubation of granulocyte suspensions with LTB4 did not affect expression of mRNA for neurotrophin receptors (results not shown). Expression of mRNA encoding trkB was consistently found in normal bone marrow cell preparations, whereas the expression of trkA and LNGFR mRNA was variable (Table 2, Fig. 4). In contrast, expression of trkC mRNA could not be observed in any of the normal bone marrow cell preparations. Analyses of neurotrophin receptor expression in bone marrow cells from MPD patients (n 5 3) revealed a similar pattern of expression, although none of these cell preparations expressed trkA mRNA (Table 2).

DISCUSSION

Fig. 3. Levels of BDNF mRNA in bone marrow cells from healthy donors and patients with MPD. Total RNA from bone marrow cells was analyzed for the expression of BDNF mRNA by RPA as described in Materials and Methods. (A) Densitometric scanning was performed on autoradiograms from five healthy donor (Controls) and four patient (MPD) cell preparations. The levels of BDNF mRNA are reported as percentage of the levels of BDNF mRNA in a neuroblastoma tumor tissue (used as positive control), which was arbitrarily set at 100%. Bars represent mean values (Student’s t test; *P , 0.05). (B) Autoradiogram showing BDNF mRNA expression in a normal bone marrow and a bone marrow from an MPD patient. Hybridization to yeast tRNA was used as negative control and to total RNA from a neuroblastoma tumor tissue as positive control.

patients with LTB4 alone or in combination with GM-CSF did not influence the expression of neurotrophin mRNAs (results not shown).

Expression of mRNA for neurotrophin receptors in human granulocytes and bone marrow cells RT-PCR with primers specific for trkA, trkB, and trkC resulted in products of the expected size for trkA (482 bp), trkB (518 bp), and trkC (546 bp) in a human neuroblastoma tumor tissue, which was always used as positive control. Moreover, a single band of the expected size (663 bp) was obtained with primers specific for LNGFR in rat spleen tissue used as positive control (Fig. 4). The identity of the PCR products in controls and samples was also confirmed by digestion with appropriate restriction enzymes and by hybridization with labeled specific DNA probes (results not shown). Laurenzi et al.

In this study we report for the first time the expression of neurotrophin mRNAs in human granulocytes. Thus, these cells expressed mRNA coding for NGF, BDNF, and NT-4, but not for NT-3. In contrast, neurotrophin receptor mRNAs were rarely expressed in human granulocytes. Thus, mRNA encoding trkB or trkC could not be detected and only one out of seven granulocyte preparations expressed trkA and LNGFR mRNA, whereas one sample displayed low levels of trkA mRNA. The finding that mRNAs for trkA and LNGFR were essentially absent in granulocytes is in agreement with our functional studies showing that NGF did not affect leukotriene production induced by the chemotactic peptide N-formyl-methionyl-leucylphenylalanine in the granulocytes [unpublished results]. In contrast, NGF has been demonstrated to stimulate the synthesis of LTC4 in human basophils [28], which express both trkA and LNGFR [18]. Moreover, we did not detect trkB or trkC mRNAs in our granulocyte preparations. Taken together, these findings do not support possible autocrine effects of the neurotrophins in granulocytes. Because circulating granulocytes are the main effector cells in the early stage of the inflammatory reaction, it may be speculated that neurotrophin production by these cells contributes to interactions with other effector cells in the inflamed tissue. The present results demonstrate that sub-nanomolar concentrations of LTB4 induced enhancement of NT-4 mRNA expression in granulocytes. The response was observed at a concentration normally reported to elicit optimal physiological effects in various systems [44–46]. It is interesting to note that the LTB4-induced effect was specific for NT-4, since the expression of NGF and BDNF mRNAs was unchanged. We have previously reported a similar stimulatory effect of LTB4 on NT-4 mRNA expression in rat spleen lymphocytes [14]. These findings may be of interest, because LTB4 is a key activator of granulocytes, displaying a mediatory role in inflammation and hypersensitivity [44]. In addition, LTB4 has been reported to stimulate lymphocytes, either directly or by amplifying cytokine-induced effects [47]. Our findings suggest that LTB4 may modulate the synthesis of NT-4, both in the early phase of inflammation,


231

Fig. 4. Expression of neurotrophin receptor mRNAs in human blood granulocytes and bone marrow cells detected by RT-PCR. (A) One band of the expected size for trkA (482 bp) was amplified from a human neuroblastoma tumor tissue used as positive control (lane 1). RNA from two blood granulocyte (lanes 2 and 3) and three normal bone marrow (lanes 4, 5, and 6) preparations showed a transcript for trkA. (B) One band of the expected size for trkB (518 bp) was amplified from a human neuroblastoma tumor tissue, used as positive control (lane 1). RNA from six normal (lanes 2–7) and two MPD (lanes 8 and 9) bone marrow preparations showed a transcript for trkB. Messenger RNA for trkB was not expressed in blood granulocytes. (C) One band of the expected size for trkC (546 bp) was amplified from a human neuroblastoma tumor tissue (lane 1), in contrast it was not detected in granulocyte (lane 2) or bone marrow cell (lane 3) RNA. (C’) One band of the expected size for LNGFR (663 bp) was amplified from rat spleen tissue, used as positive control (the primers for LNGFR amplified fragments common to the rat and human cDNA sequences; lane 1). RNA from one blood granulocyte preparation (lane 2), two normal (lanes 3 and 4) and one MPD (lane 5) bone marrow preparations showed a transcript for LNGFR. M and M8; DNA molecular size markers.

when granulocytes predominate, and in the advanced stages, when mononuclear cells have been recruited. It has previously been reported that Epstein-Barr virusactivated B lymphocytes express the trkB receptor [38]. In addition, we have detected trkB mRNA in the nonadherent fraction of freshly prepared mononuclear cells from normal human blood [unpublished results]. In agreement, expression of trkB has earlier been reported in murine thymocytes [48]. These results suggest that lymphocytes can be a target for NT-4, released at the site of inflammation. Normal bone marrow cells exhibited a weak expression of TABLE 2.

Expression of Neurotrophin Receptor mRNAs in Bone Marrow Cells Detected by RT-PCR

mRNA

1

2

3

4

5

6

MPD1

MPD2

MPD3

trkA trkB trkC LNGFR

1 1 2 2

1 1 2 2

1 1 2 6

2 1 2 6

2 1 2 nd

nd 1 nd nd

2 2 2 2

2 1 2 6

2 1 2 2

1–6, bone marrow preparations from six normal controls; MPD1–3, bone marrow preparations from three CML patients; nd, not done. The band of the PCR product for LNGFR was visible only after amplification of higher amounts of cDNA.

232



mRNA coding for the neurotrophins. This may in part depend on a low proportion of mature granulocytes or other mature cells in this tissue, which constitutes a heterogeneous population of cells in different stages of maturation. It is interesting to note that the BDNF mRNA levels were significantly higher in bone marrows from the MPD patients compared with normal bone marrow. This may be of importance because it has been postulated that BDNF plays a pivotal role in the survival of neuronal cells by inhibiting apoptosis [49, 50]. Inhibition of apoptosis has been suggested as one of the mechanisms behind the pronounced hypercellularity observed in bone marrows of MPD patients [31]. Although our data are based on a small number of patients, it is nevertheless tempting to speculate whether altered BDNF expression may play a role in the pathophysiology of MPD. Further studies on this issue are warranted. NGF has been suggested to be involved in early hematopoiesis [19]. Similarly, LTB4 and LTC4, which are readily produced by human bone marrow [51, 52], can stimulate GM-CSFinduced normal myelopoiesis in vitro [45]. GM-CSF is a multi-lineage growth factor with proliferative and priming effects, not only on myeloid progenitor cells, but also on more differentiated cells, including end cells. Incubation of bone

marrow cells with LTB4, in the presence or absence of GM-CSF, did not affect the expression of neurotrophin mRNAs. Thus, our data failed to support an interaction between neurotrophins and LTB4 or GM-CSF in human bone marrow. However, the more precise role of these compounds in the regulation of human myelopoiesis needs futher elucidation, e.g., through studies with purified progenitor cell populations. Expression of trkA protein has previously been reported only in mouse bone marrow [19]. In the present study we report for the first time expression of mRNA coding for trkA in normal human bone marrow. In contrast, we failed to detect the trkA transcript in three investigated bone marrows from MPD patients. Although more cases need to be analyzed, it is tempting to speculate whether absence of trkA mRNA expression in the bone marrow may be associated with myeloproliferative disorders. The finding that the LNGFR transcript was only weakly expressed or absent in normal and MPD bone marrow preparations may suggest that this receptor is not involved in potential neurotrophin-induced biological effects in the bone marrow. Although the distribution of mRNA coding for human trkB in neural tissue has been carefully described [53], the present study is among the first reports concerning expression of the trkB transcript in human peripheral tissues. Thus, trkB mRNA was expressed in all six normal bone marrow preparations investigated. In addition, trkB mRNA was also detected in two out of three examined MPD bone marrows. The trkB primers used in RT-PCR were chosen in the cDNA sequence encoding the receptor extracellular region, therefore do not distinguish between the truncated and the full-length trkB transcripts [38], but, more importantly, do not cross-react with trkA or trkC. These findings suggest that trkB may be consistently expressed in human hematopoietic cells and raise the possibility that interaction between trkB and the ligands BDNF or NT-4 may elicit biological responses in hematopoiesis. A biological role for BDNF in the murine immune system has recently been proposed, since trkB was expressed in immature mouse thymocytes and responded to BDNF [48]. In order to understand the possible influence of these neurotrophins in the human hematopoietic system, the subset of myeloid cells expressing this receptor needs to be defined. The mature granulocytes are not likely to express trkB because the transcript was not detected in our peripheral blood granulocyte preparations (as reported above) or in purified basophils (as reported by Bu¨rgi et al. [18]). In conclusion, these results, suggesting neurotrophin production in human granulocytes, extend previous reports concerning a role for these compounds outside the nervous system. Moreover, our findings on expression of neurotrophin receptors in human bone marrow cells indicate that this tissue may be target for neurotrophins. Clearly, further studies are needed to investigate whether the reported expression of mRNA encoding neurotrophins and neurotrophin receptors is accompanied by synthesis of the corresponding proteins. However, it is tempting to speculate that granulocyte-derived BDNF and/or NT-4 may act as hematopoietic growth factors, whereas NT-4, possibly regulated by LTB4, may be a novel modulator involved in inflammatory responses. Laurenzi et al.

ACKNOWLEDGMENTS We acknowledge the skillful technical assistance of Inger Ericsson and Barbro Na¨sman-Glaser and thank Drs. Carlo Ibanez and Thomas Miale for providing the BDNF riboprobe and the neuroblastoma tissues, respectively. We are indebted to Drs. To¨nis Timmusk and Madis Metsis for help in the preparation of the riboprobes and Lars Melin for valuable advice. This project was supported by the Swedish Cancer Society (project no. 2663), the Swedish Medical Research Council (project no. 03X-6805), the King Gustav V’s Jubilee Foundation, the King Gustav V’s 80-years Fund, and Karolinska Institutets Research Funds. M. A. L. was supported by personal grants from the Foundation in Memory of S. and E. Goljies and from the C. M. Lerici Foundation.

REFERENCES 1. Levi-Montalcini, R. (1987) The nerve growth factor: 35 years later. Science 237, 1154–1162. 2. Maness, M. L., Kastin, A. J., Weber, J. T., Banks, W. A., Beckman, B. S., Zadina, J. E. (1994) The neurotrophins and their receptors: structure, function and neuropathology. Neurosci. Biobehav. Rev. 18, 143–159. 3. Thoenen, H., Barde, Y.-A. (1980) Physiology of nerve growth factor. Physiol. Rev. 60, 1284–1335. 4. Bothwell, M. (1995) Functional interactions of neurotrophins and neurotrophin receptors. Annu. Rev. Neurosci. 18, 223–253. 5. Johnson, A., Lanahan, A., Buck, C. R., Sehgal, A., Morgan, C., Mercer, E., Bothwell, M., Chao, M. (1986) Expression and structure of the human NGF receptor. Cell 47, 545–554. 6. Smith, C. A., Farrah, T., Goodwin, R. G. (1994) The TNF receptor superfamily of cellular and viral proteins: activation, co-stimulation and death. Cell 76, 959–962. 7. Dechant, G., Barde, Y. A. (1997) Signalling through the neurotrophins p75NTR. Curr. Op. Neurobiol. 7, 413–418. 8. Ernfors, P., Ibanez, C. F., Ebendal, T., Olson, L., Persson, H. (1990) Molecular cloning and neurotrophic activities of a protein with structural similarities to nerve growth factor. Developmental and topographical expression in the brain. Proc. Natl. Acad. Sci. USA 87, 5454–5458. 9. Holm, A., Leibrock, J., Bailey, K., Barde, Y.-A. (1990) Identification and characterization of a novel member of the nerve growth factor/brainderived neurotrophic factor family. Nature 344, 339–341. 10. Maisonpierre, P. C., Belluscio, L., Squinto, S., Ip, N. Y., Furth, M. E., Lindsay, R. M., Yancopoulos, G. D. (1990) Neurotrophin-3: A neurotrophic factor related to NGF and BDNF. Science 247, 1446–1451. 11. Shelton, D. L., Reichardt, L. F. (1984) Expression of the b-nerve growth factor gene correlates with the density of sympathetic innervation in effector organs. Proc. Natl. Acad. Sci. USA 81, 7951–7955. 12. Timmusk, T., Belluardo, N., Metsis, M., Persson, H. (1993) Widespread and developmentally regulated expression of neurotrophin-4 mRNA in rat brain and peripheral tissues. Eur. J. Neurosci. 5, 605–613. 13. Santanbrogio, L., Benedetti, M., Chao, M. V., Muzaffar, R., Kulig, K., Gabellini, N., Hochwald, G. (1994) Nerve growth factor production by lymphocytes. J. Immunol. 153, 4488–4495. 14. Laurenzi, M. A., Barbany, G., Timmusk, T., Lindgren, J. A˚., Persson, H. (1994) Expression of mRNA encoding neurotrophins and neurotrophin receptors in rat thymus spleen tissue and immunocompetent cells. Regulation of neurotrophin-4 mRNA expression by mitogens and leukotriene B4. Eur. J. Biochem. 223, 733–741. 15. Ehrhard, P. B., Erb, P., Graumann, U., Otten, U. (1993) Expression of nerve growth factor and nerve growth factor receptor tyrosine kinase Trk in activated CD4-positive T-cell clones. Proc. Natl. Acad. Sci. USA 90, 10984–10988. 16. Leon, A., Buriani, A., Dal Toso, R., Fabris, M., Romanello, S., Aloe, L., Levi-Montalcini, R. (1994) Mast cells synthesize, store, and release nerve growth factor. Proc. Natl. Acad. Sci. USA 91, 3739–3743. 17. Ehrhard, P. B., Ganter, U., Bauer, J., Otten, U. (1993) Expression of functional trk proto-oncogene in human monocytes. Proc. Natl. Acad. Sci. USA 90, 5423–5427.


233

18. Bu¨rgi, B., Otten, O., Ochensberger, B., Rihs, S., Heese, K., Ehrhard, P. B., Ibanez, C. F., Dahinden, C. A. (1996) Basophil priming by neurotrophic factors. J. Immunol. 157, 5582–5588. 19. Chevalier, S., Praloran, V., Smith, C., Mac Grogan, D., Ip, N. Y., Yancopoulos, G. D., Brachet, P., Pouplard, A., Gascan, H. (1994) Expression and functionality of the trkA proto-oncogene product/NGF receptor in undifferentiated hematopoietic cells. Blood 83, 1479–1485. 20. Otten, U., Ehrhard, P., Peck, R. (1989) Nerve growth factor induces growth and differentiation of human B lymphocytes. Proc. Natl. Acad. Sci. USA 86, 10059–10063. 21. Stepien, H., Lyson, K., Stanisz, A. M., Pawlikowski, M. (1991) The effect of nerve growth factor on DNA synthesis, cyclic AMP and cyclic GMP accumulation by mouse spleen lymphocytes. Int. J. Immunopharmacol. 13, 51–56. 22. Kimata, H., Yoshida, A., Ishioka, C., Kusunoki, T., Hosoni, S., Mikawa, H. (1991) Nerve growth factor specifically induces human IgG4 production. Eur. J. Immunol. 21, 137–141. 23. Brodie, C., Gelfand, E. (1992) Functional nerve growth factor receptors on human B lymphocytes. Interaction with IL-2. J. Immunol. 148, 3492– 3497. 24. Thorpe, L. W., Warrbach-Perez, K., Perez-Polo, J. R. (1987) Effect of nerve growth factor on the expression of interleukin-2 receptors on cultured human lymphocytes. Ann. NY Acad. Sci. 496, 310–313. 25. Matsuda, H., Coughlin, M. D., Bienenstock, J., Denburg, J. A. (1988) Nerve growth factor promotes human haemopoietic colony growth and differentiation. Proc. Natl. Acad. Sci. USA 85, 6508–6512. 26. Torcia, M., Bracci-Laudiero, L., Lucibello, M., Nencioni, L., Labardi, D., Rubartelli, A., Cozzolino, F., Aloe, L., Garaci, E. (1996) Nerve growth factor is an autocrine survival factor for memory B lymphocytes. Cell 85, 345–356. 27. Tsuda, T., Wong, D., Dolovich, J., Bienenstock, J., Marshall, J., Denburg, J. A. (1991) Synergistic effects of nerve growth factor and granulocytemacrophage colony-stimulating factor on human basophilic cell differentiation. Blood 77, 971–991. 28. Bischoff, S. C., Dahinden, C. A. (1992) Effect of nerve growth factor on the release of inflammatory mediators by mature human basophils. Blood 79, 2662–2669. 29. Aloe, L., Tuveri, M. A., Levi-Montalcini, R. (1992) Nerve growth and distribution of mast cells in the synovium of adult rats. Clin. Exp. Rheumatol. 10, 203–204. 30. Kannan, Y., Ushio, H., Koyama, H., Okada, M., Oikawa, M., Yoshihara, T., Kaneko, M., Matsuda, H. (1991) 2.5 S nerve growth factor enhances survival, phagocytosis, and superoxide production of murine neutrophils. Blood 77, 1320–1325. 31. Gordon, M. Y., Goldman, J. M. (1996) Cellular and molecular mechanisms in chronic myeloid leukaemia: Biology and treatment. Br. J. Haematol. 95, 10–20. 32. Boÿum, A. (1968) Isolation of mononuclear cells and granulocytes from human blood. J. Clin. Lab. Invest. 97 (Suppl. 21), 77–89. 33. Chomczynski, P., Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. 34. Nakagawara, A., Azar, C. G., Scavarda, N. J., Brodeur, G. M. (1994) Expression and function of trkB and BDNF in human neuroblastomas. Mol. Cell. Biol. 14, 759–767. 35. Ip, N. Y., Ibanez, C. F., Nye, S. H., McClain, J., Jones, P. F., Gies, D. R., Belluscio, L., Le Beau, M. M., Espinosa, R., Squito, S. P., Persson, H., Yancopoulos, G. D. (1992) Mammalian neurotrophin-4: structure, chromosomal localisation, tissue distribution, and receptor specificity. Proc. Natl. Acad. Sci. USA 89, 3060–3064.

234



36. Martin-Zanca, D., Oskam, R., Mitra, G., Copeland, T., Barbacid, M. (1989) Molecular and biochemical characterisation of the human trk protooncogene. Mol. Cell. Biol. 9, 24–33. 37. McGregor, L. M., Baylin, S. B., Griffin, C. A., Hawkins, A. L., Nelkin, B. D. (1994) Molecular cloning of the cDNA for human trkC (NTRK3), chromosomal assignment and evidence for a splice variant. Genomics 22, 267–272. 38. Schenone, A., Gill, J. S., Zacharias, D. A., Windebank, A. J. (1996) Expression of high- and low-affinity neurotrophin receptors on human transformed B lymphocytes. J. Neuroimmunol. 64, 141–149. 39. Middlemans, D. S., Lindberg, R. A., Hunter, T. (1991) TrkB, a neural receptor protein kinase. Evidence for a full length and two truncated receptors. Mol. Cell. Biol. 11, 143–153. 40. Southern, E. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503–517. 41. Hofer, M., Pagliusi, S. R., Hohn, A., Leibrock, J., Barde, Y.-A. (1990) Regional distribution of brain-derived neurotrophic factor mRNA in the adult mouse brain. EMBO J. 9, 2459–2464. 42. Maisonpierre, P. C., Belluscio, L., Friedman, B., Alderson, R. F., Wiegand, S. J., Furth, M. E., Lindsay, R. M., Yancopoulos, G. D. (1990) NT-3, BDNF, and NGF in the developing rat nervous system: parallel as well as reciprocal patterns of expression. Neuron 5, 501–509. 43. Maisonpierre, P. C., Le Beau, M. M., Espinosa, R., Ip, N. Y., Belluscio, L., De La Monte, S. M., Squinto, S., Furth, M. E., Yancopoulos, G. D. (1991) Human and rat brain-derived neurotrophic factor and neurotrophin-3: gene structures, distributions and chromosomal localizations. Genomics 10, 558–568. 44. Samuelsson, B., Dahleń, S. E., Lindgren, J. A˚., Rouzer, C. A., Serhan, C. N. (1987) Leukotrienes and lipoxins: structures, biosynthesis, and biological effects. Science 237, 1171–1176. 45. Stenke, L., Mansour, M., Reizenstein, P., Lindgren, J. A˚. (1993) Stimulation of human myelopoiesis by leukotrienes B4 and C4—interactions with granulocyte-macrophage colony-stimulating factor. Blood 81, 352–356. 46. Rossi, P., Lindgren, J. A˚., Kullman, C., Jondal, M. (1985) Products of the lipoxygenase pathway in human natural killer cell cytotoxicity. Cell. Immunol. 93, 1–8. 47. Claesson, H. E., Odlander, B., Jakobsson, P. J. (1992) Leukotriene B4 in the immune system. Int. J. Immunopharmacol. 14, 441–449. 48. Maroder, M., Bellavia, D., Meco, D., Napolitano, M., Stigliano, A., Alesse, E., Vacca, A., Giannini, G., Frati, L., Gulino, A., Screpanti, I. (1996) Expression of trkB neurotrophin receptor during T cell development. Role of brain-derived neurotrophic factor in immature thymocyte survival. J. Immunol. 157, 2864–2872. 49. Suzuki, K., Koike, T. (1997) Brain-derived neurotrophic factor suppresses programmed death of cerebellar granule cells through a posttranslational mechanism. Mol. Chem. Neuropathol. 30, 101–124. 50. Kubo, T., Nonomura, T., Enokido, Y., Hatanaka, K. (1995) Brain-derived neurotrophic factor (BDNF) can prevent apoptosis of rat cellular granule neurons in culture. Brain Res. Develop. Brain Res. 85, 249–258. 51. Stenke, L., Lauren, L., Reizenstein, P., Lindgren, J. A˚. (1987) Leukotriene production by fresh human bone marrow cells: evidence of altered lipoxygenase activity in chronic myelocytic leukemia. Exp. Hematol. 15, 203–207. 52. Lindgren, J. A˚., Stenke, L., Mansour, M., Edenius, C., Laureń, L., Na¨sman-Glaser, B., Ericsson, I., Reizenstein, P. (1993) Formation and effects of leukotrienes and lipoxins in human bone marrow. J. Lipid. Med. 6, 313–320. 53. Shelton, D. L., Sutherland, J., Gripp, J., Camerato, T., Armanini, M. P., Phillips, H. S., Carroll, K., Spencer, S. D., Levinson, A. D. (1995) Human trks: molecular cloning, tissue distribution and expression of extracellular domain immunoadhesins. J. Neurosci. 15, 477–491.