1185-1190
4/4/08
17:16
Page 1185
ONCOLOGY REPORTS 19: 1185-1190, 2008
Expression of Sonic hedgehog signaling pathway correlates with the tumorigenesis of intraductal papillary mucinous neoplasm of the pancreas KENNICHI SATOH1,3, ATSUSHI KANNO1, SHIN HAMADA1, MORIHISA HIROTA1, JUN UMINO1, ATSUSHI MASAMUNE1, SHINICHI EGAWA2, FUYUHIKO MOTOI2, MICHIAKI UNNO2 and TOORU SHIMOSEGAWA1 1
Division of Gastroenterology and 2Department of Gastroenterological Surgery, Tohoku University Graduate School of Medicine, 1-1 Seiryo-machi, Aobaku, Sendai City, Miyagi 980-8574; 3Division of Gastroenterology, Tohoku University Graduate School of Medicine, 1-1 Seiryo-machi, Aobaku, Sendai City, Miyagi 980-8574, Japan Received July 2, 2007; Accepted October 22, 2007
Abstract. Sonic hedgehog (SHH) is frequently expressed in pre-cancerous lesions and carcinoma of the pancreas. A recent study revealed that its expression was higher in the intraductal papillary mucinous neoplasm (IPMN) of the pancreas than in the pancreatic carcinoma. However, the correlation between its signaling pathway and tumorigenesis of IPMN has not yet been well documented. We investigated the expression of mRNA and protein of SHH as well as its downstream transcription factor Gli1 in 19 microdissected lesions from 15 cases and in 75 lesions from 33 cases of the IPMN by one-step quantitative real-time reverse transcription-polymerase chain reaction and immunohistochemistry, respectively. SHH and Gli1 mRNAs were detected in all the examined lesions and 8 out of 19 lesions in IPMNs, respectively. SHH and Gli1 mRNAs were likely to be up-regulated from the adenoma and
_________________________________________ Correspondence to: Dr Kennichi Satoh, Division of Gastroenterology, Tohoku University Graduate School of Medicine, 1-1 Seiryo-machi, Aobaku, Sendai City, Miyagi 980-8574, Japan E-mail:
[email protected] Abbreviations: IPMN, intraductal papillary-mucinous tumor of the pancreas; PanIN, pancreatic intraepithelial neoplasm; SHH, sonic hedgehog; QRT-PCR, quantitative real-time reverse transcriptionpolymerase chain reaction; IPM-A, intraductal papillary-mucinous adenoma; IPM-B, borderline intraductal papillary-mucinous neoplasm; IPM-C, intraductal papillary-mucinous carcinoma; IPMB-C, borderline intraductal papillary-mucinous neoplasm to intraductal papillary-mucinous carcinoma; SMOH, smoothened; PTCH, patched; GAPDH, glyceraldehydes-3-phosphate dehydrogenase; PBS, phosphate-buffered saline
Key words: sonic hedgehog, Gli1, intraductal papillary mucinous neoplasm of the pancreas
from borderline to carcinoma cells, respectively. Immunohistochemical analysis also reported that SHH and Gli1 expression was correlated with the grade of cell atypia. These findings suggested that HH signaling was activated in IPMNs and contributed to tumorigenesis in these types of neoplasms. Introduction Intraductal papillary-mucinous neoplasia (IPMN) of the pancreas is a unique neoplasm that is considered to be a precancerous lesion analogous to adenomatous polyps of the colon (1). The basic favorable prognosis of the patients with IPMN suggests that the dysplastic component may remain in situ for a long time. We previously demonstrated, however, the activation of oncogenes such as K-ras (2,3) and c-erb B-2 (4), accumulation of p53 (3) or the expression of a member of the inhibitor of the apoptosis family, survivin (5) and loss of chromosome 18q (6) in IPMN, suggesting the malignant potential of this neoplasm. In addition, stromal infiltration and distal metastasis have been reported even in this type of tumor (7,8). However, it is still difficult to differentiate the malignant from the benign ones in spite of the establishment of various diagnostic methods for IPMNs. Sonic hedgehog (SHH) expression was frequently seen in pancreatic cancer tissues and in pancreatic intraepithelial neoplasia (PanIN) (9), which is considered to be a precursor lesion of pancreatic cancer, whereas it was undetectable in the islets, acini or ductal epithelium from a normal adult pancreas (10). Pancreata from transgenic mice in which SHH overexpression was driven by the pancreatic-specific Pdx-1 promoter showed abnormal tubular structures, a phenotype of human PanIN-1 and -2 (10). In addition, the Hedgehog (HH) pathway activation induced by the transfection of immortalized human pancreatic ductal epithelial cells with Gli, a downstream mediator of HH signaling, up-regulated the majority of foregut markers seen in PanIN lesions (11). These findings indicate that SHH mediates pancreatic carcinogenesis from an early to a late stage. On the other hand, a recent study revealed that IPMNs expressed a significantly higher level of
1185-1190
4/4/08
17:16
Page 1186
1186
SATOH et al: HEDGEHOG SIGNAL IN PANCREATIC TUMORS
SHH mRNA than pancreatic cancer did and that overexpression of SHH was an early event in the development of IPMN (12). However, to our knowledge, the association of SHH expression with histological malignancy of IPMN and/or involvement of Gli in this type of neoplasm has not yet been well studied. In this study, we investigated the expression of SHH and Gli1 in IPMN tissues in order to assess the role of the hedgehog signaling pathway in tumorigenesis of the IPMN. Materials and methods Tissues. The subjects were a total of 41 cases of IPMN who underwent surgery at the department of gastroenterological surgery at Tohoku University Hospital from January 1995 to March 2007. Informed consent was obtained from all patients before surgery. The tissues collected at the time of surgery were immediately snap-frozen in liquid nitrogen and stored at -80˚C or fixed in 10% paraformaldehyde overnight and embedded in paraffin wax. Nineteen lesions from 15 IPMN samples and 33 IPMN tissues were used for quantitative realtime reverse transcription-polymerase chain reaction (QRTPCR) and immunohistochemistry, respectively. The ductal lesions from IPMNs were histopathologically classified according to the WHO classification with slight modification (2-4): hyperplasia (nonpapillary hyperplasia); intraductal papillary-mucinous adenoma (IPM-A, papillary hyperplasia); borderline intraductal papillary-mucinous neoplasm (IPM-B, atypical hyperplasia) and intraductal papillary-mucinous carcinoma (IPM-C, carcinoma). Microdissection and one-step quantitative real-time RT-PCR. The frozen tissues embedded in the Tissue-Tek O.C.T. compound medium (Sakura, Tokyo, Japan) were cut into 8 μm sections using a cryostat (Jung CM3000, Lica, Nussloch, Germany) and then fixed in cold methanol and stained with toluidine blue. Histologically hyperplastic (including normal duct), adenoma, borderline and cancerous ductal cells from IPMNs, respectively were dissected using LaserScissors Pro300 (Cell Robotics Inc., Albuquerque, NM) according to the manufacturer's protocols (Fig. 1). These microdissected samples were collected in 350 μl of RLT lysis buffer and extracted using an RNeasy micro kit (Qiagen, Hilden, Germany) with DNase I treatment in accordance with the manufacturer's recommendation. One-step quantitative realtime RT-PCR was performed with a QuantiTect SYBR-Green RT-PCR kit (Qiagen) using a LightCycler (Roche diagnostics, Basel, Switzerland). The primer pairs used were SHH (13), forward 5'GAAAGCAGAGAACTCGGTGG3' and reverse 5'GGAAAGTGAGGAAGTCGCTG3'; Gli1 (14), forward 5'CTCCCGAAGGACAGGTATGTAAC3' and reverse 5'CCCTACTCTTTAGGCACTAGAGTTG3'; GAPDH, forward 5'GGCGTCTTCACCACCATGGAG3' and reverse 5'AAGTTGTCATGGATGACCTTGGC3'. All reactions were performed according to the manufacturer's protocol. The specificity of each PCR reaction was confirmed by melting curve analyses. The level of the target gene expression in each sample was normalized to the respective GAPDH expression level. The normalization was done according to the methods previously reported (15).
Immunohistochemistry. Localization of SHH and Gli1 in IPMNs was investigated by immunohistochemistry. The tissue sections were deparaffinized and antigens were retrieved by boiling the sections in Target retrieval solution (Dako, Carpinteria, CA) in the microwave oven. Then, the sections were incubated in methanol with 0.3% hydrogen peroxide for 30 min in order to block the endogenous peroxidase activity. Thereafter, a histofine kit (Nichirei, Tokyo, Japan) was used. After treatment with 10% serum block solution for 30 min at room temperature, the slides were incubated with the polyclonal goat anti-human SHH antibody (Santa Cruz Biotechnology, Inc. Santa Cruz, CA) or the polyclonal rabbit anti-human Gli1 antibody (Chemicon, Temecula, CA) overnight at 4˚C. After being treated with biotinylated antigoat or anti-rabbit IgG for 30 min at room temperature, the sections were incubated with peroxidase-conjugated streptavidin for 30 min at room temperature. Between the incubations, the specimens were washed in phosphate-buffered saline (PBS) three times. Visualization of the immunoreaction was carried out in 0.06 mM 3,3'-diamino-benzidine tetrahydrochloride (Dojin, Kumamoto, Japan) containing 2 mM hydrogen peroxide in PBS for several min at room temperature. For the negative control, the immunostaining processes were performed by replacing the primary antibody with PBS. The negative control sections showed no specific immunoreactivity. The immunostaining of SHH was evaluated as positive when >20% of the cells showed immunoreactivity. Gli1 staining was judged as positive when nuclear expression was detected. The evaluation of immunostaining was done independently by two observers (K.S. and A.K.) who had not been informed of the histological diagnosis. Statistical analysis. Differences between the mRNA expression of SHH or Gli1 and histological grade of IPMN was analysed by Bonferroni analysis and a p-value
