Expression of the neural cell adhesion molecule NCAM by peptide ...

Review

Expression of the Neural Cell Adhesion Molecule NCAM by Peptide- and Steroid-Producing Endocrine Cells and Tumors: Alternatively Spliced Forms and Polysialylation Georgia Lahr, P . D and Artur Mayerhofer, MD Abstract The adhesive properties of neural cell adhesion molecules (NCAMs) can be modified by alternative splicing of the primary transcript or by posttranslational modifications, such as sialylation. In this article, we describe distinct forms of alternative splicing and posttranslational modification of the extracellular domain of NCAM of various endocrine tissues and derived tumor cells of the rat and of steroid- and peptide-hormone producing endocrine cells in humans. NCAM-140 is the major isoform expressed in the rat adrenal gland, adenohypophysis, and in granulosa and granulosa-lutein cells. NCAM-180 is predominant in the neurohypophysis. Polysialylated NCAM is expressed in different endocrine tissues and tumor cells of the rat. Different amounts of NCAM mRNA containing the "extra-exon" VASE at the exon 718 splice boundary were detected in endocrine cells of rats. Human granulosa cells in culture undergo luteinization. During this process, the VASE-containing NCAM isoform is supplemented by an alternatively spliced isoform without this insert. Thus, modifications of NCAM may be important for adhesive interactions in normal and neoplastic endocrine cells. In addition, the differential expression and the alternative splicing of NCAM during luteinization of granulosa cells raise the possibility that NCAM could be involved in folliculogenesis and the formation of the corpus luteum in humans. Key Words: NCAM; alternative splicing; sialylation; folliculogenesis; human; rat.

Introduction Abteilung Anatomie und Zellbiologie der Universit~it Ulm, D-89069 Ulm, Germany (GL); (present address) Division of Neuroscience, Oregon Regional Primate Research Center, 505 NM 185th Avenue, Beaverton, OR 97006 (AM). Address correspondence to Dr. Georgia Lahr, Abteilung Anatomie und Zellbiologie, Universit~itUlm, D-89069 Ulm, Germany.

Endocrine Pathology, vol. 6, no. 2, 91-101, May 1995 9 Copyright 1995 by Humana Press Inc. All rights of any nature whatsoever reserved. 1046-3976/95/6:91-101/$6.20

Neural cell adhesion molecules (NCAMs) represent a family of cell-surface glycoproteins that were initially described in the nervous system in the adult [1-4]. As indicated by their name, these glycoproteins are adhesion molecules, which are thought to be involved in cell sorting, cell assembly, and tissue reorganization, processes that are of fundamental importance in the embryo. It is therefore not surprising that NCAMs seem to play a pivotal role in the morphogenic events during

embryonic development [5], when NCAMs are expressed by a plethora of different cell types. Several excellent reviews on these topics are available [6,7]. In the adult, NCAMs are expressed only by certain cells, including neurons, gila, and muscle cells, suggesting an involvement in the maintenance of tissue architecture. Interestingly, a few years ago NCAM was described to be present in typical endocrine cells, producing peptides and catecholamines (including those of the adenohypophysis and of the endocrine pancreas), as well [8,9]. Recent reviews [7,10] have

91

92

Endocrine Pathology

Volume 6, Number 2

focused on this topic and have suggested that NCAMs can be useful in the characterization of endocrine tumors. Since these reviews have appeared, it became clear that the range of endocrine cells expressing NCAM must be extended to include classical steroid-producing cells. However, at present little is known about the exact nature of the NCAMs expressed by all of these endocrine tissues and endocrine tumors. In view of the adhesive properties of NCAM and its suspected involvement in the maintenance of tissue organization, this may be of crucial importance for the understanding of the interactions of endocrine cells with each other. The primary NCAM-gene transcript is known to be subjected to extensive alternative splicing. Although the significance of the presence of most alternatively spliced NCAM exons is unknown, studies in the nervous system have shown that the presence of a stretch of 10 amino acids, encoded by an alternatively spliced exon called VASE [11,12] strikingly affects cell properties, including adhesion and neurite outgrowth. In addition, posttranslational modifications, namely the addition of polysialic acid (PSA) to NCAMs reduces NCAM-mediated cell adhesion. In the present brief review, we attempt to summarize recently available results on the expression of NCAM by endocrine cells of "dual" endocrine nature (steroid- and peptide-hormone production), and then address NCAM modification in endocrine cells and derived tumors.

Major NCAM Forms, Alternative Splicing, and Posttranslational Modifications of NCAM The neural cell adhesion molecule glycoprotein family belongs to the immuno-

May 1995

globulin supergene family, since the extracellular part of the protein contains five immunoglobulin (Ig)-domains that are homologous to the Ig-domains of antibodies (Fig. 1A, top). The NCAM family consists of three major members with the molecular masses of 120, 140, and 180 kDa, which are generated from a single gene by alternative splicing [6]. A recent review [7] has discussed the sites of expression of these major isoforms of NCAM. NCAM-140 is the major isoform expressed in the rat adrenal gland, adenohypophysis, and pancreatic islets, but NCAM-180 is predominant in the neurohypophysis [9,13]. Also the PC12 cell line, derived from a rat adrenal medullary pheochromocytoma, predominantly expresses NCAM-140 [9,13], in addition to NCAM180. This isoform has also been noted in rat insulinoma cells (RINA2) in addition to NCAM-140 [13]. At least 20 major exons code for these different isoforms [14]. In addition, it became clear that further small exons, which can be present in all three main isoforms, can give rise to additional NCAM-isoforms. At splice site a, between exons 12 and 13, four additional independent alternatively spliced exons of 3--48 bp [11,14-16] and at the exon 7/8 splice junction a 30 bp exon (termed VASE) [11,17] were discovered. If all different combinations identified so far were translated, up to 192 different NCAM proteins could be generated [18], thus making NCAM-expression a very complex mechanism. However, the effects of consequent small changes in the structure of most these NCAM isoforms on cell-cell interaction have not been investigated. The one exception is VASE. The alternatively spliced exon VASE is close to the NCAM domain that mediates cell-cell adhesion [19]. In the nervous system, VASE has been shown to downregulate the

NCAM Modifications in Endocrine Cells

--- G

~

c

~

I C~AC~C, CCCA~-----=.~

FI~nN

I

93

R

I ......

C~CCAG I ~ r

V

.......

[]

EXON7

B

I C~C-CC~ACr

CACTTGTAGTGGACACTCCA

234

56

337 nt *

07 nt

Fig. 1. PCR analysis. (A) Schematic representation of extra-exon VASE localized within NCAM-140 and oligonucleotide primers used for PCR analysis. The five Ig-like domains of the extracellular part of NCAM are shown in the top line. The dark box indicates the cell membrane, which is followed by the C-terminal cytoplasmic part of NCAM. The alternatively spliced exon VASE between exons 7 and 9, which encode the fourth Ig-like domain, is shown. In the lower part of the figure the rat cDNA sequence of exon 7 and exon 9 is given. The sequence of the oligonucleotide primers E7 (sense) and E9 (antisense) correspond to the rat NCAM mRNA sequence [12]. Methods see [28]. (B) PCRanalysis from reverse transcribed RNA samples prepared from endocrine tissues and tumor cells [28]. PCR products of 307 bp (without VASE) and of 337 bp (with VASE; star) are indicated. NCAM RNA with VASE is abundant in the cerebellum, whereas NCAM mRNA without VASE prevails in adrenals and the tumor cell lines examined. Equal amounts of both NCAM mRNA species exist in the pituitary. Lane 1: cerebellum; lane 2: pituitary; lane 3: adrenal; lane 4: PC12; lane 5: GH3; lane 6: RINA2.

neurite growth-promoting effect of NCAM [20]. It is a matter of speculation whether in other VASE-bearing cells a similar function could be expected. Besides alternative splicing, NCAMs can be also posttranslationally modified by mecha-

nisms, including sulfation, phosphorylation, myristinylation, and sialylation. Modulation of adhesion arises from differences in length of homopolymers of 0~(2,8)-linked-neuraminic acid units (PSA) [21,22] probably linked to the fifth Ig-like

94

Endocrine Pathology

Volume 6, Number 2

domain of NCAM [23]. PSA linked to NCAM appears to decrease cell adhesion but enhances neurite outgrowth [24,25]. This indicates that VASE and PSA modulate NCAM functions in opposite ways.

NCAM Expression by "Dual" Endocrine Cells of the Gonads Similarities during development and functional characteristics reveal a close relationship between many endocrine cells and neurons. NCAMs have first been found in the nervous system, but subsequently also in polypeptide hormone and surprisingly in "dual" steroid- and peptideproducing endocrine cells in the rodent ovary [26], the testis [27], and the adrenal [28]. For example, granulosa cells, thecainterstitial and luteal cells in the ovary express NCAM-140 [26]. In contrast to the ovary, NCAM-120 is found in Leydig cells of adult rodent testes [27], but after a brief culture period, NCAM-140 and NCAM-180 become coexpressed, as well. Moreover, the mouse Leydig cell-derived cell lineTM3 also express NCAM (Mayerhofer, unpublished). Most of these results on gonadal expression of NCAM have been confirmed by independent groups (ovary [29], Leydig cells [30]). NCAM-140 appears to be expressed, moreover, by subtypes ofcorpus-luteum-derived microvessels [31], hinting at a crucial involvement of NCAM in the dynamic processes of remodeling of all endocrine compartments of ovary. The complexity of these events in situ have until the present time hampered detailed analysis of the NCAM modification by individual cells. Few details are known. These include the fact that PSA associated with NCAM appears to be present in the gonads and evidence for the presence of extra-exons have been found as well [27]. We have studied

May 1995

recently human granulosa cells, which express NCAM-140 [32]. Molecular biological techniques are available to investigate alternatively spliced "extra-exons" like VASE, which is situated in the fourth IGlike domain of NCAM between exons 7 and 8 (Fig. 1A). Applying reverse transcription PCR, using oligonucleotide primers downstream and upstream, the exon 718 splice junction transcripts with and without VASE were detected in human granulosa cells. During time in culture, these cells change their growth behavior, a change associated with the appearance of NCAM forms devoid of VASE. In summary, although many questions remain to be answered, the existing results clearly indicate that NCAMs are factors involved in the regulation of important processes in the gonads at the cellular level. Thus, there is accumulating evidence for a functional significance of NCAM in the ovary and in other polypeptide hormone- and steroid hormone-producing endocrine cells in humans and in rodents. We now focus on alternatively spliced NCAM isoforms and sialylation of NCAM in the gonads and endocrine tissues.

Selective Expression of Alternatively Spliced NCAM Forms: Extra-Exon VASE and aTs/AAG Transcripts with and without VASE, coding for the 10 amino acid sequence, were detected in rat pituitaries, adrenals, and the different endocrine tumor cell lines (Fig. 1B) [24]. In accordance with a previous report [17], the adult adrenal gland expresses small amounts of N C A M mRNAs that contain VASE. In the rat pituitary the amounts of VASE-containing mRNA vs non-VASE mRNA were balanced. The tumor cell lines (PC12,

95


RINA2, and GH3) expressed less of the spliced VASE variant (Fig. 1B). Exon VASE would contribute 10 additional amino acids in the fourth Ig-like domain and this exon can be present in mRNAs coding for all three major NCAM isoforms [14]. The position of this insert of 10 amino acids within the fourth NCAM Ig-like loop is reminiscent to the position of amino acids that make up the hypervariable regions of the Ig-polypeptides. Since similar sequence alterations affect the structure and function of Ig domains [33], this alternative exon could conceivably alter the ability of NCAM to mediate adhesion during development. Indeed, a modification as a consequence of an alternative splicing event greatly affects the function of NCAM. The functional significance of extra-exon VASE in endocrine cells is still an enigma. As mentioned, in neurons, however, it has recently been shown that alternative exon VASE downregulates the neurite outgrowth activity of NCAM- 140 [20]. As verified earlier, human granulosa and granulosa-lutein cells contain NCAM mRNAs expressing VASE to different extents [32]. It is conceivable that altered NCAM forms could account for various degrees of cellular "adhesiveness," and that the change in the amounts of NCAM isoforms with or without exon VASE, when granulosa cells undergo luteinization, could affect NCAM function. Alternatively spliced "extra-exons" at splice site a were investigated using another technique, namely, S 1 nuclease protection analysis (S 1-NPA). Hybridizing a labeled eDNA probe (Fig. 2A), including the "extra-exon" aIs/AAG at the exon 12/13 junction, to extracted cellular RNAs of the different endocrine rat tissues and tumor cells resulted in different protected fragment after nuclease digestion of nonhybridized portions of the labeled probe [28]. The

15 nucleotides of the extra-sequences described by Dickson [34] termed exon a15 with or without an additional AAG trinucleotide [11,14,18] were present in the pituitary as well as in the cerebellum that was used as a control, but not in other tissues or tumor cells analyzed (Fig. 2B). However, the main NCAM mRNA populations in this tissues were composed of the constitutive exons exl2-exl3, i.e., with no alternative exons in between. Within the resolution of S1-NPA (Fig. 2B), rat insulinoma (RINA2), rat pheochromocytoma (PC12), and the rat adenohypophysis tumor cell lines (GH3) were devoid of the ex 12-a15with or without AAG-ex 13 arrangement in NCAM mRNA. In addition, fragments of about 339 nt observed in S1-NPA indicate possible further modifications, such as alternative exons a42, or a48 with or without an AAG triplet between the exons 12 and 13. In contrast to VASE, the functional consequences of the insertion of alternative "extra-exons" at the exon 12/13 splice junction in the coding region of the NCAM molecule of endocrine pituitary cells still remain to be investigated.

Polysialylation of NCAM One of the most striking features of NCAM is its degree of developmentally regulated polysialylation. The long polysialic acid units composed of 0~-(2,8)linked N-acetylneuraminic acid units are found almost exclusivelyon NCAM in vertebrates and not associated with other proteins [35-38]. However, a recent study has shown that this type of PSA is also associated with sodium channels in the brain [39]. Posttranslationally added PSA appears to affect the homophilic binding of NCAM by altering conformation, by

96

Endocrine Pathology

A

V o l u m e 6, N u m b e r 2

L,dl

M a y 1995

IE141E1SI, cDNA

E13 4 8 5 nt

i

I

cDNA probe 4 3 5 nt

protected fragments

3 2 4 nt

93 nt

3 3 9 nt

93 nt

B 622 404

.

t.~l~

435 nt 339nt

309

3 2 4

nt

I

217

-

110 nt

123456

Fig. 2. Sl-nuclease protection analysis. (A) Scheme of the single-stranded cDNA and cRNA probes used for $1 nuclease protection assaysand in situ hybridization [28]. The cDNA-probe (485 nt) synthesized from the mouse eDNA clone (DW22) is shown in the top line. It includes parts of exons 10, 11, and 12 totally, and parts of exon 13, and contains at the splice site a the "extra-exon sequences" aIs/AAG shown as a black box. The 435 nt fragment protected from $1 nuclease hydrolysis indicatesthe presence of these "extra-exon" sequences, whereas the protected fragments of 324 and 93 nt indicate their absence. The Hindlll restriction site is indicated by an arrow. The thin lines correspond to vector sequences. (B) Sl-nuclease protection analysis of extracted RNA from rat tumor cells [28]. NCAM mRNA with "extra-exon" als/+__AAG is only present in cerebellum, as indicated by the protected band of 435 nt (arrowhead; lane 6). NCAM mRNAs of the tumor cells examined do not contain this "extra-exon" as a single insertion. The main bands of 324 nt and 93 nt indicate that all endocrine tissues and tumor cells contain NCAM mRNA with no "extra-exon" inserted. The 485 nt band in lane 2 represents undigested probe containing flanking vector sequences. The protected band with the size of 339 nt corresponds to NCAM mRNAs containing "extra-exon" a~s and another "extraexon" (e.g., a~ and/or a42). Lane 1: size marker; lane 2: probe DW22 (485 nt); lane 3: PC12; lane 4: GH3; lane 5: RINA2; lane 6: cerebellum.


Fig. 3. Immunocytochemical detection of PSA linked to NCAM in sections of the rat pituitary [48]. Polysialylated NCAM is localized predominantly in the mixed cell population of the anterior lobe and in the pars intermedia by using the monoclonal MoAB735 PSA-antibody, followed by the ABC-detection method [49]. ah: adenohypophysis; pi: pars intermedia; nh: neurohypophysis.

simple charge repulsion or direct steric hindrance [22]. The amount of sialic acid decreases during development, suggesting that changes in the amount of sialic acid are used as a mechanism to modulate NCAM activity in vivo [40]. The importance of PSA linked to NCAM-180 in the development of the brain has been elegantly investigated in a mouse with targeted deletion of NCAM-180-specific exon 18 [41]. This study reveals conspicuous changes, especially in olfactory bulb development, owing to a failure of precursor cells to migrate. Since distinct abnormalities were noted in other brain regions, as well, a general defect in the ability of cells to migrate is assumed and is most likely owing to the inability of cells to express NCAM-180-PSA. In addition, it has been speculated that the consequence of complete inactivation of the NCAM gene in mice, such as reduced weight of the brain and a marked deficit in spatial learning [42] is mainly owing to the loss of NCAM-linked PSA.

97

In order to investigate whether posttranslationally modified NCAM by sialic acid homopolymers is expressed in endocrine tissues and tumor cells, an antibody directed against the PSA-epitopes linked to NCAM, as well as an antibody directed against the Ig-like domains present in all three main NCAM isoforms, was used [28]. In the anterior lobe of the rat hypophysis, most of the endocrine cells were heavily labeled with the PSA-antibody, whereas only a small percentage of cells appeared to be unstained (Fig. 3). In contrast, the immunoreactivity of the cells of the intermediate lobe was low. Thus, polysialylated NCAM is not homogeneously expressed by all cells of the adenohypophysis. Double-labeling studies, for example, would be required to precisely demonstrate the phenotype of the NCAMPSA-bearing cells. The presence of heavily sialylated NCAM in the anterior lobe could be related to the cell type and/or functional, hormonal plasticity of the pituitary cells. A very good example for functional and hormonal plasticity of pituitary cells are the acidophilic cells, which secrete prolactin and/or growth hormone, depending on the input of steroids and hypothalamic factors [43]. Since the majority of the anterior pituitary cells are indeed acidophils, it appears likely that they are among the PSAand NCAM-bearing cells. However, these results are in contrast to those obtained in different studies [44,45]. The first study [44] indicated a high expression of NCAM in both the neurohypophysis and the adenohypophysis. In the second case [45], a high expression of NCAM-PSA was seen in the neurohypophysis. Our results suggested also that PSA linked to NCAM is more abundant in the adrenal cortex (see zona reticularis [III]) than in the adrenal medulla ([IV]; Fig. 4). Within the cortex, the cells in the zona glomerulosa appeared

98

Endocrine Pathology

V o l u m e 6, N u m b e r 2

Fig. 4. Detection of NCAM with the used antiserum against Ig-like domains of the mouse NCAM (corresponds to position 212-1635 of cDNA; [18]) in a section of the adrenal gland by immunocytochemistry. NCAM was detected predominantly in the cortical region of adrenals. In this figure from the cortical region only the zona reticularis (111)is shown. Less NCAM was observed in the medulla (IV), however, NCAM immunoreactivity was confined to the cell surface of cell clusters.

~ii!i ~:~

~84!iiiiii)i ~i

iliiii .... iiii~i:

L i Fig. 5. Polysialylated NCAM is present in the endocrine tumor cell line RINA2 as detected immunocytochemically using the PSA-antibody as described in the legend to Fig. 3.

to contain more of these surface components than the other parts [28]. A similar distribution of NCAM has been noted in an other study [46], although these authors

M a y 1995

also found strong expression of NCAM in medullar cells, a finding shown furthermore by another group [44]. The functions of adrenal cortical cells are regulated by angiotensin II and adrenocorticotropic hormone. Furthermore, the zona glomerulosa may be regarded as a regenerative zone of the adrenal cortex [47] and cells of the zona glomerulosa might lose NCAM immunoreactivity and PSA following migration to the zona fasciculata. Similarly to the situation in the adenohypophysis, the occurrence of PSA linked to NCAM may help to explain the capability of the adrenal cortex to respond to a variety of physiological stimuli. A further example of the presence of PSA linked to NCAM in a system of extensive remodeling controlled by hormones is the ovary. There, granulosa cells contain PSA attached to NCAM [26]. Besides isoform-switching (e.g., exclusion of the VASE exon), changes in the function of NCAM may also be accomplished by posttranslational changes (e.g., loss ofpolysialic acid modifications). Clearly, the precise role played by NCAMlinked PSA during remodeling in these various organs remains to be investigated. An interesting model system for the study of NCAM-mediated processes are tumor cell lines, since the cell lines RINA2 (Fig. 5), PC12, and GH3 also exhibited intense NCAM-PSA immunoreactivities that were confined to cell surfaces and were particularly intense at contact sites between the cells [28]. On the other side, these cell lines also express a low-sialylated NCAM isoform [9,13]. The combination of high sialylated as well as low sialylated NCAMs thus indicates possible complex involvement of these different forms of NCAM in cellcell interactions between the tumor cells. In summary, NCAMs modified in several ways are present in a variety of endocrine cells including adrenal, gonadal, and


pituitary cells. Thus, posttranscriptional and posttranslational modifications of NCAM, may modulate the function of NCAMs and subsequent processes in peptide- and steroid-hormone producing endocrine tissues and endocrine tumor cells in rodents and in humans in a similar way as observed in other systems.

Acknowledgments The authors would like to thank Sabine Gruchmann, for expert technical assistance, as well as Dagmar Barthels, Wolfgang Wille (both K/Jln, Germany), Karl Sterzik, and Manfred Gratzl (Ulm, Germany). The authors also thank Annette Christoph (K/51n, Germany) for supplying the polyclonal antiserum against the Ig-like domains of NCAM, and also Dieter Bitter-Suermann (Hannover, Germany) is gratefully acknowledged for the generous gift of the monoclonal antibody. The authors thank Margit Rudolf, R. Zienecker, Ilse Urban, and Wolfgang Podschuweit for expert technical assistance. Financial support for these studies was provided by a grant from Deutsche Forschungsgemeinschaft Ma 1080/2-1 as well as by the Deutsche Krebshilfe.

References 1. Edelman GM. Cell adhesion molecules. Science 219:450-457, 1983. 2, Edelman GM. Expression of cell adhesion molecules during embryogenesis and regeneration. Exp Cell Res 161:1-16, 1984. 3. Edelman GM. Cell surface modulation and marker multiplicity in neural patterning. Trends Neurosci 7/3:78-84, 1984. 4. Rutishauser U. Developmental biology of a neural cell adhesion molecule. Nature 310:549-554, 1984. 5. Edelman GM. Morphoregulatory molecules. Biochemistry 27:3533-3543, 1988.

99 6. Edelman GM, Crossin KL. Cell adhesion molecules: implications for a molecular histology. Annu Rev Biochem 60:155-190, 1991. 7. Langley OK, Gratzl M. Neural cell adhesion molecule NCAM in neural and endocrine cells. In: Gratzl M, Langley K., eds. Markers for neural and endocrine cells. Molecular and cell biology, Diagnostic Applications. Verlag Chemie, Weir&elm, Germany, 1991; 133-I 78. 8. Aletsee-Ufrecht MC, Langley OK, Gratzl O, Gratzl M. Differential expression of the neural cell adhesion molecule NCAM140 in human pituitary tumors. FEBS Lett 272:4549, 1990. 9. Langley OK, Aletsee-Ufrecht MC, Grant N, Gratzl M. Expression of neural cell adhesion molecule NCAM in endocrine, cells. J Histochem Cytochem 37:781-791, 1989. 10. Lahr G, Langley K, Vereczkey C, Gratzl O, Gratzl M. Secretory vesicle and ceil surface markers for human endocrine pancreatic and pituitary tumors. Endocr Pathol 3:165-172, 1992. 11. Santoni M-J, Barthels D, Vopper G, Boned A, Goridis C, Wille W. Differential exon usage involving an unusual splicing mechanism generates at least eight types ofNCAM cDNA in mouse brain. EMBO J 8:385-392, 1989. I2. Small SJ, Shull GE, Santoni M-J, Akeson R. Identification ofa cDNA clone that contains the complete coding sequence for a I40-kD rat NCAM polypeptide. J Cell Biol 105: 2335-2345, 1987. 13. Langley OK, Aletsee MC, Gratzl M. Endocrine cells share expression of N-CAM with neurons. FEBS Lett 220:108-112, 1987. 14. Reyes AA, Small SJ, Akeson R. At least 27 alternatively spliced forms of the neural cell adhesion molecule mRNA are expressed during rat heart development. Mol Cell Biol 11:1654-1661, 1991. t 5. Barthels D, Vopper G, Boned A, Cremer H, Wille W. High degree of NCAM diversity generated by alternative RNA splicing in brain and muscle. EurJ Neurosci 4:327-334, 1992. 16. Predinger EA, Hoffman S, Edelman GM, Cunningham, BA. Four exons encode a 93base-pair insert in three neural cell adhesion molecule mRNAs specific for chicken heart and skeletal muscle. Proc Natl Acad Sci USA 85:9616-9620, 1988.

100

Endocrine Pathology

Volume 6, Number 2

17. Small SJ, Akeson R. Expression of the unique NCAM VASE exon is independently regulated in distinct tissues during development. J Cell Biol 111:2089-2096, 1990. I8. Barthels D, Santoni M-J, Wille W, Ruppert C, Chaix J-C, Hirsch M-R, Fontecilla-Camps JC, Goridis C. Isolation and nucleotide sequence of mouse NCAM cDNA that for a Mr 79,000 polypeptide without a membranespanning region. EMBO J 6:907-914, 1987. 19. Rao Y, Wu X-F, Gariepy J, Rutishauser U, Siu C-H. Identification of a peptide sequence involved in homophilic binding in the neural cell adhesion molecule NCAM. J Cell Biol 118:937-949, 1992. 20. Doherty P, Moolenaar CECK, Ashton SV, Michalides RJAM, Walsh FS. The VASE exon downregulates the neurite growth-promoting activity of NCAM 140. Nature 356:791-793, 1992. 21. Finne J, Deagostini-Bazin H, Goridis C. Occurrence of tx2-8-1inked polysialosyl units in neural cell adhesion molecule. Biochem Biophys Res Commun 112:482487, 1983. 22. Hoffman S, Edelman GM. Kinetics of homophilic binding by E and A forms of the neural cell adhesion molecule. Proc Natl Acad Sci USA 80:5762-5766, 1983. 23. Rutishauser U, Jessell TM. Cell adhesion molecules in vertebrate neural development. Physiol Rev 68:819-857, 1988. 24. Doherty P, Cohen J, Walsh FS. Neurite outgrowth in response to transfected NCAM changes during development and is modulated by polysialic acid. Neuron 5:209-219, 1990. 25. Rutishauser U, Acheson A, Hall AK, Sunshine J. N-CAM as a regulator for cell-cell interactions. Science 240:53-57, 1988. 26. Mayerhofer A, Lahr G, Gratzl M. Expression of the neural ceil adhesion molecule (NCAM) in endocrine cells of the ovary. Endocrinology 129:792-800, 1991. 27. Mayerhofer A, Seidl K, Lahr G, BitterSuermann D, Christoph A, Barthels D, Wille W, Gratzl M. Leydig cells express neural cell adhesion molecules in vivo and in vitro. Biol Reprod 47:656-664, 1992. 28. Lahr G, Mayerhofer A, Bucher S, Barthels D, Wille W, Gratzl M. Neural cell adhesion molecule in rat endocrine tissues and tumor cells. Endocrinology 132:1207-1217, 1993.

May 1995

29. Moiler CJ, ByskovAG, RothJ, Cells JE, Bock E. NCAM in developing mouse gonads and ducts. Anat Embryol 184:541-548, 1991. 30. Davidoff MS, Schulze W, Middendorff R, Holstein A-E The Leydig cell of the human testis--a new member of the diffuse neuroendocrine system. Cell Tissue Res 271:429-439, 1993. 31. Mayerhofer A, Spanel-Borowski K, Watkins S, Gratzl M. Cultured microvascular endothelial cells derived from the bovine corpus luteum possess NCAM-140. Exp Cell Res 201:545-548, 1992. 32. Mayerhofer A, Lahr G, Fr/Shlich U, Zienecker R, Sterzik K, Gratzl M. Expression and alternative splicing of the neural cell adhesion molecule NCAM in human granulosa cells during luteinization. FEBS Lett 346:207-212, 1994. 33. Williams AF, Barclay AN. The immunoglobulin superfamily: domains for cell surface recognition. Annu Rev Immunol 6:381405, 1988. 34. Dickson GH, Gower HJ, Barton CH, Prentice HM, Elsom VL, Moore SE, Cox RD, Quinn C, Putt W, Walsh FS. Human muscle cell adhesion molecule (N-CAM): identification of a muscle-specific sequence in the extracellular domain. Cell 50:1119-1130, 1987. 35. Bitter-Suermann D, Roth J. Monoclonal antibodies to polysialic acid reveal epitope sharing between invasive pathogenic bacteria, differentiating ceils and tumor cells. Immunol Res 6:225-237, 1987. 36. Roth J, Rutishauser U, Troy FA. Polysialic acid. From microbes to man. Birkh~iuser Verlag, Basel, Switzerland, 1993. 37. Rougon G, Dubois C, Buckley N, Magnani L, Zollinger W. A monoclonal antibody against meningococcus group B polysaccharide distinguishes embryonic from adult NCAM. J Cell Biol 103:2429-2437, 1986. 38. Theodosis DT, Rougon G, Poulain DA. Retention of embryonic features by an adult neuronal system capable of plasticity: polysialylated neural cell adhesion molecule in the hypothalamo-neurohypophyseal system. Proc Natl Acad Sci USA 88:5494-5498, 1991. 39. Zuber C, Lackie PM, Catteral WA, Roth J. Polysialic acid is associated with sodium channels and the neural cell adhesion molecule NCAM in the adult rat brain. J Biol Chem 267:9965-9971, 1992.

NCAM Modifications in Endocrine Cells 40. Edelman GM, Chuong CM. Embryonic to adult conversion of neural cell adhesion molecules in normal and staggerer mice. Proc Natl Acad Sci USA 79:7036-7040, 1982. 41. Tomasiewicz H, Ono K, Yee D, Thompson C, Goridis C, Rutishauser U, Magnuson T. Genetic deletion of a neural cell adhesion molecule variant (N-CAM- 180) produces distinct defects in the central nervous system. Neuron 11:1163-1174, 1993. 42. Cremer H, Lange R, Christoph A, Plomann M, Vopper G, Roes J, Brown R, Baldwin S. Kraemer P, Scheff S, Barthels D, Rajewesky K, Wille W. Inactivation of N-CAM gene in mice results in size reduction of the olfactory bulb and deficits in spatial learning. Nature 367:455-459, 1994. 43. Frawley LS, Boockfor FR. Mammosomatotropes: presence and functions in normal and neoplastic pituitary tissue. Endocr Rev 12:337-355, 1991. 44. Grant NJ, Leon C. Aunis D, Langley K. Cellular localization of the neural cell adhesion molecule L1 in adult rat neuroendocrine and endocrine tissues: comparisons with NCAM. J Comp Neurol 325:548-558, 1992.

101

45. Kiss JZ, Wang C, Rougon G. Nerve-dependent expression of high polysialic acid neural cell adhesion molecule in neurohypophyseal astrocytes of adult rats. Neuroscience 53:213221, 1993. 46. Pohorak M, Shimoda K, Freed WJ. Cell adhesion molecules (CAMs) in adrenal medulla in situ and in vitro: enhancement of chromaffin cell LI/Ng-CAM expression by NGE Exp Neurol 110:52-72, 1990. 47. Nussdorfer GG. Cytophysiology of the adrenal cortex. Int Rev Cytol 98:319-381, 1986. 48. Frosch M, Gorgen I, Boulnois GJ, Timmis KN, Bitter-Suerman D. NZB mouse system for production of monoclonal antibodies to weak bacterial antigens: isolation of an IgG antibody to the polysaccharide capsules of Escherichia coil K1 and group B meningococci. Proc NatI Acad Sci USA 82:11941198, 1985, 49. Hsu SM, Raine L, Fanger HJ. Use ofavidinbiotin-peroxidase (ABC) in immunoperoxidase technique: a comparison between ABC and unlabelled antibody (PAP) procedures. J Histochem Cytochem 29:577-580, 1981.