Expression of the Nonmuscle Myosin Heavy Chain IIA ...

J Am Soc Nephrol 13: 65–74, 2001

Expression of the Nonmuscle Myosin Heavy Chain IIA in the Human Kidney and Screening for MYH9 Mutations in Epstein and Fechtner Syndromes CHRISTELLE ARRONDEL,* NICOLAS VODOVAR,* BERTRAND KNEBELMANN,† ¨ NFELD,† MARIE-CLAIRE GUBLER,* CORINNE ANTIGNAC,* and JEAN-PIERRE GRU LAURENCE HEIDET* *Inserm U 423, Universite´ Rene´ Descartes, Hoˆpital Necker-Enfants Malades, Paris, France; †Service de Ne´phrologie, Hoˆpital Necker, Paris, France.

Abstract. Mutations in the MYH9 gene, which encodes the nonmuscle myosin heavy chain IIA, have been recently reported in three syndromes that share the association of macrothrombocytopenia (MTCP) and leukocyte inclusions: the MayHegglin anomaly and Sebastian and Fechtner syndromes. Epstein syndrome, which associates inherited sensorineural deafness, glomerular nephritis, and MTCP without leukocyte inclusions, was shown to be genetically linked to the same locus at 22q12.3 to 13. The expression of MYH9 in the fetal and mature human kidney was studied, and the 40 coding exons of the gene were screened by single-strand conformation polymorphism in 12 families presenting with the association of MTCP and nephropathy. MYH9 is expressed in both fetal and mature kidney. During renal development, it is expressed in the

late S-shaped body, mostly in its lower part, in the endothelial and the epithelial cell layers. Later, as well as in mature renal tissue, MYH9 is widely expressed in the kidney, mainly in the glomerulus and peritubular vessels. Within the glomerulus, MYH9 mRNA and protein are mostly expressed in the epithelial visceral cells. Four missense heterozygous mutations that are thought to be pathogenic were found in five families, including two families with Epstein syndrome. Three mutations were located in the coiled-coil rod domain of the protein, and one was in the motor domain. Two mutations (E1841K and D1424N) have been reported elsewhere in families with MayHegglin anomaly. The two others (R1165L and S96L) are new mutations, although one of them affects a codon (R1165), found elsewhere to be mutated in Sebastian syndrome.

The association of hereditary nephritis with platelet abnormalities was first reported by Epstein et al. (1) in 1972. Those authors studied two families with macrothrombocytopenia (MTCP), deafness, and nephritis, a syndrome that appeared to be autosomal dominant. The platelet disorder was characterized by thrombocytopenia, giant platelets, and ultrastructural and functional platelet abnormalities. In Fechtner syndrome, patients are affected with nephritis and MTCP as well. However, they also have cataracts and small, pale blue cytoplasmic inclusions within the neutrophils and eosinophils that were not described in families with Epstein syndrome (2). Leukocyte inclusions are also observed in two other autosomal dominant MTCP without renal, ocular, or hearing defects: Sebastian syndrome and the May-Hegglin anomaly (3,4). The renal disease in Epstein and Fechtner syndromes is progressive glomerular nephropathy. Patients present with hematuria and protein-

uria and develop renal failure. End-stage renal disease does not generally occur before the fourth or fifth decade of life; however, progression to end-stage renal disease during childhood has been reported (5). Renal histology shows variable and nonspecific abnormalities, including varying degrees of mesangial cell proliferation and mesangial matrix expansion and some tubular atrophy. Electron microscopy shows mesangial alterations, focal or diffuse effacement of podocyte foot processes, and alterations of the glomerular basement membrane (GBM). Thickening, basket-wave splitting, and rarefaction of the GBM have been reported. These alterations are reminiscent of the ultrastructural GBM lesions observed in Alport syndrome, a progressive inherited hematuric nephropathy frequently associated with sensorineural hearing loss and resulting from an alteration in one of the three chains of type IV collagen that are mainly expressed in the GBM: ␣3, ␣4, and ␣5(IV). For this reason, the kidney disease associated with MTCP is usually described as an Alport-like nephropathy. However, GBM alterations in Fechtner and Epstein syndromes have mostly a focal distribution and, except in rare cases (5), are not specific to Alport syndrome. Recently, the May-Hegglin anomaly and Sebastian and Fechtner syndromes have been shown to be genetically linked to the same locus at 22q12.3-13.1 (6 – 8), which suggests that these three dominant MTCP were allelic. Indeed, mutations in the MYH9 gene, which encodes the nonmuscle myosin heavy

Received June 4, 2001. Accepted August 3, 2001. Correspondence to Dr. Corinne Antignac, INSERM U423- Tour Lavoisier 6eme e´tage, Hoˆpital Necker-Enfants Malades, 149 rue de Se`vres, 75743 Paris Cedex 15, France. Phone: 33-1-44-49-50-98; Fax: 33-1-44-49-02-90; E-mail: [email protected] Dr. Clifford Kashtan served as Guest Editor and supervised the review and final disposition of this manuscript. 1046-6673/1301-0065 Journal of the American Society of Nephrology Copyright © 2001 by the American Society of Nephrology

66

Journal of the American Society of Nephrology

chain IIA, were subsequently identified in patients affected with these diseases (9 –11). Epstein syndrome was shown to be genetically linked to 22q11-13 as well (12), but no mutations have been reported in this syndrome so far. MYH9 encodes a nonmuscle myosin II heavy chain, chain IIA. Myosins II (or conventional myosins) are hexameric twoheaded motor proteins composed of two heavy chains and two pairs of light chains. Each heavy chain contains a motor domain (or head) that interacts with actin and binds ATP and a two-helix coiled– coil-forming sequence that homodimerizes to form a long rod (or tail). Multiple myosin II molecules associate through their tail domain to form bipolar filaments (13). In nonmigrating cells in vertebrates, nonmuscle myosins II are mainly expressed in the cell cortex and in stress fibers (13). Vertebrates have two nonmuscle myosin heavy chains, IIA and IIB, that are encoded by two distinct genes, MYH9 and MYH10, respectively (14). Most cells express both isoforms, with a few exceptions, such as platelets, which only express nonmuscle myosin IIA (12). Kidney contains relatively large amounts of both mRNAs (14). However, little is known about the cellular expression of nonmuscle myosins within the kidney and their potential function.


As a first step in the understanding of the nephropathy associated with MTCP, we studied MYH9 expression in the human kidney and screened 12 families affected with MTCP and progressive nephropathy for MYH9 mutations.

Materials and Methods Patients Twelve unrelated families with at least one individual presenting with the association of MTCP and nephropathy were investigated. Pedigrees are summarized in Figure 1. All individuals affected with nephropathy had proteinuria. Information regarding hematuria was not always available, but hematuria was present in most patients. Ten patients reached end-stage renal failure. The age at end-stage renal failure is indicated in Figure 1. None of the patients had congenital cataracts. Deafness was reported in nine families (families 1, 4 to 7, and 9 to 12). Leukocyte inclusions were detected in three cases (families 5, 7, and 10). No information regarding leukocyte morphology was available in six families (1, 4, 6, 8, 11, and 12). Three families (2, 3, and 9) were affected with Epstein syndrome (that is, association of nephropathy and MTCP without polynuclear inclusions). However, inclusion bodies were screened only by optic microscopy after May-Gru¨ nwald-Giemsa staining. In family 10, the affected male patient was found to have hypercholesterolemia and

Figure 1. Pedigrees of the 12 families affected with macrothrombocytopenia (MTCP) and nephropathy. MTCP: Ä ; Nephropathy: Á ; Hearing loss: Â ; Leukocyte inclusions: Ã . For individuals having reached end-stage renal failure (ESRF), the age at ESRF is indicated below the pedigree symbols.


abnormal liver enzymes (levels of transaminase and alkaline phosphatase were slightly elevated) that were not investigated further. Blood samples for DNA analysis were collected from one index case and, when possible, from other individuals in the family. Informed consent was obtained from all individuals or their parents, according to French legislation.

Tissues Normal fetal kidneys were obtained at autopsy from three fetuses (at 12, 15, and 26 gestational weeks) after spontaneous abortion. Two normal mature kidneys not used for transplantation were also used for the study. Specimens were immediately snap-frozen in liquid nitrogen and stored at ⫺80°C until use or fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) solution before paraffin embedding.

Methods Riboprobes Transcription and In Situ Hybridization. Two MYH9 cDNA fragments were amplified by reverse transcriptase–PCR that used human mature kidney total RNA and subcloned into PGMTeasy II (Promega, Charbonnie`res, France). Reverse transcriptase was performed as in reference 15. The primers used for PCR were 5'CCATGTGGAGCTGGTGGAGA3' and 5'AGCGGTATTTGTTGTACGGCTC 3' for probe 1, which covered nucleotides 181 to 1013 (14) and included exons 1 to 7 and part of exon 8; and 5' CAAAGGAGCCCTGGCGTTAGAG 3' and 5' CCCCATCCGCTTTGCCATCTAC 3' for probe 2, which covered nucleotides 3007 to 3722 (16) and included exons 35 to 40. Restriction enzymes for linearization and RNA polymerases used for in vitro transcription were as follows: probe 1 antisense, NcoI/Sp6 RNA polymerase; probe 1 sense, SalI/T7 RNA polymerase; probe 2 antisense, NsiI/T7 RNA polymerase; and probe 2 sense, SacII/Sp6 RNA polymerase. Labeled RNA probes were synthesized with 35S-UTP (Amersham, Brauschweig, UK) or with digoxigenin-11-UTP (Roche, Meylan, France), according to the manufacturer’s instructions. In situ hybridization was carried out as described elsewhere (17,18). Antisense and sense strands were synthesized for all riboprobes.

Immunohistology Antibodies. Immunofluorescence labeling was performed with the use of rabbit polyclonal antibodies against human platelet myosin, diluted to 1/10. These antibodies, from Biomedical Technologies (Stoughton, MA), recognize the nonmuscle myosin heavy chain IIA and are not reactive with any other protein (19). For double labeling, the following antibodies were used: monoclonal antibodies M3F7, which recognizes the type IV collagen [␣1(IV)2,␣2(IV)], extracted from human placenta (Developmental Hybridoma Bank, the University of Iowa, Iowa City, IA); MAB5 against the NC1 domain of the ␣5 chain of type IV collagen (Wieslab, Lund, Sweden); or G1D4 against synaptopodin (Progen Biotechnik GMBH, Heidelberg, Germany). Cyanin2 or fluorescein isothiocyanate– conjugated AffiniPure goat or donkey anti-rabbit IgG (H⫹L) and cyanin3-conjugated affiniPure donkey anti-mouse IgG (H⫹L) antibodies were from Jackson ImmunoResearch Laboratories (West Grove, PA). Immunofluorescence. Immunofluorescence labeling was performed on 3-␮m-thick cryostat sections fixed in acetone for 10 min and incubated for 20 min with 10% normal goat serum, 1% bovine serum albumin in PBS-Tween (0.01 M PBS containing 0.1% Tween20) for blocking nonspecific binding. After incubation for 1 h at room temperature in a moist chamber with primary antibodies diluted in the same buffer, sections were rinsed three times in PBS and incubated for 30 min with fluorescein isothiocyanate– conjugated anti-rabbit anti-

MYH9 Expression in Kidney and Novel MYH9 Mutations

67

bodies diluted 1/200 in PBS. A mounting medium that contained polyvinyl alcohol, glycerol, and tris buffer (Fluoprep, BioMerieux, Lyon, France) was used to delay fluorescence quenching. Labeling was examined with an orthoplan microscope equipped for light, fluorescence, and phase-contrast microscopy (Leica Microscopic Systems, Heezbrugg, Switzerland). Phase-contrast microscopy allows the visualization of cell structure. For dual labeling, the slides were simultaneously incubated with rabbit anti-myosin and mouse anti-[␣1(IV)2,␣2(IV)] collagen, anti␣5(IV) collagen, or anti-synaptopodin antibodies as described elsewhere (20). Sections to be stained with anti-␣5(IV) antibodies were pretreated with 0.1 mM glycine and 6 mM urea (pH 3.5) for 10 min, then rinsed in distilled water for 5 min. Then, after they were washed with PBS, tissue sections were simultaneously incubated with Cy2conjugated goat anti-rabbit IgG and Cy3-conjugated donkey antimouse IgG. They were examined with an orthoplan microscope (Leica Microscopic Systems) equipped with appropriate filters and with a Zeiss confocal microscope (Carl Zeiss Microscopy, Jena, Germany). Tissue sections directly incubated with the secondary antibodies or serially incubated with normal rabbit or mouse serum instead of the primary antibodies, followed by incubation with the corresponding secondary antibodies, served as controls.

Mutation Detection by Single-Strand Conformation Polymorphism Analysis and Direct Sequencing and Mutation Analysis DNA was extracted by use of standard procedures, and PCR was performed with 50 ng of genomic DNA. The 40 MYH9 coding exons were amplified by use of flanking intronic primers selected with the OLIGO 5.1 program (National Bioscience, Inc., Plymouth, MN). Oligonucleotide sequences and location, as well as PCR conditions and PCR product sizes, are summarized in Table 1. Large exons were amplified into two fragments. PCR products were screened by singlestrand conformation polymorphism (SSCP) analysis as in reference 21 by use of Genephor electrophoresis unit and silver staining (Amersham Pharmacia Biotech, Orsay, France). Sequence variation, which gave rise to mobility shift, was determined by direct automated sequencing (Applied Biosystems). Mutation mapping onto the chicken smooth-muscle heavy-chain crystal structure backbone (22) was performed by use of the SwissPdb (23) and Rasmol (24) programs.

Results In Situ Expression of MYH9 Transcript in Fetal and Mature Human Kidneys In the 12-wk embryonic kidney, strong hybridization was observed with both antisense probes in the late S-shaped bodies. Labeling was particularly strong in the lower part of the S-shaped body, within both endothelial and epithelial cell layers (Figure 2, A and B). More mature nephrons, located deeper in the cortex, also show strong labeling in the glomerulus that was mainly located in peripheral epithelial podocytes, as shown in Figure 2C. Focal labeling of tubular and peritubular capillary endothelial cells was also observed. The same distribution persisted at 15 and 26 wk. In adult kidney, a very strong expression of MYH9 mRNA was observed in glomeruli, particularly in the peripheral epithelial cells (Figure 2, D and E). Sense probes showed only background (not shown).

68



Table 1. Oligonucleotide primers and PCR conditions used for single-strand conformation polymorphism analysis Exon Number

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 a b

Sense (Number of Intron Bases between Primer and Exon) (5⬘33⬘)

TCCTTCTCCTCCCCGCTTAG (19)b CATCGTGGAGCTGGTGGAGA GAATCAAACTTCCTAACCTGTT (24) GGGAGGCTTTTGCATCTG (18) GGGACAGAGGTCAAGGACTT (41) CTGCCATCGTCCCCCTTCCA (65) CTCTCTAGCTCCCCATGTCA (38) GCCTTCTCCCCAGCTTGT (23) GCCTCCACTTTCAGCACCTC (32) GACCCATGTCTGCTTCTGAG (22) GAACTTTCTCTCTTGGGTCT (44) GGGTTTTCAGATCCTTTGTA (33) TAGTGCAGGGTTGGCGTCTC (26) CTCCCAGGGTGCACTCAC (26) CTTGTGACTCCTGCCTCTCT (11) TGTGGGCACTCACGTGTTCT (15) CTGTTCTAGGCACGGAAGTGAG (27) GAATCGAGGCAATGGGTAAA (28) CACCCTTTCATGGAGCTGTG (42) GTCGGGTCTGCTGTCCACTG (31) TCTTCCAGCCGAGCATGTCT (22) TGTTGCGAGGAGCTTGTGTT (19) GAAACCGAGCTGTGTGCC TCTGGGCCTGCTGTCCTTAC (21) AACCAACACTAAATGCCAGCCT (16) GACAGAACCCATGGCACTGA (29) TGCTCCTTGGAGGTGAAACT (34) ATCCCCGGCCTCCACTCTGA (18) CACTCACGTCTTTGCTTTCT (10) GGGTCCATGGTCCTTTGTGT (17) CTAAGCACCCGCACCCCTCT (14) CATCTCGGGCATCTGCTTAC (17) CAGCGGCACGAGGAGAAG TCATGGTGCCCACCTCTT (6) TTGCTCCTGACTTGGGCTCT (11) TTCCCAAGTTGTTGATGT (12) AGCACCAGCCATGAGCCGTGTT (76) GCTGTGGCTGCCTTTAGGTC (22) CCCTCACTTCTCCCGCCCAC (7) ATCCTGCTGCCACCTTCCTC (67) ACGCCCAGAAGAACGAGAAT GTGTTCCCTCTGAGCCACCT (14) CTGCACGCCCAGAGCCCCTA (34) CCCGCTGACCCTCTGCTTCT (14)

Antisense (Number of Intron Bases between Primer and Exon) (5⬘33⬘)

TCCTTGTTCACCTTCACCTTCTa (33) CCCACCTCGGAGCCCTCAGA (50) CTGCAAAGGTGTCAATGA (60) AGTTGTGGTTTCAGTAGGAGAC (50) AAGTGCTCTTCCTCCATCAT (59) CCCAGGAAAAGGCAGCATGA (8) CTCTTATCCCAACGAACCAC (56) ATGATGTCTACGGTCCAATTCT (17) TGCCCCACACTCGACCATAG (51) CCTTCCCTCCTGAGCAAATC (61) CCCACAACAGCCTCAACT (42) AAGGATAAGGCAACCAACAG (18) AGAGGCAGGTGTGAGGTCAA (35) GACTCCACCTCTCCTGTGAA (46) TGTGGAGGTGGGAAGATGAC (35) CTGAGCACCCCACACCACAG (38) GGGACTCACTGCACGCACAG (25) GGCTGCCCATCCAGAGAG (38) CAACAGAAGGGCGTGGCAAG (25) TGCACCCGTAGTCCCAGCTA (54) CCTACCGATGGCCAGCAG (54) TCCTGGTTCCTGCTCCTC GGGCAGGAACCTGGATGT (43) TGACCACACTCTCCCATCCA (44) CCTGACCGCCAGCCCTTG (55) AGAACTAGGGCCAGCAGCAA (50) GTCCATGTCTCCAAGCCAAG (22) AACCCTGCCCTCCCCCTG (31) ACTGCTGCTAGGGCCCAC (41) GCGTGGACACAGAGGCCTTT (41) GTGCCCGGCCAGCAGCTC AGCCGCGTCTTGGTCTTCTC (19) GGAGAGGAAATGCAAAGGAT (45) CACCGACCCTCTGTGATGAC (48) AGAACAGAAGCCTGCGTGAA (43) CTTCATATGTAGTTGGCTCA (44) GCCCCACGCTGCCACCTGCT (32) ACCCTGGGGACACACCTGGT (60) TTCTGCCGGCTGGGTCCAAG TCCATCTCCTGCAGCTTGAC (32) GCCAGAGTTTTTTCCAGGAC (47) CCTGCCTGTCACCCCATCTG (13) GAGGCAAAGGGGCGGGTGGG (42) TCTGGGAAGGGGAGGCTGTG

PCR Annealing PCR Product Temperature (°C) Size (bp)

55 57 55 52 56 61 50 55 54 56 55 54 56 58 54 60 55 56 59 60 60 55 54 60 55 61 58 61 58 60 61 58 58 59 60 54 59 60 58 59 56 61 64 61

248 225 271 161 225 257 150 218 233 209 262 268 258 273 212 284 229 159 281 205 246 237 256 242 224 296 337 223 287 203 246 195 189 304 312 255 291 183 231 206 221 209 260 214

Exonic sequences are underlined. Number of exon bases between primer and begining of translation.

Expression of the MYH9 Chain in Mature Kidney By standard immunofluorescence, the protein was expressed in the glomeruli, in arteriolar and peritubular capillary endothelial cells, and faintly in the brush border in proximal tubules. Figure 3 shows double labeling that used both MYH9 antibod-

ies and antibodies directed against the [␣1(IV)2,␣2(IV)] collagen molecule (Figure 3A), the ␣5 chain of type IV collagen (Figure 3B), or synaptopodin (Figure 3, D and E). Within the glomerulus, MHY9 was widely expressed (Figure 3C). Strong labeling was observed within cells regarded as podocytes be-



69

Figure 2. In situ hybridization with MYH9 antisense probe 1 labeled with 35S (A, D, and E) or digoxigenin (B and C) in fetal (A through C) and mature kidney (D and E). Dark-field (A and E) and phase-contrast microscopy (D). Strong hybridization is observed in the lower part of the S-shaped body (A and B, arrows) as well as in the capillary loop-stage glomerulus, where it predominates in epithelial cells (C). A high level of expression observed in mature glomeruli, particularly in podocytes (D and E, arrows). The pattern observed with probe 2 was the same. Sense probes showed only background. Magnifications: ⫻80 in A; ⫻250 in B and C; and ⫻350 in D and E.

cause of their location at the periphery of the glomerular tuft on the outer face of the GBM labeled with anti-type IV collagen antibodies (Figure 3A). It was colocalized with that of synaptopodin in the podocyte foot processes, as evidenced by the orange color seen on double immunolabeling (Figure 3E). In addition, it was also detected in the podocyte body, at distance from the GBM and synaptopodin labelings. Glomerular endocapillary cells also stained for MYH9 antibodies (Figure 3A).

Characterization of the Mutations and Segregation of the Mutation in Families We tested the 40 coding exons of MHY9 in 12 families and found a total of 15 sequence variants. Four were polymor-

phisms, and six were silent mutations. Four mutations thought to be pathogenic were found in five families. In one of these families, we found an additional mutation of unknown significance. All were missense heterozygous mutations. These results are summarized in Table 2. The D1424N mutation observed in family 1 was already reported in a family with the May-Hegglin anomaly (11). D1424N involves a highly conserved aspartic acid residue (Figure 4) in the coiled-coil domain that was also found to be mutated (D1424H) in a family presenting with Fechtner syndrome (9). This mutation replaces a negatively charged residue by a positively charged amino acid within the coiled-coil domain. It might affect the dimerization of the proteins through

70



Figure 3. Double immunolabeling with MYH9 antibodies (in green), type IV collagen (A), ␣5 chain of type IV collagen (B), and synaptopodin (D and E) antibodies (in red). Nonmuscle heavy chain IIA is expressed in the glomeruli, peritubular vessels, and the proximal tubule brush border (A). Within the glomerulus, it is expressed in endocapillary cells (B, arrowheads) and in podocytes (A and B, arrows), as shown by the overlapping labeling with synaptopodin (E). Magnifications: ⫻350 in A; ⫻650 in B; ⫻500 in C through E.

their ␣ helices. DNA was available for patients II-1 and III-1, who both carried the heterozygous mutation. This G3 A mutation at position 4270 was not found in 48 control chromosomes. The G3 A mutation observed at position 5521 of the coding region of the cDNA in family 2, which predicts a change from glutamic acid to lysine at amino acid 1841, has already been reported in seven unrelated families with MTCP (9,10). It affects a conserved acidic residue in the rod repeat 37 of the ␣-helical coiled-coil domain. This residue is conserved in the majority of myosins. In four smooth-muscle myosins as well as in drosophila nonmuscle myosin II, another negatively charged hydrophilic amino acid (an aspartic acid) fits that position (Figure 4). In family 2, patients II-3 and III-2 carried the mutation, whereas DNA from the mother of III-2 was not

mutated. DNA from patients II-1, II-2, and III-1 were not available. This mutation was not found in 48 control chromosomes. Family 5 carried an R1165L mutation due to a G3 T transition at position 3494 in the cDNA. A missense mutation affecting the same arginine (R1165C) was reported elsewhere in a family with Sebastian syndrome (9). This arginine is highly conserved in the coiled-coil domain of nonmuscle and muscle myosins (Figure 4). Its substitution by a leucine would change a positively charged residue with a neutral amino acid within the coiled-coil domain, probably resulting in modification of polar interactions. We were not able to study the segregation of the mutation in that family, because DNA was available only for patient III-3. This mutation was not found in 48 control chromosomes.



We found the C3 T mutation in exon 1 at position 287 of the cDNA (Figure 5), predicting a change from serine to leucine at amino acid 96 (S96L), in two families (families 3 and 4) that originated from South America and France, respectively. In family 4, patient III-1 and her mother, II-5, carried the mutation, whereas neither of the mother’s brothers nor her parents carried this mutation. In family 3, the unaffected parents of individual II-2 did not carry the mutation. This mutation occurred in a CpG pair, which suggests that its recurrence in families that originate from different parts of the world is due to methylation-mediated deamination. In addition, this mutation is a de novo mutation in both individual II-2 in family 3 and in individual II-5 in family 4, which rules out the possibility of a founder effect responsible for the occurrence of the same mutation in these two families. This mutation occurs in the globular head of the myosin heavy chain, downstream from Table 2. Mutations in the MYH9 gene in five familiesa Family

Phenotype

Nucleotide Change

Amino Acid Change

Exon

1 2 3

Fe/Ep Ep Ep

4 5

Fe/Ep Fe

G4270A G5521A C287T C4198T C287T G3494T

D1424N E1841K S96L R1400W S96L R1165L

30 38 1 30 1 26

a Fe, Fechtner syndrome; Ep, Epstein syndrome; Fe/Ep, families for which there is no information regarding leukocyte morphology.

71

the SH3 domain. The serine at position 96 is located at the extremity of the 96 to 107 helix (which correspondes to 99 to 110 in Gallus gallus smooth-muscle myosin [22]). As shown in Figure 4, this amino acid is conserved in nonmuscle and smooth muscle myosins in all species. In human skeletal and cardiac myosins, either a glycine or an alanine fits that position. These two amino acids are also quite small. Figure 6 shows a space-filling representation of the region with any of the three amino acids from the wild-type myosins (Figure 6, A through C) or with the leucine substitution (Figure 6D). The bulkier side chain of leucine may be predicted to collide with cysteine 91 and, in doing so, to disturb the organization of the region. Furthermore, the leucine substitution results in the loss of the hydrogen bound normally linking S96 to N93 (not shown). This mutation was not found in 48 control chromosomes. Surprisingly, another mutation located in exon 30, which substitutes an arginine to a tryptophan in the coiled-coil domain (R1400W), was found in individuals II-2 and I-1 in family 3. This mutation was not found in 140 control chromosomes.

Discussion Mutations in the MYH9 gene have been recently reported elsewhere in nonsyndromic inherited deafness (DFNA17) (25) as well as in the May-Hegglin anomaly and Fechtner and Sebastian syndromes (9 –11). These three syndromes share the association of MTCP and leukocyte inclusions. The MayHegglin anomaly and Sebastian syndrome can be differentiated by the ultrastructural aspect of the leukocyte inclusions that are both different from Do¨ hle bodies seen in acute infections (26).

Figure 4. Clustal W alignment of the amino acid sequences from class II muscle and nonmuscle myosins. Numbering is according to the human MYH9 sequence. SM, smooth muscle; NM, nonmuscle; MHC, myosin heavy chain; Sk, skeletal; Rn, Rattus norvegicus; Gg, Gallus gallus; Xl, Xenopus laevis; Bt, Bos taurus; Dm, Drosophila melanogaster; Mm, Mus musculus; Oc, Oryctolagus cuniculus; and Ce, Caenorhabditis elegans. GeneBank accession numbers are human MYH9, P35579; Rn. MYH9, NP_037326; Gg. MYH9, P14105; Xl. NMMHCA, AAC83556; human MYH10, AAA99177; Rn. NMMYHB, AAF61445; Gg. NMMHCB, AAA48988; Xl. NMMMHCB, AAA49915; Bt. NMMHCB, BAA36494; Dm. NMII, AAB09049; Ce. NMYII, AAA83339; Rn. neuronal MHC, S21801; Gg. SMMHC, P10587; Mm. SM2, JC5421; Oc. SM2, P35748; human skeletal B, AAD29949; human skeletal A, AAD29950; human fetal skeletal muscle, AAD29951; human perinatal skeletal muscle, P13535; human embryonal, P11055; human extra-ocular, AAD29948; human cardiac muscle beta, P12883; human cardiac muscle alpha, P13533; and human smooth muscle, P35749.

72


Figure 5. Mobility shift observed in single-strand conformation polymorphism of DNA in members of family 4. The heterozygous mutation C287T in patient III-1 and II-5 is not present in patients I-1, I-2, II-1, II-2, II-3, and II-4.

Fechtner syndrome, in which leukocyte inclusions look like those observed in Sebastian syndrome, is distinguished by the additional occurrence of progressive nephritis and deafness that is considered to be a variant of Alport syndrome and by the presence of congenital cataracts (2). In this study, we studied MYH9 expression in human kidney by in situ hybridization and immunohistology. We found that MYH9 is expressed in both fetal and mature renal tissues. During development, it is mainly expressed in the lower part of the late S-shaped body, in both the endothelial cells and the future podocytes. Later, MYH9 is widely expressed in the

Figure 6. Schematic representation of amino acid 99 (corresponding to human S96) and cysteine 94 (corresponding to C91 in human) mapped onto the G. gallus smooth-muscle heavy-chain crystal structure backbone (22). A, S96; B, G96; C, A96; and D, L96 as predicted by the C3 T mutation at position 287 of the cDNA. The bulkier side chain of the leucine is predicted to collide with the cysteine 91. The programs used were Swiss-Pdb viewer (23) and Rasmol (24).


kidney, mainly in glomeruli and arteriolar and peritubular capillary endothelial cells. Within the glomerulus, MHY9 mRNA and protein are mostly expressed by the podocyte cells, although endocapillary cells show some level of expression. It has been shown elsewhere (27) by immunoelectron microscopy that, within the podocyte, “platelet myosin” was colocalized with actin and ␣-actinin. They are mainly located in the foot processes but are also present in a continuous narrow layer located underneath the entire plasma membrane. Taken together, these data suggest that, in the kidney, nonmuscle heavy chain IIA is a major component of the actin-myosin contractile apparatus in the podocyte foot process. It could play a role in maintaining capillary wall integrity against hydraulic pressure in physiological conditions and/or contribute to the foot process retraction in pathological conditions. This expression in glomerular epithelial cells is in agreement with the clinical and pathological features observed in Fechtner nephropathy. Ultrastructural alterations of the GBM close to those observed in Alport syndrome have been reported in some patients (5). It will be interesting to study whether basement membrane proteins that are normally synthesized by the glomerular epithelial cells are downregulated in these patients. However, the expression of the ␣3, ␣4, and ␣5 chains of type IV collagen in the GBM was shown to be normal in some patients affected with nephropathy and MTCP (28). Because mutations in MYH9 were found in different syndromes with MTCP and leukocyte inclusions, with or without associated kidney disease, we looked for mutations in this gene in families with progressive nephropathy associated with MTCP, regardless of the presence of polynuclear inclusions. Indeed, many patients were not examined for leukocyte morphology. In addition, the characterization of leukocyte inclusions, which is the central point for a correct differentiation between Fechtner and Epstein syndromes, may be missed if only a few cells are screened. Therefore, the distinction between Fechtner and Epstein syndromes may be not definitive. None of the patients had congenital cataracts. Using SSCP, we screened the 40 coding exons of the MYH9 gene in 12 unrelated families, including 3 with Epstein syndrome, as determined by leukocyte morphology that used Giemsa-stained smears. Epstein syndrome was previously shown to be genetically linked to 22q11-13 (12), but no mutations have been reported in this syndrome so far. We found four mutations that are thought to be pathogenic in five families, including two with Epstein syndrome. Three are located in the coiled-coil rod, and one affects the motor domain of the protein. In families with several affected individuals, the various symptoms (nephritis, deafness, and MTCP) are frequently present in various combinations in different individuals (Figure 1). Such variability in penetrance and expressivity, already reported for many families in the literature, suggests that other genes and/or environmental events might influence the phenotypic expression of the mutation. The D1424N mutation is not always associated with kidney disease in family 1 and has been reported elsewhere in a family with MTCP without renal involvement (11). The E1841K mutation that we found in family 2, in which all affected individuals have kidney disease,


has been reported elsewhere in seven families without renal involvement, six with May-Hegglin anomaly, and one with either May-Hegglin or Sebastian syndrome (9,10). In family 5, which carries the R1165L mutation, several patients suffer from isolated MTCP, whereas others show the association of MTCP, deafness, and nephropathy. R1165L affects a codon found elsewhere to be mutated in Sebastian syndrome (R1165C) (9). Finally, the S96L mutation identified in two unrelated families has not been reported before. In one family (family 4), the mother is affected with MTCP, deafness, and nephropathy, whereas her daughter suffers from MTCP and hearing loss but has not developed proteinuria or hematuria at age 6 yr. In family 3, the female affected with the same mutation does not suffer from deafness. The affected patient in family 3 carries, in addition to the S96L de novo mutation, a R1400W mutation that was inherited from her father, who is not affected with MTCP or nephropathy. We were not able to determine whether these two mutations are located on one or on two different alleles in the patient. We believe that the S96L mutation is pathogenic, because it affects a conserved amino acid, it is predicted to perturb the helical region, and it segregates with the disease in family 4. Conversely, the arginine at position 1400 is less conserved, and its substitution is not responsible for any phenotype in the father in family 3. However, the R1400W was not found in 140 control chromosomes. Thus, we cannot rule out a pathogenic role for that variant that would not be expressed in the father. In addition it might influence the phenotypic expression of the S96L mutation. More generally, polymorphisms or rare variants in MYH9 itself or within other genes interacting with MYH9 might play a role in the renal expressivity of MYH9 mutations. Whether MYH9 variants might play a role in the course of other glomerular nephropathies remains another open question. We did not find any mutation in MYH9 in seven other families. From a clinical point of view, these families are not distinguishable from the five families that were found to carry a mutation, apart from family 10, in which one affected individual was found to have abnormal liver enzymes and hypercholesterolemia. Elevation of transaminases and alkaline phosphatase with hypercholesterolemia have been reported elsewhere in several members of a family with Fechtner syndrome (29). In that family, the liver defect seemed to be inherited with an incomplete penetrance. The case we report here suggests that liver involvement is part of the Fechtner syndrome and that liver enzymes and cholesterol levels should be investigated in those families. The mutation rate we report here is lower than that detected for other genes when we used SSCP in our laboratory. It is possible that some mutations have been missed because of the presence of polymorphism (which makes additional band shifts difficult to detect) or because of a large rearrangement, such as a deletion, that would not be detected by SSCP. Another possibility is that the association of MTCP and glomerular nephropathy is a genetically heterogeneous syndrome, although data from linkage analysis (6 – 8,12) do not favor this hypothesis.


73

In conclusion, we describe here the wide expression of MYH9 in fetal and mature kidneys and show that nonmuscle myosin heavy chain IIA is mainly expressed in podocytes. We report four MYH9 mutations associated with MTCP and progressive nephropathy. Two are new mutations, and two had been reported elsewhere in families with the May-Hegglin anomaly. Furthermore, we show for the first time that MYH9 mutations are associated with Epstein syndrome. These results, along with recent articles that have shown the involvement of MYH9 in isolated inherited deafness (25), as well as in MTCP with leukocyte abnormalities (9 –11), illustrate the broad range of phenotypes associated with MYH9 mutations. It does also demonstrate the variable penetrance and expressivity of the different symptoms within a given family and between families that carry the same mutation. This study will contribute to unraveling a complex classification of diseases including MTCP that until now was based on leukocyte morphology and on the presence or absence of symptoms that are actually due to incomplete penetrance and variable expressivity. The next step is now to characterize the genetic and epigenetic factors implicated in the phenotypic expression of the glomerular disease associated with MYH9 mutations.

Acknowledgments We thank the patients, families, and physicians who contributed to this work. This study was supported by the Association Franc¸ aise contre les Myopathies, the Fondation pour la Recherche me´ dicale, the Association Claude Bernard, and the Association pour l’Utitisation du Rein Artificiel. We are grateful to Thomas Edmons for technical assistance. We are indebted to Doreen Broneer for her comments on this manuscript.

References 1. Epstein CJ, Sahud MA, Piel CF, Goodman JR, Bernfield MR, Kushner J, Ablin AR: Hereditary macrothrombocytopathia, nephritis and deafness. Am J Med 52: 299 –310, 1972 2. Peterson L, Rao V, Crosson J, White J: Fechtner syndrome. A variant of Alport syndrome with leukocyte inclusions and macrothrombocytopenia. Blood 65: 397– 406, 1985 3. Hegglin R: Gleichzeitige konstitutionelle Vera¨ nderungen an Neutrophilen und Thombozyten. Helv Med Acta 12: 439 – 440, 1945 4. Greinacher A, Nieuwenhuis HK, White JC: Sebastian platelet syndrome: A new variant of hereditary macrothrombocytopenia with leukocyte inclusions. Blut 61: 282–288, 1990 5. Moxey-Mims MM, Young G, Silverman A, Selby DM, White JG, Kher KK: End stage renal disease in two pediatric patients with Fechtner syndrome. Pediatr Nephrol 13: 782–786, 1999 6. Kunishima S, Kojima T, Tanaka T, Kamiya T, Ozawa K, Nakamura Y, Saito H: Mapping of a gene for May-Hegglin anomaly to chromosome 22q. Hum Genet 105: 379 –383, 1999 7. Toren A, Amariglio N, Rozenfeld-Granot G, Simon A, BrokSimoni F, Pras E, Rechavi G: Genetic linkage of autosomal dominant Alport syndrome with leucocyte inclusion and macrothrombocytopenia (Fechtner syndrome) to chromosome 22q11– 13. Am J Hum Genet 65: 1711–1717, 1999 8. Martignetti J, Heath K, Harris J, Bizzaro N, Savoia A, Balduini C, Desnick R: The gene for May-Hegglin anomaly localizes to a

74

9.

10.

11.

12.

13. 14.

15.

16.

17.

18.


⬍1-Mb region on chromosome 22q12.3–13.3. Am J Hum Genet 66: 1449 –1454, 2000 The May-Hegglin/Fechtner Syndrome Consortium. Mutations in MYH9 result in the May-Hegglin anomaly, and Fechtner and Sebastian syndromes. Nat Genet 26: 103–105, 2000 Kelley MJ, Jawien W, Ortel TL, Korczak JF: Mutation of the MYH9 gene, encoding non-muscle heavy chain A, in MayHegglin anomaly. Nat Genet 26: 106 –108, 2000 Kunishima S, Kojima T, Matsushita T, Tanaka T, Tsurusawa M, Furukawa Y, Nakamura Y, Okamura T, Amemiya N, Nakayama T, Kamiya T, Saito H: Mutations in the NMMHC-A gene cause autosomal dominant macrothrombocytopenia with leukocyte inclusions (May-Hegglin anomaly/Sebastian syndrome). Blood 97: 1147–1149, 2001 Toren A, Rozenfeld-Granot G, Rocca B, Epstein C, Amariglio N, Laghi F, Landolfi R, Brok-Simoni F, Carlsson L, Rechavi G, Greinacher A: Autosomal dominant giant platelet syndromes: A hint of the same genetic defect as in Fechtner syndrome owing to a similar linkage to chromosome 22q11–13. Blood 96: 3447– 3451, 2000 Sellers JR: Myosins:A diverse superfamily. Biochim Biophys Acta 1496: 3–22, 2000 Simons M, Wang M, MCBride W, Kawamoto S, Yamakawa K, Gdula D, Adelstein R, Weir L: Human non-muscle myosin heavy chains are encoded by two genes located on different chromosomes. Circ Res 69: 530 –539, 1991 Knebelmann B, Deschenes G, Gros F, Hors MC, Gru¨ nfeld JP, Zhou J, Tryggvason K, Gubler MC, Antignac C: Substitution of arginine for glycine 325 in the collagen alpha 5 (IV) chain associated with X-linked Alport syndrome: Characterization of the mutation by direct sequencing of PCR-amplified lymphoblast cDNA fragments. Am J Hum Genet 51: 135–142, 1992 Saez CG, Myers JC, Shows TB, Leinwand LA: Human nonmuscle myosin heavy chain mRNA: Generation of diversity through alternative polyadenylation. Proc Natl Acad Sci USA 87: 1164 –1168, 1990 Heidet L, Cai Y, Sado Y, Ninomyia Y, Thorner P, Guicharnaud L, Boye E, Chauvet V, Cohen Solal L, Beziau A, Garcia Torres R, Antignac C, Gubler MC: Diffuse leiomyomatosis associated with X-linked Alport Syndrome: Extracellular matrix study using immunohistochemistry and in situ hybridization. Lab Invest 76: 233–243, 1997 Boute N, Gribouval O, Roselli S, Benessy F, Lee H, Fuchshuber A, Dahan K, Gubler MC, Niaudet P, Antignac C: The NPHS2


19.

20.

21.

22.

23.

24. 25.

26.

27.

28.

29.

gene encoding a novel glomerular protein, podocin, is mutated in autosomal recessive steroid-resistant nephrotic syndrome. Nat Genet 24: 349 –354, 2000 Miller M, Bower E, Levitt P, Li D, Chantler PD: Myosin II distribution in neurons is consistent with a role in growth cone motility but not synaptic vesicle mobilization. Neuron 8: 25– 44, 1992 Cai YI, Sich M, Beziau A, Kleppel MM, Gubler MC: Collagen distribution in focal and segmental glomerulosclerosis: An immunofluorescence and ultrastructural immunogold study. J Pathol 179: 188 –196, 1996 Saunier S, Calado J, Heilig R, Silbermann F, Benessy F, Morin G, Konrad M, Broyer M, Gubler MC, Weissenbach J, Antignac C: A novel gene that encodes a protein with a putative src homology 3 domain is a candidate gene for familial juvenile nephronophthisis. Hum Mol Genet 6: 2317– 2323, 1997 Dominguez R, Freyzon Y, Trybus KM, Cohen C: Crystal structure of a vertebrate smooth muscle myosin motor domain and its complex with essential light chain: Visualization of the prepower stroke state. Cell 94: 559 –571, 1998 Guex N, Peitsch MC: SWISS-MODEL and the Swiss-PdbViewer: An environment for comparative protein modeling. Electrophoresis 18: 2714 –2723, 1997 Sayle RA, Milner-White EJ: RASMOL: Biomolecular graphics for all. Trends Biochem Sci 20: 374, 1995 Lalwani J, Goldstein MJ, Kelley MJ, Luxford W, Castelein CM, Mhatre AN: Human non syndromic hereditary deafness DFNA17 is due to a mutation in non-muscle myosin MYH9. Am J Hum Genet 67: 1121–1128, 2000 Cawley JC, Hayhoe FG: The inclusions of the May-Hegglin anomaly and Dohle bodies of infection: Ultrastructural comparison. Br J Haematol 22: 491– 496, 1972 Drenckhahn D, Kranke RP: Ultrastructural organization of contractile and cytoskeletal proteins in glomerular podocytes of chicken, rat and man. Lab Invest 59: 673– 681, 1988 Naito I, Nomura S, Inoue S, Kagawa M, Kawai S, Gunshin Y, Joh K, Tsukidate C, Sado Y, Osawa G: Normal distribution of collagen IV in renal basement membranes in Epstein’s syndrome. J Clin Pathol 50: 919 –922, 1997 Gershoni-Baruch R, Baruch Y, Viener A, Lichtig C: Fechtner syndrome: Clinical and genetic aspects. Am J Med Genet 31: 357–367, 1988