Extraembryonic Endoderm Stem Cell Lines from Common Voles of the ...

ISSN 1022-7954, Russian Journal of Genetics, 2008, Vol. 44, No. 11, pp. 1280–1289. © Pleiades Publishing, Inc., 2008. Original Russian Text © A.I. Shevchenko, V.V. Demina, N.A. Mazurok, A.I. Zhelezova, Ya.R. Yefremov, A.G. Shilov, A.I. Shevela, A.V. Belevantseva, V.V. Vlasov, S.M. Zakian, 2008, published in Genetika, 2008, Vol. 44, No. 11, pp. 1477–1485.

GENERAL GENETICS

Extraembryonic Endoderm Stem Cell Lines from Common Voles of the Genus Microtus A. I. Shevchenkoa, V. V. Deminaa, N. A. Mazuroka, A. I. Zhelezovaa, Ya. R. Yefremova, A. G. Shilova, A. I. Shevelab,c, A. V. Belevantsevac, V. V. Vlasovb, and S. M. Zakiana a

Institute of Cytology and Genetics, Siberian Branch, Russian Academy of Sciences, Novosibirsk, 630090 Russia; e-mail: [email protected] b Institute of Chemical Biology and Fundamental Medicine, Siberian Branch, Russian Academy of Sciences, Novosibirsk, 630090 Russia; e-mail: [email protected] c New Medical Technology Center, Siberian Branch, Russian Academy of Sciences, Novosibirsk, 630090 Russia; e-mail: [email protected] Received March 17, 2008

Abstract—Twenty-eight independent extraembryonic endoderm (XEN) stem cell lines have been obtained from morula and blastocyst cells of common voles. Most cell lines form very few cell–cell contacts when growing and morphologically correspond to the XEN that were earlier described in mice. In addition, XEN cell lines with atypical morphology forming colonies have been obtained for the first time. Both types of XEN lines rapidly proliferate, retain their morphology and karyotype during more than 25 passages in cell culture, and express genes characteristic of XEN. One of two X chromosomes in XEN lines with karyotype XX has been shown to be inactive and associated with the Xist gene transcript. It has been demonstrated that the paternal X chromosome is inactive. DOI: 10.1134/S1022795408110057

INTRODUCTION The trophoectoderm and cells referred to as the inner cell mass (ICM) are formed at the blastocyst stage of mammal zygote cleavage. Afterwards, the ICM is subdivided into two cell populations, the primitive endoderm (hypoblast) and primitive ectoderm (epiblast). The epiblast gives rise to all embryonic organs and gametes; its derivatives are involved in the formation of extraembryonic membranes (the amnion, allantois, and yolk sac). The primitive endoderm gives rise to the extraembryonic endoderm (XEN), which is subdivided into the parietal and visceral endoderms involved in the formation of the yolk sac. Trophoectoderm cells form the placenta [1]. Epiblast cells, extraembryonic endoderm and ectoderm cell precursors can be separated in vitro as cultures of embryonic stem (ES), trophoblast stem (TS), and XEN cells, respectively [2]. These cell lines are good models for studying early ontogeny in mammals. Cultures of mouse XEN cells expressing markers typical of XEN derivatives have been obtained. Mouse XEN cells injected into blastocysts contribute exclusively to the extraembryonic organs that are normally formed from XEN cells [3]. It is known that X-inactivation (the process upon which one of two X chromosomes becomes transcriptionally inactive) begins at the two-cell stage of the embryogenesis of female mammals. Imprinted inacti-

vation of the paternal X chromosome occurs at this stage, this chromosome remaining inactive in extraembryonic tissues [4]. In epiblast cells, the paternal X chromosome is initially reactivated, which is followed by random inactivation of either the paternal or the maternal X chromosome. In female interspecific hybrids of common voles, the random X-inactivation is disturbed: the X chromosome of Microtus arvalis preferentially remains active, while the X chromosomes of three other closely related species are preferentially inactivated [5–7]. This study was aimed at obtaining and describing XEN cell lines from embryos of different species and interspecific hybrids of common voles, examining the expression of genes characteristic of these cells, and characterizing X-inactivation in them. MATERIALS AND METHODS Animals. We used animals of two closely related species of the genus Microtus (family Arvicolidae): M. arvalis and M. rossiaemeridionalis. The animals captured in natural populations were kept and reproduced in the vivarium of the Institute of Cytology and Genetics of the Siberian Branch of the Russian Academy of Sciences. Obtaining embryos. Intra- and interspecific crosses of M. rossiaemeridionalis were carried out. Three and a half days after fertilization, morulae and blastocysts (early, medium, and late) were washed off from the ovi-

1280

EXTRAEMBRYONIC ENDODERM STEM CELL LINES

duct and uterus with Witten’s medium. The zona pellucida was removed with Tyrode’s medium (pH 2.5–2.7) for 1.5 min. The blastocysts and morulae were put into the wells of four-well plates; after three to five days (depending on the growth rate), the inner cell mass (ICM) was mechanically extracted in a Dulbecco’s phosphate buffer saline (DPBS, pH 7.2) containing no calcium or magnesium ions or in the growth medium and mechanically separated into pieces and cells with the use of capillaries with fire-polished tips. The cells thus obtained were transferred to the wells of four-well plates containing a feeder layer and nutrition medium for XEN cell culturing. The feeder cell layer. To obtain the feeder cell layer, we used primary embryonic fibroblasts from 13- to 14-dayold embryos of CBA mice and M. rossiaemeridionalis. The embryonic fibroblasts were cultured in αåÖå, Dulbecco’s modified Eagle’s medium (DMEM, GIBCO/BRL), or their combination supplemented with 10% fetal calf serum (FCS, GIBCO/BRL), 50 µg/ml penicillin, and 50 µg/ml streptomycin (GIBCO/BRL). To arrest mitotic division of the embryonic fibroblasts, mitomycin C (Sigma) was added to a final concentration of 10 µg/ml for 2 h, after which the cells were washed trice with DPBS. The feeder cells were plated to four-well plates at a density of about 1.5 × 105 cells per well. The plates were preliminarily treated with 0.1% gelatin for 10−15 min at room temperature. Obtaining and culturing XEN cells. Blastocyst ICM cells were cultured in either sodium pyruvate-free, glucose-rich (4500 mg/l) DMEM (GIBCO/BRL) or DMEM/F-12 mixture (1 : 1, GIBCO/BRL) supplemented with 15% FCS on the feeder layer at 37°C in an atmosphere containing 5% CO2. The culture media contained mouse leukemia inhibitory factor (LIF, GIBCO/BRL) at a final concentration of 1000 U/ml, 1 mM L-glutamine (GIBCO/BRL), 1× solution of nonessential amino acids (GIBCO/BRL), 0.1 mM 2-mercaptoethanol (Sigma), 50 U/ml penicillin (GIBCO/BRL), and 50 µg/ml streptomycin (GIBCO/BRL). After a period of growth, XEN-like cells were selected according to morphological criteria. Cell islands were mechanically isolated in the culture medium or DPBS, the primary colonies at the first and second passages were broken into separate pieces and cells using capillaries with fire-polished tips and transferred to another well. Beginning from the third or fourth passage, 0.025% trypsin, 0.037% disodium ethylenediaminetetraacetate (EDTA), and 2% chicken serum were used for cell disaggregation. Feeder was not used; the surface of the wells was treated with 0.1% gelatin (Sigma) before plating; LIF and 2-mercaptoethanol were excluded from the growth medium. Histochemical assay for alkaline phosphatase activity. The medium was aspirated, and the well was washed with DPBS one or two times and air-dried for 15–20 min. A kit from Sigma was used for alkaline phosphatase assay. RUSSIAN JOURNAL OF GENETICS

Vol. 44

No. 11

1281

Cytogenetic analysis. Cell hypotony and fixation, as well as chromosome banding were performed as described earlier [8]; the duration of hypotony of XEN cells was 60 min. Obtaining tumors. XEN cells (8 × 106 to 9 × 106) in 150 ml of culture medium containing no serum or growth factors were injected to athymic Balb/c-nu mice subcutaneously to the neck region between ears. Isolation of RNA, reverse transcription, and PCR. RNA was isolated from a suspension of XEN cells with the use of TRI REAGENT (Sigma) as recommended by the manufacturer; cDNA was synthesized on a template of total RNA using the SuperScriptIII reverse transcriptase (Invitrogene). The cDNA synthesis was primed with random oligonucleotides. Table 1 shows the nucleotide sequences of the primers used for PCR. For each pair of primers, we carried out a negative control reaction, where a reaction mixture containing all components necessary for cDNA synthesis except for reverse transcriptase was used. The PCR products were analyzed by electrophoresis in 2% agarose gel and sequenced to confirm their homology to the corresponding mouse genes. The nucleotide sequences have been deposited into the EMBL database; their accession numbers are listed in Table 1. RNA/DNA-FISH, line ploidy analysis, and immunostaining. RNA-FISH was performed as described in [3]; DNA-FISH, as described in [9]. The ploidy of XEN cells was determined using DNA profiling of nuclei stained with propidium iodide by means of a BD FACSAria flow cytofluorometer in the Sharing Flow Cytometry Center of the Institute of Cytology and Genetics of the Siberian Branch of the Russian Academy of Sciences. For obtaining a suspension of nuclei, the cell monolayer was washed twice with 1× PBS and lysed with a mixture of 1× PBS and 0.5% Triton X-100. The nuclei were fixed with 50% methanol for 30 min at room temperature, washed from the alcohol, and treated with 500 µg/ml RNase A for 30 min at 37°C. After addition of 0.1 volume of a saturated propidium iodide solution, the nuclei were incubated for 30 min at room temperature and analyzed using the flow cytofluorometer. Splenocytes of M. rossiaemeridionalis were used as a control. For immunofluorescent in situ hybridization, XEN cells were transferred to polylysine-covered slides 2 h before fixation. The resultant preparations were fixed with 4% formaldehyde for 10 min, permobilized with 0.5% Triton X-100 for 5 min, washed with PBS, and incubated in a 10 mg/ml bovine serum albumin solution. The preparations were hybridized with polyclonal rabbit antibodies against GATA6 (sc-9055, Santa Cruz Biotechnology) and vimentin (ab58462, Abcam) and with monoclonal murine antibodies against GATA4 (sc-25310, Santa Cruz Biotechnology) and cytokeratin 18 (MAB3234, Millipore) diluted 1 : 50. Afterwards, the preparations were incubated with fluorescence-labeled antibodies against mouse or rabbit immunoglobulins. The cell nuclei were stained with 2008

1282

SHEVCHENKO et al.

Table 1. The primers used for analysis of gene expression in common vole XEN cell lines Gene

Nucleotide sequence of the primer

PCR product size, bp

ACC

β-actin

GACGGGGTCACCCACACTGT GAGTACTTGCGCTCAGGAGGAG

523

Oct4

CCAAGCTGCTGAAGCAGAAGA TTTGAATGCATGGGAGAGCCCAG

631

EF030115

Eomes

ATTGTCCCTGGAGGTCGGTA GAAGGTCGGGTCAGGGTAAT

316

EU285608

Hand1

CCCCATGCTCCACGAACCC AACTCCCTTTTCCGCTTGCT

467

EU285606

Fgf2r

TCTTGTTCTTCAGGGGACGATTC ATGCTTCCCACTATTTACTCCTCTG

242

DQ517964

Esrrβ

AGCTGCGGCTCCTTCATCAAG CTTGTACTTCTGGCGGCCTCC

543

DQ517967

Cdx2

CCACCATGTACGTGAGCTACC GACTGAGCGCTGTCCAAGTT

184

DQ517966

Pl-1

TCCAGAGAATCGAGAGGAAGT ACAACTCGGCACCTCAAGAC

383

DQ517968

Tpbp

AAACAGCCACTGTGCCATTG GTAAGGTTTTATTAGTGTGAACAT

214

DQ517965

Foxa2

CCCTACGCCAATATGAACTCCATG GTTCTGCCGGTAGAAAGGGA

220

EU285609

Hnf4

GGTCAAGCTACGAGGACAGC AGAAGATGATGGCTTTGAGG

460

EU285605

Sox2

TCCATGACCAGCTCGCAGACCTAC CCCTCCCAATTCCCTTGTTTCTCT

392

EU285607

Nanog

TCCATAACTTCGGGGAGGA TCACAGAGTAGTTCAGGAATA

156

EU285611

Afp

ACATCGAGGAGAGCCAGGCA CCTGAGCTTGGCACAGATCC

413

EU285612

Gata6

CACCATCATCACCACCCGACCTAC CAGGGCCAGAGCACACCAAGAATC

788

EU285604

Sall4

TCACCAACGCCGTCATGTTACAGC GGTGGGCTGTGCTCGGATAAATGT

604

EU285610

Note: ACC, the accession number of the nucleotide sequence of the PCR product in the EMBL database.

RUSSIAN JOURNAL OF GENETICS

Vol. 44

No. 11

2008


(a)

1283

(b)

R

F

(c)

Fig. 1. The morphology of XEN cells of lines (a) XENM6 (magnification, ×400) and (b) XEN3Ars (magnification, ×320). (c) A semithin cross section of XENM6: R, a rounded cell; F, flattened cells.

10% DAPI diluted in the antifade reagent Vestashield Mounting Medium. RESULTS Derivation of XEN Cells from Microtus Blastocysts We used 11 blastocysts (3–3.5 days after fertilization) and 5 late morulae of the common vole M rossiaemeridionalis, 18 blastocysts and 3 late morulae of M. rossiaemeridionalis × M. arvalis hybrids, and 11 blastocysts of M. arvalis × M. rossiaemeridionalis hybrids. The M. rossiaemeridionalis blastocysts and morulae were, without removing the zona pellucida, left in the culture medium for four to six days, until they shed the zona pellucida (hatched) and attached to the feeder layer. In experiments with hybrid blastocysts and morulae, the zona pellucida was removed with Tyrode’s solution, and the embryos were transferred to the feeder layer. Two to three days after attachment, the growing ICM was divided into four- to eight-cell aggregates, and the formation of XEN cells was observed one or two days later. We obtained 28 XEN cell lines, including 9 M. rossiaemeridionalis lines, 12 M. rossiaemeridionalis × M. arvalis lines, and 7 M. arvalis × M. rossiaemeridionalis lines, which were morphologically different from one another. The morphology of most XEN lines corresponded to that described by other authors [3]. The cells formed few cell– cell contacts; two cell subpopulations were distinguished: rounded cells and prolate, flattened cells (Figs. 1a, 1c). RUSSIAN JOURNAL OF GENETICS

Vol. 44

No. 11

Analysis of semithin slices of cells of the XENM6 line embedded into resin showed that rounded cells were at the stage of division, and flattened cells were in the G1 and S phases (Fig. 1c). The nuclei of flattened cells occupied almost the entire cell volume and had invaginations; one or two nucleoli were discernible. We found that some growing XEN cells formed colonies of flattened cells with tight cell–cell contacts, and distinct boundaries between cells (Fig. 1b). These cells were more strongly attached to the surface of the culture wells, and preliminary treatment of the wells with gelatin was not necessary for successful culturing. No XEN cells with this morphology have been described in available literature before. Both types of XEN cells retained their morphology and high proliferation rate during at least 25 passages. Estimation of the Stem Properties of Vole XEN Cell Lines Suspensions of XEN cells were injected to athymic Balb/s-nu mice. Six XEN lines were injected to 13 mice, but in none of the animals did these cells form a tumor. Apparently, XEN cells have no malignant potential and cannot form teratomas. 2008

1284

SHEVCHENKO et al.

Table 2. Characteristics of the obtained lines of common vole XEN cells XEN cell line

Obtained from crosses

Passage

Sex chromosome set

Ploidy

XENM6 XENg

M. rossiaemeridionalis ×M. rossiaemeridionalis

27 19

L7.10 XENV III

M. rossiaemeridionalis ×M. arvalis

24 16

XEN3Ars

M. arvalis ×M. rossiaemeridionalis

17

–

XENM2 XENM4 XENM7 XEN7P XEN8P


13 28 13 15 13

– 2n – – –

XENV I M. rossiaemeridionalis ×M. arvalis XENV IX X XENTSR-A

16 23 10

– 2n –

XEN1Ars XEN2Ars XEN4Ars XEN5Ars XEN6Ars XEN7Ars

M. arvalis ×M. rossiaemeridionalis

16 15 18 21 15 18

XENM3 XENM5


26 18

2n 4n XX

2n –

XY

2n 2n 4n – – 2n – –

X0

Note: –, ploidy not determined.

Estimation of the Ploidy of the Obtained XEN Cell Lines Analysis of the ploidy of nine XEN cell lines by means of DNA profiling of the nuclei stained with propidium iodide performed wit the use of a flow cytofluorometer showed that two lines consisted of diploid and tetraploid cells, and seven lines contained only diploid cells (Table 2). Figure 2 shows examples of the DNA profiles of suspension nuclei of several lines. G-Banding of Metaphase Chromosomes of XEN Cell Lines We used the GTG method for banding metaphase chromosomes of cells of the XENM4 and XENM6 lines (Fig. 3). At the moment of fixation and staining, the cell lines were at the 25th or later passages. Analysis of 50 metaphase spreads of cells from each line did not show abnormalities of the chromosome number or any

chromosomal rearrangement. Thus, these data further confirm that cultured XEN cells can retain a stable diploid karyotype during many passages. Expression of Genes Characteristic of XEN Vole XEN cells expressed the genes of transcription factors characteristic of mouse XEN [3], including Gata4, Gata6, Sall4, Hnf4, and Foxa2 (Figs. 4, 5b). Only trace levels of the expression of the Afp gene characteristic of differentiated mouse XEN [3] were found in vole XEN cell cultures (Fig. 4). Regarding the genes of transcription factors characteristics of other types of preimplantation blastocyst cells, we did not detect expression of the main genes of ES cells [2] (Oct-4 and Nanog) in vole XEN cells or the genes characteristic of TS cells [2, 10] (Cdx2, Fgf2r, Eomes, and Hand1); only Esrrβ was expressed at a low level (Fig. 4). Nor were the Tpbp (data not shown) and


Vol. 44

No. 11

2008

EXTRAEMBRYONIC ENDODERM STEM CELL LINES 3000 2500 2000 1500 1000 500 0

250

1285

(a) M. rossiaemeridionalis splenocites G1 (2N)

G2 (4N)

(b)

1Ars

2N

4N

Count

200 150 100 50 0 (c)

4Ars 2N

4N

6N

8N

150 100 50 0

50

100

150

200 250 PI-A, ×1.000

Fig. 2. The DNA profiles of (a) M. rossiaemeridionalis splenocytes, (b) 1Ars cells, and (c) 4Ars cells. The abscissa shows the relative intensity of staining (amount of DNA); the ordinate shows the number of events. The distribution of events among subpopulations: (a) G (2N), 60%; G2 (4N), 25%; (b) 2N, 68%; 4N, 25%; (c) 2N, 12%; 4N, 57%; 6N, 7%; 8N, 14%. The splenocytes and 1Ars cells (panels (a) and (b), respectively) are normal diploids with approximately equal 2N to 4N ratios reflecting the distribution of cells between the G1 and G2 phases, whereas 4Ars cells (panel (c)) form a mixed culture with distinctly prevailing tetraploids, whose proportion, as estimated by analysis of the identified populations, is about 77%.

Pl-1 (Fig. 4) genes characteristic of the placenta expressed in XEN cells. Ninety-five percent of cultured vole XEN cells (Fig. 5a) were shown staining with antibodies against the intermediate filament cytokeratin 18, which is characteristic of both parietal and visceral mouse endoderms [11]. Antibodies against vimentin, another intermediate filament, which is detected in mice only in visceral endoderm cells [12], stained only 5–10% of cultured vole XEN cells (Fig. 5a). We did not find differences in the expression of transcription factors or intermediate filament genes RUSSIAN JOURNAL OF GENETICS

Vol. 44

No. 11

between growing XEN cell lines forming few cell–cell contacts and those forming colonies. Identification of Sex Chromosome Sets in XEN Cell Lines by Means of in situ Fluorescent Hybridization We used DNA-FISH to identify the sex chromosome sets in the obtained XEN cell lines (Figs. 5c–5f). A total of 21 cell lines were analyzed using this method (Table 2). The MS4 repeat specific for the heterochromatin of the sex chromosomes of M. rossiaemeridionalis and M. arvalis [13] was used as a probe to detect the X and Y chromosomes of these species. The X chromosomes of M. arvalis and M. rossiaemeridionalis 2008

1286

SHEVCHENKO et al.

1

9

2

10

17

18

25

26

3

4

11

19

12

20

5

13

21

6

14

22

23

7

8

15

16

24

1

X

Y

Fig. 3. GTG-banding of metaphase chromosomes of XENM4 cells derived from the M. rossiaemeridionalis.

were detected using an X-chromosome microdissection library of voles of the genus Microtus [14]. X-Inactivation in XEN Cells RNA-FISH showed that 98% of nuclei of the XEN lines XENg, XENM6, and L7.10 containing two X chromosomes per diploid set of autosomes express the transcript of the Xist gene. The presence of this transcript confirmed that X-inactivation had occurred in XEN cells. The RNA-FISH of preparations of the L7.10 line, which was obtained from XEN cells of M. rossiaemeridionalis × M. arvalis hybrids, was followed by DNA-FISH using the MS4 repeat characteristic of the heterochromatin block of the M.rossiaemeridionalis X chromosome (Fig. 5h). In 85% of the cells, the signals of the Xist RNA and MS4 repeat were separate from each other. This indicated that the maternal (M. rossiaemeridionalis) X chromosome, which contained MS4, was mostly active, whereas the paternal (M. arvalis) X chromosome accumulated the Xist RNA and was mostly inactive. Thus, imprinted inactivation of the paternal X chromosome preferentially occurred in vole XEN cells. DISCUSSION We have obtained and described a number of cell lines from vole morulae and blastocysts that exhibit the characteristics of XEN. In contrast to cultures of ES and TS cells, cultures of XEN cell lines are easy to isolate and maintain. Apparently, a feeder and LIF are necessary at the initial stages of obtaining XEN cultures for

triggering the signaling pathway determining cell differentiation towards XEN: in their absence, rapidly proliferating XEN cultures are more rarely formed. Subsequent maintenance of XEN cultures does not require a feeder or additional factors in the culture medium. At early passages, a feeder may be necessary for providing a cellular microenvironment, rather than as a source of factors, because XEN cells replated at a low density proliferate slowly. The output of XEN lines from blastocysts is higher than from morulae. Apparently, many ICM cells are already naturally predetermined to develop into XEN cells at the blastocyst stage, whereas morula cells have not yet undergone this predetermination, and only a few cells differentiate along this pathway in vitro. Most vole XEN lines obtained in this study were morphologically similar to mouse XEN lines described earlier. However, we have also obtained lines of XEN cells that were morphologically different from all XEN cells studied earlier and formed colonies in vitro, although they did not differ from cells with a typical morphology in any molecular marker studied. Repression of the Nanog gene and activation of the Gata4 and Gata6 genes, which we observed in the obtained cell lines, are assumed to be crucial for cell differentiation towards XEN [2]. Note that expression of the Sall4, Gata4, and Gata6 genes coding for transcription factors is characteristic of XEN cells capable of differentiating into all types of cells forming the parietal and visceral endoderms [3]. The assumption that the obtained XEN cells are undifferentiated is supported by the low expression rate of the Afp gene, whose intense expression is characteristic of differenti-


Vol. 44

No. 11

2008

EXTRAEMBRYONIC ENDODERM STEM CELL LINES ES cells

1287

Oct4

Nanog Sox2 β-actin

Emb + –

1 + –

2 + –

TS cells Fgf2r Cdx2 Pl-1 Eomes Esrrβ Hand1 XEN

Hnf4 Foxa2 Gata6 Sall4 Afp

β-actin

Fig. 4. Expression of genes encoding transcription factors characteristic of ES, TS, and XEN cells in a blastocyst (Bl), a 7.5-dayold embryo (Emb), and two XEN cell lines (1, XENM6; 2, XEN3Ars) differing in morphology. – indicates a negative control for reverse transcription.

ated XEN cells [3]. Note that the cultured vole XEN cells expressed, at a low level, the Esrrβ gene, which is involved in the signaling pathway determining unlimited proliferation of multipotent TS cells [15]. This signaling pathway may also serve for maintaining proliferation of undifferentiated multipotent XEN cells. Mouse extraembryonic trophoblast and endoderm cell lines are characterized by imprinted inactivation of the paternal X chromosome [16]. The inactivation is accompanied the expression of the noncoding RNA of the Xist gene and accumulation of its transcript on the inactive X chromosome [17]. This study has demonRUSSIAN JOURNAL OF GENETICS

Vol. 44

No. 11

strated that vole XEN cells, like all cells of extraembryonic origin, exhibit imprinted inactivation of the paternal X chromosome and accumulate Xist RNA on it. Note that, in somatic cells of adult M. rossiaemeridionalis × M. arvalis hybrids, irrespective of the direction of crossing, display preferential inactivation of the M. rossiaemeridionalis X chromosome, which contains a heterochromatin block [5–7]. However, preferential inactivation of one or the other X chromosome in XEN cells of hybrid females is determined by its paternal origin rather than the species from which it originates or the presence of the heterochromatin block. This indicates 2008

1288

SHEVCHENKO et al.

(a) DAPI

Krt18

Vim

GATA4

GATA6

(b) DAPI

(c)

(d)

Yr Xr

Xr Xr Xr (e)

(f)

Xr

Xr Ya Xa

(g)

(h)


Fig. 5. Characteristics of vole XEN cell lines. Imunofluorescent staining of XEN cells with antibodies against (b) GATA4 (green) and GATA6 (red); (a) cytokeratin 18 (Krt18, green) and vimentin (Vim, red). Cell nuclei (blue) are stained with DAPI. The sex chromosome sets in XEN lines: (c) XX; (d) XY M. rossiaemeridionalis; (e) XX; (f) XY M. rossiaemeridionalis × M. arvalis (Xr and Yr are the X and Y chromosomes of M. rossiaemeridionalis; Xa and Ya are the X and Y chromosomes of M. arvalis). (g) Xist RNA in the nuclei of XENM6 cells; (h) imprinted X-inactivation in L7.10 line of XEN cells. The green signal shows the Xist gene transcript in the inactive X chromosome; the red signal shows the MS4 repeat in the M. rossiaemeridionalis X chromosome.

Vol. 44

No. 11

2008


that the molecular mechanisms that trigger inactivation and are responsible for the choice of the X chromosome to be inactivated in extraembryonic cells differ from those in the cells forming the embryo proper. Thus, we have obtained a new model of embryonic cells other than ES and TS that may be used for studying the expression of genes determining the development of the primitive endoderm and its derivatives, as well as other early ontogenetic processes in extraembryonic tissues, such as imprinted X-inactivation in females. ACKNOWLEDGMENTS This study was supported by the Russian Foundation for Basic Research (project no. 06-04-48337) and the Integration Interdisciplinary Project of the Siberian Branch of the Russian Academy of Sciences (project no. 14.2). REFERENCES 1. Dyban, A.P., Rannee razvitie mlekopitayushchikh (Early Development of Mammals), Leningrad: Nauka, 1988. 2. Ralston, A. and Rossant, J., Genetic Regulation of Stem Cell Origins in the Mouse Embryo, Clin. Genet., 2005, vol. 68, no. 2, pp. 106–112. 3. Kunath, T., Arnaud, D., Uy, G., et al., Imprinted X-Inactivation in Extra-Embryonic Endoderm Cell Lines from Mouse Blastocysts, Development, 2005, vol. 132, pp. 1649–1661. 4. Shevchenko, A.I., Pavlova, S.V., Dement’eva, E.V., et al., Chromatin Modifications during X-Chromosome Inactivation in Female Mammals, Russ. J. Genet., 2006, vol. 42, no. 9, pp. 1019–1029. 5. Zakian, S.M., Kulbakina, N.A., Meyer, M., et al., NonRandom Inactivation of the X-Chromosome in Interspecific Hybrid Voles, Genet. Res., 1987, vol. 50, pp. 23–27. 6. Zakian, S.M., Nesterova, T.B., Cheryaukene, O.V., and Bochkarev, M.N., Heterochromatin as a Factor Affecting X-Inactivation in Interspecific Female Vole Hybrids (Microtidae, Rodentia), Genet. Res., 1991, vol. 58, pp. 105–110.


Vol. 44

No. 11

1289

7. Nesterova, T.B., Slobodyanyuk, S.Y., Elisaphenko, E.A., et al., Characterization of the Genomic Xist Locus in Rodents Reveals Conservation of Overall Gene Structure and Tandem Repeats but Rapid Evolution of Unique Sequence, Genome Res., 2001, vol. 11, no. 5, pp. 833– 849. 8. Mazurok, N.A., Rubtsov, N.B., Nesterova, T.B., and Zakian, S.M., High-Resolution G-Banding of Chromosomes in Microtus kirgisorum (Muridae, Rodentia), Cytogenet. Cell Genet., 1994, vol. 67, pp. 208–210. 9. Fantes, J.A., Oghene, K., Boyle, S., et al., A High Resolution Integrated Physical, Cytogenetic and Genetic Map of Human Chromosome 11 from the Distal Region of p13 to the Proximal Part of p15.1, Genomics, 1995, vol. 25, pp. 447–461. 10. Tanaka, S., Kunath, T., Hadjantonakis, A.K., et al., Promotion of Trophoblast Stem Cell Proliferation by FGF4, Science, 1998, vol. 282, pp. 2072–2075. 11. Oshima, R., Identification and Immunoprecipitation of Cytoskeletal Proteins from Murine Extra-Embryonic Endodermal Cells, Biochemistry, 1981, vol. 256, no. 15, pp. 8124–8133. 12. Maddox-Hyttel, P., Alexopoulos, N.I., Vajta, G., et al., Immunohistochemical and Ultrastructural Characterization of the Initial Post-Hatching Development of Bovine Embryos, Reproduction, 2003, vol. 125, pp. 607–623. 13. Elisaphenko, E.A., Nesterova, T.B., Duthie, S.M., et al., Repetitive DNA Sequences in the Common Vole: Cloning, Characterization and Chromosome Localization of Two Novel Complex Repeats MS3 and MS4 from the Genome of the East European Vole Microtus rossiaemeridionalis, Chromosome Res., 1998, vol. 6, pp. 351–360. 14. Rubtsov, N.B., Rubtsova, N.V., Anopriyenko, O.V., et al., Reorganization of the X Chromosome in Voles of the Genus Microtus, Cytogenet. Genome Res., 2002, vol. 99, pp. 323–329. 15. Rossant, J. and Cross, J.C., Placental Development: Lessons from Mouse Mutants, Nat. Rev. Genet., 2001, vol. 2, no. 7, pp. 538–548. 16. Takagi, N. and Sasaki, M., Preferential Inactivation of the Paternally Derived X Chromosome in the Extraembryonic Membranes of the Mouse, Nature, 1975, vol. 256, no. 5519, pp. 640–642. 17. Penny, G.D., Kay, G.F., Sheardown, S.A., et al., Requirement for Xist in X Chromosome Inactivation, Nature, 1996, vol. 379, no. 6561, pp. 131–137.

2008