We report two Japanese families affected by pulmonary Mycobac- terium avium complex (MAC) disease, involving an older brother and younger sister in one ...
Familial Pulmonary Mycobacterium avium Complex Disease EISAKU TANAKA, TERUMI KIMOTO, HISAKO MATSUMOTO, KAZUNARI TSUYUGUCHI, KATSUHIRO SUZUKI, SONOKO NAGAI, MITSUNOBU SHIMADZU, HIDEAKI ISHIBATAKE, TAKAKO MURAYAMA, and RYOICHI AMITANI Departments of Infectious Diseases and Respiratory Medicine, Kyoto University Hospital, Kyoto; Department of Genetics, Mitsubishi Kagaku Bio-clinical Laboratory, Incorporated, Tokyo; and Department of Internal Medicine, Kyusyu Kouseinenkin Hospital, Fukuoka, Japan
We report two Japanese families affected by pulmonary Mycobacterium avium complex (MAC) disease, involving an older brother and younger sister in one family and two brothers in the second family. We investigated whether defects in the natural resistanceassociated macrophage protein gene (NRAMP1) underlay susceptibility to MAC in these cases. All of the patients had computed tomographic findings of peripheral nodules and bronchiectasis. Pulse-field gel electrophoresis patterns of mycobacterial genomic DNA restriction fragments revealed that none of the MAC strains isolated from the patients was epidemiologically related to any of the others. Direct sequencing of the complementary DNA of the patients’ NRAMP1 revealed a nonconservative missense mutation at codon 419 in one patient, which was heterozygous and was not seen in his affected sibling. No variations similar to those found in mice that show susceptibility to MAC were found. The results suggest an underlying genetic defect in host defense rather than exposure to an unusually virulent strain of MAC as the pathogenetic factor in MAC disease; however, alterations in the coding region of NRAMP1 do not appear to explain the susceptibility to MAC.
Mycobacterium avium complex (MAC) infection has been increasing in incidence (1, 2), and is a challenging clinical problem because MAC is resistant to ordinary antibiotics and can be lethal (3). MAC causes disseminated disease in patients with severe immunodeficiency, such as in acquired immune deficiency syndrome (AIDS), and causes refractory pulmonary disease in patients without apparent immunodeficiency (3). Disturbed mechanical lung defenses caused by predisposing pulmonary disease have been considered the cause of pulmonary infection by MAC, but the infection can also occur in previously healthy hosts without underlying conditions (4). Most patients are elderly, nonsmoking women, and have characteristic computed tomographic findings of peripheral nodules and bronchiectasis (5, 6). Because MAC is ubiquitous in the environment, and most people have the opportunity to be exposed to MAC, unknown host factors that determine susceptibility to MAC may play crucial roles in the pathogenesis of MAC disease. In mice, natural resistance to infection with several intracellular pathogens, including Mycobacterium bovis (7) and MAC (8), is controlled by a single dominant gene, the natural resistance-associated macrophage protein gene (Nramp1) (9). A single, nonconservative amino acid substitution of aspartic acid for glycine at position 169 of the protein encoded by Nramp1 is invariably correlated with the susceptibility phenotype to MAC and M. bovis in 27 inbred mouse strains (10). The human homologue of Nramp1 (NRAMP1) has been cloned, and several polymorphisms in it have been identified (11, 12). (Received in original form July 29, 1999 and in revised form November 3, 1999) Correspondence and requests for reprints should be addressed to Eisaku Tanaka, M.D., Department of Respiratory Medicine, Tenri Hospital, Mishimacho 200, Tenri, Nara 632-8552, Japan. Am J Respir Crit Care Med Vol 161. pp 1643–1647, 2000 Internet address: www.atsjournals.org
The recent finding that some polymorphisms in NRAMP1 are correlated with tuberculosis in West Africans (13) suggested that genetic variations in NRAMP1 may affect susceptibility to human mycobacterial infection. We hypothesized that a genetic defect in NRAMP1 might underlie susceptibility in familial cases of pulmonary MAC disease. In familial cases, however, there is also the possibility that patients might be exposed to an unusually virulent strain of the organism in the common environment or by person-toperson transmission. In the present study we examined two familial cases of pulmonary MAC disease, and used analysis of restriction fragment length polymorphisms (RFLP) of bacterial genomic DNA to investigate whether the patients might have been infected with the same MAC strain. We also used reverse transcription-polymerase chain reaction (RT–PCR) sequence analysis to determine whether a common genetic defect in NRAMP1 might underlie susceptibility to MAC.
METHODS Case Histories Patient 1. A 52-yr-old Japanese man visited the Kyoto University Hospital because of a chronic productive cough in 1998. When he had been 42 yr old, he had developed a productive cough, and MAC was first detected in sputum cultures generated at a nearby hospital. The patient received several courses of drug therapy, including antituberculosis drugs and clarithromycin, but continued to have a chronic cough that waxed and waned. Excretion of MAC continued, and chest roentgenographic findings gradually worsened. The patient had smoked one pack of cigarettes daily from the ages of 19 to 32 yr, and had been exposed to industrial cement dust for 10 yr. His 50-yr-old younger brother was healthy, but his younger sister (Patient 2) had pulmonary MAC disease. A chest roentgenogram (Figure 1A) and high-resolution computed tomography (HRCT) revealed diffuse, small nodules and bronchiectasis in both of the patient’s lungs. His serum was negative for antibodies to human immunodeficiency virus (HIV) type 1 and type 2 and human T-cell lymphotrophic virus type 1. Smears and cultures of sputum for acid-fast bacilli (AFB) were positive on three successive occasions. The isolate was confirmed to be Mycobacterium intracellulare. Combination chemotherapy was prescribed for 6 mo with rifampin, clarithromycin, ethambutol, and initial kanamycin, followed by a quinolone. The patient’s condition has improved, but he continues to excrete MAC. Patient 2. This patient, the younger sister of Patient 1, had been well until the age of 41 yr, in 1990, when she developed a productive cough and bloody sputum. In 1991, MAC was first detected through sputum cultures. Antituberculosis drugs were administered for 2 yr with symptomatic relief. The patient’s condition had been quiescent until 1994, when her productive cough recurred and MAC was cultured repeatedly from her sputum. A combination of antituberculosis drugs and clarithromycin was prescribed for 2 yr. Although the patient continued to have positive cultures of sputum, she remained relatively healthy until developing a low-grade fever and hemoptysis in February 1998, when she was admitted to the Kyoto University Hospital at the age of 49 yr. The patient was a nonsmoking housewife
1644
AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE
without obvious risk factors for HIV infection. She had lived in a different household from Patient 1 after her marriage, although they visited one another frequently. A chest roentgenogram (Figure 1B) and HRCT scan revealed small nodules and bronchiectasis in the right upper and lower lobes, and collapse of the right middle lobe. Sputum smears and cultures for AFB were repeatedly positive. The isolate was confirmed to be M. avium. Combination chemotherapy was prescribed with rifampin, clarithromycin, ethambutol, and initial kanamycin, followed by a quinolone. The patient became afebrile, but she continues to excrete MAC. Patient 3. A 54-yr-old Japanese man unrelated to Patients 1 and 2 was admitted to the Chest Disease Research Institute Hospital because of hemoptysis in 1996. He had been given a diagnosis of pulmonary MAC disease at another hospital in 1981, and had taken antituberculosis drugs for half a year. He had been well until 3 mo before admission, when he began having an intermittent low-grade fever and a productive cough with hemoptysis. The patient was a nonsmoker and denied previous exposure to industrial dust. His two older sisters and one younger brother were healthy, but his older brother (Patient 4) had pulmonary MAC disease. The patient had lived separately from his older brother for the previous 30 yr, and they rarely visited each other. A chest roentgenogram (Figure 1C) and HRCT scan revealed pe-
VOL 161
2000
ripheral small nodules and infiltration associated with bronchiectasis in the right upper and middle lobes and in the left lingula. Smears were negative, but cultures of sputa and bronchial washings were positive for M. avium. The patient received clarithromycin plus ethambutol, rifampin, and kanamycin for an initial period of 2 mo, and subsequently received a quinolone for 24 mo. His condition improved and his sputum converted to negative. Patient 4. This patient, the older brother of Patient 3, had been followed for hypertrophic obstructive cardiomyopathy since 1982 at the Department of Internal Medicine of Kyushu Koseinennkin Hospital. He was a nonsmoker and reported that he had not been exposed to industrial dust. MAC was first detected in his sputum culture when he was 50 yr of age, in 1986. Because his productive cough and chest roentgenographic findings (Figure 1D) worsened, several courses of combination chemotherapy, including clarithromycin and levofloxacin, had been prescribed for him since 1994, but he continues to intermittently excrete MAC.
Analysis of Bacterial RFLP Mycobacterial chromosomal DNA was prepared as described previously, with minor modifications (14). Multiple (sweep) colonies ob-
Figure 1. (A) Chest roentgenogram of Patient 1, showing diffuse small nodules and bronchiectasis in the both lungs. (B) Chest roentgenogram of Patient 2, showing peripheral small nodules and bronchiectasis in the right lung. (C) Chest roentgenogram of Patient 3, showing peripheral nodules and infiltration associated with bronchiectasis in the right upper and middle lobes, and in the lingula. (D) Chest roentgenogram of Patient 4, showing cardiomegaly and peripheral small nodules and bronchiectasis in the middle lobe and ligula.
1645
Tanaka, Kimoto, Matsumoto, et al.: Familial M. avium Complex Disease tained from sputum cultures were transferred from slants of 3% Ogawa egg medium into 9 ml of Middlebrook 7H9 broth supplemented with Middlebrook Bacto albumin-dextrose-catalase for enrichment (Difco Laboratories, Detroit, MI). The broth culture was incubated at 37⬚ C on a shaker for 7 to 9 d to an optical density (OD) of 0.20 at 600 nm. Following this, 1 ml of 10⫻ ACT solution (1 mg/ml of ampicillin, 10 mg/ml of D-cycloserine, 10 mg/ml of D-threonine) was added and the culture was incubated for an additional 18 h. After centrifugation, the pellet was resuspended in 0.2 ml of cold TS buffer (50 mM Tris, 0.5 M sucrose, pH 7.6) and was frozen in liquid nitrogen. After thawing, the bacterial suspension was mixed with 0.2 ml of 1.3% molten Incert agarose (FMC Bioproducts, Rockland, ME) in TEN buffer (50 mM Tris, 250 mM ethylenediamine tetraacetic acid, 200 mM NaCl, pH 7.6) at 60⬚ C, and was then dispensed into plug molds. Subsequent treatment with lysozyme (Sigma Chemical Co., St. Louis, MO) and proteinase K (Sigma) was performed as previously described (15). Plugs were then incubated overnight at 37⬚ C with 20 U of the restriction enzyme AseI (TOYOBO, Osaka, Japan). Large restriction fragments were separated in a 1% SeaKem Gold agarose (FMC Bioproducts) gel, through use of an ATTO Crossfield AE-6800 (ATTO Corporation, Tokyo, Japan) electrophoresis apparatus at 14⬚ C for 22 h at 200 V, with pulse times of 40 s.
Analysis of NRAMP1 Complementary DNA Total RNA was extracted from peripheral blood cells by the acid– phenol single-step method, and complementary DNA (cDNA) synthesis was conducted with 5 g of total RNA and random hexamer primers, with SuperScript reverse transcriptase (Life Technologies Inc., Rockville, MD) at 45⬚ C for 1 h, followed by a 1-min period at 100⬚ C. Human NRAMP1 cDNA from each patient was amplified by means of PCR, with the use of two sets of NRAMP1-specific primers: nucleotides ⫺131 (relative to the transcription start site) to ⫺111, 5⬘– CTCGGCTGCGGATGGGTAACA–3⬘ (NRAMP1-10F sense), and nucleotides 1,790 to 1,813, 5⬘–ATCACATGGCTGCGCTAGGAAACA–3⬘ (NRAMP1-9R antisense); and nucleotides ⫺131 to ⫺111, 5⬘–CTCGGCTGCGGATGGGTAACA–3⬘ (NRAMP1-10F sense), and nucleotides 1,415 to 1,437, 5⬘–GATGGCGCAGACTAGCACCATGA–3⬘ (NRAMP1-7R antisense). PCR reactions were conducted in a GeneAmp Model 2400 PCR system (Perkin-Elmer, Foster City, CA), in a mixture of 1⫻ Taq polymerase buffer, 1.5 mM MgCl2, all four deoxynucleotide triphosphates (dNTPs) (each at 0.2 mM), each primer at 250 nM, and 1.0 unit of LATaq polymerase (Takara Shuzo, Tokyo, Japan). All reactions were denatured at 94⬚ C for 3 min and subjected to 35 amplification cycles with an annealing temperature of 60⬚ C. Each cycle consisted of 30 s at 94⬚ C, 40 s at the indicated annealing temperature, and 120 s at 72⬚ C. PCR was terminated after an extension step at 72⬚ C for 3 min. The PCR products were excised from agarose gels, purified, and used as templates for the second PCR amplification. Nested or seminested PCR was done in a mixture of 1⫻ Taq polymerase buffer, 1.5 mM MgCl2, all four dNTPs (each at 0.2 mM), each primer at 250 nM, and 1.0 unit of AmpliTaq gold polymerase (Perkin-Elmer) with eight sets of primers: nucleotides ⫺131 to ⫺111, 5⬘–CTCGGCTGCGGATGGGTAACA–3⬘ (NRAMP1-10F sense), and nucleotides 133 to 155, 5⬘–GTGCCCGGTTTTGTGTCTGGGAT–3⬘ (NRAMP1-1R antisense); nucleotides 104 to 127, 5⬘– GAGAGACCTACCTGAGTGAGAAGA–3⬘ (NRAMP1-2F sense), and nucleotides 370 to 393, 5⬘–CTTAGGGTAGTAGAGATGGCAGAC–3⬘ (NRAMP1-2R antisense); nucleotides 273 to 295, 5⬘–ACTTCTCTGGGTGCTGCTCTGG–3⬘ (NRAMP1-3F sense), and nucleotides 548 to 571, 5⬘–CGTAGTTATCGAGGAAGAGGAAGA–3⬘ (NRAMP1-3R antisense); nucleotides 508 to 529, 5⬘–CTCTGGGGTGGCGTCCTCATCA–3⬘ (NRAMP1-4F sense), and nucleotides 760 to 781, 5⬘–AGTGCAGGTAGATGTTGTGGGG–3⬘ (NRAMP1-4R antisense); nucleotides 635 to 660, 5⬘–ATGAGTATGTGGTGGCGCGTCCTGAG–3⬘ (NRAMP1-5F sense), and nucleotides 970 to 995, 5⬘–TTGGCGTAGTCGTGGAGGCTGCTGTT–3⬘ (NRAMP1-5R antisense); nucleotides 900 to 924, 5⬘–CTTTGTCATGGCTGTCTTTGGGCA–3⬘ (NRAMP1-6F sense), and nucleotides 1,148 to 1,170, 5⬘– GAAGCCCTCCATCACGAACTGTC–3⬘ (NRAMP1-6R antisense); nucleotides 1,030 to 1,052, 5⬘–GACATTTACCAGGGGGGCGTGAT–3⬘ (NRAMP1-7F sense), and nucleotides 1,415 to 1,437, 5⬘– GATGGCGCAGACTAGCACCATGA–3⬘ (NRAMP1-7R anti-
sense); and nucleotides 1,333 to 1,355, 5⬘–CCCATCCTCACGTTCACCAGCAT–3⬘ (NRAMP1-8F sense), and nucleotides 1,790 to 1,813, 5⬘–ATCACATGGCTGCGCTAGGAAACA–3⬘ (NRAMP19R antisense). All reactions were denatured at 95⬚ C for 9 min and subjected to 40 cycles of amplification with an annealing temperature of 60⬚ C. Each cycle consisted of 30 s at 95⬚ C, 2 min at the indicated annealing temperature, and 2 min at 72⬚ C. The PCR was terminated after an extension step at 60⬚ C for 3 min. The PCR products were excised from agarose gels and purified, and the fragments obtained were subjected to thermal cycle sequencing in both the sense and antisense orientations.
RESULTS Analysis of Bacterial RFLP
All of the strains of cultured organisms were identified as MAC through use of the Accuprobe technique (GenProbe, Inc., San Diego, CA). The strain obtained from the sputum of Patient 1 was confirmed as M. intracellulare and the strains obtained from Patients 2, 3, and 4 were confirmed as M. avium through the Amplicor PCR assay (Roche Diagnostic Systems, Inc., Branchburg, NJ). The large restriction fragment bands of bacterial genomic DNA were compared on the basis of the Tenover criteria (16). There were seven or more band differences among the MAC strains (Figure 2), and the strains were considered to be epidemiologically unrelated to each other. Therefore, the possibility that the patients were infected with the same MAC strain through exposure in a common environment, or by person-toperson transmission, was disproven. Analysis of NRAMP1 cDNA
Direct sequencing of NRAMP1 cDNA revealed two variants in the coding regions of the gene. One of the variants was pre-
Figure 2. Pulse-field gel electrophoresis patterns of genomic DNA restriction fragments digested with AseI (pulse times, 40 s; running time, 22 h): lane 1, DNA strands; lane 2, MAC recovered from Patient 1; lane 3, MAC from Patient 2; lane 4, MAC from Patient 3; lane 5, MAC from Patient 4.
1646
AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE
dicted to cause a nonconservative amino acid substitution: R419Q, a CGG (arginine) to CAG (glutamine) substitution at codon 419. The substitution of uncharged glutamine for positively charged arginine might affect the function of the protein. The variation was heterozygous and was seen only in Patient 1. Another variant was a silent nucleotide substitution: a TTC to TTT (phenylalanine) substitution at codon 66. There was a variant in the 3⬘ untranslated region (UTR): a G or A substitution 86 nucleotides downstream of the stop codon. None of the patients had a variation at codon 172 corresponding to the mouse susceptibility mutation in Nramp1 at codon 169 (G169D). No other polymorphisms or variants reported so far were found (i.e., GGC or GGT [Gly] at codon 249, GCG [Ala] or GTG [Val] at codon 318, GAC [Asp] or AAC [Asn] at codon 543, or deletion of TGTG at 55 nucleotides 3⬘ to the last codon [11]).
DISCUSSION Reports of MAC disease occurring in more than one member of a family are rare (17–19), and the reported cases have been cases of disseminated or cutaneous infection. Among 170 patients given a diagnosis of definite pulmonary MAC disease in our department, there have so far been three patients who have had siblings with pulmonary MAC disease. Two of the involved families are presented in this report, and the other family (two sisters) could not be investigated because the index patient was dead. Except for family history, no clinical characteristics could distinguish familial from nonfamilial MAC disease. The 170 patients with MAC disease diagnosed at our institution had 622 siblings, three of whom had MAC disease, giving a period prevalence of 482 cases per 100,000 population, as compared with a prevalence of 2.5 cases per 100,000 population in Japan (2) as a whole. Although the observed prevalence of MAC disease among the siblings of the index patients appears to be higher than the prevalence in the general population, the small number of cases in the study, and selection bias, preclude a definite analysis of the relative risk. The higher-than-expected incidence of familial cases suggests three possibilities: that the patients have genetic defects in their host defenses, that the patients are infected with an unusually virulent strain of MAC, or both. In mice, it has been shown that a single dominant gene, Nramp1, controls resistance to intracellular parasites including mycobacteria (7, 8), and that a homozygous mutation in Nramp1 (G169D) invariably determines the susceptibility to infection with these organisms (10). Nramp1 encodes an integral membrane phosphoglycoprotein of 110 kD, which is expressed exclusively in phagosome membranes of macrophages (20, 21). The human orthologous gene, NRAMP1, has strong homogeneity with murine Nramp1, especially in the region of the mouse susceptibility mutation (22), and several variants or polymorphisms have been reported in the coding region, in introns, in the promoter region, and in the 3⬘ untranslated region (UTR) of NRAMP (11, 12). Huang and colleagues analyzed four regions of NRAMP1 in eight sporadic cases of pulmonary MAC disease, but found no variations correlated with the disease (23). Recently, Bellamy and colleagues reported that susceptibility to tuberculosis in West Africans was significantly associated with four polymorphisms in NRAMP1: a (CA)n microsatellite in the immediate 5⬘ region of the gene, a single-nucleotide change in intron 4 (469 ⫹ 14G/C), a nonconservative single-base substitution at codon 543 (D543N), and a TGTG deletion in the 3⬘ UTR (13). Therefore, we focused on an alteration of NRAMP1 as a candidate for an underlying genetic factor in the present study, although the host
VOL 161
2000
factors correlated with susceptibility to pulmonary MAC infection might be heterogeneous in humans. By direct sequencing of NRAMP1 cDNA, we found one nonconservative missense mutation (R419Q), in Patient 1, that had not been previously reported. However, the mutation was heterozygous and was not found in the patient’s affected sibling. The other variation seen was a silent mutation at codon 66. The results suggest that alterations of the NRAMP1 cDNA sequence cannot explain the susceptibility of these patients to MAC. We could not, however, exclude the possibility that a quantitative defect in the NRAMP1 protein caused pulmonary MAC disease in these patients. Further analysis of the promoter region and introns of NRAMP1, and quantitation of the NRAMP protein in macrophages, will be necessary to address these issues. Moreover, because we have evaluated only two families, and host factors might be heterogeneous, evaluation of more cases of familial MAC diseases should be undertaken. In conclusion, different RFLP patterns of MAC strains obtained from our patients’ siblings excluded the possibility of their being infected with the same MAC strains as the patients, and suggested that host genetic factor(s) may underlie susceptibility to familial pulmonary MAC disease. Although alterations in NRAMP1 cDNA could not explain the susceptibility to MAC in our patients, further analysis of familial cases should open new prospects for research in the pathogenesis of this refractory disease. Acknowledgment : The authors would like to thank Dr. Kazunori Hirayoshi for technical advice, and Ms. Kazumi Kataoka for secretarial work.
References 1. O’Brien, R. J., L. J. Geiter, and D. J. Snider. 1987. The epidemiology of nontuberculous mycobacterial diseases in the United States: results from a national survey. Am. Rev. Respir. Dis. 135:1007–1014. 2. Sakatani, M. 1999. Nontuberculous mycobacteriosis: the present status of epidemiology and clinical studies. Kekkaku 74:377–384. 3. American Thoracic Society. 1997. Diagnosis and treatment of disease caused by nontuberculous mycobacteria. Am. J. Respir. Crit. Care Med. 156(Suppl.):S1–S25. 4. Prince, D. S., D. D. Peterson, R. M. Steiner, J. E. Gottlieb, R. Scott, H. L. Israel, W. G. Figueroa, and J. E. Fish. 1989. Infection with Mycobacterium avium complex in patients without predisposing conditions. N. Engl. J. Med. 321:863–868. 5. Hartman, T. E., S. J. Swensen, and D. E. Williams. 1993. Mycobacterium avium-intracellulare complex: evaluation with CT. Radiology 187:23–26. 6. Tanaka, E., R. Amitani, A. Niimi, K. Suzuki, T. Murayama, and F. Kuze. 1997. Yield of computed tomography and bronchoscopy for the diagnosis of Mycobacterium avium complex pulmonary disease. Am. J. Respir. Crit. Care Med. 155:2041–2046. 7. Gros, P., E. Skamene, and A. Forget. 1981. Genetic control of natural resistance to Mycobacterium bovis (BCG) in mice. J. Immunol. 127:2417– 2421. 8. Goto, Y., R. M. Nakamura, H. Takahashi, and T. Tokunaga. 1984. Genetic control of resistance to Mycobacterium intracellulare infection in mice. Infect. Immun. 46:135–140. 9. Vidal, S. M., D. Malo, K. Vogan, E. Skamene, and P. Gros. 1993. Natural resistance to infection with intracellular parasites: isolation of a candidate for Bcg. Cell 73:469–485. 10. Malo, D., K. Vogan, S. Vidal, J. Hu, M. Cellier, E. Schurr, A. Fuks, N. Bumstead, K. Morgan, and P. Gros. 1994. Haplotype mapping and sequence analysis of the mouse Nramp gene predict susceptibility to infection with intracellular parasites. Genomics 23:51–61. 11. Liu, J., T. M. Fujiwara, N. T. Buu, F. O. Snchez, M. Cellier, A. J. Paradis, D. Frappier, E. Skamene, P. Gros, K. Morgan, and E. Schurr. 1995. Identification of polymorphisms and sequence variants in the human homologue of the mouse natural resistance-associated macrophage protein gene. Am. J. Hum. Genet. 56:845–853. 12. Blackwell, J. M., C. H. Barton, J. K. White, S. Searle, A. M. Baker, H. Williams, and M. A. Shaw. 1995. Genomic organization and sequence of the human NRAMP gene: identification and mapping of a promoter region polymorphism. Mol. Med. 1:194–205. 13. Bellamy, R., C. Ruwende, T. Corrah, K. P. McAdam, H. C. Whittle, and
1647
Tanaka, Kimoto, Matsumoto, et al.: Familial M. avium Complex Disease
14.
15.
16.
17.
18.
A. V. Hill. 1998. Variations in the NRAMP1 gene and susceptibility to tuberculosis in West Africans. N. Engl. J. Med. 338:640–644. Slutsky, A. M., R. D. Arbeit, T. W. Barber, J. Rich, C. F. von Reyn, W. Pieciak, M. A. Barlow, and J. N. Maslow. 1994. Polyclonal infections due to Mycobacterium avium complex in patients with AIDS detected by pulsed-field gel electrophoresis of sequential clinical isolates. J. Clin. Microbiol. 32:1773–1778. Maslow, J. N., A. M. Slutsky, and R. D. Arbeit. 1993. Application of pulse-field gel electrophoresis to molecular epidemiology. In D. H. Persing, D. F. Smith, F. C. Tenover, and T. J. White, editors. Diagnostic Molecular Microbiology: Principles and Applications. American Society for Microbiology, Washington, DC. 563–572. Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. Persing, and B. Swaminathan. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233– 2239. Nedorost, S. T., B. Elewski, J. W. Tomford, and C. Camisa. 1991. Rosacea-like lesions due to familial Mycobacterium avium-intracellulare infection. Int. J. Dermatol. 30:491–497. Levin, M., M. J. Newport, S. D’Souza, P. Kalabalikis, I. N. Brown, H. M. Lenicker, P. V. Agius, E. G. Davies, A. Thrasher, N. Klein, and J. M. Blackwell. 1995. Familial disseminated atypical mycobacterial infec-
19.
20.
21.
22.
23.
tion in childhood: a human mycobacterial susceptibility gene? Lancet 345:79–83. Frucht, D. M., and S. M. Holland. 1996. Defective monocyte costimulation for IFN-␥ production in familial disseminated Mycobacterium avium complex infection: abnormal IL-12 regulation. J. Immunol. 157:411–416. Vidal, S., E. Pinner, S. Lepage, S. Gauthier, and P. Gros. 1996. Natural resistance to intracellular infections: Nramp1 encodes a membrane phosphoglycoprotein absent in macrophages from susceptible (Nramp1D169) mouse strains. J. Immunol. 157:3559–3568. Gruenheid, S., E. Pinner, M. Desjardins, and P. Gros. 1997. Natural resistance to infection with intracellular pathogens: the Nramp1 protein is recruited to the membrane of the phagosome. J. Exp. Med. 185:717–730. Cellier, M., G. Govoni, S. Vidal, T. Kwan, N. Groulx, J. Liu, F. Sanchez, E. Skamene, E. Schurr, and P. Gros. 1994. Human natural resistanceassociated macrophage protein: cDNA cloning, chromosomal mapping, genomic organization, and tissue-specific expression. J. Exp. Med. 180:1741–1752. Huang, J. H., P. J. Oefner, V. Adi, K. Ratnam, S. J. Ruoss, E. Trako, and P. N. Kao. 1998. Analyses of the NRAMP1 and IFN-␥R1 genes in women with Mycobacterium avium-intracellulare pulmonary disease. Am. J. Respir. Crit. Care Med. 157:377–381.
