SUPPLEMENTARY INFORMATION
Title: Redox-sensing under hypochlorite stress and infection conditions by the Rrf2family repressor HypR in Staphylococcus aureus
Authors: Vu Van Loi1, Tobias Busche1,2, Karsten Tedin3, Jörg Bernhardt4, Jan Wollenhaupt5, Nguyen Thi Thu Huyen1, Christoph Weise6, Jörn Kalinowski2, Markus Wahl5, Marcus Fulde3 and Haike Antelmann1*
Departments & Institutions: 1Freie
Universität Berlin, Institute for Biology-Microbiology, D-14195 Berlin, Germany
2Bielefeld 3Freie
University, Center for Biotechnology, D-33594 Bielefeld, Germany
Universität Berlin, Institute of Microbiology and Epizootics, Centre for Infection Medicine,
D-14163 Berlin, Germany 4Ernst-Moritz-Arndt-University
of Greifswald, Institute, for Microbiology, D-17487 Greifswald,
Germany; 5Freie
Universität Berlin, Laboratory of Structural Biochemistry, D-14195 Berlin, Germany
6Freie
Universität Berlin, Institute of Chemistry and Biochemistry, D-14195 Berlin, Germany
Abbreviated title: Redox-sensing of NaOCl by HypR in Staphylococcus aureus
*Corresponding author: Haike Antelmann, Freie Universität Berlin, Institute for Biology-Microbiology, Königin-Luise-Strasse 12-16, D-14195 Berlin, Germany, Tel: +49-(0)30-838-51221, Fax: +49-(0)30-838-451221 E-mail:
[email protected]
Key words: Staphylococcus aureus/ Rrf2/redox sensing regulator/ hypochlorite stress
Figure S1
A
∆hypR hypR 0‘
15’
∆hypR hypRC33A 30’
0‘
15’
30’
∆hypR hypRC99A 0‘
15’
30’
∆hypR hypRC142A 0‘
15’
30’
∆hypR 0‘
2661 1821 1517
15' NaOCl 0.7 kb
1049
hypR
23S rRNA 16S rRNA
B
∆hypR hypR 0‘
15’
C
∆hypR ∆hypR ∆hypR hypRC33A hypRC99A hypRC142A ∆hypR 0‘
15’
0‘
15’
0‘
15’
0‘
15'
WT 0‘ 15’ 30’ NaOCl
diamide
0.7 kb
2661 1821 1517
hypR
1.8 kb
hypR-merA
1049
23S rRNA
23S rRNA
16S rRNA
16S rRNA
Figure S1. Northern blot analysis of hypR transcription under NaOCl (A, C) and diamide stress (B) in hypR Cys-Ala mutants in S. aureus COL using a hypR-specific RNA probe. A) Northern blot analysis of hypR transcription was analyzed in the S. aureus COL DhypR mutant and in DhypR mutants complemented with hypR, hypRC33A, hypRC99A and hypRC142A (A) and in the S. aureus wild type (B) before and 15 and 30 min after exposure to 1 mM NaOCl (A, C) or 15 min after diamide stress (B). For stress experiments, S. aureus cells were grown in RPMI medium and treated with 1 mM NaOCl (A, C) or 2 mM diamide (B) at an OD500 of 0.5. The arrows point toward the hypR-merA bicistronic mRNA in (C) and towards the plasmidbased 1 kb hypR transcript in the complemented strains (A, B) that was detected with a hypR specific antisense mRNA probe. The methylene blue stain is shown as RNA loading control below the Northern blots with the 16S and 23S rRNAs.
Figure S2
A -35
-10
TAATTGTAACTA
HypR
B
T
P 0.05 0.1 0.2 0.3 0.4 0.5 0.6 1.2 µM
C
IR-m1
CAGTTACAATTA G
A
IR-m2
IR-m1
IR-m2
trxA
rnaIII
Figure S2. HypR binds specifically to the operator sequence upstream of the hypR-merA operon. A) The alignment of the HypR operator in conserved hypR-merA upstream regions across Staphylococcus species is shown (from Fig.6C). Two base substitutions were introduced in each half of the inverted repeat denoted with arrows (IR-m1 and IR-m2). B) EMSAs were used to analyze DNA binding of purified HypR protein to the hypR-merA promoter region with bases substitutions (IR-m1 and IR-m2). As non-specific controls, DNA probes were used containing trxA and rnaIII internal gene fragments.
Figure S3
A
HypR Co 20 50 100
C99A
C33A
Co 20 50 100 Co
Co 20 50 100 µM NaOCl
70 55 40 35 25
70 55 40 35 25
15
15
10
10
C142A 20
B
50 100 µM NaOCl
HypR
Reducing SDS-PAGE
Reducing SDS-PAGE
Figure S3. Reducing SDS-PAGE of purified HypR wild type and Cys mutant proteins treated with NaOCl. (A, B) The purified HypR wild type and Cys mutant proteins were treated with increasing NaOCl concentrations in vitro and subjected to reducing SDS-PAGE analysis and stained with Coomassie Blue to analyze for reversible thiol-oxidations. The HypR intermolecular disulfides are shown in the non-reducing SDS-PAGE analysis in Figure 8AB.
Figure S4 A
HypR Co 5
10
C33A 20
Co 5
10
C99A 20 µM Dia
Co 5
10
B
C142A 20
Co 5
10
20 µM Dia
70 55 40 35 25
70 55 40 35 25
HypRdisulfide
15
15
HypR
Non-reducing SDS-PAGE
C
HypR Co
5
10
Non-reducing SDS-PAGE C99A
C33A 20
Co 5
10
20 µM Dia
Co
70 55 40 35 25
70 55 40 35 25
15
15
Reducing SDS-PAGE
5
10
C142A 20
Co
5
10
D 20 µM Dia
HypR
Reducing SDS-PAGE
Figure S4. Non-reducing (A, B) and reducing (C, D) SDS-PAGE analysis of purified HypR proteins after diamide treatment. (A, B) The purified HypR wild type and Cys mutant proteins were treated with increasing concentrations of 5-20 µM diamide in vitro and subjected to non-reducing SDS-PAGE analysis to analyze for intermolecular disulfide formation. (C, D) The reducing SDS-PAGE analysis showed that the HypR disulfide under diamide stress are reversible and could be reduced with DTT. The SDS-PAGE gels are stained with Coomassie Blue.
HypR Co
20 50 100
70 55 40 35 25
Co 20 50 100 µM NaOCl
4
2 1
3
15
x104
4
1575.93
1552.45
1533.68
C33A + NaOCl (disulfide dimer, lane 4)
3000
1533.70
1
HypR + NaOCl (disulfide dimer, lane 1)
1000
1499.65
2000
1500
1520
1533.63
2
1575.89
3
1499.72
Intens. [a.u.]
C33A + NaOCl (lane 3) 1499.70
4 2
Intens. [a.u.]
HypR
6
1489.74
Intens. [a.u.]
x104
HypRdisulfide
1590.71
A
C33A
1590.72
Figure S5
B 1590.71: 90-103, C99+IAM
C 1590.71: 90-103, C99+IAM
D 1533.63: 90-103, Cys99 1540
1560
1580
1600
1620
m/z Figure S5: Non-reduding SDS-PAGE (from Figure 8A) (A) and MALDI-TOF spectra of the tryptically digested oxidized wild type HypR protein as disulfide dimer, lane 1 (D), the Cys33A protein, lane 3 (B) and Cys33A disulfide dimer, lane 4 (C). The purified HypR and Cys33A mutant proteins were subjected to NaOCl treatment, alkylated with 100 mM IAM and separated by non-reducing SDS-PAGE and stained with Coomassie Blue as described in Figure 8A. The labelled bands 1-4 were cut, tryptic digested and analyzed by MALDI-TOF MS/MS. Cys99 is reduced in the HypR sample due to the fragmentation of the Cys33-Cys99 disulfide peptide (see Figure 9). The full alkylation of Cys99 peptide (Cys99+57 for IAM) and the absence of Cys142 in the Cys33A sample suggests the artifical oxidation to the Cys142-Cys142 disulfide.
Figure S6 A
WT HypR
DhypR HypR
DhypR
DhypR
70 55 40 35 25
HypRDisulfid
15
HypR
Co NaOCl Co NaOCl
70 55 40 35 25
HypRdisulfide
15
15
HypR
Reducing a-HypR
DhypR HypR DhypR
DhypR
C33A
Reducing a-HypR DhypR
C99A
Co NaOCl Co NaOCl Co NaOCl
Co NaOCl Co NaOCl Co NaOCl
70 55 40 35 25
70 55 40 35 25
15
15
Loading control
B
C142A
70 55 40 35 25
Reducing a-HypR
C
DhypR
C99A
Co NaOCl Co NaOCl Co NaOCl
Co NaOCl Co NaOCl Co NaOCl
WT HypR
C33A
C142A
D
Co NaOCl Co NaOCl
70 55 40 35 25 15 Loading control
Loading control
Figure S6. Reducing HypR-specific Western blot analysis (A) and Coomassie-stained SDS-PAGE loading control (B). (A,B) HypR-specific Western blot analysis was performed from S. aureus COL with plasmid pRB473-hypR, the ΔhypR deletion mutant and ΔhypR mutant strains complemented with hypR, hypRC33A, hypRC99A and hypRC142A. S. aureus strains were exposed to 1 mM NaOCl stress, alkylated with IAM and the protein extracts were subjected to reducing Western blot analysis using polyclonal rabbit anti-HypR antibodies. (B,C) The reducing SDS-PAGE is shown as protein loading control using Coomassie-stained images of the same cell lysates used for Western blot analysis. The non-reducing Western blot analysis of HypR intersubunit disulfides is presented in Figure 8CD.
Figure S7
∆hypR co
∆hypR NaOCl
HypR-C33A co
HypR-C33A NaOCl
HypR co
HypR NaOCl
HypR-C99A co
HypR-C99A NaOCl
Figure S7. Non-reducing/Reducing diagonal SDS-PAGE and HypR-specific Western blot analysis of immunoprecipitated HypR and HypR Cys mutants. HypR-specific Western blot analysis was performed from S. aureus COL with plasmid pRB473-hypR, the ΔhypR deletion mutant and ΔhypR mutant strains complemented with hypR, hypRC33A and hypRC99A. S. aureus strains were exposed to 1 mM NaOCl stress, alkylated with IAM and the protein extracts were subjected to nonreducing/reducing diagonal SDS-PAGE and HypR specific Western blot analysis using polyclonal rabbit anti-HypR antibodies. The HypR intersubunit disulfides are only shown in the wild type HypR protein under NaOCl stress, but not in the Cys33A and Cys99A mutants. For the diagonal assay, immunoprecipitated HypR samples were used while the diagonal assays with the crude extracts are shown in Figure 8.
Figure S8
80
72 ± 2 kDa
0.6
34 ± 2 kDa
0.4
40
0.2
20
1.0
HypR C33A
10
12
100
13
0.8
80
0.6
60
67 ± 4 kDa 34 ± 2 kDa
0.4
40
0.2
20
HypR C99A
10
12
100
13
0.8
80
78 ± 4 kDa
0.6
60
32 ± 2 kDa
0.4
40
0.2
20
HypR C142A
10
12
100
13
0.8
80
0.6
69 ± 3 kDa
0.4
60
34 ± 3 kDa
40
0.2
20
0.0 6
7
8
9 10 11 Volume (ml)
12
13
14
Molecular weight (kDa)
1.0
Molecular weight (kDa)
Refractive index [a.u.]
60
Molecular weight (kDa)
Refractive index [a.u.]
0.8
1.0
Refractive index [a.u.]
100
HypR
Molecular weight (kDa)
Refractive index [a.u.]
Dimer 1.0
Figure S8. SEC-MALS of reduced HypR and HypR Cys-Ala mutant proteins. The molecular weights and oligomerisation states of reduced HypR and reduced HypR Cys33A, Cys99A and Cys142A mutant proteins were determined using SEC-MALS. The HypR proteins (170 µM each) were reduced with 10 mM TCEP and subjected to a S75 10/300 sizeexclusion column in SEC buffer (10 mM HEPES, 500mM NaCl, 1 mM TCEP, pH 7.4). The plots show the normalized refractive index chromatograms of the SEC-MALS runs and calculated molecular weights of the peaks. All HypR Cys mutants and the HypR wild type protein elute mainly as dimers at the size of 32-34 kDa. The higher mass oligomers (6778 kDa) are observed at different amounts between each Cys mutant and may represent disulfidecrosslinks of two HypR dimers.
Figure S9 A
B
[θ]molar (deg cm2 dmol-1)
10000
HypR C33A C99A C142A
5000
Secondary structure content (%) of HypR proteins
0 -5000 -10000
α-helices
WT 36
C33A 35
C99A 34
C142A 37
β-strands
11
12
13
11
β-turns
18
19
19
19
Unordered
35
34
34
34
-15000 190
200
210
220
230
240
250
Wavelengh (nm)
Figure S9. CD spectra of reduced HypR and HypR Cys-Ala mutant proteins (A) and calculation of secondary structure elements (B). (A) CD-spectra of DTT-reduced HypR and HypR Cys33A, Cys99A and Cys142A mutant proteins were measured using a Jasco J-810 spectropolarimeter at 10 µM in 20 mM potassium phosphate buffer, pH 7.5 with 1 mM DTT. [θ]molar is the molar ellipticity per residue. (B) The CD spectra were normalized and deconvoluted using the CDSSTR algorithm associated with the DichroWeb software (http://dichroweb.cryst.bbk.ac.uk). Secondary structure elements were calculated indicating similar contents of a-helices (34-37%), b-sheets (11-13 %) and ß-turns (18-19%) in all four HypR proteins.
Figure S10
Figure S10. Multiple protein sequence alignments of S. aureus MerA with others NADPH-flavin disulfide reductases. The flavin disulfide reductase MerA of S. aureus COL was aligned with RclA of Escherichia coli (49.89%), A0A0D1BJB9_STRSZ from Streptococcus equi (47.37%), B9DIN9_STACT from Staphylococcus carnosus (61.50%), A0A111AIW0_STREE (Pdh_1) from Streptococcus pneumoniae (66.59%), Q5HRF1_STAEQ from Staphylococcus epidermidis (66.36 %), A0A1N4X6F7_9MYCO (MerA) from Mycobacterium abscessus (72.05%) and A0A0U1FHA4_SALTM from Salmonella enterica (49.89%). The multiple sequence alignment was performed using ClustalW2 and presented using Jalview. Intensity of the blue color gradient is based on 50% identity. The conserved Cys residues are marked with asterisk (*) and highlighted in red.
Loi 5ml His superloop position 2002:10_UV1_280nm Loi 5ml His superloop position 2002:10_Flow Loi 5ml His superloop position 2002:10_Inject
Loi 5ml His superloop position 2002:10_Conc Loi 5ml His superloop position 2002:10_Fractions Loi 5ml His superloop position 2002:10_Logbook
HypR purified protein conc.: 2.8 mg/ml (158.7 µM)
mAU 5000
HypR pool (Fractions B3-10) B3 B6 B10 B14
B2
4000
KDa 70 55 40
3000
B6
35 25
B3
2000
UV1 280nm
B2
B14
1000
0
15
B10
F2 A2 A4 A6 A8 A10 A12 A14 B1 B3 B5 A2 A4 A6 A8 A10 A12 A14 B1 B3 B5 B7 B9 B11 B13 B15 C2 C4 C6 C8 C10C12C14 D1 D3 D5 0
20
40
60
80
100
120
Waste 140
ml
Figure S11: HypR protein purification profile using the Äkta-Explorer. Ni-agarose chromatography was performed as described in Methods. Fractions B3-B10 with purified HypR proteins were eluted using an increasing imidazole gradient of 0-500 mM in elution buffer (20 mM NaH2PO4, 500 mM NaCl, 500 mM imidazole, pH 7.4). Purity of the eluted fractions was analyzed by 12% reducing SDS-PAGE analysis (inset), fractions B3-B10 were pooled and concentrated by dialysis in 10 mM Tris-HCl (pH 8.0), 100 mM NaCl and 30% glycerol. The final HypR protein concentration after dialysis was 2.8 mg/ml (158.7 µM) with an 3-fold enrichment after dialysis. The blue curve is the UV spectrum at 280 nm with eluted protein fraction in red, the imadazole gradient is in green.
Table S1: DESeq2 differential gene expression analysis of Staphylococcus aureus USA300 wild type after 30 min of NaOCl treatment Locus USA300HOU_0238 USA300HOU 1094 USA300HOU 2402 USA300HOU_2404 USA300HOU 2405 USA300HOU_1099 USA300HOU_2011 USA300HOU 2013 USA300HOU_1942 USA300HOU_0228 USA300HOU 0392 USA300HOU_0431 USA300HOU_0437 USA300HOU 0867 USA300HOU_1090 USA300HOU_1095 USA300HOU 2401 USA300HOU 0728 USA300HOU_0729 USA300HOU 0730 USA300HOU_0731 USA300HOU_0587 USA300HOU 0588 USA300HOU_2567 USA300HOU_2568 USA300HOU 2511 USA300HOU_2512 USA300HOU_2028 USA300HOU 0358 USA300HOU_0359 USA300HOU_0360 USA300HOU_0248 USA300HOU 0249 USA300HOU_0090 USA300HOU_0091 USA300HOU 0092 USA300HOU 0093 USA300HOU_0403 USA300HOU 0404 USA300HOU_1857 USA300HOU_1858 USA300HOU 1700 USA300HOU 2128 USA300HOU_1823 USA300HOU 1824 USA300HOU_1825 USA300HOU_1277 USA300HOU 1856 USA300HOU_0870 USA300HOU_0871 USA300HOU 0873 USA300HOU_0874 USA300HOU_0875 USA300HOU 0792 USA300HOU_1349 USA300HOU_1350 USA300HOU 1283 USA300HOU 0364 USA300HOU_0365 USA300HOU 0366 USA300HOU_2544 USA300HOU_2545 USA300HOU 0668 USA300HOU_0669 USA300HOU_0670 USA300HOU_2266 USA300HOU_1891 USA300HOU 1064 USA300HOU_1065 USA300HOU_1066 USA300HOU 1067 USA300HOU 1068 USA300HOU_1069 USA300HOU 1720 USA300HOU 2173 USA300HOU_0837 USA300HOU 0127 USA300HOU_0128 USA300HOU_0129 USA300HOU 0130 USA300HOU_0131 USA300HOU_0132 USA300HOU 0133 USA300HOU_0134 USA300HOU_0135 USA300HOU 0124 USA300HOU_0125 USA300HOU_0126 USA300HOU 0759 USA300HOU 0760 USA300HOU_0761 USA300HOU 0762 USA300HOU_0367 USA300HOU_0368 USA300HOU 2167 USA300HOU_2168 USA300HOU_2169 USA300HOU 1553 USA300HOU_2228 USA300HOU_0905 USA300HOU 2396 USA300HOU_2576 USA300HOU_2577 USA300HOU 2578 USA300HOU 0452 USA300HOU_2386 USA300HOU 1556 USA300HOU_1557 USA300HOU_1558 USA300HOU 2134 USA300HOU 2135 USA300HOU_0933 USA300HOU 0797 USA300HOU_0515 USA300HOU_0516 USA300HOU 0517 USA300HOU_0518 USA300HOU_2026 USA300HOU 2024 USA300HOU 2025 USA300HOU_1580 USA300HOU 1581 USA300HOU_1582 USA300HOU_1583 USA300HOU 2617 USA300HOU 2618 USA300HOU_0507 USA300HOU 2123 USA300HOU_0464 USA300HOU_0184 USA300HOU 0212 USA300HOU_0406 USA300HOU_2042 USA300HOU 2267 USA300HOU 2393 USA300HOU_2394 USA300HOU 2395 USA300HOU_1393 USA300HOU_1394 USA300HOU 1395 USA300HOU 1396
Gene symbol coa efb hlgA hlgC hlgB hla lukF lukS map USA300HOU_0228 selX ssl9 SCIN ear ecb scc sbi saeS saeR saeQ saeP merA hypR USA300HOU_2567 USA300HOU_2568 catE2 frp yodC catE USA300HOU_0359 azoR1 USA300HOU_0248 hmp tauE cstR cstA cstB ahpF ahpC USA300HOU_1857 bcp tpx dps hemY hemH hemE katA perR sufC sufD sufS sufU sufB trxB arlS arlR citB efeO efeB efeU feoB feoA fhuA fhuB fhuG fhuD2 ftn isdA isdC isdD isdE isdF isdG isdH iucB fbiB sbnA sbnB sbnC sbnD sbnE sbnF sbnG sbnH sbnl sirC sirB sirA sstA sstB sstC sstD tatC tatA htsC htsB htsA rpmG 2 rpsN_2 mnmC lmrB2 cobW 3 feoB_3 USA300HOU 2578 yciC zinT zur znuB znuC czrA czrB clpB clpP ctsR mcsA mcsB clpC USA300HOU_2026 groEL groES dnaJ dnaK grpE hrcA cysG cysJ cysK luxS USA300HOU_0464 srpF oppF 2 tcyP yedE caiA tcyC tcyB tcyA dinG birA papS bshA
Regulon SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS HypR HypR TetR TetR QsrR QsrR QsrR QsrR QsrR QsrR NsrR NsrR CstR CstR CstR CstR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Zur Zur Zur Zur Zur Zur Zur Zur Zur Zur Zur Zur CzrA CzrA CtsR CtsR CtsR CtsR CtsR CtsR CtsR HrcA HrcA HrcA HrcA HrcA HrcA CymR CymR CymR CymR CymR CymR CymR CymR CymR CymR CymR CymR CymR BSH BSH BSH BSH
Function staphylocoagulase fibrinogen-binding protein gamma-hemolysin component A gamma hemolysin component C gamma hemolysin component B alpha-hemolysin possible leukocidin subunit possible leukocidin subunit cell surface protein MapW2 hypothetical protein possible staphylococcal enterotoxin staphylococcal exotoxin Staphylococcal complement inhibitor SCIN Ear protein fibrinogen binding-like protein fibrinogen-binding protein precursor-like protein immunoglobulin G-binding protein SBI sensor histidine kinase SaeS response regulator SaeR hypothetical membrane protein hypothetical lipoprotein pyridine nucleotide-disulfide reductase Rrf2-family repressor of the hypR-merA operon hypothetical protein hypothetical protein possible dioxygenase FMN reductase possible nitroreductase possible lactoylglutathione lyase possible alkanal monooxygenase (FMN-linked) possible FMN reductase hypothetical protein flavohemoprotein hypothetical membrane protein repressor of hydrogen sulfide detoxification cstAB-sqr operon rhodanese domain-containing protein hydroxyacylglutathione hydrolase peroxiredoxin subunit F peroxiredoxin subunit C D-3-phosphoglycerate dehydrogenase possible peroxiredoxin possible peroxiredoxin Dps family stress protein protoporphyrinogen oxidase ferrochelatase uroporphyrinogen decarboxylase catalase peroxide regulon repressor PerR FeS assembly ATPase SufC FeS assembly protein SufD SufS subfamily cysteine desulfurase NifU family SUF system FeS assembly protein FeS assembly protein SufB thioredoxin-disulfide reductase sensor histidine kinase response regulator aconitate hydratase iron (Fe2+)-binding lipoprotein iron (Fe2+)-dependent Dyp family peroxidase OFeT family oxidase-dependent iron (Fe2+) transporter FeoB family ferrous iron (Fe2+) uptake protein hypothetical protein iron (Fe3+) ABC transporter, ATP-binding protein iron (Fe3+) ABC transporter, membrane protein iron (Fe3+) ABC transporter, membrane protein iron (Fe+3) ABC transporter, iron-binding protein ferritin iron (Fe2+)-regulated surface determinant protein IsdA iron (Fe2+)-regulated surface determinant protein IsdC hemoglobin iron ABC transporter, membrane component IsdD hemoglobin iron ABC transporter, lipoprotein IsdE hemoglobin iron ABC transporter, permease IsdF heme-degrading monooxygenase IsdG cell wall surface anchored protein possible Iuc family aerobactin synthesis protein possible nitroreductase possible pyridoxal-phosphate dependent enzyme possible ornithine cyclodeaminase IucA/IucC family siderophore biosynthesis protein MFS family major facilitator transporter IucA/IucC family siderophore biosynthesis protein IucA/IucC family siderophore biosynthesis protein HpcH/HpaI family aldolase diaminopimelate decarboxylase hypothetical protein Siderophore staphylobactin ABC transporter, permease protein SirC Siderophore staphylobactin ABC transporter, permease protein SirB Siderophore staphylobactin ABC transporter, siderophore-binding protein SirA siderophore-Fe(III) ABC transporter permease siderophore-Fe(III) ABC transporter permease siderophore-Fe(III) ABC transporter, ATP-binding protein siderophore-Fe(III) ABC transporter,lipoprotein Tat family twin arginine targeting transporter TatC Tat family twin arginine targeting transporter TatA heme ABC transporter, permease HtsC heme ABC transporter, permease HtsB heme ABC transporter, heme-binding protein HtsA ribosomal protein L33 ribosomal protein S14 hypothetical protein MFS family major facilitator transporter, multidrug :cation symporter cobalamin (vitamin B12) biosynthesis protein FeoB family ferrous iron (Fe2+) uptake protein hypothetical protein cobalamin (vitamin B12) biosynthesis protein ABC transporter, binding protein Zn-uptake transcriptional regulator zinc ABC transporter, permease zinc ABC transporter, ATP-binding protein transcriptional regulator CzrA CDF family cation diffusion facilitator CzrB S14 family endopeptidase ClpB S14 family endopeptidase ClpP CtsR family transcriptional regulator hypothetical protein ATP:guanido phosphotransferase AAA family ATP-binding protein hypothetical membrane protein chaperone GroEL chaperone GroES chaperone DnaJ chaperone DnaK chaperone GrpE heat shock transcriptional repressor HrcA possible sirohydrochlorin ferrochelatase sulfite reductase (NADPH) alpha subunit cysteine synthase S-ribosylhomocysteine lyase ABC transporter, binding protein hypothetical protein oligopeptide ABC transporter, ATP-binding protein DAACS family dicarboxylate/amino acid:sodium (Na+) or proton (H+) symporter hypothetical membrane protein acyl-CoA dehydrogenase ABC transporter, ATP-binding protein ABC transporter, membrane protein amino acid ABC transporter, binding protein DNA-directed DNA polymerase III epsilon subunit biotin--[acetyl-CoA-carboxylase] ligase/biotin operon transcriptional regulator polynucleotide adenylyltransferase glycosyltransferase
USA300HOU_0561 USA300HOU_1117 USA300HOU 1365 USA300HOU 1366 USA300HOU_1367 USA300HOU 1368 USA300HOU_1515 USA300HOU_1516 USA300HOU 0768 USA300HOU_1417 USA300HOU_0801 USA300HOU 0802 USA300HOU 0803 USA300HOU_0804 USA300HOU 0805 USA300HOU_0806 USA300HOU_1036 USA300HOU 1037 USA300HOU_1038 USA300HOU_1039 USA300HOU 0538 USA300HOU_0539 USA300HOU_0540 USA300HOU 0541 USA300HOU_2201 USA300HOU_2202
bshB bshC brx USA300HOU 1366 USA300HOU_1367 USA300HOU 1368 USA300HOU_1515 brxB brxC ypdA gapR gap pgk tpiA pgm eno pdhA pdhB pdhC pdhD rplL3 rpsL rpsG tuf budA1 alsS
BSH BSH BSH BSH BSH BSH BSH BSH BSH BSH CggR CggR CggR CggR CggR CggR PDH PDH PDH PDH Translation Translation Translation Translation CidR CidR
bacillithiol biosynthesis deacetylase BshB2 bacillithiol biosynthesis cysteine-adding enzyme BshC bacillredoxin BrxA hypothetical protein hypothetical protein hypothetical protein hypothetical protein bacillredoxin BrxB bacillredoxin YtxJ putative bacillithiol system oxidoreductase, YpdA family DeoR family transcriptional regulator glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) phosphoglycerate kinase triose-phosphate isomerase bisphosphoglycerate mutase phosphopyruvate hydratase pyruvate dehydrogenase (acetyl-transferring) alpha subunit pyruvate dehydrogenase (acetyl-transferring) beta subunit dihydrolipoyllysine-residue acetyltransferase dihydrolipoyl dehydrogenase possible RNA-binding ribosomal protein ribosomal protein S12 ribosomal protein S7 elongation factor EF1A acetolactate decarboxylase acetolactate synthase
Base mean A-value M-value Fold change Standard error Wald statistic P-value Adjusted P-value 1721,18 10,75 5,08 33,93 0,13 38,69 0 0 90,54 6,50 2,43 5,37 0,23 10,53 6,10473E-26 7,08309E-25 2343,80 11,19 6,87 117,01 0,15 46,25 0 0 1447,18 10,50 6,18 72,35 0,15 41,45 0 0 1912,17 10,90 5,62 49,30 0,14 41,16 0 0 217,83 7,77 1,27 2,41 0,18 7,20 5,86529E-13 3,47084E-12 1315,36 10,36 4,75 26,99 0,12 38,44 0 0 930,97 9,86 4,77 27,21 0,13 35,52 2,8575E-276 3,6155E-274 22759,86 14,47 6,50 90,34 0,11 59,38 0 0 89,73 6,49 1,92 3,79 0,25 7,63 2,41263E-14 1,59066E-13 11,72 4,69 25,84 0,13 37,53 0 0 3384,77 185,75 7,54 1,60 3,04 0,17 9,69 3,46021E-22 3,39253E-21 31510,58 14,94 7,37 165,73 0,12 60,32 0 0 910,61 9,83 5,72 52,61 0,16 35,02 9,5094E-269 1,0985E-266 14629,94 13,84 7,30 157,70 0,14 53,59 0 0 10,45 7,06 133,18 0,22 32,46 3,3778E-231 3,2052E-229 1402,05 44769,24 15,45 7,36 164,71 0,08 87,50 0 0 17409,91 14,09 4,79 27,74 0,08 56,70 0 0 16691,29 14,03 5,03 32,56 0,08 59,66 0 0 13493,23 13,72 5,89 59,13 0,09 65,04 0 0 14,69 7,61 195,25 0,10 73,70 0 0 26388,03 26351,22 14,69 7,47 176,88 0,10 77,48 0 0 12604,87 13,62 7,50 180,65 0,11 71,32 0 0 678,39 9,41 0,56 1,47 0,12 4,50 6,70589E-06 2,07664E-05 691,52 9,43 0,66 1,58 0,11 5,81 6,26543E-09 2,68504E-08 12,57 3,25 9,54 0,10 31,68 3,1075E-220 2,7522E-218 6089,18 1466,50 10,52 2,31 4,96 0,10 22,83 2,4204E-115 1,4616E-113 5935,90 12,54 2,79 6,92 0,09 29,49 3,8517E-191 3,1981E-189 944,67 9,88 2,08 4,23 0,11 19,29 5,96262E-83 2,59716E-81 1135,99 10,15 2,24 4,74 0,10 21,97 5,0163E-107 2,8974E-105 568,38 9,15 2,28 4,86 0,12 19,19 4,1226E-82 1,73869E-80 82,22 6,36 2,33 5,03 0,24 9,53 1,51523E-21 1,43785E-20 508,15 8,99 2,37 5,18 0,12 19,07 4,83465E-81 2,00713E-79 1813,88 10,82 2,17 4,49 0,11 19,89 4,69283E-88 2,22658E-86 10,07 2,08 4,24 0,12 17,12 9,66714E-66 3,42474E-64 1077,73 429,48 8,75 1,85 3,61 0,15 12,20 3,09253E-34 4,92027E-33 739,88 9,53 1,31 2,48 0,11 11,91 1,10854E-32 1,67352E-31 7542,51 12,88 2,53 5,77 0,12 21,96 6,7492E-107 3,8154E-105 8361,86 13,03 2,02 4,05 0,10 19,69 2,89553E-86 1,28224E-84 9,68 0,40 1,32 0,10 4,04 5,45056E-05 0,000150074 822,10 510,69 9,00 0,25 1,19 0,13 1,95 0,051474029 0,084790139 2086,07 11,03 1,76 3,38 0,13 13,93 4,25008E-44 9,41039E-43 7492,33 12,87 1,35 2,55 0,11 12,82 1,34782E-37 2,40346E-36 592,54 9,21 0,41 1,33 0,12 3,57 0,000363464 0,000898348 8,68 0,55 1,46 0,12 4,43 9,28325E-06 2,83187E-05 409,72 464,72 8,86 0,43 1,35 0,13 3,29 0,00099631 0,002289963 12324,88 13,59 1,58 2,98 0,10 16,55 1,66388E-61 5,39138E-60 10334,08 13,34 0,12 1,08 0,13 0,91 0,361704152 0,447623629 5820,30 12,51 0,28 1,22 0,08 3,52 0,000435519 0,00106652 12,66 0,39 1,31 0,09 4,10 4,21562E-05 0,000118308 6461,65 3080,76 11,59 0,70 1,63 0,11 6,23 4,65888E-10 2,21443E-09 1142,24 10,16 1,06 2,08 0,13 8,34 7,49843E-17 5,79167E-16 2312,11 11,17 1,32 2,49 0,11 11,65 2,40157E-31 3,30621E-30 2327,07 11,18 2,19 4,57 0,10 21,60 1,9721E-103 1,0916E-101 11,00 0,69 1,61 0,10 6,89 5,3875E-12 3,00096E-11 2049,02 1530,01 10,58 0,65 1,57 0,10 6,75 1,46994E-11 7,84265E-11 2211,79 11,11 0,37 1,29 0,12 3,23 0,001218566 0,002753171 974,29 9,93 -0,73 0,60 0,10 -7,26 3,73083E-13 2,26838E-12 899,61 9,81 -1,06 0,48 0,11 -9,53 1,58112E-21 1,49503E-20 9,35 -1,23 0,43 0,12 -9,99 1,72948E-23 1,7674E-22 652,50 65,72 6,04 -0,77 0,59 0,34 -2,26 0,023687065 0,042126193 8,13 3,02 -0,82 0,57 0,56 -1,45 0,145676475 0,208771518 580,30 9,18 0,71 1,64 0,11 6,23 4,74801E-10 2,25276E-09 362,11 8,50 0,79 1,73 0,12 6,43 1,24842E-10 6,177E-10 291,89 8,19 0,59 1,50 0,14 4,22 2,46495E-05 7,1656E-05 1394,43 10,45 0,53 1,44 0,09 5,64 1,65664E-08 6,8669E-08 3,38 0,33 1,26 0,10 0,000718254 0,001694849 19821,19 14,27 530,30 9,05 -0,05 0,96 0,13 -0,41 0,684528157 0,749090327 0,233103372 44,06 5,46 0,39 1,31 0,28 1,39 0,165198965 72,29 6,18 -0,25 0,84 0,24 -1,04 0,298246807 0,38083303 62,97 5,98 0,14 1,10 0,24 0,58 0,56230628 0,642877705 6,07 -0,29 0,82 0,26 -1,13 0,257067819 0,338133264 67,35 26,33 4,72 -1,31 0,40 0,37 -3,50 0,00046839 0,00113862 10,01 -0,67 0,63 0,11 -5,94 2,80554E-09 1,25494E-08 1032,05 339,03 8,41 0,15 1,11 0,13 1,16 0,2473627 0,327801843 845,17 9,72 0,70 1,63 0,12 6,03 1,61169E-09 7,29514E-09 4,77396E-07 68,20 6,09 1,29 2,44 0,24 5,28 1,2721E-07 85,37 6,42 0,88 1,83 0,23 3,88 0,000103051 0,000276851 6,59 0,73 1,66 0,24 3,08 0,002105006 0,004576923 96,35 39,41 5,30 -0,30 0,81 0,41 -0,73 0,464181186 0,550688005 46,90 5,55 0,11 1,08 0,32 0,34 0,736687788 0,796330127 0,958262349 55,29 5,79 0,02 1,01 0,26 0,07 0,940384222 30,34 4,92 -0,17 0,89 0,37 -0,46 0,648245435 0,717362816 5,30 -0,14 0,91 0,32 -0,43 0,670272995 0,736219656 39,53 44,72 5,48 -0,11 0,92 0,29 -0,39 0,698664004 0,761423404 1168,69 10,19 0,46 1,38 0,13 3,66 0,000251116 0,000639095 0,077949517 55,42 5,79 -0,53 0,69 0,27 -1,99 0,04691053 67,13 6,07 -0,15 0,90 0,24 -0,64 0,523895841 0,608935222 6,73 -0,38 0,77 0,20 -1,87 0,060861364 0,097886589 106,01 75,25 6,23 0,22 1,16 0,23 0,97 0,33040079 0,414678744 53,71 5,75 0,16 1,12 0,28 0,57 0,568309682 0,647706311 100,16 6,65 0,32 1,25 0,21 1,48 0,138623614 0,199551916 878,52 9,78 1,01 2,02 0,12 8,74 2,38615E-18 1,98125E-17 9,70 1,03 2,05 0,10 9,84 7,43269E-23 7,48055E-22 832,90 152,41 7,25 1,11 2,16 0,17 6,45 1,14635E-10 5,68255E-10 2,12483E-17 243,21 7,93 1,32 2,50 0,15 8,73 2,57507E-18 513,25 9,00 1,68 3,21 0,13 12,97 1,86744E-38 3,46979E-37 421,70 8,72 -0,42 0,75 0,13 -3,34 0,000834606 0,001943512 7,35 0,64 1,56 0,18 3,52 0,000423794 0,001040684 162,59 96,63 6,59 2,71 6,55 0,27 10,11 5,07085E-24 5,39245E-23 0,008687454 1665,13 10,70 0,31 1,24 0,11 2,86 0,004246967 62,53 5,97 -0,31 0,80 0,25 -1,28 0,20188659 0,276216616 83,65 6,39 -0,11 0,93 0,23 -0,47 0,636895359 0,708046431 6,50 0,43 1,34 0,25 1,74 0,082016546 0,126530954 90,57 123,27 6,95 -0,81 0,57 0,20 -3,97 7,24002E-05 0,000196896 6,94129E-51 2320,73 11,18 1,40 2,64 0,09 15,22 2,42958E-52 144,24 7,17 0,13 1,09 0,18 0,71 0,4754348 0,562185253 172,83 7,43 0,51 1,42 0,16 3,13 0,00175175 0,003859371 6,64 1,07 2,09 0,23 4,69 2,73383E-06 8,87993E-06 99,58 3117,76 11,61 0,20 1,15 0,12 1,66 0,097566761 0,14788071 9,44595E-08 8911,55 13,12 0,57 1,49 0,10 5,59 2,30727E-08 2041,24 11,00 -0,22 0,86 0,09 -2,50 0,012387895 0,023360281 1659,59 10,70 0,84 1,79 0,13 6,64 3,10637E-11 1,6324E-10 0,016030257 958,26 9,90 0,27 1,21 0,10 2,64 0,008241374 1075,55 10,07 0,24 1,18 0,10 2,56 0,010566989 0,020242602 0,000166539 1261,00 10,30 0,40 1,32 0,10 4,01 6,07989E-05 1772,24 10,79 0,46 1,37 0,10 4,64 3,4528E-06 1,10398E-05 751,63 9,55 -1,00 0,50 0,14 -7,03 2,06907E-12 1,1772E-11 11,88 0,52 1,43 0,11 4,55 5,47202E-06 1,70848E-05 3760,11 2243,50 11,13 0,11 1,08 0,09 1,17 0,241753158 0,32229711 2,32931E-07 292,69 8,19 0,78 1,72 0,14 5,42 5,95259E-08 4920,95 12,26 1,50 2,83 0,10 14,34 1,17406E-46 2,91541E-45 2364,35 11,21 1,34 2,53 0,09 15,08 2,26874E-51 6,41282E-50 11,37 1,29 2,44 0,10 12,73 3,82442E-37 6,73224E-36 2653,62 480,88 8,91 -0,83 0,56 0,13 -6,50 8,10176E-11 4,0847E-10 1342,68 10,39 -0,61 0,65 0,10 -6,46 1,01338E-10 5,06118E-10 0,94 1,92 0,10 9,56 1,13944E-21 1,09296E-20 3451,46 11,75 707,58 9,47 -0,31 0,81 0,14 -2,17 0,029841055 0,052197289 1336,03 10,38 -0,11 0,93 0,09 -1,16 0,246599434 0,326953442 196,54 7,62 0,65 1,57 0,16 4,10 4,18275E-05 0,000117604 191,58 7,58 -0,19 0,88 0,16 -1,17 0,242899494 0,323338656 9,03 -1,15 0,45 0,13 -8,80 1,37273E-18 1,15423E-17 522,27 111,21 6,80 -0,73 0,60 0,20 -3,72 0,000197949 0,000510633 144,11 7,17 0,45 1,37 0,18 2,52 0,011655022 0,022119567 4111,35 12,01 0,76 1,69 0,13 5,98 2,20791E-09 9,89277E-09 4641,22 12,18 0,73 1,66 0,10 7,60 2,91546E-14 1,88936E-13 5,74 9,64553E-09 4,08092E-08 4610,58 12,17 0,67 1,59 0,12 -2,32 0,020111473 0,036265834 275,48 8,11 -0,35 0,79 0,15 178,25 7,48 0,17 1,13 0,16 1,05 0,294498496 0,377281824 208,71 7,71 0,27 1,21 0,18 1,48 0,138642392 0,199551916 212,22 7,73 0,59 1,50 0,17 3,52 0,000436249 0,001067323 1435,28 591,89 376,09 847,43 383,55 326,90 493,88 338,93 1478,65 717,14 22537,04 30414,24 7170,17 4349,28 5165,25 4680,39 3178,58 2452,07 2761,56 2424,12 175,02 347,26 383,11 4236,66 228,67 483,07
10,49 9,21 8,55 9,73 8,58 8,35 8,95 8,40 10,53 9,49 14,46 14,89 12,81 12,09 12,33 12,19 11,63 11,26 11,43 11,24 7,45 8,44 8,58 12,05 7,84 8,92
0,83 1,29 0,38 0,18 -0,07 -0,19 1,11 0,96 0,39 0,26 0,88 1,25 1,17 0,76 0,97 1,19 1,77 1,94 1,88 1,88 1,75 1,67 1,59 0,93 0,26 0,33
1,78 2,44 1,31 1,13 0,95 0,88 2,16 1,94 1,31 1,20 1,84 2,38 2,25 1,69 1,96 2,28 3,41 3,84 3,69 3,67 3,36 3,17 3,01 1,91 1,20 1,26
0,11 0,12 0,14 0,11 0,13 0,15 0,13 0,17 0,10 0,12 0,09 0,12 0,12 0,12 0,11 0,12 0,12 0,11 0,09 0,13 0,18 0,14 0,15 0,15 0,15 0,12
7,72 10,98 2,74 1,72 -0,58 -1,31 8,80 5,73 3,78 2,19 10,04 10,51 9,56 6,27 8,58 9,71 15,24 17,06 20,06 14,97 9,86 12,31 10,74 6,39 1,77 2,86
1,14777E-14 4,54984E-28 0,006054236 0,084592756 0,559107152 0,191279776 1,31657E-18 1,02292E-08 0,000156404 0,02836554 1,03438E-23 7,75996E-26 1,21436E-21 3,64772E-10 9,69989E-18 2,79193E-22 1,77876E-52 2,86973E-65 1,76523E-89 1,146E-50 6,33266E-23 8,14185E-35 6,93744E-27 1,63407E-10 0,076690272 0,004205623
7,79952E-14 5,70233E-27 0,012076656 0,129770759 0,640056794 0,264015774 1,11406E-17 4,31414E-08 0,000410637 0,049780211 1,07778E-22 8,96444E-25 1,16063E-20 1,7463E-09 7,71635E-17 2,74747E-21 5,19359E-51 1,00327E-63 8,84944E-88 3,17179E-49 6,39768E-22 1,31109E-33 8,34063E-26 8,01055E-10 0,119300968 0,008635503
Locus USA300HOU 0273 USA300HOU 0274 USA300HOU_2531 USA300HOU 2532 USA300HOU_2533 USA300HOU_2048 USA300HOU 2049 USA300HOU 2050 USA300HOU_2051 USA300HOU_2052 USA300HOU 2053 USA300HOU 2054 USA300HOU_2055 USA300HOU 2056 USA300HOU_1328 USA300HOU_1329 USA300HOU 1330 USA300HOU_1331 USA300HOU_1332 USA300HOU 1757 USA300HOU 1758 USA300HOU_1759 USA300HOU_1760 USA300HOU 0376 USA300HOU 0832 USA300HOU_0847 USA300HOU 0848
Gene symbol lrgA lrgB cidC cidB cidA ilvD ilvB ilvN ilvC leuA leuB leuC leuD ilvA2 lysC asd dapA dapB dapD ribH ribA ribB ribD USA300HOU 0376 lysE metN2 metI2
Regulon CidR CidR CidR CidR CidR CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY
Function murein hydrolase regulator LrgA murein hydrolase regulator LrgB pyruvate oxidase hypothetical membrane protein hypothetical membrane protein dihydroxy-acid dehydratase acetolactate synthase large subunit acetolactate synthase small subunit ketol-acid reductoisomerase 2-isopropylmalate synthase 3-isopropylmalate dehydrogenase 3-isopropylmalate dehydratase large subunit 3-isopropylmalate dehydratase small subunit threonine ammonia-lyase aspartate kinase aspartate-semialdehyde dehydrogenase dihydrodipicolinate synthase dihydrodipicolinate reductase 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase riboflavin synthase beta subunit bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II riboflavin synthase alpha subunit diaminohydroxyphosphoribosylaminopyrimidine deaminase hypothetical protein LysE family L-lysine exporter ABC transporter, ATP-binding protein ABC transporter, membrane protein
USA300HOU_0849 USA300HOU 1375 USA300HOU_1376 USA300HOU_2491 USA300HOU 2564 USA300HOU_2285 USA300HOU_0941 USA300HOU 0942 USA300HOU_0969 USA300HOU_1164 USA300HOU 1165 USA300HOU_1166 USA300HOU_1167 USA300HOU 0721 USA300HOU 0722 USA300HOU_1239 USA300HOU 1240 USA300HOU_2040 USA300HOU_1698 USA300HOU 1699 USA300HOU_2092 USA300HOU_2093 USA300HOU 2094 USA300HOU_2095 USA300HOU_2096 USA300HOU 2097 USA300HOU 2098 USA300HOU_2099 USA300HOU 2100 USA300HOU 2101 USA300HOU_2102 USA300HOU 2103 USA300HOU_2104 USA300HOU_1675 USA300HOU 1676 USA300HOU_1677 USA300HOU_1028 USA300HOU 1029 USA300HOU_0150 USA300HOU_0151 USA300HOU 2126 USA300HOU_1309 USA300HOU_1310 USA300HOU 1721 USA300HOU_1230 USA300HOU_2492 USA300HOU 2493 USA300HOU_2494 USA300HOU_2495 USA300HOU 1227 USA300HOU_1228 USA300HOU_1229 USA300HOU 0788 USA300HOU 0789 USA300HOU_0790 USA300HOU 0791 USA300HOU 1681 USA300HOU_1682 USA300HOU 1086 USA300HOU_1087 USA300HOU_1088 USA300HOU 2125 USA300HOU_0519 USA300HOU_0520 USA300HOU 0194 USA300HOU_0420 USA300HOU_0421 USA300HOU 0469 USA300HOU 0470 USA300HOU_0505 USA300HOU 0506 USA300HOU_0607 USA300HOU_0927 USA300HOU 0929 USA300HOU_0930 USA300HOU_0931 USA300HOU 0958 USA300HOU_0959 USA300HOU_0960 USA300HOU 1194 USA300HOU_1195 USA300HOU_1216 USA300HOU 1313 USA300HOU 1314 USA300HOU_1315 USA300HOU 1316 USA300HOU_1338 USA300HOU_1339 USA300HOU 1358 USA300HOU 1359 USA300HOU_1383 USA300HOU 1384 USA300HOU_1385 USA300HOU_1419 USA300HOU 1517 USA300HOU_1518 USA300HOU_1519 USA300HOU 1520 USA300HOU_1536 USA300HOU_1537 USA300HOU 1538 USA300HOU_1577 USA300HOU_1578 USA300HOU 1579 USA300HOU 1683 USA300HOU_1827 USA300HOU 1865 USA300HOU_1866 USA300HOU_1867 USA300HOU 1868 USA300HOU_2124 USA300HOU_2193 USA300HOU 2199 USA300HOU 2234 USA300HOU_2243 USA300HOU 2244 USA300HOU_2329 USA300HOU_2330 USA300HOU 2353 USA300HOU 2434 USA300HOU_2435 USA300HOU 2436 USA300HOU_2437 USA300HOU_0745 USA300HOU 0746 USA300HOU_2496 USA300HOU_2500 USA300HOU 2505 USA300HOU_2526 USA300HOU_2527 USA300HOU 2562 USA300HOU_2623 USA300HOU_2624 USA300HOU 2625 USA300HOU 0780 USA300HOU_1176 USA300HOU 1177 USA300HOU_1183 USA300HOU_1184 USA300HOU 1185 USA300HOU_1186 USA300HOU_0018 USA300HOU_0019
metQ ilvA1 ald fnbA isaA ssaA fabH fab fabI fapR plsX fabD fabG deoR fruB glnR glnA nrgA ackA USA300HOU 1699 atpC atpD atpG atpA atpH atpF atpE atpB atpI mnaA upp glyA USA300HOU_2104 coaE fpg polA cydA cydB deoC1 deoB deoC2 femA femB fhs glpF gntP gntK gntR USA300HOU_2495 mutS mutL glpP hprK lgt USA300HOU_0790 USA300HOU 0791 citC citZ murI USA300HOU_1087 USA300HOU_1088 pdp radA USA300HOU_0520 USA300HOU 0194 USA300HOU 0420 USA300HOU_0421 USA300HOU 0469 USA300HOU 0470 ftsH hslO USA300HOU_0607 USA300HOU_0927 cdr USA300HOU_0930 yitW pepF USA300HOU_0959 USA300HOU_0960 USA300HOU 1194 proS cinA opp-2F opp-2D opp-2C opp-2B USA300HOU_1338 USA300HOU_1339 USA300HOU 1358 crr gpsB USA300HOU 1384 USA300HOU_1385 ebpS bfmBB bfmBAB bfmBAA lpdA gcvPB gcvPA gcvT mtaB rsmE prmA aapA traP USA300HOU 1865 USA300HOU_1866 USA300HOU_1867 recX USA300HOU_2124 USA300HOU_2193 USA300HOU 2199 pbuG USA300HOU_2243 femX USA300HOU_2329 USA300HOU_2330 USA300HOU 2353 opuCD opuCC opuCB opuCA opuBA opuBB relP USA300HOU_2500 fbp trxA_6 USA300HOU_2527 USA300HOU 2562 nsaS nsaR USA300HOU 2625 secA sucC sucD xerC hslV hslU codY walR walK
CodY CodY CodY CodY CodY CodY FapR FapR FapR FapR FapR FapR FapR FruR FruR GlnR GlnR GlnR GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS
ABC transporter, binding protein threonine ammonia-lyase alanine dehydrogenase fibronectin-binding protein A immunodominant antigen A secretory antigen SsaA 3-oxoacyl-[acyl-carrier-protein] synthase 3-oxoacyl-[acyl-carrier-protein] synthase enoyl-[acyl-carrier-protein] reductase (NADH) hypothetical protein fatty acid/phospholipid synthesis protein [acyl-carrier-protein] S-malonyltransferase 3-oxoacyl-[acyl-carrier-protein] reductase DeoR family transcriptional regulator 1-phosphofructokinase glutamate--ammonia ligase repressor glutamate--ammonia ligase AMT family ammonium or ammonia transporter acetate kinase hypothetical protein proton- translocating F-type ATPase epsilon subunit proton-translocating F-type ATPase delta subunit proton-translocating F-type ATPase gamma subunit proton-translocating F-type ATPase alpha subunit proton-translocating F-type ATPase beta subunit proton-translocating F-type ATPase subunit B proton-translocating F-type ATPase epsilon subunit C proton-translocating F-type ATPase beta subunit A hypothetical protein UDP-N-acetylglucosamine 2-epimerase uracil phosphoribosyltransferase glycine hydroxymethyltransferase hypothetical protein dephospho-CoA kinase DNA-formamidopyrimidine glycosylase DNA-directed DNA polymerase I cytochrome d ubiquinol oxidase subunit I cytochrome d ubiquinol oxidase subunit II deoxyribose-phosphate aldolase phosphopentomutase deoxyribose-phosphate aldolase methicillin resistance factor FemA methicillin resistance factor FemB formate--tetrahydrofolate ligase MIP family major intrinsic protein channel protein GntP family gluconate:proton (H+) symporter gluconokinase gluconate operon transcriptional repressor MerR family transcriptional regulator DNA mismatch repair protein MutS DNA mismatch repair protein MutL glycerol uptake operon antiterminator HPr kinase prolipoprotein diacylglyceryl transferase possible acetyltransferase hypothetical TPR domain protein isocitrate dehydrogenase (NADP(+)) citrate (Si)-synthase glutamate racemase possible HAM1 family protein hypothetical protein pyrimidine nucleoside phosphorylase DNA repair protein RadA hypothetical protein hypothetical membrane protein hypothetical membrane protein hypothetical protein hypothetical protein hypothetical membrane protein cell division protein FtsH heat shock protein Hsp33 hypothetical protein fumarylacetoacetase coenzyme A disulfide reductase possible HAD superfamily hydrolase hypothetical protein M03 family oligopeptidase F possible dithiol-disulfide isomerase globin M50 family peptidase proline--tRNA ligase competence-damage inducible protein CinA oligopeptide ABC transporter, ATP-binding protein oligopeptide ABC transporter, ATP-binding protein oligopeptide ABC transporter, membrane protein oligopeptide ABC transporter, membrane protein hypothetical protein tellurite resistance protein hypothetical protein PTS family glucose/glucoside (glc) porter component IIA hypothetical protein hypothetical protein hypothetical protein elastin-binding protein dihydrolipoyllysine-residue acetyltransferase 2-oxoisovalerate dehydrogenase (acylating) beta subunit pyruvate dehydrogenase (acetyl-transferring) alpha subunit dihydrolipoyl dehydrogenase glycine dehydrogenase (decarboxylating) subunit 2 glycine dehydrogenase (decarboxylating) subunit 1 aminomethyltransferase possible 2-methylthioadenine synthase hypothetical protein ribosomal protein L11 methyltransferase APC family amino acid-polyamine-organocation transporter RNAIII-activating protein TRAP teichoic acid ABC transporter, membrane protein teichoic acid ABC transporter, ATP-binding protein hypothetical protein hypothetical protein hypothetical membrane protein possible aldo/keto reductase possible HAD superfamily hydrolase NCS2 family nucleobase:cation symporter-2 RND resistance-nodulation-cell division acriflavin:proton (H+) antiporter peptidoglycan pentaglycine interpeptide biosynthesis protein FmhB hypothetical protein hypothetical protein possible zinc (Zn2+) dependent dehydrogenase glycine betaine/L-proline ABC transporter, membrane protein glycine betaine/L-proline ABC transporter, binding protein glycine betaine/choline ABC transporter, membrane protein glycine betaine/choline ABC transporter, ATP-binding protein glycine/betaine/carnitine/choline ABC transporter, ATP-binding protein glycine betaine/carnitine/choline ABC transporter, membrane protein hypothetical protein alkaline phosphatase fructose-bisphosphatase possible thioredoxin possible thioesterase possible acetyltransferase sensor histidine kinase response regulator hypothetical protein Sec Type I general secretory pathway preprotein translocase subunit SecA succinate--CoA ligase (ADP-forming) beta subunit succinate--CoA ligase (ADP-forming) alpha subunit tyrosine recombinase XerC T01 family HslV component of HsIUV peptidase T01 family HslU component of HsIUV peptidase CodY family transcriptional regulator response regulator VicR sensor histidine kinase VicK
Base mean A-value M-value Fold change Standard error Wald statistic P-value Adjusted P-value 105,92 6,73 1,69 3,23 0,24 7,05 1,83267E-12 1,04718E-11 295,51 8,21 1,17 2,25 0,16 7,29 3,00294E-13 1,84694E-12 2641,56 11,37 2,57 5,94 0,10 26,37 3,335E-153 2,3949E-151 840,18 9,71 2,47 5,55 0,11 23,00 4,9537E-117 3,0609E-115 252,69 7,98 2,67 6,37 0,20 13,64 2,22669E-42 4,55101E-41 2424,86 11,24 0,55 1,46 0,10 5,30 1,17905E-07 4,46258E-07 2324,54 11,18 0,71 1,63 0,10 7,36 1,88279E-13 1,18264E-12 470,56 8,88 0,86 1,81 0,12 7,15 8,45137E-13 4,91363E-12 873,77 9,77 1,16 2,24 0,11 10,20 1,99954E-24 2,18633E-23 9,64 1,88 3,69 0,11 16,78 3,23365E-63 1,08757E-61 795,28 363,29 8,50 2,69 6,45 0,16 16,61 6,16745E-62 2,04837E-60 328,18 8,36 3,22 9,31 0,17 18,70 4,86831E-78 1,95986E-76 138,24 7,11 3,27 9,64 0,23 14,27 3,48276E-46 8,48964E-45 197,29 7,62 3,23 9,40 0,18 17,66 7,91834E-70 3,04913E-68 14,57 0,59 1,50 0,08 7,44 9,81044E-14 6,23597E-13 24311,30 18949,03 14,21 0,55 1,47 0,08 6,70 2,04833E-11 1,09067E-10 15761,10 13,94 0,58 1,49 0,09 6,45 1,09391E-10 5,43276E-10 10428,60 13,35 0,53 1,44 0,09 5,88 4,03079E-09 1,75038E-08 7370,60 12,85 0,46 1,37 0,09 5,36 8,42831E-08 3,24551E-07 327,81 8,36 1,45 2,73 0,14 10,18 2,32193E-24 2,52843E-23 784,14 9,61 1,22 2,33 0,10 11,73 8,87562E-32 1,25439E-30 517,19 9,01 1,29 2,44 0,13 10,00 1,47048E-23 1,51437E-22 868,68 9,76 1,26 2,40 0,10 12,19 3,62198E-34 5,72833E-33 322,43 8,33 0,71 1,64 0,15 4,74 2,13018E-06 7,00481E-06 2096,02 11,03 -0,24 0,85 0,14 -1,77 0,077079381 0,119836113 9131,39 13,16 1,14 2,20 0,08 14,00 1,48536E-44 3,46194E-43 7338,00 12,84 1,29 2,44 0,10 13,46 2,5203E-41 5,03491E-40 7956,68 84,95 68,09 13657,47 7531,34 4255,34 444,67 929,19 1192,83 157,87 226,28 207,82 160,66 56,80 71,82 2515,81 5375,27 86,71 1928,88 435,18 157,89 463,44 284,74 542,62 273,48 282,00 265,07 618,61 412,39 1183,21 899,71 2148,78 1565,51 255,02 338,80 1208,00 344,68 287,09 313,40 752,58 238,19 1447,28 1486,19 487,93 121,81 120,66 100,07 120,59 247,30 621,48 294,51 62,61 622,60 533,73 384,96 609,86 825,66 570,48 1310,33 1156,94 857,53 494,26 1003,55 612,75 167,71 77,71 179,12 219,96 349,70 5332,59 420,00 349,37 3892,60 1839,00 403,88 2788,16 545,56 2449,35 958,05 543,76 637,68 858,69 77,78 75,78 78,63 91,20 720,80 1327,22 961,72 2067,91 1310,30 1110,05 327,07 10671,18 140,33 207,26 328,30 522,09 673,90 781,29 639,36 1204,17 406,08 288,39 3208,41 7860,67 587,23 1084,22 447,95 637,29 510,13 494,96 122,13 3541,94 1367,58 1438,34 560,64 659,81 133,18 169,01 291,60 210,19 534,23 780,32 1150,96 172,67 492,94 465,68 453,22 452,16 783,00 148,45 135,21 55,96 3282,38 1147,36 1396,06 324,63 193,52 335,07 219,43 991,26 1545,80
12,96 6,41 6,09 13,74 12,88 12,06 8,80 9,86 10,22 7,30 7,82 7,70 7,33 5,83 6,17 11,30 12,39 6,44 10,91 8,77 7,30 8,86 8,15 9,08 8,10 8,14 8,05 9,27 8,69 10,21 9,81 11,07 10,61 7,99 8,40 10,24 8,43 8,17 8,29 9,56 7,90 10,50 10,54 8,93 6,93 6,91 6,64 6,91 7,95 9,28 8,20 5,97 9,28 9,06 8,59 9,25 9,69 9,16 10,36 10,18 9,74 8,95 9,97 9,26 7,39 6,28 7,48 7,78 8,45 12,38 8,71 8,45 11,93 10,84 8,66 11,45 9,09 11,26 9,90 9,09 9,32 9,75 6,28 6,24 6,30 6,51 9,49 10,37 9,91 11,01 10,36 10,12 8,35 13,38 7,13 7,70 8,36 9,03 9,40 9,61 9,32 10,23 8,67 8,17 11,65 12,94 9,20 10,08 8,81 9,32 8,99 8,95 6,93 11,79 10,42 10,49 9,13 9,37 7,06 7,40 8,19 7,72 9,06 9,61 10,17 7,43 8,95 8,86 8,82 8,82 9,61 7,21 7,08 5,81 11,68 10,16 10,45 8,34 7,60 8,39 7,78 9,95 10,59
1,14 1,70 1,98 4,84 1,69 1,31 2,74 2,48 0,55 0,42 0,43 0,74 0,91 0,62 0,51 -0,04 0,18 -0,62 1,38 0,53 1,37 1,39 1,88 1,78 1,39 1,18 0,99 0,83 0,46 -0,14 0,01 -0,12 -0,55 -0,55 -0,49 -0,02 -0,07 -0,08 0,14 0,24 -0,12 0,79 0,77 0,84 -0,36 -0,08 -0,66 -0,21 -0,04 -0,51 -1,01 -0,61 0,37 0,91 1,14 0,81 1,24 1,19 1,19 1,41 1,63 0,01 0,20 0,36 0,65 1,08 1,23 -1,21 -0,93 1,10 1,03 0,30 0,48 0,29 0,42 0,45 -0,52 1,26 0,98 0,03 0,38 0,58 0,37 -0,05 -0,35 -0,16 1,12 1,21 1,37 1,23 1,48 1,50 1,08 0,34 -0,69 -1,26 -1,42 -1,24 -0,38 -0,18 -0,08 0,03 -0,16 0,77 -0,76 -0,16 -0,54 -0,57 -0,13 -0,10 0,64 0,70 -0,16 0,82 0,03 0,43 0,43 0,42 0,42 1,17 0,83 0,69 0,92 1,17 1,24 -0,18 0,13 -0,49 1,76 1,59 -0,47 0,20 0,41 0,44 0,38 0,89 0,95 -0,74 -0,49 -0,08 0,15 0,02 0,22
2,21 3,25 3,93 28,55 3,24 2,47 6,69 5,59 1,47 1,34 1,35 1,67 1,88 1,54 1,43 0,97 1,13 0,65 2,59 1,45 2,58 2,62 3,69 3,44 2,62 2,26 1,98 1,78 1,37 0,91 1,01 0,92 0,69 0,68 0,71 0,98 0,95 0,94 1,10 1,18 0,92 1,73 1,70 1,79 0,78 0,94 0,63 0,86 0,97 0,70 0,50 0,65 1,29 1,88 2,20 1,76 2,37 2,28 2,28 2,65 3,10 1,01 1,15 1,28 1,56 2,11 2,35 0,43 0,52 2,15 2,05 1,23 1,40 1,23 1,34 1,37 0,70 2,39 1,98 1,02 1,30 1,49 1,29 0,97 0,78 0,89 2,17 2,31 2,58 2,34 2,79 2,83 2,11 1,27 0,62 0,42 0,37 0,42 0,77 0,88 0,95 1,02 0,90 1,71 0,59 0,89 0,69 0,68 0,91 0,93 1,56 1,63 0,89 1,77 1,02 1,35 1,34 1,34 1,34 2,25 1,78 1,61 1,89 2,25 2,37 0,88 1,09 0,71 3,38 3,01 0,72 1,15 1,33 1,35 1,30 1,85 1,93 0,60 0,71 0,95 1,11 1,01 1,16
0,08 0,23 0,29 0,10 0,15 0,11 0,14 0,12 0,14 0,17 0,15 0,16 0,17 0,26 0,25 0,11 0,10 0,24 0,12 0,12 0,19 0,13 0,15 0,13 0,15 0,14 0,15 0,11 0,14 0,11 0,14 0,12 0,10 0,15 0,13 0,10 0,14 0,15 0,14 0,11 0,15 0,10 0,09 0,13 0,19 0,20 0,24 0,19 0,16 0,11 0,15 0,29 0,12 0,11 0,15 0,11 0,12 0,12 0,10 0,09 0,12 0,12 0,11 0,11 0,16 0,23 0,16 0,16 0,14 0,11 0,13 0,13 0,09 0,10 0,12 0,15 0,11 0,09 0,10 0,11 0,12 0,11 0,23 0,24 0,25 0,21 0,12 0,10 0,12 0,10 0,10 0,10 0,13 0,10 0,18 0,18 0,15 0,12 0,11 0,11 0,11 0,10 0,12 0,17 0,12 0,12 0,11 0,10 0,12 0,12 0,14 0,12 0,19 0,13 0,09 0,10 0,14 0,13 0,18 0,17 0,13 0,16 0,12 0,10 0,09 0,16 0,11 0,12 0,14 0,13 0,11 0,21 0,18 0,27 0,10 0,10 0,11 0,13 0,17 0,14 0,16 0,10 0,10
13,66 7,33 6,82 49,19 11,07 12,02 19,89 21,15 4,06 2,47 2,92 4,65 5,30 2,42 2,08 -0,36 1,85 -2,57 11,21 4,46 7,13 10,46 12,66 13,31 9,22 8,53 6,68 7,73 3,20 -1,24 0,09 -1,04 -5,54 -3,75 -3,79 -0,23 -0,52 -0,56 1,02 2,25 -0,83 7,57 8,44 6,61 -1,86 -0,41 -2,78 -1,09 -0,25 -4,52 -6,93 -2,13 3,07 8,23 7,75 7,19 10,15 9,61 12,02 14,90 14,02 0,09 1,77 3,26 4,03 4,71 7,62 -7,61 -6,59 10,47 7,99 2,22 5,44 2,93 3,51 3,06 -4,60 13,95 9,68 0,31 3,21 5,37 1,60 -0,19 -1,40 -0,76 9,63 12,40 10,98 11,90 14,55 14,92 8,12 3,57 -3,80 -7,13 -9,74 -10,66 -3,38 -1,63 -0,75 0,28 -1,30 4,64 -6,48 -1,38 -4,93 -5,88 -1,05 -0,90 4,61 5,70 -0,87 6,35 0,30 4,54 3,03 3,38 2,42 6,87 6,21 4,24 7,69 11,46 13,42 -1,14 1,13 -4,07 12,98 11,77 -4,16 0,98 2,27 1,63 3,77 8,96 8,72 -5,52 -2,95 -0,55 0,95 0,15 2,24
1,72206E-42 2,33069E-13 8,89288E-12 0 1,71274E-28 2,74453E-33 4,94662E-88 2,9624E-99 4,98723E-05 0,013686215 0,003445256 3,35756E-06 1,16506E-07 0,015566149 0,037330599 0,722153835 0,064646775 0,010231273 3,75671E-29 8,13865E-06 9,76812E-13 1,29535E-25 9,36356E-37 2,07264E-40 2,98976E-20 1,44776E-17 2,39628E-11 1,10093E-14 0,001370623 0,214379832 0,93118089 0,29716954 3,00683E-08 0,000176508 0,000150587 0,816369303 0,60247446 0,572218114 0,308402648 0,024307238 0,408848882 3,8061E-14 3,04861E-17 3,9725E-11 0,063141822 0,68075233 0,00540574 0,275108413 0,80472563 6,22649E-06 4,27926E-12 0,033007854 0,002158362 1,90765E-16 9,17999E-15 6,30886E-13 3,21523E-24 6,97293E-22 2,8215E-33 3,23367E-50 1,16126E-44 0,931115579 0,077375304 0,001112927 5,64652E-05 2,47197E-06 2,63327E-14 2,81423E-14 4,3544E-11 1,15606E-25 1,34507E-15 0,026141704 5,231E-08 0,003433217 0,000455521 0,002217784 4,31753E-06 3,07795E-44 3,60256E-22 0,758936029 0,001329915 7,76336E-08 0,108539832 0,845442596 0,161003583 0,444441904 5,86202E-22 2,56691E-35 4,77757E-28 1,13525E-32 5,51112E-48 2,61217E-50 4,58576E-16 0,000360572 0,000147462 9,97359E-13 2,10752E-22 1,52084E-26 0,000729018 0,103478277 0,451689123 0,776316421 0,194952556 3,4974E-06 9,35097E-11 0,167339873 8,05396E-07 4,00312E-09 0,29353129 0,370221193 3,96692E-06 1,21788E-08 0,383255988 2,15812E-10 0,76402498 5,67304E-06 0,002486318 0,000729106 0,015600887 6,6397E-12 5,3312E-10 2,28199E-05 1,47769E-14 2,18166E-30 4,3514E-41 0,252675954 0,257555405 4,70086E-05 1,69063E-38 5,62319E-32 3,21521E-05 0,328849761 0,023388429 0,102480567 0,000165024 3,1739E-19 2,77766E-18 3,45778E-08 0,003153156 0,581062687 0,343595863 0,881059811 0,025409795
3,5469E-41 1,45367E-12 4,86181E-11 0 2,17739E-27 4,28953E-32 2,30582E-86 1,51369E-97 0,000138176 0,025518788 0,007179643 1,07742E-05 4,41594E-07 0,02868187 0,063704176 0,783808308 0,103404187 0,019627793 4,89293E-28 2,50282E-05 5,65444E-12 1,45836E-24 1,62608E-35 4,04927E-39 2,68371E-19 1,14485E-16 1,27084E-10 7,50043E-14 0,003075798 0,29105756 0,950498511 0,379813956 1,22158E-07 0,000458887 0,000396541 0,86246252 0,677433196 0,651406825 0,391882274 0,043171345 0,494002492 2,44862E-13 2,38942E-16 2,05749E-10 0,101247931 0,745879975 0,010889349 0,357489482 0,853478874 1,93269E-05 2,40381E-11 0,057246651 0,004673813 1,43995E-15 6,30264E-14 3,70855E-12 3,47271E-23 6,73712E-21 4,38406E-32 8,76721E-49 2,75489E-43 0,950498511 0,120225837 0,002540419 0,000155148 8,08872E-06 1,72756E-13 1,82822E-13 2,23784E-10 1,31267E-24 9,79137E-15 0,046121187 2,05908E-07 0,007165796 0,001111404 0,004790775 1,36568E-05 6,9306E-43 3,51912E-21 0,815073981 0,002992028 3,00251E-07 0,161744438 0,885083128 0,227667121 0,530733545 5,68445E-21 4,26268E-34 5,95963E-27 1,70416E-31 1,43559E-46 7,1552E-49 3,41299E-15 0,000892861 0,000389082 5,76083E-12 2,08166E-21 1,81205E-25 0,001715886 0,155510058 0,537696236 0,829715499 0,267980607 1,1169E-05 4,68783E-10 0,235249758 2,81571E-06 1,74365E-08 0,376224138 0,455617281 1,26229E-05 5,08789E-08 0,468404397 1,04638E-09 0,819214839 1,76709E-05 0,005327539 0,001715886 0,028725957 3,67535E-11 2,52046E-09 6,67757E-05 9,86491E-14 2,95749E-29 8,62811E-40 0,333843863 0,338439521 0,000130924 3,16338E-37 8,07612E-31 9,21554E-05 0,412927134 0,041650842 0,154447457 0,00043114 2,76493E-18 2,27785E-17 1,4005E-07 0,006622875 0,657811487 0,428808928 0,913729866 0,045009217
Locus USA300HOU 0020 USA300HOU 0021 USA300HOU_1507 USA300HOU 2269 USA300HOU_2270 USA300HOU_2271 USA300HOU 2272 USA300HOU 2273 USA300HOU_2274 USA300HOU 2275 USA300HOU 0997 USA300HOU_0199 USA300HOU_2666 USA300HOU 2667 USA300HOU_2668 USA300HOU_2669 USA300HOU 0709 USA300HOU_1753 USA300HOU_0029 USA300HOU 0030 USA300HOU_0107 USA300HOU_0116 USA300HOU 0121 USA300HOU 0152 USA300HOU_0153 USA300HOU 0154 USA300HOU_0155 USA300HOU_0162 USA300HOU 0179 USA300HOU_0180 USA300HOU_0218 USA300HOU 0220 USA300HOU_0221 USA300HOU_0222 USA300HOU 0223 USA300HOU_0236 USA300HOU_0237 USA300HOU 0285 USA300HOU 0290 USA300HOU_0291 USA300HOU 0292 USA300HOU_0293 USA300HOU_0296 USA300HOU 0297 USA300HOU 0301 USA300HOU_0307 USA300HOU 0309 USA300HOU_0323 USA300HOU_1980 USA300HOU 0416 USA300HOU_0465 USA300HOU_0466 USA300HOU 0550 USA300HOU_0551 USA300HOU_0553 USA300HOU 0554 USA300HOU_0679 USA300HOU_0680 USA300HOU 0681 USA300HOU 0689 USA300HOU_0719 USA300HOU 0813 USA300HOU_0814 USA300HOU_0815 USA300HOU 0949 USA300HOU_0950 USA300HOU_0951 USA300HOU 0952 USA300HOU_0953 USA300HOU_0955 USA300HOU_1151 USA300HOU 1243 USA300HOU 1838 USA300HOU_1839 USA300HOU 2344 USA300HOU_2345 USA300HOU_2346 USA300HOU 2347 USA300HOU_2349 USA300HOU_2389 USA300HOU 2390 USA300HOU_2391 USA300HOU_2412 USA300HOU 2413 USA300HOU 2459 USA300HOU_2460 USA300HOU 2461 USA300HOU 2536 USA300HOU_2546 USA300HOU 2684 USA300HOU_2685 USA300HOU_2686 USA300HOU 2687 USA300HOU_2688 USA300HOU_2368 USA300HOU 0663 USA300HOU_2662 USA300HOU_2663 USA300HOU 2664 USA300HOU_0819 USA300HOU_2619 USA300HOU 1659 USA300HOU 1660 USA300HOU_1661 USA300HOU 1662 USA300HOU_1663 USA300HOU_1664 USA300HOU 2638 USA300HOU_2182 USA300HOU_2183 USA300HOU 2184 USA300HOU_2185 USA300HOU_2186 USA300HOU 2187 USA300HOU_2188 USA300HOU_0377 USA300HOU 0378 USA300HOU 0379 USA300HOU_0380 USA300HOU_2250 USA300HOU 2251 USA300HOU_2252 USA300HOU_2253 USA300HOU 2254 USA300HOU 2255 USA300HOU_2257 USA300HOU 2258 USA300HOU_2259 USA300HOU_2260 USA300HOU 2261 USA300HOU_1122 USA300HOU_1123 USA300HOU 1124 USA300HOU_0718 USA300HOU_0140 USA300HOU 0141 USA300HOU_0142 USA300HOU_0143 USA300HOU 0144 USA300HOU 0229 USA300HOU_0246 USA300HOU 0252 USA300HOU_0253 USA300HOU_0483 USA300HOU 0484 USA300HOU_0485 USA300HOU_0487 USA300HOU 0488 USA300HOU_0489 USA300HOU_0614 USA300HOU 0783 USA300HOU 0944 USA300HOU_0945 USA300HOU 0946 USA300HOU_0947 USA300HOU_0948 USA300HOU 0990 USA300HOU_0991 USA300HOU 0992 USA300HOU_0993 USA300HOU 1100 USA300HOU_1101 USA300HOU_1180 USA300HOU 1181 USA300HOU_1237 USA300HOU_1238 USA300HOU 1255 USA300HOU 1256 USA300HOU_1257 USA300HOU_1258
Gene symbol walH walI zwf ureA ureB ureC ureE ureF ureG ureD atl brnQ1 icaA icaD icaB icaC mgrA rot ugpQ maoC USA300HOU_0107 nptA lctP phnE1 phnE2 phnC phnD adhE isdI USA300HOU_0180 acpD malK malE malF malD glpQ1 SCIN_2 USA300HOU 0285 USA300HOU 0290 USA300HOU_0291 USA300HOU 0292 USA300HOU_0293 USA300HOU_0296 esxA essB USA300HOU_0307 USA300HOU 0309 USA300HOU_0323 dut USA300HOU 0416 sle1 USA300HOU_0466 dck dgk USA300HOU_0553 azo1 graX graR graS sarX USA300HOU_0719 USA300HOU 0813 USA300HOU_0814 USA300HOU_0815 opp-4A opp-4D opp-4F opp-4B opp-4C spxA USA300HOU_1151 USA300HOU 1243 USA300HOU 1838 USA300HOU_1839 hssR hssS USA300HOU_2346 USA300HOU 2347 lctP_2 USA300HOU_2389 dsbA USA300HOU_2391 USA300HOU_2412 msbA3 USA300HOU 2459 USA300HOU_2460 dapF amiD2 mmpL USA300HOU 2684 USA300HOU_2685 USA300HOU_2686 USA300HOU 2687 USA300HOU_2688 sarZ abcA cap1C cap1B cap1A clfA gpxA2 hemL hemB hemD hemC hemX hemA isaB lacG lacE lacF lacD lacC lacB lacA metE metF metC metI moaA mobA moaD moaE mobB moeA moaB moeB modC modB modA mraY murD divIB norA galE cap5M2 cap8H USA300HOU_0143 USA300HOU 0144 uhpT USA300HOU_0246 glcC USA300HOU_0253 holB USA300HOU 0484 yabA USA300HOU_0487 USA300HOU 0488 rsmI USA300HOU_0614 USA300HOU 0783 oppB oppC oppD oppF oppA menF menD menH menB USA300HOU 1100 USA300HOU_1101 dprA topA hflX USA300HOU_1238 USA300HOU 1255 USA300HOU_1256 USA300HOU_1257 USA300HOU_1258
Regulon GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA
Function hypothetical protein YycH hypothetical protein YycI glucose-6-phosphate 1-dehydrogenase urease gamma subunit urease beta subunit urease alpha subunit urease accessory protein UreE urease accessory protein UreF urease accessory protein UreG urease accessory protein UreD acetylglucosaminidase possible LIVCS family branched chain amino acid:cation symporter intercellular adhesion protein A intercellular adhesion protein D intercellular adhesion protein B intercellular adhesion protein C possible MarR family transcriptional regulator repressor of toxins Rot glycerophosphodiester phosphodiesterase possible acyl dehydratase MaoC hypothetical membrane protein possible PnaS family phosphate:sodium (Na+) symporter LctP family L-lactate permease phosphonate ABC transporter, permease phosphonate ABC transporter, permease phosphonate ABC transporter, ATP-binding protein phosphonate ABC transporter, phosphonate-binding protein alcohol dehydrogenase heme-degrading enzyme IsdG hypothetical membrane protein azoreductase maltose ABC transporter ATP-binding protein maltose ABC transporter, binding protein maltose ABC transporter, permease maltose ABC transporter, permease possible glycerophosphodiester phosphodiesterase hypothetical protein hypothetical protein ABC transporter, ATP-binding protein hypothetical protein hypothetical membrane protein hypothetical protein hypothetical protein ESAT-6 family virulence protein virulence protein EssB hypothetical protein hypothetical membrane protein hypothetical membrane protein deoxyuridine 5'-triphosphate nucleotidohydrolase hypothetical protein possible LysM family autolysin hypothetical protein deoxynucleoside kinase deoxynucleoside kinase hydrolase hypothetical protein hypothetical protein response regulator sensor histidine kinase possible staphylococcal accessory protein X hypothetical protein hypothetical protein hypothetical protein hypothetical lipoprotein oligopeptide ABC transporter, oligopeptide-binding protein oligopeptide ABC transporter, ATP-binding protein oligopeptide ABC transporter, ATP-binding protein oligopeptide ABC transporter, permease oligopeptide ABC transporter, permease transcriptional regulator Spx hypothetical lipoprotein hypothetical protein hypothetical protein hypothetical protein hemin DNA-binding response regulator hemin sensor histidine kinase hypothetical protein hypothetical membrane protein LctP family L-lactate permease hypothetical protein possible lipoprotein possible lipoprotein ABC transporter, ATP-binding protein ABC transporter, ATP-binding protein hypothetical protein hypothetical protein hypothetical protein possible secretory antigen MmpL efflux pump hypothetical protein cobalt (Co2+) ABC transporter, membrane protein ABC transporter, membrane protein hypothetical protein hypothetical protein MarR/SarA family transcriptional regulator ABC transporter, ATP-binding protein/permease capsular polysaccharide biosynthesis protein CapC capsular polysaccharide biosynthesis protein CapB capsular polysaccharide biosynthesis protein CapA fibrinogen-binding protein glutathione peroxidase glutamate-1-semialdehyde 2,1-aminomutase porphobilinogen synthase uroporphyrinogen-III synthase hydroxymethylbilane synthase possible cytochrome c assembly protein glutamyl-tRNA reductase immunodominant antigen B 6-phospho-beta-galactosidase PTS lactose-N,N-diacetylchitobiose-beta-glucoside (lac) porter component IIBC PTS lactose-N,N-diacetylchitobiose-beta-glucoside (lac) porter component IIA tagatose-bisphosphate aldolase tagatose-6-phosphate kinase galactose-6-phosphate isomerase LacB subunit galactose-6-phosphate isomerase LacA subunit 5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase methylenetetrahydrofolate reductase/homocysteine S-methyltransferase bifunctional cystathionine gamma-lyase/gamma-synthase bifunctional cystathionine gamma-lyase/gamma-synthase molybdenum (Mo2+) cofactor biosynthesis protein A molybdenum (Mo2+) cofactor biosynthesis protein A molybdopterin synthase small subunit molybdopterin synthase large subunit molybdopterin-guanine dinucleotide biosynthesis protein B molybdopterin biosynthesis protein MoeA molybdopterin cofactor biosynthesis protein MoaB molybdopterin biosynthesis protein MoeB molybdenum (Mo2+) ABC transporter, ATP-binding protein molybdenum (Mo2+) ABC transporter, membrane protein molybdenum (Mo2+) ABC transporter, binding protein phospho-N-acetylmuramoyl-pentapeptide- transferase UDP-N-acetylmuramoylalanine--D-glutamate ligase cell division protein FtsQ MFS family major facilitator transporter UDP-glucose 4-epimerase capsular polysaccharide biosynthesis protein glycosyltransferase polysaccharide extrusion protein polysaccharide biosynthesis protein MFS family major facilitator transporter, hexose phosphate:cation symporter ABC transporter, binding protein PTS system, IIBC components purine nucleosidase DNA-directed DNA polymerase III delta' subunit hypothetical protein DNA replication intiation control protein YabA hypothetical protein hypothetical protein tetrapyrrole methylase deoxyribonuclease (pyrimidine dimer) possible LysM family autolysin oligopeptide ABC transporter, membrane protein oligopeptide ABC transporter, membrane protein oligopeptide ABC transporter, ATP-binding protein oligopeptide ABC transporter, ATP-binding protein oligopeptide ABC transporter, binding protein isochorismate synthase 2-oxoglutarate decarboxylase S33 family peptidase naphthoate synthase hypothetical protein hypothetical protein DNA processing protein DprA DNA topoisomerase A GTP-binding protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein
Base mean A-value M-value Fold change Standard error Wald statistic P-value Adjusted P-value 851,30 9,73 0,17 1,13 0,11 1,62 0,105533275 0,157730787 400,71 8,65 0,69 1,62 0,13 5,20 2,04266E-07 7,49632E-07 5109,25 12,32 1,51 2,86 0,11 13,96 2,87995E-44 6,58961E-43 17,67 4,14 -0,24 0,84 0,44 -0,56 0,578445901 0,656247122 29,83 4,90 -0,48 0,72 0,36 -1,33 0,182366853 0,252764073 79,51 6,31 0,26 1,20 0,22 1,17 0,242106548 0,32244466 46,15 5,53 0,35 1,27 0,27 1,27 0,204773626 0,27973446 62,27 5,96 0,45 1,37 0,24 1,90 0,058045517 0,093983509 113,77 6,83 0,53 1,44 0,19 2,70 0,007026622 0,013860233 164,05 7,36 0,49 1,40 0,17 2,87 0,004089766 0,008423649 25002,46 14,61 0,23 1,17 0,09 2,71 0,006801423 0,013466006 11,64 0,07 1,05 0,11 0,70 0,484185942 0,571008454 3199,53 134,48 7,07 -0,38 0,77 0,18 -2,14 0,032501037 0,056552229 75,40 6,24 -0,42 0,75 0,23 -1,80 0,071496444 0,112645791 112,91 6,82 -0,31 0,80 0,21 -1,49 0,137109386 0,197773963 168,26 7,39 -0,73 0,60 0,17 -4,35 1,3374E-05 3,98541E-05 12,29 0,69 1,62 0,13 5,20 1,94054E-07 7,14131E-07 4992,13 5736,32 12,49 0,32 1,25 0,10 3,19 0,001409395 0,003154812 925,86 9,85 1,31 2,48 0,12 10,55 4,87004E-26 5,70031E-25 96,80 6,60 0,22 1,17 0,21 1,05 0,291695799 0,374775502 124,74 6,96 -0,84 0,56 0,19 -4,35 1,33404E-05 3,98262E-05 10,89 1,20 2,30 0,13 9,57 1,04423E-21 1,00526E-20 1900,07 2002,75 10,97 -0,71 0,61 0,11 -6,21 5,39061E-10 2,54402E-09 35,80 5,16 -0,12 0,92 0,31 -0,40 0,690761549 0,754358174 32,61 5,03 0,33 1,26 0,34 0,98 0,325783938 0,409658269 42,61 5,41 0,10 1,07 0,31 0,33 0,741498555 0,800228132 6,16 -0,19 0,88 0,26 -0,74 0,460221156 0,546628347 71,70 268,22 8,07 -0,74 0,60 0,14 -5,10 3,46803E-07 1,2469E-06 236,85 7,89 0,74 1,68 0,15 5,02 5,12798E-07 1,81667E-06 175,79 7,46 0,26 1,20 0,17 1,58 0,113542739 0,16834992 12494,03 13,61 3,12 8,71 0,09 35,02 1,0328E-268 1,1434E-266 7,04 -0,26 0,84 0,20 -1,30 0,19495917 0,267980607 131,46 68,64 6,10 -1,12 0,46 0,25 -4,45 8,77427E-06 2,68896E-05 59,80 5,90 -1,37 0,39 0,27 -5,06 4,29597E-07 1,53626E-06 31,91 5,00 -0,54 0,69 0,33 -1,63 0,102862145 0,154819398 861,94 9,75 -1,33 0,40 0,13 -10,08 6,49215E-24 6,84509E-23 9,31 4,28 19,38 0,16 27,35 1,0319E-164 7,8338E-163 636,42 152,63 7,25 0,05 1,04 0,17 0,31 0,756352701 0,813285765 142,21 7,15 -1,13 0,46 0,19 -5,91 3,40346E-09 1,50717E-08 151,06 7,24 -1,73 0,30 0,20 -8,45 2,79277E-17 2,19538E-16 227,42 7,83 -1,02 0,49 0,16 -6,52 7,12906E-11 3,60112E-10 10,79 -0,33 0,80 0,11 -2,86 0,004296432 0,008774496 1775,05 174,00 7,44 -1,23 0,42 0,18 -6,82 8,87452E-12 4,86177E-11 3155,92 11,62 -0,17 0,89 0,11 -1,61 0,108196 0,161413122 60,28 5,91 -0,98 0,51 0,29 -3,33 0,000854732 0,00198516 175,48 7,46 -0,81 0,57 0,18 -4,42 9,95863E-06 3,02401E-05 4,98 -0,63 0,65 0,34 -1,83 0,066795808 0,106400756 31,49 477,79 8,90 0,70 1,62 0,12 5,93 3,08452E-09 1,3705E-08 29,35 4,88 -1,02 0,49 0,49 -2,07 0,038144932 0,064968643 201,09 7,65 -0,91 0,53 0,17 -5,24 1,60533E-07 5,97389E-07 8381,57 13,03 0,76 1,69 0,09 8,75 2,13213E-18 1,78147E-17 8,94 0,48 1,40 0,18 2,65 0,008140754 0,01587259 490,94 264,63 8,05 0,08 1,06 0,14 0,54 0,587370177 0,663538503 242,09 7,92 -0,56 0,68 0,19 -2,98 0,002865158 0,006075598 1472,07 10,52 -1,14 0,45 0,10 -11,08 1,61839E-28 2,06734E-27 1213,38 10,24 -0,47 0,72 0,10 -4,84 1,31373E-06 4,46938E-06 9,04 -0,09 0,94 0,12 -0,73 0,467696069 0,554020712 527,09 368,77 8,53 -0,02 0,99 0,14 -0,12 0,903580264 0,932237361 462,83 8,85 -0,13 0,91 0,12 -1,05 0,292300185 0,375370513 96,53 6,59 -1,34 0,39 0,23 -5,76 8,48119E-09 3,59402E-08 4844,14 12,24 -0,30 0,81 0,10 -3,12 0,001819368 0,004001705 8,53 -0,16 0,90 0,15 -1,05 0,295276715 0,378096497 370,05 260,15 8,02 -0,26 0,84 0,16 -1,62 0,105185874 0,157508814 454,94 8,83 -0,34 0,79 0,13 -2,65 0,008142394 0,01587259 627,56 9,29 -0,01 0,99 0,12 -0,09 0,929419077 0,949429638 125,93 6,98 -0,64 0,64 0,19 -3,37 0,000751168 0,001763121 94,23 6,56 -0,68 0,63 0,23 -2,93 0,003383115 0,007072333 -2,09 -0,52 0,70 0,25 0,036328435 0,062233819 64,02 6,00 90,70 6,50 -0,11 0,93 0,23 -0,48 0,632225461 0,704033131 0,01 1,00 0,11 45650,99 15,48 0,06 0,954490092 0,967969533 477,14 8,90 -0,35 0,78 0,13 -2,67 0,0074854 0,014699709 6,25 -0,38 0,77 0,23 -1,66 0,096274137 0,146255221 75,89 2642,70 11,37 0,77 1,70 0,12 6,63 3,41298E-11 1,7851E-10 2563,74 11,32 0,89 1,86 0,11 8,44 3,08169E-17 2,40825E-16 0,023046865 251,13 7,97 -0,39 0,76 0,16 -2,51 0,012204343 691,85 9,43 -0,21 0,87 0,11 -1,83 0,067629969 0,107536103 7,03 -0,70 0,62 0,18 -3,79 0,000149044 0,000392866 130,81 216,85 7,76 -0,16 0,90 0,16 -0,99 0,321126545 0,404754778 1213,16 10,24 -0,75 0,59 0,11 -6,77 1,32886E-11 7,13288E-11 96,41 6,59 0,00 1,00 0,22 0,00 0,996123726 0,997249714 638,46 9,32 0,10 1,07 0,11 0,90 0,367381549 0,452961844 8,20 -0,18 0,88 0,13 -1,37 0,171640797 0,239899841 294,06 101,10 6,66 -0,49 0,71 0,21 -2,34 0,019366134 0,035003957 105,24 6,72 -0,59 0,67 0,20 -2,88 0,003949532 0,008160114 76,88 6,26 1,06 2,09 0,28 3,74 0,000182228 0,000472831 93,54 6,55 1,42 2,68 0,27 5,35 8,60592E-08 3,30911E-07 6,56 1,84 3,59 0,23 7,86 3,78979E-15 2,67095E-14 94,04 581,18 9,18 0,95 1,94 0,14 6,69 2,21585E-11 1,1775E-10 496,38 8,96 0,12 1,09 0,13 0,92 0,357529507 0,44369729 81,03 6,34 -0,40 0,76 0,23 -1,76 0,078602014 0,121775831 186,08 7,54 -0,05 0,96 0,16 -0,34 0,732461648 0,792729368 9,37 -0,07 0,96 0,11 -0,60 0,547975254 0,630017417 660,71 476,21 8,90 0,09 1,06 0,12 0,70 0,484838669 0,571524553 616,67 9,27 0,14 1,10 0,12 1,21 0,225735392 0,30353185 4295,95 12,07 0,38 1,30 0,13 2,95 0,003219771 0,006752117 1777,13 10,80 0,16 1,12 0,09 1,74 0,082052252 0,126530954 5,73 -1,37 0,39 0,28 -4,93 8,21651E-07 2,86876E-06 53,22 52,33 5,71 -1,61 0,33 0,29 -5,51 3,59386E-08 1,44461E-07 0,000658782 39,84 5,32 -1,14 0,45 0,31 -3,65 0,000260587 9666,43 13,24 1,06 2,08 0,12 8,82 1,18396E-18 1,0115E-17 151,05 7,24 -0,65 0,64 0,18 -3,62 0,000298479 0,000749584 8,73 1,00 2,01 0,13 7,98 1,50562E-15 1,09004E-14 425,59 295,06 8,20 0,32 1,25 0,15 2,07 0,03822993 0,0650717 0,032973352 264,13 8,05 -0,36 0,78 0,15 -2,36 0,01818064 644,13 9,33 -0,21 0,86 0,12 -1,78 0,075416922 0,117802917 947,84 9,89 0,54 1,46 0,15 3,59 0,000329752 0,000824226 11,92 0,65 1,57 0,10 6,76 1,38632E-11 7,4263E-11 3862,70 804,38 9,65 -0,13 0,91 0,12 -1,12 0,262159413 0,343639645 0,819305367 97,93 6,61 -0,06 0,96 0,20 -0,30 0,765034481 43,68 5,45 -0,07 0,95 0,33 -0,21 0,83442654 0,876312773 9,49 3,25 0,17 1,13 0,55 0,32 0,752429275 0,81005048 3,96 -0,47 0,72 0,49 -0,97 0,332889473 0,4170143 15,59 18,53 4,21 -0,87 0,55 0,57 -1,55 0,122037761 0,17924507 11,68 3,55 -0,93 0,52 0,60 -1,55 0,121279144 0,178229362 11,58 3,53 -0,93 0,53 0,54 -1,72 0,085088328 0,130305295 869,88 9,76 -0,76 0,59 0,11 -6,80 1,05943E-11 5,70977E-11 10,56 -1,38 0,38 0,11 -12,68 7,41714E-37 1,29654E-35 1512,96 1343,77 10,39 -0,88 0,54 0,13 -6,85 7,44418E-12 4,09507E-11 1268,17 10,31 -0,59 0,67 0,12 -4,76 1,88869E-06 6,28852E-06 844,17 9,72 0,34 1,27 0,10 3,34 0,000839809 0,001953917 470,30 8,88 0,49 1,41 0,14 3,60 0,00031308 0,000784029 204,09 7,67 0,48 1,39 0,16 3,05 0,002259561 0,004873095 0,086836283 253,23 7,98 0,29 1,22 0,15 1,94 0,052944968 211,15 7,72 0,26 1,20 0,16 1,60 0,108724917 0,161929431 347,84 8,44 0,40 1,32 0,13 3,08 0,002063594 0,004490556 261,40 8,03 0,05 1,04 0,16 0,34 0,73211714 0,792679398 520,11 9,02 -0,16 0,90 0,13 -1,26 0,206256063 0,281325647 400,20 8,64 0,01 1,01 0,13 0,11 0,908933962 0,935790879 528,55 9,05 -0,06 0,96 0,11 -0,54 0,591548278 0,667123843 704,64 9,46 0,06 1,04 0,11 0,55 0,580800561 0,657795009 209,38 7,71 -1,61 0,33 0,19 -8,65 5,20012E-18 4,19961E-17 188,81 7,56 -0,30 0,81 0,16 -1,89 0,05874053 0,094935272 292,20 8,19 0,47 1,38 0,14 3,43 0,000596822 0,001429897 -3,59 0,000334196 0,000833763 4214,91 12,04 -0,37 0,77 0,10 80,01 6,32 -0,49 0,71 0,26 -1,91 0,056568753 0,091816235 51,83 5,70 -0,55 0,68 0,29 -1,88 0,059450732 0,095908073 54,74 5,77 -0,78 0,58 0,28 -2,80 0,005138158 0,010366048 67,63 6,08 -0,89 0,54 0,27 -3,36 0,00077768 0,001818922 -2,08 0,037166713 0,063506081 99,28 6,63 -0,44 0,74 0,21 96,17 6,59 -0,39 0,76 0,24 -1,60 0,109873932 0,163549041 122,31 6,93 0,45 1,36 0,20 2,27 0,022939869 0,040879431 127,29 6,99 -0,31 0,81 0,19 -1,62 0,10554962 0,157730787 77,72 6,28 0,04 1,03 0,23 0,16 0,871551476 0,906345312 -1,43 0,37 0,10 -14,52 9,71644E-48 2,45872E-46 2554,83 11,32 -20,01 4,09898E-89 2,01685E-87 1356,04 10,41 -1,97 0,25 0,10 494,68 8,95 -1,88 0,27 0,15 -12,45 1,4185E-35 2,37042E-34 210,49 7,72 -2,02 0,25 0,18 -11,23 3,04452E-29 3,98487E-28 109,79 6,78 -1,94 0,26 0,25 -7,70 1,35503E-14 9,13786E-14 214,34 7,74 -1,63 0,32 0,17 -9,77 1,54135E-22 1,53385E-21 -9,40 5,22132E-21 4,81703E-20 122,19 6,93 -2,05 0,24 0,22 360,37 8,49 -0,20 0,87 0,13 -1,49 0,135092079 0,195288168 1412,75 10,46 -0,43 0,74 0,18 -2,43 0,015120585 0,028016314 628,38 9,30 -1,18 0,44 0,13 -9,40 5,3021E-21 4,87463E-20 537,98 9,07 -1,35 0,39 0,12 -11,52 1,06193E-30 1,44695E-29 8,73 -1,21 0,43 0,14 -8,54 1,3393E-17 1,06225E-16 425,33 554,43 9,11 -0,59 0,66 0,12 -4,76 1,89859E-06 6,31357E-06 379,04 8,57 0,39 1,31 0,15 2,64 0,008260274 0,016043529 880,15 9,78 0,52 1,44 0,11 4,74 2,1336E-06 7,00737E-06 444,95 8,80 0,45 1,36 0,12 3,73 0,000192857 0,000498463 885,78 9,79 0,79 1,73 0,14 5,48 4,159E-08 1,65674E-07 163,55 7,35 0,27 1,21 0,22 1,22 0,222692978 0,300200529 343,79 8,43 0,49 1,40 0,17 2,83 0,004682962 0,009512715 239,21 7,90 -0,02 0,99 0,19 -0,10 0,92298628 0,945045321 4757,73 12,22 0,28 1,22 0,09 2,98 0,002838509 0,006033536 193,88 7,60 -0,76 0,59 0,16 -4,85 1,25548E-06 4,28767E-06 192,06 7,59 -0,11 0,93 0,16 -0,68 0,495826612 0,581638547 390,08 8,61 -0,48 0,71 0,18 -2,64 0,008258035 0,016043529 481,89 8,91 -0,04 0,98 0,17 -0,21 0,834048346 0,876261943 541,87 9,08 -0,24 0,85 0,15 -1,56 0,118728239 0,175353491 240,90 7,91 -0,50 0,71 0,18 -2,71 0,006685946 0,013247248
Locus USA300HOU 1260 USA300HOU 1543 USA300HOU_1544 USA300HOU 1545 USA300HOU_1546 USA300HOU_1605 USA300HOU 1606 USA300HOU 1607 USA300HOU_1608 USA300HOU 1609 USA300HOU_1623 USA300HOU_1678 USA300HOU 1747 USA300HOU_1787 USA300HOU_2070 USA300HOU 2071 USA300HOU 2072 USA300HOU_2073 USA300HOU 2268 USA300HOU_2277 USA300HOU_2278 USA300HOU 2279 USA300HOU 2440 USA300HOU_2513 USA300HOU 2520 USA300HOU_2579 USA300HOU_2580 USA300HOU 2581 USA300HOU_2587 USA300HOU_2653 USA300HOU 2654 USA300HOU_2655 USA300HOU_2683 USA300HOU 0821 USA300HOU_0472 USA300HOU_0473 USA300HOU 0271 USA300HOU 0272 USA300HOU_2115 USA300HOU 0213 USA300HOU_0214 USA300HOU_0215 USA300HOU 0216 USA300HOU_0375 USA300HOU_0426 USA300HOU 0432 USA300HOU 0558 USA300HOU_0710 USA300HOU 0711 USA300HOU 0712 USA300HOU_0773 USA300HOU 0822 USA300HOU_0833 USA300HOU_0940 USA300HOU 0962 USA300HOU_0963 USA300HOU_0964 USA300HOU 0965 USA300HOU_0966 USA300HOU_0967 USA300HOU 0971 USA300HOU 1035 USA300HOU_1050 USA300HOU 1092 USA300HOU 1373 USA300HOU_1497 USA300HOU 1716 USA300HOU_1828 USA300HOU 1829 USA300HOU_2105 USA300HOU_2106 USA300HOU 2107 USA300HOU 2166 USA300HOU_2300 USA300HOU 2406 USA300HOU_2422 USA300HOU_2503 USA300HOU 2504 USA300HOU_2540 USA300HOU_2588 USA300HOU 2596 USA300HOU_2671 USA300HOU_2517 USA300HOU 2339 USA300HOU 2088 USA300HOU_2613 USA300HOU 2614 USA300HOU 0754 USA300HOU_0755 USA300HOU 0756 USA300HOU_0511 USA300HOU_0512 USA300HOU_1008 USA300HOU_0017 USA300HOU 1909 USA300HOU 1009 USA300HOU_1010 USA300HOU 1011 USA300HOU_1012 USA300HOU_1013 USA300HOU 1014 USA300HOU_1015 USA300HOU_1016 USA300HOU_1017 USA300HOU 1018 USA300HOU_1137 USA300HOU_1138 USA300HOU 1139 USA300HOU_1140 USA300HOU_1141 USA300HOU 1142 USA300HOU_1143 USA300HOU_1144 USA300HOU 2632 USA300HOU_2633 USA300HOU_2634 USA300HOU 2635 USA300HOU 0195 USA300HOU_0196 USA300HOU 0197 USA300HOU_0198 USA300HOU_0919 USA300HOU 0920 USA300HOU_1521 USA300HOU_1522 USA300HOU 1852 USA300HOU_1853 USA300HOU_2610 USA300HOU 2631 USA300HOU_2362 USA300HOU_2037 USA300HOU 2038 USA300HOU 2637 USA300HOU_2407 USA300HOU 2408 USA300HOU_2409 USA300HOU_2410 USA300HOU 2411 USA300HOU_0823 USA300HOU_0163 USA300HOU 0164 USA300HOU_0165 USA300HOU_0167 USA300HOU 0168 USA300HOU_0170 USA300HOU_0171 USA300HOU 0172 USA300HOU 0173 USA300HOU_0174 USA300HOU 0175 USA300HOU_0176 USA300HOU_0177 USA300HOU 0178 USA300HOU_2556 USA300HOU_2557 USA300HOU 2558 USA300HOU_2559 USA300HOU_2560 USA300HOU 1808 USA300HOU_1809 USA300HOU_1810 USA300HOU 1811 USA300HOU 1812 USA300HOU_1813 USA300HOU 1814 USA300HOU_1815 USA300HOU_2089 USA300HOU 2090
Gene symbol USA300HOU 1260 comGD comGC comGB comGA lamB accC accB ahs2 USA300HOU 1609 USA300HOU 1623 USA300HOU_1678 sasC USA300HOU_1787 kdpC kdpB kdpA kdpF USA300HOU 2268 USA300HOU_2277 sarY USA300HOU 2279 USA300HOU 2440 ddh USA300HOU 2520 USA300HOU 2579 USA300HOU_2580 USA300HOU 2581 USA300HOU_2587 secY2 sasA USA300HOU_2655 USA300HOU_2683 emp gltB gltD lytS lytR pyrG USA300HOU 0213 USA300HOU_0214 USA300HOU_0215 ggt USA300HOU_0375 ssl4 ssl10 USA300HOU 0558 USA300HOU_0710 USA300HOU 0711 USA300HOU 0712 USA300HOU_0773 USA300HOU 0822 USA300HOU 0833 USA300HOU_0940 USA300HOU 0962 relQ ppnK USA300HOU 0965 mgtE cpaA USA300HOU 0971 USA300HOU 1035 USA300HOU_1050 flr norB USA300HOU_1497 USA300HOU 1716 ecsB ecsA hemK prfA tdk USA300HOU 2166 USA300HOU_2300 USA300HOU 2406 USA300HOU_2422 USA300HOU_2503 USA300HOU 2504 mvaS USA300HOU_2588 gabT lip srtA tcaR ywpF nrdG nrdD nrdI nrdE nrdF pdxS pdxT folD purA purB purE purK purC purS purQ purL purF purM purH purD uraA pyrB pyrC carA carB pyrF pyrE USA300HOU_1144 arcC arcD arcB arcA argB argJ argC argD argH argG recN argR artQ artM cudT arcR scrA scrK scrB aur bioW bioF bioB bioA bioD nuc cap5A cap5B cap5C cap5E cap5F cap5H cap5I cap5J cap5K cap5L cap5M cap5N cap5O cap5P crtN crtM crtQ crtI crtO epiG epiE epiF epiP epiD epiC epiB epiA fabZ murA1
Regulon MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA NrdR NrdR NrdR NrdR NrdR PdxR PdxR PurR PurR PurR PurR PurR PurR PurR PurR PurR PurR PurR PurR PurR PyrR PyrR PyrR PyrR PyrR PyrR PyrR PyrR ArcR ArcR ArcR ArcR ArgR ArgR ArgR ArgR ArgR ArgR ArgR ArgR ArgR ArgR ArgR ArgR ScrR ScrR ScrR SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB
Function hypothetical protein competence protein ComGD competence protein ComGC competence protein ComGB competence protein ComGA possible lactam utilization protein biotin carboxylase acetyl-CoA carboxylase biotin carboxyl carrier subunit Allophanate hydrolase subunit 2 allophanate hydrolase subunit 1 dehydrogenase hypothetical membrane protein cell surface anchored protein hypothetical protein K+-transporting ATPase, C subunit K+-transporting ATPase, B subunit K+-transporting ATPase, A subunit K+-transporting ATPase, F subunit UT family urea transporter hypothetical protein staphylococcal accessory regulator Y AraC family transcriptional regulator amino acid permease D-lactate dehydrogenase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein Sec family Type I general secretory pathway protein SecY LPXTG cell wall surface anchor family protein hypothetical protein hypothetical protein secretory extracellular matrix and plasma binding protein glutamate synthase (NADPH), large subunit glutamate synthase (NADPH) small subunit sensor histidine kinase LytS response regulator LytR CTP synthase oligopeptide ABC transporter, membrane protein oligopeptide ABC transporter, membrane protein RGD domain lipoprotein T3 family gamma-glutamyltransferase acetyl-CoA C-acetyltransferase superantigen-like protein superantigen-like protein glycosyltransferase possible cobalamin (vitamin B12) biosynthesis protein possible aldo/keto reductase hypothetical membrane protein diguanylate cyclase GGDEF domain protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein GTP diphosphokinase inorganic polyphosphate/ATP-NAD kinase ribosomal large subunit pseudouridine synthase D MgtE family magnesium (Mg2+)/cobalt (Co2+) transporter-E CPA2 family monovalent cation:proton (H+) antiporter-2 AGCS family alanine or glycine:sodium (Na+) or proton (H+) symporter hypothetical protein hypothetical protein hypothetical protein MFS family major facilitator transporter hypothetical protein S1 family peptidase ABC transporter, permease ABC transporter, ATP-binding protein HemK family methyltransferase peptide chain release factor RF1 thymidine kinase hypothetical membrane protein hypothetical membrane protein hypothetical membrane protein hypothetical protein ABC transporter, ATP-binding protein ABC transporter, membrane protein hydroxymethylglutaryl-CoA synthase TetR transcriptional regulator 4-aminobutyrate transaminase triacylglycerol lipase sortase transcriptional regulator TcaR hypothetical protein anaerobic ribonucleotide reductase small subunit anaerobic ribonucleotide reductase large subunit ribonucleotide-diphosphate reductase subunit gamma ribonuceloside diphosphate reductase subunit alpha ribonucleoside-diphosphate reductase subunit beta possible pyridoxine (vitamin B6) biosynthesis protein GMP synthase (glutamine-hydrolyzing) methylene-THF dehydrogenase (NADP(+))/ cyclohydrolase adenylosuccinate synthase adenylosuccinate lyase 5-(carboxyamino)imidazole ribonucleotide mutase 5-(carboxyamino)imidazole ribonucleotide synthase phosphoribosylaminoimidazolesuccinocarboxamide synthase phosphoribosylformylglycinamidine synthase phosphoribosylformylglycinamidine synthase subunit I phosphoribosylformylglycinamidine synthase subunit II amidophosphoribosyltransferase phosphoribosylformylglycinamidine cyclo-ligase phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase phosphoribosylamine--glycine ligase NCS family uracil:cation symporter aspartate carbamoyltransferase dihydroorotase carbamoyl-phosphate synthase (glutamine-hydrolyzing), small subunit carbamoyl-phosphate synthase (glutamine-hydrolyzing), large subunit orotidine-5'-phosphate decarboxylase orotate phosphoribosyltransferase hypothetical protein carbamate kinase APC family amino acid-polyamine-organocation transporter ornithine carbamoyltransferase arginine deiminase acetylglutamate kinase glutamate N-acetyltransferase N-acetyl-gamma-glutamyl-phosphate reductase ornithine--oxo-acid transaminase argininosuccinate lyase argininosuccinate synthase DNA repair protein RecN arginine repressor glutamate ABC transporter, ATP-binding protein amino acid ABC transporter, membrane protein BCCT family betaine/carnitine/choline transporter Crp/FNR family transcriptional regulator PTS family sucrose porter component IIBC fructokinase beta-fructofuranosidase zinc metalloproteinase aureolysin 6-carboxyhexanoate--CoA ligase 8-amino-7-oxononanoate synthase biotin synthase adenosylmethionine--8-amino-7-oxononanoate transaminase dethiobiotin synthase thermonuclease precursor capsular polysaccharide biosynthesis protein Cap5A capsular polysaccharide biosynthesis protein Cap5B capsular polysaccharide biosynthesis protein Cap5C capsular polysaccharide biosynthesis protein Cap5E capsular polysaccharide biosynthesis protein Cap5F capsular polysaccharide biosynthesis protein Cap5H capsular polysaccharide biosynthesis protein Cap5I capsular polysaccharide biosynthesis protein Cap5J capsular polysaccharide synthesis protein Cap5K capsular polysaccharide biosynthesis protein Cap5L capsular polysaccharide biosynthesis protein Cap5M capsular polysaccharide biosynthesis protein Cap5N capsular polysaccharide biosynthesis protein Cap5O capsular polysaccharide biosynthesis protein Cap5P squalene synthase squalene desaturase glycosyltransferase phytoene dehydrogenase hypothetical membrane protein lantibiotic epidermin immunity protein F epidermin ABC transporter, membrane protein epidermin ABC transporter, ATP-binding protein S8A family lantibiotic epidermin serine protease lantibiotic epidermin biosynthesis protein EpiD lantibiotic epidermin biosynthesis protein EpiC lantibiotic epidermin biosynthesis protein EpiB lantibiotic epidermin EpiA (3R)-hydroxymyristoyl-[acyl carrier protein] dehydratase UDP-N-acetylglucosamine 1-carboxyvinyltransferase
USA300HOU_2091 USA300HOU_2314
USA300HOU_2091 hutG
SigB SigB
hypothetical protein formimidoylglutamase
Base mean A-value M-value Fold change Standard error Wald statistic P-value Adjusted P-value 99,85 6,64 -0,18 0,88 0,21 -0,84 0,400267154 0,485399282 24,93 4,64 -1,48 0,36 0,39 -3,79 0,000151861 0,000399191 19,23 4,27 -1,90 0,27 0,45 -4,17 3,01667E-05 8,67456E-05 43,40 5,44 -1,74 0,30 0,32 -5,47 4,57571E-08 1,81187E-07 76,58 6,26 -1,24 0,42 0,24 -5,12 3,08805E-07 1,11329E-06 45,43 5,51 -0,34 0,79 0,36 -0,94 0,346507814 0,431632097 99,93 6,64 -0,71 0,61 0,22 -3,23 0,001238768 0,002794064 60,48 5,92 -0,25 0,84 0,25 -1,00 0,316603369 0,400007205 116,46 6,86 -0,31 0,81 0,19 -1,63 0,102902166 0,154819398 103,08 6,69 -0,12 0,92 0,20 -0,61 0,540636343 0,624281079 439,72 8,78 2,49 5,61 0,14 17,45 3,42191E-68 1,28057E-66 67,96 6,09 -0,81 0,57 0,25 -3,27 0,001058149 0,0024258 271,38 8,08 -0,25 0,84 0,17 -1,52 0,129502254 0,188644456 860,44 9,75 0,71 1,63 0,13 5,55 2,81077E-08 1,14719E-07 72,33 6,18 0,04 1,03 0,24 0,16 0,873206164 0,907355799 97,06 6,60 -0,40 0,76 0,26 -1,54 0,124031745 0,181784219 83,06 6,38 -1,07 0,47 0,24 -4,44 9,11521E-06 2,7838E-05 15,25 3,93 -1,58 0,33 0,51 -3,12 0,001781851 0,003922433 50,65 5,66 -0,24 0,84 0,27 -0,91 0,361510686 0,447592681 830,08 9,70 0,23 1,17 0,12 1,95 0,051558123 0,084876043 247,43 7,95 -0,84 0,56 0,15 -5,51 3,53297E-08 1,42229E-07 694,66 9,44 -1,91 0,27 0,12 -15,57 1,15808E-54 3,57794E-53 1093,35 10,09 1,06 2,08 0,10 10,11 5,07381E-24 5,39245E-23 514,25 9,01 -0,11 0,93 0,13 -0,84 0,399812682 0,485069541 42,04 5,39 -0,58 0,67 0,30 -1,93 0,053667082 0,08780384 48,69 5,61 -0,28 0,82 0,32 -0,89 0,373374003 0,459072062 50,79 5,67 -0,49 0,71 0,31 -1,57 0,116420884 0,1722329 30,06 4,91 -0,77 0,59 0,37 -2,05 0,040097052 0,067858514 707,27 9,47 0,52 1,43 0,20 2,55 0,010722337 0,020487061 54,19 5,76 0,35 1,28 0,27 1,33 0,184273874 0,254875564 2841,65 11,47 0,89 1,86 0,11 8,11 5,03717E-16 3,73848E-15 701,46 9,45 0,60 1,52 0,13 4,58 4,70475E-06 1,47935E-05 401,04 8,65 -0,80 0,57 0,12 -6,53 6,37859E-11 3,22817E-10 331,87 8,37 2,85 7,21 0,14 19,80 3,11819E-87 1,40424E-85 12117,39 13,56 -1,25 0,42 0,10 -13,08 4,38928E-39 8,33023E-38 1193,27 10,22 -0,67 0,63 0,11 -6,23 4,52897E-10 2,16041E-09 878,69 9,78 1,24 2,37 0,12 10,63 2,11104E-26 2,50403E-25 238,30 7,90 0,71 1,64 0,15 4,63 3,67931E-06 1,17358E-05 674,77 9,40 -0,36 0,78 0,11 -3,29 0,001006043 0,002310334 61,81 5,95 -1,34 0,40 0,27 -4,92 8,50159E-07 2,96052E-06 51,96 5,70 -1,64 0,32 0,31 -5,23 1,70079E-07 6,29757E-07 85,47 6,42 -1,18 0,44 0,25 -4,71 2,4951E-06 8,14433E-06 6,85 -0,56 0,68 0,23 -2,47 0,013673353 0,025512711 115,19 235,44 7,88 0,30 1,23 0,15 2,06 0,039603076 0,067193725 134,38 7,07 3,18 9,05 0,23 13,76 4,51218E-43 9,59109E-42 285,74 8,16 2,26 4,80 0,14 15,83 1,99226E-56 6,22757E-55 1246,32 10,28 -0,33 0,79 0,10 -3,38 0,000727533 0,001715222 275,49 8,11 0,13 1,10 0,15 0,88 0,380477531 0,46608059 542,75 9,08 -0,84 0,56 0,14 -6,16 7,27928E-10 3,40511E-09 163,88 7,36 -1,00 0,50 0,17 -5,80 6,59587E-09 2,8221E-08 495,67 8,95 0,10 1,07 0,16 0,61 0,54460457 0,626684427 14,31 3,84 0,79 1,73 0,51 1,54 0,123198539 0,180750148 16688,56 14,03 -0,55 0,69 0,15 -3,73 0,000191298 0,000495658 948,24 9,89 0,24 1,18 0,42 0,58 0,560850323 0,641489155 1048,86 10,03 0,45 1,36 0,10 4,42 9,68547E-06 2,9478E-05 1936,49 10,92 0,48 1,39 0,09 5,23 1,70179E-07 6,29757E-07 2646,32 11,37 0,55 1,47 0,10 5,31 1,08806E-07 4,14181E-07 1267,09 10,31 0,23 1,17 0,10 2,32 0,020368601 0,0366911 1019,11 9,99 -0,37 0,78 0,10 -3,69 0,000221551 0,000568755 672,78 9,39 -0,15 0,90 0,11 -1,33 0,184265456 0,254875564 3109,80 11,60 -0,17 0,89 0,11 -1,62 0,104952139 0,157280222 1282,31 10,32 0,72 1,65 0,11 6,30 2,99948E-10 1,44902E-09 1583,30 10,63 0,28 1,21 0,14 2,02 0,043011699 0,072330433 4330,72 12,08 6,23 74,87 0,14 44,03 0 0 75,57 6,24 -0,15 0,90 0,24 -0,61 0,54173829 0,624847221 131,99 7,04 0,66 1,58 0,18 3,70 0,00021379 0,000550426 0,734859089 411,20 8,68 0,06 1,04 0,14 0,43 0,66870707 278,21 8,12 -0,61 0,66 0,14 -4,41 1,04177E-05 3,15619E-05 317,88 8,31 -0,45 0,73 0,14 -3,30 0,000959698 0,00221347 367,86 8,52 0,90 1,87 0,12 7,27 3,68466E-13 2,25579E-12 470,55 8,88 0,71 1,64 0,12 6,16 7,46292E-10 3,48488E-09 8,07 0,38 1,30 0,14 2,73 0,006354782 0,012666658 269,64 1141,50 10,16 2,84 7,14 0,11 25,30 3,4275E-141 2,2767E-139 394,37 8,62 -0,50 0,71 0,12 -4,00 6,22456E-05 0,000170326 30,99 4,95 -0,09 0,94 0,33 -0,26 0,793792384 0,844994537 457,52 8,84 1,47 2,78 0,13 11,79 4,50421E-32 6,53972E-31 12,43 -1,20 0,43 0,09 -13,94 3,4183E-44 7,63229E-43 5530,54 6260,90 12,61 -1,08 0,47 0,11 -10,25 1,21612E-24 1,34076E-23 257,37 8,01 0,81 1,75 0,16 5,09 3,54909E-07 1,27431E-06 98,67 6,62 -0,39 0,77 0,22 -1,77 0,076436722 0,118976198 10641,83 13,38 -0,32 0,80 0,10 -3,26 0,001116697 0,002546835 9,52 -0,18 0,88 0,13 -1,37 0,170270948 0,238336238 732,31 1364,02 10,41 -0,11 0,93 0,10 -1,15 0,248530537 0,329021244 1,2154E-171 1086,09 10,08 3,02 8,10 0,11 28,08 1,5553E-173 400,55 8,65 -0,61 0,65 0,15 -4,16 3,12082E-05 8,95468E-05 74,52 6,22 -0,34 0,79 0,24 -1,43 0,152971271 0,217816006 7,66 -0,43 0,74 0,15 -2,85 0,004345517 0,008867925 202,28 5941,60 12,54 0,27 1,21 0,08 3,39 0,000696351 0,001649025 2,19529E-09 15711,42 13,94 0,62 1,53 0,10 6,23 4,61035E-10 4757,01 12,22 -0,10 0,93 0,10 -1,02 0,306362839 0,389663027 593,09 9,21 1,62 3,07 0,13 12,73 3,826E-37 6,73224E-36 8,67 1,74 3,34 0,14 12,83 1,09127E-37 1,95913E-36 408,70 0,071770821 1560,08 10,61 0,22 1,16 0,11 2,03 0,042570875 303,72 8,25 0,69 1,61 0,15 4,73 2,20636E-06 7,2374E-06 10,17 -1,03 0,49 0,12 -8,94 3,99886E-19 3,47221E-18 1154,33 434,93 8,76 0,67 1,59 0,14 4,85 1,21169E-06 4,15414E-06 667,38 9,38 0,74 1,68 0,11 6,80 1,02326E-11 5,54858E-11 9,3739E-08 280,90 8,13 0,77 1,71 0,14 5,59 2,28262E-08 241,41 7,92 0,91 1,88 0,14 6,29 3,18551E-10 1,53054E-09 8,36 0,86 1,82 0,13 6,50 8,2972E-11 4,17531E-10 328,86 505,82 8,98 0,75 1,69 0,13 5,63 1,76576E-08 7,29646E-08 284,47 8,15 1,46 2,76 0,15 10,08 6,68609E-24 7,02172E-23 2,56751E-16 164,48 7,36 1,65 3,14 0,20 8,44 3,29515E-17 7,63 1,57 2,98 0,21 7,43 1,05785E-13 6,7081E-13 197,60 213,04 7,73 1,10 2,14 0,15 7,18 6,72678E-13 3,93679E-12 200,93 7,65 1,91 3,77 0,17 11,17 5,89126E-29 7,63564E-28 6,58961E-43 225,32 7,82 2,38 5,22 0,17 13,96 2,90171E-44 293,07 8,20 2,26 4,81 0,15 15,23 2,08505E-52 6,02171E-51 7,80 2,30 4,91 0,17 13,75 5,42395E-43 1,14376E-41 223,37 433,96 8,76 1,61 3,05 0,13 12,34 5,3985E-35 8,79989E-34 95,56 6,58 1,13 2,19 0,21 5,51 3,49339E-08 1,41278E-07 3,78948E-07 95,37 6,58 1,12 2,18 0,21 5,33 9,89801E-08 321,67 8,33 -0,43 0,74 0,15 -2,83 0,004665869 0,009485244 9,22344E-05 131,10 7,03 0,85 1,80 0,20 4,16 3,22144E-05 190,62 7,57 1,01 2,02 0,19 5,29 1,1926E-07 4,50105E-07 225,05 7,81 1,42 2,68 0,18 7,82 5,13643E-15 3,59144E-14 277,83 8,12 1,77 3,41 0,15 11,84 2,3711E-32 3,48066E-31 164,04 7,36 0,37 1,29 0,19 1,96 0,050514381 0,083416227 0,982718724 375,64 8,55 0,00 1,00 0,14 0,03 0,972732497 513,75 9,00 0,10 1,07 0,12 0,78 0,435516973 0,521717131 951,85 9,89 0,61 1,52 0,12 4,88 1,05166E-06 3,62891E-06 2742,68 11,42 4,89 29,73 0,13 38,13 0 0 3000,33 11,55 4,62 24,62 0,13 35,45 2,4914E-275 3,009E-273 1,37848E-10 706,75 9,47 -0,71 0,61 0,11 -6,67 2,60962E-11 288,92 8,17 -0,29 0,82 0,15 -1,93 0,053732075 0,087856075 3153,36 11,62 3,63 12,37 0,11 31,79 8,1452E-222 7,4627E-220 15,33 4202,63 12,04 3,94 0,11 34,52 4,036E-261 4,2895E-259 88,52 6,47 0,28 1,21 0,23 1,19 0,232868196 0,311860281 7,06 133,30 1,10 2,15 0,18 6,17 6,99006E-10 3,27559E-09 233,85 7,87 0,13 1,10 0,19 0,70 0,483784413 0,570788271 -0,57 0,566311661 0,646622296 425,02 8,73 -0,08 0,95 0,14 714,74 9,48 -0,18 0,88 0,11 -1,66 0,096346464 0,14628146 732,60 9,52 -0,84 0,56 0,12 -7,22 5,09707E-13 3,05021E-12 49,92 5,64 -0,21 0,86 0,30 -0,72 0,471784241 0,558614407 78,38 6,29 -0,16 0,90 0,25 -0,61 0,539579489 0,623874109 -0,47 0,72 0,27 -1,74 0,082713977 0,127329686 65,46 6,03 60,82 5,93 -0,55 0,68 0,29 -1,86 0,062752295 0,100744923 28,22 4,82 -1,21 0,43 0,37 -3,24 0,00117813 0,002666347 544,34 9,09 2,39 5,24 0,18 12,97 1,90002E-38 3,50579E-37 37,47 5,23 -0,19 0,88 0,31 -0,61 0,543878689 0,626391711 -0,68 0,497096565 0,58287095 43,09 5,43 -0,21 0,86 0,31 44,93 5,49 -0,37 0,77 0,30 -1,24 0,216058458 0,292742133 58,27 5,86 0,08 1,06 0,32 0,25 0,805638907 0,853501825 72,81 6,19 0,71 1,63 0,28 2,50 0,012454064 0,023468404 40,37 5,34 0,42 1,34 0,33 1,28 0,199769438 0,273742855 59,21 5,89 0,28 1,22 0,27 1,04 0,296375449 0,379137972 76,02 6,25 0,45 1,36 0,23 1,93 0,053093156 0,087025611 76,27 6,25 0,43 1,34 0,24 1,79 0,073784164 0,115728763 133,91 7,07 0,43 1,35 0,18 2,40 0,016401417 0,03003347 127,28 6,99 0,54 1,45 0,18 2,96 0,003063338 0,006459753 144,55 7,18 0,50 1,41 0,17 2,89 0,003807202 0,007878298 1,04 0,297189768 0,379813956 189,90 7,57 0,16 1,12 0,16 384,45 8,59 0,12 1,08 0,13 0,87 0,381608576 0,467250685 141,59 7,15 -0,29 0,82 0,21 -1,40 0,162074148 0,229059048 172,98 7,43 -0,43 0,74 0,17 -2,48 0,013310428 0,024905497 328,29 8,36 0,12 1,09 0,13 0,97 0,331359635 0,415489642 5,91 3,4574E-09 1,5285E-08 679,23 9,41 0,70 1,62 0,12 251,75 7,98 0,78 1,72 0,15 5,16 2,46113E-07 8,95783E-07 378,72 8,56 0,61 1,53 0,16 3,92 8,6744E-05 0,000234465 442,22 8,79 0,72 1,64 0,15 4,90 9,64386E-07 3,34078E-06 673,68 9,40 0,82 1,77 0,13 6,36 1,95327E-10 9,50522E-10 284,04 8,15 0,53 1,45 0,14 3,91 9,22698E-05 0,000249147 30,07 4,91 -0,35 0,79 0,35 -0,98 0,327393943 0,411488035 59,30 5,89 -0,98 0,51 0,27 -3,67 0,00024188 0,000617363 190,70 7,58 -0,54 0,69 0,17 -3,13 0,00173696 0,003833143 102,87 6,68 0,00 1,00 0,28 0,01 0,992956509 0,995099171 2403,25 11,23 0,45 1,36 0,09 4,72 2,34146E-06 7,67109E-06 6482,53 12,66 0,34 1,27 0,08 4,10 4,10445E-05 0,000115525 1760,25 2626,68
10,78 11,36
0,44 0,36
1,36 1,28
0,09 0,11
4,94 3,18
7,8101E-07 0,001468553
2,73405E-06 0,003281704
Locus USA300HOU 0583 USA300HOU 0584 USA300HOU_0585 USA300HOU 0563 USA300HOU_0564 USA300HOU_0565 USA300HOU 2699 USA300HOU 2441 USA300HOU_1202 USA300HOU 1203 USA300HOU_1204 USA300HOU_2059 USA300HOU 2060 USA300HOU_2061 USA300HOU_2062 USA300HOU 0114 USA300HOU 0115 USA300HOU_0117 USA300HOU 0120 USA300HOU_0182 USA300HOU_0183 USA300HOU 0283 USA300HOU 0328 USA300HOU_0329 USA300HOU 0349 USA300HOU_0395 USA300HOU_0397 USA300HOU 0408 USA300HOU_0409 USA300HOU_0410 USA300HOU 0544 USA300HOU_0577 USA300HOU_0621 USA300HOU 0699 USA300HOU_0700 USA300HOU_0701 USA300HOU 0702 USA300HOU 0703 USA300HOU_0704 USA300HOU 0705 USA300HOU_0726 USA300HOU_0727 USA300HOU 0733 USA300HOU_0734 USA300HOU_0735 USA300HOU 0749 USA300HOU_0794 USA300HOU_0795 USA300HOU 0796 USA300HOU 0798 USA300HOU_0799 USA300HOU 0816 USA300HOU 0817 USA300HOU_0818 USA300HOU 0825 USA300HOU_0826 USA300HOU_0830 USA300HOU 0835 USA300HOU_0845 USA300HOU_0846 USA300HOU 0868 USA300HOU_0878 USA300HOU_0879 USA300HOU 0986 USA300HOU 1023 USA300HOU_1024 USA300HOU 1108 USA300HOU_1624 USA300HOU_1625 USA300HOU 1668 USA300HOU_1728 USA300HOU_1729 USA300HOU 1743 USA300HOU_1744 USA300HOU_1745 USA300HOU 1761 USA300HOU 1848 USA300HOU_1849 USA300HOU 1870 USA300HOU 1877 USA300HOU_1878 USA300HOU 1879 USA300HOU_1927 USA300HOU_2019 USA300HOU 2020 USA300HOU_2080 USA300HOU_2081 USA300HOU 2082 USA300HOU_2110 USA300HOU_2129 USA300HOU 2133 USA300HOU 2170 USA300HOU_2171 USA300HOU 2172 USA300HOU_2175 USA300HOU_2176 USA300HOU 2177 USA300HOU_2178 USA300HOU_2200 USA300HOU 2290 USA300HOU_2291 USA300HOU_2293 USA300HOU 2308 USA300HOU_2351 USA300HOU_2415 USA300HOU 2416 USA300HOU 2443 USA300HOU_2444 USA300HOU 2462 USA300HOU_2465 USA300HOU_2497 USA300HOU 2542 USA300HOU 2572 USA300HOU_2573 USA300HOU 2574 USA300HOU_2575 USA300HOU_2582 USA300HOU 2598 USA300HOU_2603 USA300HOU_2604 USA300HOU 2609 USA300HOU_2647 USA300HOU_2648 USA300HOU 2649 USA300HOU_2650 USA300HOU_2651 USA300HOU 2652 USA300HOU 2658 USA300HOU_2659 USA300HOU 2689 USA300HOU_2695 USA300HOU_2698 USA300HOU 2702 USA300HOU_0622 USA300HOU_0123 USA300HOU 2646 USA300HOU 2630 USA300HOU_2326 USA300HOU 2383 USA300HOU_0113 USA300HOU_1701 USA300HOU 1702 USA300HOU 1703 USA300HOU_1854 USA300HOU 0555 USA300HOU_0556 USA300HOU_0122 USA300HOU 2032 USA300HOU_2033 USA300HOU_2034 USA300HOU 2035 USA300HOU_2031 USA300HOU_2197 USA300HOU 2665 USA300HOU_0108 USA300HOU_1136 USA300HOU 0280 USA300HOU 0281 USA300HOU_0282 USA300HOU 0190 USA300HOU_0340 USA300HOU_0415 USA300HOU 0435 USA300HOU_0436 USA300HOU_0447 USA300HOU 0448 USA300HOU 0449 USA300HOU_0450 USA300HOU 0642 USA300HOU_0643 USA300HOU_0644
Gene symbol mvaK1 mvaD mvaK2 nagB hxlA hxlB nixA pnbA rbfA truB ribC sigB rsbW rsbV rsbU USA300HOU 0114 norC USA300HOU_0117 USA300HOU 0120 USA300HOU_0182 USA300HOU_0183 rbsR USA300HOU 0328 USA300HOU_0329 USA300HOU 0349 USA300HOU 0395 USA300HOU_0397 USA300HOU 0408 USA300HOU_0409 USA300HOU_0410 USA300HOU 0544 USA300HOU_0577 USA300HOU_0621 USA300HOU 0699 USA300HOU_0700 USA300HOU_0701 USA300HOU 0702 USA300HOU 0703 USA300HOU_0704 USA300HOU 0705 USA300HOU 0726 csbB queE queD queC bmrU USA300HOU_0794 USA300HOU_0795 whiA USA300HOU 0798 USA300HOU_0799 USA300HOU 0816 USA300HOU 0817 USA300HOU_0818 USA300HOU 0825 USA300HOU_0826 USA300HOU_0830 ohr USA300HOU_0845 trxA_3 USA300HOU 0868 USA300HOU_0878 USA300HOU_0879 USA300HOU 0986 USA300HOU 1023 USA300HOU_1024 arcD1 USA300HOU 1624 USA300HOU_1625 lysP USA300HOU_1728 USA300HOU_1729 USA300HOU 1743 USA300HOU_1744 USA300HOU_1745 USA300HOU 1761 USA300HOU 1848 USA300HOU_1849 USA300HOU 1870 ptpA USA300HOU_1878 USA300HOU 1879 USA300HOU_1927 USA300HOU_2019 USA300HOU 2020 USA300HOU_2080 USA300HOU_2081 USA300HOU 2082 aldA USA300HOU_2129 USA300HOU 2133 USA300HOU 2170 USA300HOU_2171 USA300HOU 2172 asp23 USA300HOU_2176 amaP opuD2 USA300HOU_2200 USA300HOU 2290 fdhA USA300HOU_2293 USA300HOU 2308 USA300HOU 2351 USA300HOU_2415 USA300HOU 2416 USA300HOU 2443 USA300HOU_2444 USA300HOU 2462 USA300HOU_2465 USA300HOU_2497 clpL USA300HOU 2572 USA300HOU_2573 USA300HOU 2574 USA300HOU_2575 USA300HOU_2582 USA300HOU 2598 USA300HOU_2603 USA300HOU_2604 USA300HOU 2609 gtfB gtfA secA2 asp3 asp2 asp1 USA300HOU 2658 USA300HOU_2659 yceI USA300HOU_2695 USA300HOU_2698 USA300HOU 2702 sarA sarS sasF clfB gltS nirR USA300HOU_0113 USA300HOU_1701 thiI nifZ USA300HOU_1854 sdrC sdrD spa agrB agrD agrC agrA hld hysA icaR plc pyrR rbsK rbsD rbsU fdh geh USA300HOU_0415 ssl11 USA300HOU_0436 USA300HOU_0447 USA300HOU 0448 USA300HOU 0449 USA300HOU_0450 USA300HOU 0642 mnhA mnhB
Regulon SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB TcaR TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP TraP
Function mevalonate kinase diphosphomevalonate decarboxylase phosphomevalonate kinase glucosamine-6-phosphate deaminase possible 3-hexulose-6-phosphate synthase glucose-6-phosphate isomerase NiCoT family nickel (Ni2+)-cobalt (Co2+) transporter carboxylesterase ribosome-binding factor A pseudouridylate synthase bifunctional riboflavin kinase/FAD synthase RibC DNA-directed RNA polymerase sigma subunit FliA anti-sigma B factor anti-sigma B factor antagonist sigma factor B regulator M20 family peptidase possible MFS family major facilitator transporter myosin-cross-reactive antigen hypothetical membrane protein CDF family cation diffusion facilitator hypothetical protein ribose operon repressor ABC transporter, membrane protein ABC transporter, binding protein possible dehydrogenase hypothetical protein hypothetical membrane protein hypothetical protein hypothetical protein hypothetical protein possible hydrolase APC family amino acid-polyamine-organocation transporter hydrolase possible GNAT family acetyltransferase possible lipoprotein hypothetical protein possible GNAT family acetyltransferase hypothetical protein hypothetical protein hypothetical protein dehydrogenase possible glycosyltransferase organic radical-activating protein possible 6-pyruvoyltetrahydropterin synthase ExsB family post-transcriptional regulator possible diacylglycerol kinase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein acetyltransferase hypothetical protein hypothetical protein hypothetical protein OsmC/Ohr family protein TOPRIM domain topiosmerase/primase possible thioredoxin hypothetical protein CBS domain protein dioxygenase hypothetical protein hypothetical protein hypothetical protein arginine/ornithine APC family amino acid-polyamine-organocation antiporter hypothetical protein hypothetical protein APC family amino acid-polyamine-organocation transporter hypothetical protein possible general stress protein hypothetical protein pseudouridylate synthase polysaccharide biosynthesis protein hypothetical protein hypothetical protein glucosamine-6-phosphate isomerase C56 family endopeptidase PfpI protein-tyrosine-phosphatase hypothetical protein possible ribonuclease BN hypothetical protein GNAT family acetyltransferase hypothetical membrane protein hypothetical protein hypothetical protein hypothetical protein aldehyde dehydrogenase hypothetical protein hypothetical protein hypothetical protein possible Iuc family aerobactin synthesis protein MFS family major facilitator transporter alkaline shock protein 23 hypothetical membrane protein hypothetical protein BCCT family betaine/carnitine/choline transporter hypothetical protein hypothetical protein formate dehydrogenase alpha subunit inositol-phosphate phosphatase dehydrogenase hypothetical lipoprotein hypothetical protein hypothetical membrane protein ABC transporter, membrane protein ABC transporter, ATP-binding protein hypothetical protein alkylhydroperoxidase hypothetical protein S14 family endopeptidase Clp TetR family transcriptional regulator dehydrogenase hypothetical protein hydrolase hypothetical protein hypothetical membrane protein hypothetical protein hypothetical protein possible metallo-beta-lactamase hypothetical protein glycosyl transferase, group 1 family protein Sec family Type I general secretory pathway protein SecA2 accessory secretory protein Asp3 accessory secretory protein Asp2 accessory secretory protein Asp1 hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical membrane protein staphylococcal accessory regulator A staphylococcal accessory regulator S LPXTG family cell wall surface anchor protein clumping factor B ESS family glutamate:sodium (Na+) symporter transcriptional regulator NirR bifunctional AraC family transcriptional regulator/xylan 1,4-beta-xylosidase hypothetical protein thiamine biosynthesis protein cysteine desulfurase hypothetical protein Ser-Asp rich fibrinogen/bone sialoprotein-binding protein SdrC Ser-Asp rich fibrinogen/bone sialoprotein-binding protein SdrD immunoglobulin G binding protein A accessory gene regulator protein B accessory gene regulator protein D accessory gene regulator protein C accessory gene regulator protein A delta-hemolysin hyaluronate lyase Ica operon transcriptional regulator R phosphatidylinositol diacylglycerol-lyase possible uracil phosphoribosyltransferase ribokinase ribose ABC transporter, membrane protein DMT superfamily drug/metabolite transporter formate dehydrogenase triacylglycerol lipase hypothetical protein superantigen-like protein hypothetical protein hypothetical lipoprotein hypothetical protein hypothetical protein hypothetical protein possible bacteriophage integrase CPA3 family monovalent cation (K+ or Na+):proton (H+) antiporter-3, MnhA subunit CPA3 family monovalent cation (K+ or Na+):proton (H+) antiporter-3, MnhB subunit
Base mean A-value M-value Fold change Standard error Wald statistic P-value Adjusted P-value 177,35 7,47 0,22 1,16 0,16 1,33 0,183769735 0,254575697 354,16 8,47 0,50 1,41 0,13 3,75 0,000176131 0,000458354 371,66 8,54 0,67 1,59 0,13 5,25 1,51789E-07 5,66437E-07 563,65 9,14 0,40 1,32 0,12 3,32 0,000884374 0,002052212 2860,28 11,48 0,77 1,71 0,10 7,57 3,5977E-14 2,32017E-13 2784,84 11,44 1,06 2,09 0,10 11,06 1,86302E-28 2,35717E-27 422,75 8,72 0,23 1,18 0,13 1,79 0,074162476 0,116184965 3242,08 11,66 0,89 1,85 0,09 10,02 1,22318E-23 1,26953E-22 238,63 7,90 1,36 2,56 0,18 7,50 6,62439E-14 4,23101E-13 457,55 8,84 0,47 1,39 0,11 4,12 3,7818E-05 0,000106783 688,16 9,43 0,77 1,71 0,12 6,64 3,10874E-11 1,6324E-10 5622,50 12,46 0,10 1,07 0,08 1,19 0,233491109 0,312536966 3538,73 11,79 0,01 1,01 0,09 0,12 0,90381763 0,932237361 3327,93 11,70 0,23 1,17 0,11 2,05 0,040828612 0,068964795 2175,08 11,09 -0,65 0,64 0,13 -5,20 1,99368E-07 7,3267E-07 328,44 8,36 0,84 1,79 0,15 5,72 1,09614E-08 4,6083E-08 346,57 8,44 0,84 1,79 0,14 5,88 4,09488E-09 1,77489E-08 190,82 7,58 1,19 2,28 0,17 7,18 6,87115E-13 4,01245E-12 290,23 8,18 0,34 1,26 0,13 2,53 0,011397261 0,02167227 268,30 8,07 0,63 1,55 0,14 4,46 8,26209E-06 2,53785E-05 159,57 7,32 1,50 2,82 0,20 7,32 2,43888E-13 1,51759E-12 240,86 7,91 -0,01 0,99 0,16 -0,07 0,943511204 0,960501635 1907,88 10,90 1,08 2,11 0,10 10,56 4,40805E-26 5,18239E-25 1579,11 10,62 1,11 2,16 0,10 11,00 3,7567E-28 4,73059E-27 1577,13 10,62 1,44 2,72 0,09 15,35 3,8217E-53 1,14093E-51 60902,91 15,89 0,51 1,42 0,09 5,89 3,78332E-09 1,65879E-08 17186,33 14,07 0,78 1,71 0,28 2,82 0,004822801 0,009744625 1872,01 10,87 0,34 1,27 0,12 2,86 0,00428035 0,008748376 2714,20 11,41 0,12 1,09 0,10 1,25 0,211342931 0,287231799 3259,76 11,67 0,75 1,68 0,12 6,01 1,88654E-09 8,48147E-09 4000,77 11,97 1,58 2,99 0,09 16,97 1,42792E-64 4,92724E-63 3094,31 11,60 1,66 3,15 0,11 14,47 1,8632E-47 4,6703E-46 10194,98 13,32 1,55 2,94 0,09 16,92 3,48176E-64 1,18603E-62 60,96 5,93 0,04 1,03 0,26 0,15 0,880159175 0,913152256 347,80 8,44 -0,15 0,90 0,16 -0,98 0,32873538 0,412927134 1660,99 10,70 0,55 1,47 0,10 5,48 4,19216E-08 1,66745E-07 409,63 8,68 0,20 1,15 0,12 1,63 0,103942496 0,155943089 1426,80 10,48 1,09 2,12 0,09 11,71 1,07695E-31 1,514E-30 2063,03 11,01 1,17 2,24 0,15 7,54 4,7201E-14 3,0293E-13 7389,74 12,85 1,00 2,00 0,09 10,96 5,86719E-28 7,28464E-27 814,15 9,67 1,51 2,85 0,10 14,83 9,64704E-50 2,56322E-48 2743,97 11,42 1,28 2,42 0,11 11,28 1,61567E-29 2,12516E-28 383,16 8,58 1,21 2,31 0,14 8,80 1,35305E-18 1,14129E-17 233,46 7,87 1,07 2,11 0,15 7,24 4,51697E-13 2,72145E-12 169,42 7,40 0,73 1,66 0,17 4,35 1,33797E-05 3,98541E-05 5453,87 12,41 0,36 1,28 0,09 4,04 5,31456E-05 0,000146633 1429,01 10,48 0,27 1,20 0,10 2,76 0,005821339 0,011655839 3045,22 11,57 0,87 1,82 0,09 9,50 2,09185E-21 1,97093E-20 1774,98 10,79 0,95 1,93 0,10 9,17 4,56149E-20 4,06707E-19 3876,90 11,92 0,58 1,49 0,09 6,07 1,3113E-09 6,02791E-09 4753,88 12,21 0,57 1,49 0,14 4,04 5,44319E-05 0,000150027 101,55 6,67 0,21 1,15 0,22 0,96 0,336264754 0,420449624 413,30 8,69 0,48 1,39 0,15 3,25 0,001168682 0,002647218 486,08 8,93 0,68 1,60 0,15 4,66 3,08635E-06 9,96407E-06 1047,95 10,03 1,28 2,43 0,10 12,25 1,58449E-34 2,53614E-33 1032,65 10,01 1,08 2,12 0,10 10,70 1,06208E-26 1,27114E-25 5201,78 12,34 1,03 2,05 0,10 10,55 5,30725E-26 6,18481E-25 3853,65 11,91 0,77 1,71 0,13 6,17 6,93462E-10 3,25535E-09 646,36 9,34 0,62 1,54 0,13 4,66 3,15812E-06 1,01711E-05 693,26 9,44 0,78 1,72 0,12 6,39 1,65813E-10 8,09863E-10 44550,64 15,44 -0,71 0,61 0,10 -7,10 1,23023E-12 7,09049E-12 1690,86 10,72 0,57 1,48 0,10 5,90 3,52906E-09 1,55501E-08 929,51 9,86 0,17 1,12 0,11 1,56 0,119564628 0,176392681 1353,92 10,40 0,80 1,74 0,12 6,86 6,8467E-12 3,78205E-11 733,19 9,52 -0,88 0,54 0,11 -8,23 1,79781E-16 1,36091E-15 1823,93 10,83 0,45 1,37 0,12 3,73 0,000191398 0,000495658 166,75 7,38 0,86 1,82 0,18 4,79 1,70896E-06 5,72597E-06 12944,21 13,66 0,37 1,29 0,11 3,37 0,000755289 0,001771228 4,68 0,44 1,36 0,09 2,89496E-06 9,38038E-06 12950,12 13,66 6707,84 12,71 0,15 1,11 0,08 1,76 0,077978236 0,120879914 0,65 1,57 0,08 7,78 7,0776E-15 4,89718E-14 10159,05 13,31 13077,28 13,67 0,62 1,53 0,15 4,06 4,92873E-05 0,000136698 4498,70 12,14 0,93 1,91 0,08 11,86 1,91859E-32 2,83205E-31 10,70 0,06 1,04 0,09 0,59 0,554155963 0,635901979 1660,84 1454,06 10,51 -0,34 0,79 0,11 -3,00 0,002674883 0,005708566 1,45655E-05 272,17 8,09 -0,64 0,64 0,14 -4,58 4,62674E-06 4716,82 12,20 0,51 1,43 0,12 4,44 8,82118E-06 2,70022E-05 8405,49 13,04 0,44 1,36 0,10 4,31 1,63056E-05 4,82449E-05 13,84 0,91 1,87 0,12 7,85 4,18938E-15 2,94476E-14 14671,37 8838,35 13,11 0,69 1,61 0,08 8,51 1,71797E-17 1,3545E-16 1,2257E-14 7179,30 12,81 0,88 1,84 0,11 7,96 1,71145E-15 3800,30 11,89 0,56 1,48 0,11 5,30 1,18703E-07 4,48641E-07 3421,22 11,74 0,78 1,71 0,13 5,82 5,74532E-09 2,47012E-08 8,45 0,13 1,10 0,13 1,06 0,29036459 0,373245629 350,01 125,79 6,97 0,04 1,03 0,20 0,19 0,849674939 0,888242949 12,22 1,11 2,16 0,11 9,79 1,30118E-22 1,29971E-21 4785,40 328,57 8,36 0,16 1,12 0,15 1,09 0,276455781 0,358838794 315,15 8,30 0,25 1,19 0,13 1,85 0,064853558 0,103555231 13,45 1,23 2,35 0,11 11,63 2,94067E-31 4,0275E-30 11156,07 698,48 9,45 1,24 2,36 0,11 11,45 2,37744E-30 3,20653E-29 10,63 0,99 1,99 0,10 10,30 7,32842E-25 8,11317E-24 1589,56 290,52 8,18 -0,26 0,84 0,15 -1,72 0,08473953 0,129920906 774,79 9,60 0,24 1,18 0,10 2,26 0,02365858 0,042103715 0,35517237 173,25 7,44 -0,18 0,88 0,16 -1,10 0,272829058 79303,01 16,28 0,80 1,74 0,11 7,23 4,721E-13 2,83794E-12 15,33 0,82 1,77 0,13 6,39 1,65541E-10 8,09863E-10 41111,33 50099,15 15,61 0,86 1,81 0,11 7,66 1,9128E-14 1,27376E-13 4594,73 12,17 1,48 2,79 0,10 14,56 4,91608E-48 1,29327E-46 2,11981E-17 3373,74 11,72 0,83 1,78 0,09 8,73 2,56101E-18 1077,35 10,07 0,19 1,14 0,10 1,95 0,051657727 0,08497599 12,66 0,01 1,01 0,09 0,12 0,906828619 0,934617394 6475,84 348,30 8,44 0,13 1,10 0,13 0,99 0,32156904 0,404933147 6204,52 12,60 0,89 1,85 0,11 7,81 5,72474E-15 3,97145E-14 7524,18 12,88 0,19 1,14 0,09 2,02 0,043530942 0,073003269 1086,15 10,09 -0,03 0,98 0,11 -0,29 0,773185629 0,826958745 8,53 1,23 2,34 0,13 9,66 4,57072E-22 4,4485E-21 369,52 713,38 9,48 -0,45 0,73 0,14 -3,16 0,001595277 0,003544022 699,01 9,45 0,11 1,08 0,12 0,99 0,324490119 0,408224548 215,28 7,75 1,20 2,30 0,19 6,38 1,77299E-10 8,64371E-10 6492,25 12,66 1,46 2,75 0,12 11,70 1,2259E-31 1,71433E-30 14,33 0,10 1,07 0,11 0,89 0,373221618 0,459072062 20576,41 7517,13 12,88 2,54 5,80 0,10 26,40 1,4428E-153 1,0649E-151 51,36 5,68 -0,42 0,75 0,29 -1,44 0,149634579 0,213709556 64,59 6,01 -0,19 0,87 0,26 -0,76 0,450179933 0,536139884 1260,01 10,30 0,70 1,63 0,11 6,61 3,78492E-11 1,97574E-10 12,40 0,88 1,84 0,10 8,67 4,30536E-18 3,509E-17 5394,62 721,83 9,50 0,94 1,92 0,12 7,98 1,47063E-15 1,06761E-14 908,53 9,83 1,11 2,16 0,14 7,93 2,1206E-15 1,51057E-14 831,28 9,70 1,38 2,61 0,11 12,87 6,60417E-38 1,19369E-36 703,45 9,46 1,03 2,04 0,14 7,15 8,6463E-13 5,01598E-12 10,28 0,79 1,73 0,10 7,64 2,19932E-14 1,45363E-13 1245,26 689,24 9,43 -0,40 0,76 0,10 -3,84 0,000125142 0,000333502 812,37 9,67 -0,29 0,82 0,10 -2,80 0,005180843 0,010444234 1020,09 9,99 0,25 1,19 0,10 2,42 0,015329604 0,028344298 54,74 5,77 -0,28 0,82 0,33 -0,85 0,39402788 0,480023877 6,59 -0,19 0,87 0,24 -0,81 0,420598196 0,505669415 96,22 100,37 6,65 0,19 1,14 0,22 0,87 0,382243739 0,467812812 1612,31 10,65 0,34 1,27 0,15 2,29 0,02215476 0,039613187 0,47 1,39 0,11 4,42 9,90604E-06 3,01148E-05 1086,65 10,09 15920,21 13,96 2,20 4,59 0,10 21,18 1,6138E-99 8,57559E-98 983,10 9,94 0,66 1,58 0,11 5,89 3,93217E-09 1,71556E-08 394,08 8,62 0,51 1,43 0,15 3,43 0,000608192 0,001455826 545,68 9,09 0,38 1,30 0,12 3,15 0,001652349 0,003661627 15047,71 13,88 0,63 1,55 0,11 5,86 4,71269E-09 2,03603E-08 5280,60 12,37 -0,03 0,98 0,12 -0,26 0,797158616 0,847898496 8101,22 12,98 1,11 2,15 0,08 13,70 1,04507E-42 2,16934E-41 27636,73 14,75 1,10 2,14 0,11 10,15 3,20314E-24 3,47271E-23 236,99 7,89 -0,11 0,92 0,17 -0,67 0,503669462 0,589964063 29,37 4,88 -0,39 0,76 0,35 -1,11 0,267132299 0,348953057 690,12 9,43 -0,25 0,84 0,11 -2,25 0,024547186 0,043539302 218,33 7,77 -0,20 0,87 0,17 -1,16 0,245128677 0,325490701 619,77 9,28 -0,40 0,76 0,12 -3,37 0,000759164 0,001778746 627,62 9,29 -0,69 0,62 0,11 -6,13 9,06001E-10 4,2001E-09 2,88 0,004007652 0,008267337 1806,73 10,82 0,29 1,22 0,10 1062,64 10,05 -0,25 0,84 0,10 -2,61 0,009068111 0,017522888 10805,92 13,40 0,03 1,02 0,08 0,31 0,758717539 0,815073981 75828,12 16,21 -1,27 0,41 0,10 -13,32 1,72352E-40 3,39214E-39 1584,95 10,63 -0,08 0,95 0,10 -0,77 0,442186641 0,528753333 0,12 0,907272215 0,934712011 712,28 9,48 0,01 1,01 0,11 1798,79 10,81 0,26 1,20 0,13 2,00 0,04508811 0,075156279 1144,23 10,16 0,26 1,20 0,13 2,03 0,042842828 0,072137765 1363,12 10,41 -0,47 0,72 0,16 -2,98 0,002841925 0,006035966 201,52 7,65 -0,45 0,73 0,16 -2,86 0,00422812 0,008661615 8,31 -0,11 0,93 0,16 -0,68 0,497416812 0,582989179 317,97 115,04 6,85 -0,54 0,69 0,20 -2,72 0,006591293 0,013108582 349,00 8,45 0,25 1,19 0,14 1,78 0,075725837 0,118215951 156,42 7,29 -0,31 0,80 0,18 -1,77 0,077553581 0,120432417 93,96 6,55 -0,43 0,74 0,21 -2,02 0,043321867 0,072805946 107,99 6,75 -0,32 0,80 0,20 -1,57 0,115755881 0,171440008 301,79 8,24 -0,52 0,70 0,15 -3,49 0,000484042 0,00117452 5856,58 12,52 2,27 4,81 0,10 22,45 1,388E-111 8,1955E-110 1087,15 10,09 0,15 1,11 0,11 1,43 0,15142829 0,215850304 40,62 5,34 -0,12 0,92 0,31 -0,39 0,694568614 0,757581612 247,98 7,95 -0,30 0,81 0,14 -2,09 0,036562833 0,062595005 313,21 8,29 0,26 1,20 0,17 1,53 0,126612229 0,184738436 473,06 8,89 -0,08 0,95 0,16 -0,47 0,635722603 0,707038492 172,76 7,43 -0,61 0,66 0,18 -3,36 0,000766605 0,001794599 128,41 7,00 -0,73 0,60 0,19 -3,83 0,000127326 0,000338643 619,89 9,28 0,72 1,65 0,11 6,55 5,7448E-11 2,91854E-10 1076,40 10,07 0,72 1,64 0,11 6,59 4,33035E-11 2,22979E-10 184,59 7,53 0,47 1,38 0,18 2,65 0,008169026 0,015912831
Locus USA300HOU 0645 USA300HOU 0646 USA300HOU_0647 USA300HOU 0648 USA300HOU_0649 USA300HOU_1112 USA300HOU 1113 USA300HOU 2615 USA300HOU_0474 USA300HOU 0475 USA300HOU_2112 USA300HOU_0567 USA300HOU 0568 USA300HOU_0569 USA300HOU_0570 USA300HOU 0571 USA300HOU 1650 USA300HOU_1831 USA300HOU 1832 USA300HOU_1833 USA300HOU_1869 USA300HOU 2418 USA300HOU 2419 USA300HOU_2551 USA300HOU 1880 USA300HOU_1881 USA300HOU_1882 USA300HOU 1883 USA300HOU_1933 USA300HOU_1934 USA300HOU 1935 USA300HOU_1936 USA300HOU_1937 USA300HOU 1946 USA300HOU_2403 USA300HOU_1945 USA300HOU 1105 USA300HOU 1104 USA300HOU_1103 USA300HOU 1091 USA300HOU_1431 USA300HOU_0430 USA300HOU 2397 USA300HOU_1947 USA300HOU_0423 USA300HOU 1430 USA300HOU_2490 USA300HOU_2672 USA300HOU 0138 USA300HOU 1770 USA300HOU_0219 USA300HOU 2673 USA300HOU 2165 USA300HOU_0424 USA300HOU 2029 USA300HOU_0089 USA300HOU_0915 USA300HOU 1389 USA300HOU_2537 USA300HOU_0200 USA300HOU 2262 USA300HOU_0537 USA300HOU_2538 USA300HOU 2599 USA300HOU 1390 USA300HOU_0394 USA300HOU 1649 USA300HOU_0325 USA300HOU_1950 USA300HOU 0838 USA300HOU_2525 USA300HOU_1278 USA300HOU 0678 USA300HOU_1499 USA300HOU_0217 USA300HOU 1498 USA300HOU 1391 USA300HOU_0007 USA300HOU 0405 USA300HOU 0181 USA300HOU_0513 USA300HOU 2158 USA300HOU_2087 USA300HOU_0429 USA300HOU 2283 USA300HOU_2180 USA300HOU_1944 USA300HOU_1851 USA300HOU 1777 USA300HOU_2232 USA300HOU_2233 USA300HOU 2552 USA300HOU_1893 USA300HOU_2181 USA300HOU 1573 USA300HOU 2674 USA300HOU_0369 USA300HOU 1131 USA300HOU 0589 USA300HOU_0247 USA300HOU 2231 USA300HOU_0732 USA300HOU_2014 USA300HOU 1168 USA300HOU_0904 USA300HOU_1423 USA300HOU 1666 USA300HOU_1598 USA300HOU_1710 USA300HOU 0657 USA300HOU_0102 USA300HOU_0557 USA300HOU 1422 USA300HOU_1889 USA300HOU_0075 USA300HOU 2712 USA300HOU 2108 USA300HOU_1574 USA300HOU 0928 USA300HOU_1361 USA300HOU_1575 USA300HOU 0902 USA300HOU_1360 USA300HOU_2282 USA300HOU 2430 USA300HOU_1749 USA300HOU_0903 USA300HOU 1114 USA300HOU_1327 USA300HOU_1308 USA300HOU 1093 USA300HOU 2472 USA300HOU_1733 USA300HOU 1599 USA300HOU_1555 USA300HOU_1748 USA300HOU 1082 USA300HOU_1034 USA300HOU_1201 USA300HOU 1686 USA300HOU_0536 USA300HOU_2149 USA300HOU 2602 USA300HOU 2230 USA300HOU_1127 USA300HOU 2229 USA300HOU_0650 USA300HOU_2553 USA300HOU 0988 USA300HOU_1205 USA300HOU_1489 USA300HOU 1645 USA300HOU_2471 USA300HOU_1850 USA300HOU 1732 USA300HOU_2226 USA300HOU_0956 USA300HOU 1022 USA300HOU 0560 USA300HOU_1513 USA300HOU 0495 USA300HOU_1190 USA300HOU_1512 USA300HOU 1693 USA300HOU_1687 USA300HOU_0542 USA300HOU 1307 USA300HOU 0939 USA300HOU_1775 USA300HOU_2280
Gene symbol mnhC mnhD mnhE mnhF mnhG psmß1 psmß2 citM treP treC murZ proP vraA vraB vraC USA300HOU 0571 USA300HOU 1650 USA300HOU_1831 USA300HOU 1832 prsA USA300HOU_1869 USA300HOU 2418 USA300HOU 2419 USA300HOU_2551 vraR vraS vraT vraU pmtD pmtC pmtB pmtA ytrA scn USA300HOU_2403 USA300HOU_1945 ssl14 ssl13 ssl12 USA300HOU 1091 lukS-PV ssl8 USA300HOU 2397 chp ssl2 lukF-PV fnbB USA300HOU_2672 butA tal USA300HOU_0219 hisI USA300HOU 2165 ssl3 USA300HOU 2029 USA300HOU_0089 USA300HOU_0915 USA300HOU 1389 USA300HOU_2537 USA300HOU_0200 fdhD rpoC USA300HOU_2538 fdaB nth USA300HOU_0394 USA300HOU 1649 brnQ2 USA300HOU_1950 USA300HOU 0838 USA300HOU_2525 rpmG2 USA300HOU 0678 fur USA300HOU_0217 xerD dnaD nnrD nfrA aldA USA300HOU_0513 lmrS yidC ssl7 USA300HOU 2283 USA300HOU_2180 USA300HOU_1944 queG metK rpsQ rpmC copA USA300HOU_1893 USA300HOU_2181 USA300HOU 1573 hisF USA300HOU_0369 USA300HOU 1131 USA300HOU 0589 USA300HOU_0247 rplN USA300HOU_0732 USA300HOU_2014 USA300HOU 1168 USA300HOU_0904 ribU clpX USA300HOU 1598 USA300HOU_1710 tagH USA300HOU_0102 sdrE fer gatD USA300HOU_0075 noc rpmE2 USA300HOU_1574 USA300HOU 0928 msrA1 USA300HOU_1575 ndh2 msrB nhaC USA300HOU 2430 leuS USA300HOU_0903 USA300HOU 1114 USA300HOU_1327 trpA USA300HOU 1093 USA300HOU_2472 USA300HOU_1733 USA300HOU 1599 sodA USA300HOU_1748 uvrC def infB accA rpoB mtlD USA300HOU 2602 rplX USA300HOU_1127 rplE USA300HOU_0650 copZ USA300HOU 0988 rpsO USA300HOU_1489 USA300HOU 1645 USA300HOU_2471 cspR USA300HOU 1732 rplF trfA USA300HOU 1022 folE2 USA300HOU_1513 rplY tsf gnd USA300HOU 1693 accD USA300HOU_0542 trpB USA300HOU_0939 USA300HOU_1775 ssaA
Regulon TraP TraP TraP TraP TraP TraP TraP TraP TreR TreR VraSR VraSR VraSR VraSR VraSR VraSR VraSR VraSR VraSR VraSR VraSR VraSR VraSR VraSR VraSR VraSR VraSR VraSR YtrA YtrA YtrA YtrA YtrA -
Function CPA3 family monovalent cation (K+ or Na+):proton (H+) antiporter-3, MnhC subunit CPA3 family monovalent cation (K+ or Na+):proton (H+) antiporter-3, MnhD subunit CPA3 family monovalent cation (K+ or Na+):proton (H+) antiporter-3, MnhE subunit CPA3 family monovalent cation (K+ or Na+):proton (H+) antiporter-3, MnhF subunit CPA3 family monovalent cation (K+ or Na+):proton (H+) antiporter-3, MnhG subunit antibacterial protein antibacterial protein CitMHS citrate-magnesium :proton/ citrate-calcium:proton symporter PTS family trehalose (tre) porter component IIBC alpha, alpha-phosphotrehalase UDP-N-acetylglucosamine 1-carboxyvinyltransferase MFS family major facilitator transporter, proline/betaine:cation symporter long-chain-fatty-acid--CoA ligase acetyl-CoA C-acetyltransferase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical membrane protein peptidylprolyl isomerase transglycosylase glycerate kinase hypothetical protein hypothetical protein response regulator VraR sensor histidine kinase VraS hypothetical membrane protein hypothetical protein hypothetical membrane protein ABC transporter, ATP-binding protein hypothetical membrane protein ABC transporter, ATP-binding protein GntR family transcriptional regulator hypothetical protein hypothetical protein hypothetical protein superantigen-like protein superantigen-like protein superantigen-like protein hypothetical protein Panton-Valentine leukocidin, LukS-PV superantigen-like protein 8 hypothetical protein chemotaxis-inhibiting protein CHIPS superantigen-like protein 2 Panton-Valentine leukocidin subunit F fibronectin binding protein B hypothetical protein acetoin reductase translaldolase M23/M37 peptidase domain-containing protein bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP hypothetical protein superantigen-like protein 3 carbon-nitrogen family hydrolase hypothetical protein Oye family NADH-dependent flavin oxidoreductase hypothetical protein hypothetical protein isochorismatase formate dehydrogenase accessory protein DNA-directed RNA polymerase subunit beta' hypothetical protein fructose-1,6-bisphosphate aldolase endonuclease III hypothetical protein hypothetical protein branched-chain amino acid transport system II carrier protein hypothetical protein thioredoxin hypothetical protein 50S ribosomal protein L33 acetyltransferase FUR family transcriptional regulator hypothetical protein tyrosine recombinase XerD DNA replication protein DnaD hypothetical protein NAD(P)H-flavin oxidoreductase aldehyde dehydrogenase hypothetical protein EmrB/QacA family drug resistance transporter hypothetical protein superantigen-like protein 7 NAD/NADP octopine/nopaline dehydrogenase alcohol dehydrogenase, zinc-containing hypothetical protein iron-sulfur cluster-binding protein S-adenosylmethionine synthetase 30S ribosomal protein S17 50S ribosomal protein L29 copper-translocating P-type ATPase exonuclease hypothetical protein hypothetical protein imidazole glycerol phosphate synthase subunit HisF hypothetical protein glyoxalase hypothetical protein hypothetical protein 50S ribosomal protein L14 hypothetical protein hypothetical protein hypothetical protein hypothetical protein ATP-dependent protease ATP-binding subunit ClpX GTP-binding protein YqeH OsmC/Ohr family protein teichoic acids export protein ATP-binding subunit hypothetical protein sdrE protein ferredoxin cobyric acid synthase putative lysophospholipase ParB family chromosome partioning protein 50S ribosomal protein L31 hypothetical protein hypothetical protein methionine sulfoxide reductase A hypothetical protein NADH dehydrogenase methionine sulfoxide reductase B Na+/H+ antiporter NhaC epimerase/dehydratase leucyl-tRNA synthetase Na+/H+ antiporter family protein HAD superfamily hydrolase ABC transporter ATP-binding protein tryptophan synthase subunit alpha hypothetical protein hypothetical protein hypothetical protein HAD superfamily hydrolase superoxide dismutase rhodanese-like domain-containing protein excinuclease ABC subunit C peptide deformylase translation initiation factor IF-2 acetyl-CoA carboxylase carboxyltransferase subunit alpha DNA-directed RNA polymerase subunit beta mannitol-1-phosphate 5-dehydrogenase acetyl-CoA synthetase 50S ribosomal protein L24 hypothetical protein 50S ribosomal protein L5 Na+/H+ antiporter copper ion binding protein acetyltransferase 30S ribosomal protein S15 phi PVL ORF 30-like protein hypothetical protein hypothetical protein RNA methyltransferase hypothetical protein 50S ribosomal protein L6 adaptor protein hypothetical protein GTP cyclohydrolase M20/M25/M40 family peptidase 50S ribosomal protein L25/general stress protein rplY elongation factor Ts 6-phosphogluconate dehydrogenase acetyl-CoA carboxylase subunit beta M20/M25/M40 family peptidase tryptophan synthase subunit beta surface protein aldo/keto reductase oxidoreductase staphyloxanthin biosynthesis protein
Base mean A-value M-value Fold change Standard error Wald statistic P-value Adjusted P-value 112,17 6,81 0,55 1,47 0,20 2,75 0,005879954 0,011755483 188,46 7,56 1,09 2,13 0,17 6,48 9,02386E-11 4,5324E-10 79,83 6,32 1,23 2,35 0,24 5,13 2,84055E-07 1,02825E-06 106,38 6,73 1,15 2,22 0,20 5,86 4,70468E-09 2,03588E-08 118,72 6,89 1,29 2,44 0,20 6,54 6,03079E-11 3,05798E-10 75,30 6,23 -0,15 0,90 0,24 -0,64 0,522778835 0,608420221 60,54 5,92 -0,29 0,82 0,27 -1,08 0,281690819 0,364370148 159,65 7,32 -0,75 0,60 0,18 -4,20 2,62912E-05 7,60956E-05 154,96 7,28 -0,87 0,55 0,17 -5,03 4,84445E-07 1,72543E-06 192,51 7,59 -0,45 0,73 0,16 -2,82 0,004737099 0,009600664 1379,87 10,43 0,19 1,14 0,10 1,91 0,055889501 0,090824711 1711,16 10,74 1,13 2,19 0,13 8,81 1,23765E-18 1,05062E-17 58,15 5,86 -0,41 0,75 0,26 -1,61 0,106825063 0,159457412 100,19 6,65 -0,40 0,76 0,22 -1,80 0,072490536 0,113968849 31,49 4,98 -0,91 0,53 0,35 -2,62 0,008737722 0,016921376 26,30 4,72 -1,33 0,40 0,39 -3,44 0,000582819 0,001397609 491,01 8,94 1,81 3,52 0,12 15,55 1,53465E-54 4,63361E-53 9929,86 13,28 1,01 2,01 0,09 10,74 6,29686E-27 7,60489E-26 674,46 9,40 -0,23 0,85 0,16 -1,47 0,14094629 0,202538828 4529,08 12,15 1,56 2,96 0,11 14,02 1,17563E-44 2,7643E-43 3851,45 11,91 0,56 1,48 0,10 5,66 1,4959E-08 6,22003E-08 853,13 9,74 0,56 1,47 0,11 5,31 1,08103E-07 4,12093E-07 1747,04 10,77 0,76 1,70 0,09 8,29 1,1227E-16 8,57191E-16 1070,31 10,06 2,28 4,87 0,11 21,36 2,8892E-101 1,5666E-99 383,95 8,58 0,30 1,23 0,12 2,42 0,015704026 0,028895844 560,82 9,13 0,07 1,05 0,11 0,60 0,551533826 0,633286679 417,24 8,70 0,23 1,17 0,13 1,81 0,07091335 0,111952924 290,00 8,18 0,13 1,09 0,15 0,86 0,388102664 0,473022376 668,33 9,38 0,50 1,42 0,15 3,32 0,00089509 0,002075264 1097,66 10,10 0,46 1,38 0,11 4,13 3,61722E-05 0,000102572 600,56 9,23 0,27 1,20 0,14 1,99 0,046956063 0,077976413 923,43 9,85 0,18 1,13 0,11 1,65 0,098329087 0,148951188 597,02 9,22 0,00 1,00 0,11 0,00 0,999384287 0,999384287 19296,62 14,24 6,21 73,83 0,08 74,18 0 0 191,41 7,58 5,69 51,68 0,30 19,22 2,75944E-82 1,18255E-80 615,94 9,27 5,17 35,97 0,17 30,89 1,5104E-209 1,2946E-207 922,84 9,85 4,35 20,45 0,13 34,02 1,3291E-253 1,3079E-251 705,31 9,46 4,01 16,10 0,14 29,32 6,0445E-189 4,8667E-187 598,49 9,23 3,60 12,10 0,14 25,78 1,3173E-146 9,2106E-145 1897,77 10,89 3,45 10,96 0,10 34,37 7,2667E-259 7,426E-257 243,04 7,93 3,42 10,72 0,17 19,86 9,85888E-88 4,51639E-86 251,44 7,97 3,10 8,58 0,17 18,21 4,06404E-74 1,61166E-72 1031,26 10,01 3,07 8,42 0,12 25,44 8,4454E-143 5,7537E-141 297,61 8,22 3,02 8,10 0,17 18,20 5,46283E-74 2,13452E-72 279,43 8,13 2,99 7,95 0,17 17,40 7,63818E-68 2,8187E-66 289,04 8,18 2,73 6,63 0,16 17,34 2,22964E-67 8,11529E-66 1090,60 10,09 2,63 6,21 0,11 24,98 1,0137E-137 6,5694E-136 440,98 8,78 2,52 5,72 0,14 17,60 2,6246E-69 9,96222E-68 5943,78 12,54 2,42 5,37 0,11 21,16 2,2662E-99 1,18065E-97 2921,50 11,51 2,42 5,35 0,12 20,00 5,33839E-89 2,57893E-87 1064,04 10,06 2,41 5,32 0,13 19,02 1,27186E-80 5,19897E-79 1099,55 10,10 2,39 5,25 0,16 15,07 2,5546E-51 7,14482E-50 53,99 5,75 2,25 4,76 0,30 7,61 2,76066E-14 1,79781E-13 232,16 7,86 2,18 4,54 0,19 11,70 1,28524E-31 1,7879E-30 8778,08 13,10 2,11 4,31 0,09 24,73 5,1386E-135 3,2508E-133 456,96 8,84 2,10 4,28 0,17 12,34 5,35626E-35 8,78493E-34 2084,38 11,03 2,06 4,18 0,12 17,30 4,39325E-67 1,57741E-65 381,03 8,57 1,96 3,88 0,13 14,53 7,40766E-48 1,91089E-46 194,41 7,60 1,94 3,83 0,22 8,62 6,54604E-18 5,25463E-17 180,35 7,49 1,86 3,63 0,18 10,37 3,53063E-25 3,94155E-24 1392,01 10,44 1,85 3,62 0,11 16,58 9,61781E-62 3,15488E-60 1995,81 10,96 1,84 3,57 0,15 11,93 7,81201E-33 1,18609E-31 243,70 7,93 1,78 3,44 0,19 9,43 4,02584E-21 3,74009E-20 3735,22 11,87 1,77 3,42 0,12 14,24 5,40723E-46 1,30609E-44 609,07 9,25 1,77 3,41 0,13 13,86 1,05574E-43 2,31827E-42 108,62 6,76 1,74 3,35 0,22 8,01 1,11983E-15 8,17412E-15 283,50 8,15 1,71 3,27 0,15 11,10 1,28919E-28 1,6628E-27 344,07 8,43 1,69 3,22 0,13 12,51 6,36749E-36 1,07761E-34 6,10 1,69 3,22 0,28 1,06509E-09 4,91312E-09 59,09 5,88 708,56 9,47 1,64 3,12 0,14 11,89 1,36172E-32 2,03264E-31 1,61 3,06 0,10 15,55 1,4979E-54 4,57463E-53 1151,63 10,17 5178,77 12,34 1,60 3,03 0,10 16,12 1,94548E-58 6,15375E-57 811,12 9,66 1,59 3,01 0,12 13,78 3,27465E-43 7,13175E-42 9,87 1,58 2,99 0,15 10,83 2,56236E-27 3,13741E-26 935,55 891,81 9,80 1,57 2,98 0,11 14,10 3,67744E-45 8,80266E-44 9,59109E-42 635,08 9,31 1,57 2,98 0,11 13,76 4,50051E-43 492,50 8,94 1,57 2,96 0,12 13,14 1,86481E-39 3,5646E-38 1335,87 10,38 1,57 2,96 0,12 13,30 2,46398E-40 4,77868E-39 9,11 1,55 2,93 0,13 12,38 3,38612E-35 5,58815E-34 552,48 353,84 8,47 1,53 2,88 0,15 9,89 4,77179E-23 4,83918E-22 0,001736483 20,83 4,38 1,52 2,88 0,45 3,37 0,000738512 621,01 9,28 1,52 2,86 0,12 12,48 1,00744E-35 1,69415E-34 786,01 9,62 1,51 2,85 0,11 13,71 8,29975E-43 1,73641E-41 7,74 1,51 2,84 0,17 8,62 6,58849E-18 5,27278E-17 213,99 1502,35 10,55 1,46 2,75 0,10 15,27 1,15591E-52 3,41251E-51 2,8317E-40 825,01 9,69 1,46 2,74 0,11 13,51 1,39614E-41 349,15 8,45 1,45 2,73 0,15 9,90 3,99753E-23 4,06952E-22 9,63 1,36 2,56 0,12 11,76 6,19188E-32 8,79777E-31 792,49 1225,55 10,26 1,34 2,53 0,12 11,33 9,58977E-30 1,2804E-28 3,49671E-18 242,61 7,92 1,32 2,49 0,15 8,94 4,04023E-19 229,57 7,84 1,31 2,48 0,15 8,75 2,16009E-18 1,79917E-17 764,21 9,58 1,30 2,46 0,11 12,14 6,56759E-34 1,03255E-32 8,91 1,30 2,46 0,13 9,79 1,24232E-22 1,24561E-21 480,41 399,31 8,64 1,29 2,45 0,13 10,00 1,47642E-23 1,51462E-22 2,50855E-18 380,59 8,57 1,27 2,41 0,14 8,97 2,87015E-19 1374,56 10,42 1,24 2,36 0,13 9,33 1,06732E-20 9,67872E-20 932,04 9,86 1,23 2,34 0,11 11,33 9,66984E-30 1,28464E-28 7,55 1,22 2,34 0,16 7,70 1,31554E-14 8,89413E-14 186,94 13,82 3,79 1,21 2,31 0,57 2,12 0,034055265 0,058794568 0,006383855 20,14 4,33 1,21 2,31 0,41 2,97 0,00302254 246,55 7,95 1,20 2,30 0,15 8,18 2,79109E-16 2,09489E-15 274,17 8,10 1,20 2,29 0,15 7,92 2,30752E-15 1,63933E-14 5,54983E-45 5342,70 12,38 1,19 2,28 0,08 14,30 2,25586E-46 0 48,74 5,61 1,18 2,26 0,29 4,09 4,31549E-05 0,000120952 3,60825E-37 7466,99 12,87 1,17 2,26 0,09 12,96 1,98271E-38 414,45 8,70 1,17 2,25 0,13 8,92 4,48623E-19 3,8701E-18 2018,80 10,98 1,16 2,24 0,13 8,99 2,46673E-19 2,16307E-18 8,80 1,16 2,23 0,12 9,47 2,67474E-21 2,49361E-20 444,70 206,18 7,69 1,15 2,22 0,16 7,18 7,2217E-13 4,20791E-12 2,2864E-20 702,10 9,46 1,14 2,20 0,12 9,48 2,43527E-21 670,27 9,39 1,14 2,20 0,12 9,40 5,20653E-21 4,81703E-20 4569,87 12,16 1,13 2,19 0,09 13,01 1,05151E-38 1,98146E-37 8,15769E-20 432,35 8,76 1,13 2,19 0,12 9,35 8,96517E-21 121,48 6,92 1,10 2,14 0,19 5,92 3,12946E-09 1,38814E-08 10,77 1,09 2,14 0,09 12,02 2,89194E-33 4,46738E-32 1740,81 896,74 9,81 1,09 2,13 0,14 7,77 7,85213E-15 5,41899E-14 1276,28 10,32 1,09 2,13 0,16 6,89 5,58657E-12 3,10534E-11 3,32336E-19 513,34 9,00 1,08 2,12 0,12 9,20 3,71485E-20 733,02 9,52 1,08 2,11 0,18 5,94 2,89679E-09 1,29357E-08 11,03 1,08 2,11 0,10 10,79 3,90943E-27 4,76485E-26 2087,76 385,47 8,59 1,07 2,10 0,13 8,31 9,60985E-17 7,37958E-16 2511,90 11,29 1,07 2,10 0,12 9,00 2,35428E-19 2,0713E-18 4,6506E-31 1834,91 10,84 1,05 2,08 0,09 11,82 3,18558E-32 1050,01 10,04 1,05 2,08 0,10 10,61 2,69061E-26 3,17731E-25 9,14 1,05 2,07 0,11 9,13 6,70405E-20 5,93755E-19 565,37 2485,17 11,28 1,04 2,06 0,12 8,87 7,52653E-19 6,45096E-18 17508,42 14,10 1,04 2,06 0,10 10,88 1,3803E-27 1,6979E-26 8,15 1,04 2,06 284,03 0,16 6,46 1,06941E-10 5,32099E-10 567,76 9,15 1,04 2,05 0,11 9,15 5,91332E-20 5,25475E-19 89,48 6,48 1,04 2,05 0,24 4,32 1,55531E-05 4,60698E-05 431,35 8,75 1,04 2,05 0,16 6,67 2,48883E-11 1,3173E-10 10,49 3,39 1,02 2,03 0,52 1,96 0,050090774 0,082768151 356,35 8,48 1,02 2,02 0,14 7,35 1,91574E-13 1,2005E-12 309,10 8,27 1,01 2,02 0,15 6,55 5,71105E-11 2,90694E-10 20209,97 14,30 1,01 2,01 0,10 10,06 8,01959E-24 8,389E-23 220,71 7,79 1,01 2,01 0,16 6,24 4,43563E-10 2,11969E-09 796,17 9,64 1,01 2,01 0,10 10,14 3,5293E-24 3,79649E-23 411,82 8,69 1,00 2,00 0,14 7,21 5,54674E-13 3,30441E-12 684,92 9,42 1,00 1,99 0,11 9,26 1,99814E-20 1,79968E-19 460,85 8,85 0,99 1,98 0,13 7,49 6,73089E-14 4,28872E-13 4759,45 12,22 0,98 1,97 0,12 8,20 2,45124E-16 1,84502E-15 8,65 5,27248E-18 4,24515E-17 1512,19 10,56 0,98 1,97 0,11 3382,66 11,72 0,97 1,96 0,09 10,47 1,17994E-25 1,33409E-24 204,57 7,68 0,97 1,96 0,16 6,05 1,45862E-09 6,64762E-09 1295,24 10,34 0,96 1,94 0,15 6,29 3,14197E-10 1,51236E-09 271,39 8,08 0,95 1,93 0,16 6,04 1,49886E-09 6,81932E-09 1914,10 10,90 0,94 1,92 0,12 7,84 4,37864E-15 3,06967E-14 68,73 6,10 0,94 1,91 0,25 3,76 0,000167786 0,000437924 269,18 8,07 0,94 1,91 0,14 6,75 1,44747E-11 7,73826E-11 570,65 9,16 0,93 1,91 0,15 6,40 1,58206E-10 7,76994E-10 1334,77 10,38 0,93 1,91 0,14 6,43 1,25996E-10 6,22249E-10 659,18 9,36 0,93 1,91 0,12 7,69 1,42107E-14 9,53477E-14 5,45 5,10655E-08 2,01307E-07 211,64 7,73 0,93 1,90 0,17 503,03 8,97 0,91 1,88 0,12 7,65 1,94037E-14 1,28866E-13 376,59 8,56 0,91 1,88 0,13 7,25 4,16703E-13 2,52205E-12 275,25 8,10 0,91 1,88 0,14 6,63 3,39837E-11 1,78096E-10 17615,50 14,10 0,90 1,87 0,11 8,15 3,68348E-16 2,74916E-15 4720,65 12,20 0,90 1,87 0,13 6,92 4,47946E-12 2,50567E-11 1610,03 10,65 0,90 1,87 0,10 8,72 2,66993E-18 2,19628E-17 441,10 8,78 0,90 1,87 0,13 6,95 3,53989E-12 2,00117E-11 1636,09 10,68 0,90 1,86 0,13 6,85 7,42359E-12 4,09222E-11 2039,66 10,99 0,90 1,86 0,14 6,47 9,92757E-11 4,96752E-10 2702,07 11,40 0,88 1,84 0,11 7,96 1,69088E-15 1,21423E-14 0 3257,16 11,67 0,87 1,83 0,12 7,35 2,01962E-13 1,26262E-12 435,96 8,77 0,87 1,82 0,12 7,08 1,44659E-12 8,3015E-12 1457,49 10,51 0,86 1,82 0,10 8,81 1,2035E-18 1,0249E-17 111,52 6,80 0,86 1,82 0,22 3,90 9,56238E-05 0,000257942 266,15 8,06 0,86 1,82 0,15 5,72 1,0577E-08 4,45374E-08 253,56 7,99 0,86 1,81 0,15 5,88 4,03173E-09 1,75038E-08 301,97 8,24 0,85 1,81 0,14 6,02 1,74793E-09 7,88496E-09
Locus USA300HOU 2315 USA300HOU 2645 USA300HOU_0869 USA300HOU 0428 USA300HOU_1597 USA300HOU_0582 USA300HOU 1053 USA300HOU 1919 USA300HOU_2157 USA300HOU 1734 USA300HOU_2498 USA300HOU_1398 USA300HOU 1002 USA300HOU_0691 USA300HOU_0032 USA300HOU 1600 USA300HOU 1189 USA300HOU_1646 USA300HOU 1005 USA300HOU_0033 USA300HOU_1337 USA300HOU 0742 USA300HOU_1169 USA300HOU_1219 USA300HOU 2595 USA300HOU_0572 USA300HOU_1199 USA300HOU 2225 USA300HOU_0655 USA300HOU_2458 USA300HOU 1903 USA300HOU 1657 USA300HOU_1592 USA300HOU 2227 USA300HOU 2057 USA300HOU_0084 USA300HOU 1596 USA300HOU_1200 USA300HOU_2292 USA300HOU 0502 USA300HOU_0389 USA300HOU_0906 USA300HOU 0753 USA300HOU_2076 USA300HOU_0901 USA300HOU 1530 USA300HOU 2457 USA300HOU_2701 USA300HOU 2148 USA300HOU 1457 USA300HOU_0573 USA300HOU 2470 USA300HOU_1731 USA300HOU_1080 USA300HOU 2691 USA300HOU_1648 USA300HOU_1351 USA300HOU 1644 USA300HOU_1004 USA300HOU_0066 USA300HOU 1688 USA300HOU 2147 USA300HOU_0562 USA300HOU 2018 USA300HOU 0085 USA300HOU_1444 USA300HOU 0579 USA300HOU_1713 USA300HOU_1364 USA300HOU 2469 USA300HOU_1058 USA300HOU_1207 USA300HOU 2220 USA300HOU 1126 USA300HOU_2338 USA300HOU 1031 USA300HOU 2208 USA300HOU_1888 USA300HOU 2501 USA300HOU_1388 USA300HOU_0714 USA300HOU 1886 USA300HOU_1782 USA300HOU_0921 USA300HOU 0900 USA300HOU_0690 USA300HOU_0775 USA300HOU 1003 USA300HOU_0059 USA300HOU_0226 USA300HOU 1899 USA300HOU 1636 USA300HOU_0876 USA300HOU 1007 USA300HOU_0581 USA300HOU_0752 USA300HOU 0270 USA300HOU_1231 USA300HOU_0145 USA300HOU 2224 USA300HOU_1859 USA300HOU_0578 USA300HOU 0526 USA300HOU_0656 USA300HOU_2154 USA300HOU 2717 USA300HOU 0675 USA300HOU_1563 USA300HOU 1559 USA300HOU_1040 USA300HOU_1786 USA300HOU 1387 USA300HOU_2113 USA300HOU_1656 USA300HOU 1595 USA300HOU_1511 USA300HOU_0525 USA300HOU 0917 USA300HOU_0686 USA300HOU_0673 USA300HOU 2030 USA300HOU_2195 USA300HOU_2216 USA300HOU 2644 USA300HOU 0531 USA300HOU_1188 USA300HOU 1658 USA300HOU_1455 USA300HOU_1416 USA300HOU 0776
Gene symbol lyrA USA300HOU 2645 USA300HOU_0869 ssl6 aroE lipL ctaA USA300HOU 1919 salA USA300HOU 1734 USA300HOU 2498 USA300HOU_1398 qoxD USA300HOU_0691 mecR1 mtnN USA300HOU 1189 rplU qoxA rplL cspA ltaS acpP USA300HOU_1219 USA300HOU 2595 vraX USA300HOU_1199 rplR USA300HOU_0655 cntA putP USA300HOU 1657 USA300HOU_1592 rpsH USA300HOU 2057 copA USA300HOU 1596 USA300HOU_1200 USA300HOU_2292 USA300HOU 0502 rpsR mnhG USA300HOU 0753 cshA sufA efp cntB USA300HOU_2701 mtlA USA300HOU 1457 pdxK USA300HOU 2470 USA300HOU 1731 trxA USA300HOU 2691 mreC USA300HOU_1351 rpmA qoxB arcC USA300HOU 1688 mtlR USA300HOU_0562 ktrB USA300HOU 0085 USA300HOU_1444 USA300HOU 0579 USA300HOU 1713 thyA USA300HOU 2469 USA300HOU_1058 rnjB adk sepF tcaA rnjA rpsI USA300HOU_1888 USA300HOU 2501 pbp2 USA300HOU_0714 USA300HOU 1886 USA300HOU_1782 pgi USA300HOU 0900 USA300HOU_0690 USA300HOU_0775 qoxC adhC USA300HOU_0226 USA300HOU 1899 secDF USA300HOU_0876 USA300HOU 1007 eutD queF scdA glpK sodM rpsE gsaB USA300HOU_0578 USA300HOU 0526 tagA rocF rpmH USA300HOU 0675 sigA nfo USA300HOU_1040 USA300HOU_1786 recU fbaA tag nadD USA300HOU_1511 USA300HOU_0525 gudB USA300HOU 0686 dhaM USA300HOU 2030 USA300HOU_2195 rpsK USA300HOU 2644 rplK rpsB USA300HOU 1658 USA300HOU_1455 ansA USA300HOU 0776
Regulon -
Function hypothetical protein isochorismatase hypothetical protein superantigen-like protein 6 shikimate 5-dehydrogenase lipoate-protein ligase A family protein cytochrome oxidase assembly protein hypothetical protein ATP-binding Mrp/Nbp35 family protein thioredoxin hypothetical protein hypothetical protein quinol oxidase subunit IV hypothetical protein methicillin-resistance MecR1 regulatory protein 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase hypothetical protein 50S ribosomal protein L21 quinol oxidase subunit II hypothetical protein CSD family cold shock protein sulfatase acyl carrier protein hypothetical protein amino acid permease hypothetical protein hypothetical protein 50S ribosomal protein L18 hypothetical protein peptide ABC transporter peptide-binding protein high affinity proline permease abrB protein hypothetical protein 30S ribosomal protein S8 hypothetical protein ATPase copper transport hypothetical protein 50S ribosomal protein L7 transcriptional regulator hypothetical protein 30S ribosomal protein S18 monovalent cation/H+ antiporter subunit G integral membrane domain-containing protein DEAD/DEAH box helicase hypothetical protein elongation factor P peptide ABC transporter permease N-acetyltransferase PTS system, mannitol-specific IIA component phi-like protein phosphomethylpyrimidine kinase short chain dehydrogenase/reductase oxidoreductase FtsK/SpoIIIE family protein thioredoxin hypothetical protein rod shape-determining protein MreC hypothetical protein 50S ribosomal protein L27 quinol oxidase subunit I carbamate kinase NADP-dependent malic enzyme BglG family transcriptional antiterminator hypothetical protein sodium transport family protein putative lipoprotein prophage L54a, major tail protein hypothetical protein hypothetical protein thymidylate synthase hypothetical protein hypothetical protein metallo-beta-lactamase adenylate kinase hypothetical protein tcaA protein hypothetical protein 30S ribosomal protein S9 hypothetical protein drug transporter penicillin-binding protein 2 deoxyribodipyrimidine photolyase hypothetical protein hypothetical protein glucose-6-phosphate isomerase hypothetical protein hypothetical protein hypothetical protein quinol oxidase subunit III alcohol dehydrogenase, zinc-containing hypothetical protein hypothetical protein bifunctional preprotein translocase subunit SecD/SecF hypothetical protein hypothetical protein phosphotransacetylase 7-cyano-7-deazaguanine reductase cell wall biosynthesis protein ScdA glycerol kinase superoxide dismutase 30S ribosomal protein S5 glutamate-1-semialdehyde aminotransferase hypothetical protein hypothetical protein teichoic acid biosynthesis protein arginase 50S ribosomal protein L34 hypothetical protein RNA polymerase sigma factor SigA endonuclease IV hypothetical protein hypothetical protein Holliday junction-specific endonuclease fructose-bisphosphate aldolase DNA-3-methyladenine glycosylase nicotinate (nicotinamide) nucleotide adenylyltransferase glyoxalase RNA methyltransferase glutamate dehydrogenase LysM domain-containing protein PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM hypothetical protein MerR family transcriptional regulator 30S ribosomal protein S11 N-acetylmuramoyl-L-alanine amidase 50S ribosomal protein L11 30S ribosomal protein S2 hypothetical protein possible bacteriophage transcriptional regulator L-asparaginase degV family protein
USA300HOU_1684 USA300HOU 0672 USA300HOU 2214 USA300HOU_0854 USA300HOU 1508 USA300HOU_1647 USA300HOU_2138 USA300HOU 2219 USA300HOU_0192 USA300HOU_1796 USA300HOU 2426 USA300HOU_0999 USA300HOU_1501 USA300HOU 1904 USA300HOU_1146 USA300HOU_1043 USA300HOU 0918 USA300HOU 0523 USA300HOU_0685 USA300HOU 0337 USA300HOU_1707 USA300HOU_1297 USA300HOU 0479 USA300HOU_0968 USA300HOU_0427 USA300HOU 2217 USA300HOU_2215 USA300HOU_1163 USA300HOU 1593 USA300HOU_1594 USA300HOU_1056 USA300HOU 1730 USA300HOU 1026 USA300HOU_0372 USA300HOU 1921 USA300HOU_2563 USA300HOU_0828 USA300HOU 1535 USA300HOU_0907 USA300HOU_1951
pykA dhaL rplQ USA300HOU_0854 USA300HOU 1508 mreD USA300HOU_2138 infA ausA USA300HOU_1796 USA300HOU 2426 USA300HOU_0999 USA300HOU_1501 USA300HOU 1904 USA300HOU_1146 potD glpQ cysS pitA nanR rpsD USA300HOU_1297 recR USA300HOU_0968 ssl5 rpsM rpoA recG rsfS USA300HOU_1594 USA300HOU_1056 murC ptsI USA300HOU_0372 ppaC USA300HOU_2563 USA300HOU_0828 USA300HOU 1535 mnhF ami
-
pyruvate kinase DAK2 domain-containing protein DhaL 50S ribosomal protein L17 Cro/CI family transcriptional regulator AraC family transcriptional regulator rod shape-determining protein MreD hypothetical protein translation initiation factor IF-1 gramicidin S synthetase 2 related protein hypothetical protein hypothetical protein hypothetical protein aldo/keto reductase oxidoreductase hypothetical protein fibronectin/fibrinogen binding-like protein spermidine/putrescine ABC transporter substrate-binding protein glycerophosphoryl diester phosphodiesterase cysteinyl-tRNA synthetase phosphate transporter family protein hypothetical protein 30S ribosomal protein S4 hypothetical protein recombination protein RecR hypothetical protein superantigen-like protein 5 30S ribosomal protein S13 DNA-directed RNA polymerase subunit alpha ATP-dependent DNA helicase RecG hypothetical protein hypothetical protein hypothetical protein UDP-N-acetylmuramate--L-alanine ligase phosphoenolpyruvate-protein phosphotransferase ABC transporter ATP-binding protein manganese-dependent inorganic pyrophosphatase acetyltransferase hypothetical protein rhodanese-like domain-containing protein monovalent cation/H+ antiporter subunit F lytic enzyme
Base mean A-value M-value Fold change Standard error Wald statistic P-value Adjusted P-value 4336,14 12,08 0,84 1,79 0,12 7,22 5,37921E-13 3,21181E-12 1263,96 10,30 0,84 1,79 0,09 9,37 6,9523E-21 6,34786E-20 81,14 6,34 0,83 1,78 0,24 3,42 0,000620473 0,001482551 82,68 6,37 0,83 1,78 0,25 3,37 0,00075093 0,001763121 228,53 7,84 0,82 1,77 0,15 5,41 6,42855E-08 2,50817E-07 1194,90 10,22 0,82 1,76 0,12 6,57 4,95144E-11 2,53487E-10 314,52 8,30 0,82 1,76 0,14 5,80 6,65808E-09 2,84413E-08 937,73 9,87 0,82 1,76 0,11 7,28 3,28573E-13 2,01621E-12 1245,85 10,28 0,80 1,74 0,10 7,75 8,89278E-15 6,12127E-14 1402,63 10,45 0,80 1,74 0,11 7,42 1,128E-13 7,13592E-13 416,42 8,70 0,80 1,74 0,13 6,06 1,36795E-09 6,27743E-09 6452,05 12,66 0,80 1,74 0,12 6,59 4,51656E-11 2,3167E-10 461,40 8,85 0,79 1,73 0,18 4,41 1,04731E-05 3,16937E-05 602,17 9,23 0,78 1,72 0,15 5,32 1,02694E-07 3,92037E-07 1940,92 10,92 0,78 1,72 0,13 6,20 5,5731E-10 2,62549E-09 304,92 8,25 0,78 1,72 0,13 5,85 4,78802E-09 2,06522E-08 206,04 7,69 0,77 1,71 0,17 4,67 3,04667E-06 9,84794E-06 743,75 9,54 0,77 1,71 0,11 6,90 5,17111E-12 2,88648E-11 4012,54 11,97 0,77 1,71 0,13 6,04 1,51028E-09 6,85951E-09 929,59 9,86 0,77 1,70 0,10 7,50 6,37043E-14 4,07861E-13 3676,38 11,84 0,76 1,70 0,18 4,33 1,46236E-05 4,34132E-05 5071,32 12,31 0,76 1,69 0,10 7,31 2,67279E-13 1,65154E-12 9,98 0,76 1,69 0,38 2,01 0,044806215 0,074827224 1013,13 1221,77 10,25 0,75 1,68 0,14 5,24 1,64676E-07 6,1195E-07 19899,00 14,28 0,75 1,68 0,13 5,57 2,52026E-08 1,03021E-07 1508,48 10,56 0,75 1,68 0,10 7,65 1,94488E-14 1,28866E-13 119,15 6,90 0,74 1,67 0,22 3,35 0,000817304 0,001906565 7,80 0,74 1,67 0,15 4,88 1,04608E-06 3,61436E-06 223,17 215,63 7,75 0,73 1,65 0,17 4,29 1,80929E-05 5,32959E-05 217,62 7,77 0,73 1,65 0,16 4,56 5,23855E-06 1,63944E-05 2965,63 11,53 0,72 1,65 0,11 6,40 1,58072E-10 7,76994E-10 247,85 7,95 0,72 1,64 0,14 5,08 3,69715E-07 1,3239E-06 9,28 0,71 1,64 0,15 4,63 3,72285E-06 1,18604E-05 621,87 250,40 7,97 0,71 1,64 0,15 4,87 1,12594E-06 3,87517E-06 400,60 8,65 0,71 1,63 0,13 5,50 3,89673E-08 1,55928E-07 693,94 9,44 0,70 1,63 0,11 6,55 5,61777E-11 2,86496E-10 136,41 7,09 0,70 1,63 0,19 3,77 0,000163595 0,000427828 7,06 0,70 1,63 0,19 3,70 0,000214722 0,000551756 133,26 1000,37 9,97 0,70 1,62 0,10 6,81 9,54839E-12 5,20946E-11 4855,50 12,25 0,69 1,61 0,14 4,83 1,39744E-06 4,73595E-06 262,81 8,04 0,69 1,61 0,15 4,48 7,32911E-06 2,26699E-05 97,90 6,61 0,68 1,60 0,20 3,40 0,00067735 0,001605459 8,75 0,68 1,60 0,13 5,38 7,51409E-08 2,91034E-07 430,56 925,18 9,85 0,68 1,60 0,12 5,84 5,19938E-09 2,23902E-08 1557,14 10,60 0,67 1,59 0,13 5,18 2,18781E-07 8,00689E-07 2405,76 11,23 0,66 1,58 0,17 3,88 0,00010465 0,000280582 117,72 6,88 0,66 1,58 0,20 3,21 0,001341886 0,003013855 483,47 8,92 0,65 1,57 0,12 5,43 5,51831E-08 2,16896E-07 942,77 9,88 0,65 1,57 0,10 6,22 5,06962E-10 2,40107E-09 22,86 4,51 0,65 1,57 0,39 1,68 0,093126742 0,14179814 1072,30 10,07 0,64 1,56 0,12 5,55 2,93864E-08 1,19571E-07 257,46 8,01 0,64 1,56 0,15 4,23 2,38427E-05 6,94629E-05 1416,52 10,47 0,64 1,56 0,10 6,66 2,79275E-11 1,47229E-10 5310,36 12,37 0,64 1,56 0,11 6,05 1,41238E-09 6,45904E-09 2777,61 11,44 0,64 1,56 0,11 5,64 1,67836E-08 6,94612E-08 447,30 8,81 0,63 1,55 0,12 5,37 7,86623E-08 3,03346E-07 126,04 6,98 0,63 1,55 0,22 2,91 0,003615078 0,007498253 1201,31 10,23 0,63 1,55 0,17 3,76 0,000170189 0,000443325 4026,06 11,98 0,63 1,55 0,12 5,05 4,3205E-07 1,54295E-06 301,36 8,24 0,63 1,54 0,13 4,76 1,97967E-06 6,5504E-06 464,55 8,86 0,62 1,54 0,12 5,16 2,41033E-07 8,80913E-07 1310,42 10,36 0,62 1,54 0,09 6,61 3,88542E-11 2,02423E-10 845,69 9,72 0,62 1,53 0,12 5,16 2,42323E-07 8,84413E-07 1170,37 10,19 0,62 1,53 0,11 5,61 2,01659E-08 8,30712E-08 171,36 7,42 0,62 1,53 0,16 3,80 0,000145608 0,000384573 113,83 6,83 0,61 1,53 0,20 3,11 0,001888584 0,004136825 7,78372E-07 1458,93 10,51 0,61 1,53 0,12 5,19 2,1239E-07 138,60 7,11 0,61 1,53 0,23 2,64 0,008209203 0,01597938 5,54 0,61 1,52 0,11 3,07313E-08 1,24661E-07 747,51 9,55 134,03 7,07 0,61 1,52 0,20 3,09 0,002026758 0,004421261 1,20315E-06 559,15 9,13 0,61 1,52 0,12 5,10 3,34184E-07 932,87 9,87 0,61 1,52 0,11 5,42 5,94815E-08 2,32931E-07 694,86 9,44 0,60 1,52 0,14 4,21 2,60722E-05 7,56265E-05 11,40 0,60 1,52 0,10 6,13 8,84272E-10 4,10754E-09 2696,60 708,71 9,47 0,59 1,51 0,12 4,99 5,97183E-07 2,1044E-06 11,76 0,59 1,51 0,11 5,45 5,00332E-08 1,97531E-07 3462,93 1592,83 10,64 0,59 1,51 0,12 4,98 6,52462E-07 2,29311E-06 11,76 3,56 0,59 1,51 0,49 1,20 0,23019834 0,308907571 5,26683E-05 323,44 8,34 0,59 1,50 0,14 4,29 1,786E-05 3727,14 11,86 0,59 1,50 0,14 4,13 3,66698E-05 0,000103761 9,32 0,59 1,50 0,11 5,51 3,63846E-08 1,46033E-07 637,13 5,79 2,53 0,59 1,50 0,60 0,97 0,332171957 0,416311741 410,95 8,68 0,59 1,50 0,16 3,58 0,000343377 0,000853464 9,79197E-05 4406,76 12,11 0,59 1,50 0,14 4,14 3,4458E-05 1184,53 10,21 0,58 1,50 0,10 5,78 7,46024E-09 3,17658E-08 9,84 0,58 1,50 0,12 4,82 1,46708E-06 4,95303E-06 916,41 411,25 8,68 0,58 1,49 0,13 4,29 1,82468E-05 5,36896E-05 1088,70 10,09 0,57 1,49 0,15 3,76 0,000169748 0,000442612 6,84308E-08 3120,13 11,61 0,57 1,49 0,10 5,65 1,64832E-08 87,16 6,45 0,57 1,49 0,22 2,60 0,009390587 0,018106523 3,95 0,57 1,48 0,48 1,18 0,236903083 0,316625499 15,49 4751,54 12,21 0,57 1,48 0,13 4,48 7,42895E-06 2,29253E-05 7,43 2,89 0,57 1,48 0,59 0,96 0,335078702 0,419163895 7368,80 12,85 0,56 1,48 0,11 5,28 1,3241E-07 4,96209E-07 1374,19 10,42 0,56 1,48 0,11 4,97 6,69763E-07 2,35081E-06 8,60 0,56 1,48 0,13 4,41 1,01398E-05 3,07552E-05 387,17 205,45 7,68 0,56 1,47 0,16 3,41 0,000646436 0,00154043 87,30 6,45 0,55 1,46 0,23 2,38 0,01721459 0,031435854 5485,48 12,42 0,55 1,46 0,12 4,58 4,61915E-06 1,45588E-05 323,44 8,34 0,54 1,46 0,16 3,45 0,000566077 0,001359916 8,75 0,54 1,45 0,14 3,88 0,00010585 0,000283511 430,30 854,20 9,74 0,54 1,45 0,13 4,10 4,2167E-05 0,000118308 340,98 8,41 0,54 1,45 0,14 3,96 7,38206E-05 0,000200144 732,94 9,52 0,54 1,45 0,10 5,13 2,93033E-07 1,0593E-06 371,95 8,54 0,54 1,45 0,13 4,06 5,00493E-05 0,000138522 9,11 0,54 1,45 0,17 3,18 0,001470321 0,003282894 550,85 1286,59 10,33 0,53 1,45 0,11 4,96 6,95556E-07 2,43812E-06 3,75071E-05 2446,75 11,26 0,53 1,45 0,12 4,37 1,25212E-05 625,55 9,29 0,53 1,44 0,11 4,77 1,8491E-06 6,17217E-06 127,34 6,99 0,53 1,44 0,19 2,83 0,004608824 0,009383635 583,56 9,19 0,52 1,44 0,12 4,40 1,07001E-05 3,23069E-05 815,47 9,67 0,52 1,44 0,15 3,49 0,000476166 0,001156466 0,000652097 11129,14 13,44 0,52 1,43 0,14 3,65 0,000257697 1587,68 10,63 0,52 1,43 0,10 4,99 6,07034E-07 2,13628E-06 665,66 9,38 0,52 1,43 0,12 4,40 1,05876E-05 3,20038E-05 2520,16 11,30 0,51 1,43 0,14 3,59 0,000334108 0,000833763 444,39 8,80 0,51 1,42 0,13 3,84 0,000121249 0,000323453 1,33624E-05 1556,30 10,60 0,51 1,42 0,11 4,60 4,20938E-06 9008,02 13,14 0,51 1,42 0,14 3,52 0,000426528 0,00104643 40,20 5,33 0,51 1,42 0,30 1,71 0,087563304 0,133787061 13,81 3,79 0,51 1,42 0,48 1,05 0,292494354 0,375438405 88,65 6,47 0,50 1,42 0,24 2,14 0,032652488 0,056778574 0,000230643 586,81 9,20 0,50 1,42 0,13 3,93 8,51563E-05 8097,70 12,98 0,50 1,42 0,09 5,31 1,11042E-07 4,21483E-07 1605,74 10,65 0,50 1,42 0,12 4,35 1,35601E-05 4,03463E-05 1077,96 10,07 0,50 1,41 0,11 4,52 6,2344E-06 1,93288E-05 31,13 4,96 0,50 1,41 0,33 1,49 0,136310172 0,196808911 43,50 5,44 0,48 1,40 0,31 1,55 0,120566789 0,177575365 353,86 8,47 0,48 1,39 0,15 3,11 0,00184994 0,004058869 869,98 9,76 0,48 1,39 0,12 4,13 3,70493E-05 0,000104723 5613,94 79,85 378,21 1397,18 1807,60 260,20 418,65 477,87 2719,52 2,54 27,11 2268,74 396,32 797,00 1174,01 574,75 374,78 997,23 715,59 691,73 679,82 71,00 1722,18 59,82 45,38 753,95 920,46 438,15 660,00 1291,44 986,35 457,92 8353,51 279,31 7421,56 183,48 969,27 1381,46 93,06 26,80
12,45 6,32 8,56 10,45 10,82 8,02 8,71 8,90 11,41 1,34 4,76 11,15 8,63 9,64 10,20 9,17 8,55 9,96 9,48 9,43 9,41 6,15 10,75 5,90 5,50 9,56 9,85 8,78 9,37 10,33 9,95 8,84 13,03 8,13 12,86 7,52 9,92 10,43 6,54 4,74
0,47 0,47 0,47 0,47 0,47 0,47 0,47 0,46 0,46 0,46 0,46 0,45 0,45 0,45 0,45 0,44 0,44 0,44 0,44 0,44 0,44 0,44 0,44 0,44 0,44 0,43 0,43 0,43 0,43 0,43 0,43 0,43 0,43 0,43 0,43 0,43 0,43 0,43 0,43 0,43
1,39 1,39 1,39 1,38 1,38 1,38 1,38 1,38 1,38 1,38 1,37 1,37 1,37 1,36 1,36 1,36 1,36 1,36 1,36 1,36 1,36 1,36 1,35 1,35 1,35 1,35 1,35 1,35 1,35 1,35 1,35 1,35 1,35 1,35 1,35 1,35 1,35 1,34 1,34 1,34
0,13 0,24 0,13 0,09 0,13 0,15 0,20 0,12 0,11 0,72 0,44 0,09 0,14 0,10 0,09 0,12 0,14 0,10 0,14 0,12 0,14 0,23 0,14 0,30 0,33 0,12 0,13 0,13 0,11 0,11 0,10 0,12 0,13 0,13 0,13 0,18 0,15 0,17 0,21 0,39
3,59 1,99 3,53 5,04 3,66 3,10 2,37 3,81 4,33 0,64 1,03 5,24 3,31 4,36 4,74 3,73 3,25 4,44 3,07 3,74 3,25 1,90 3,15 1,48 1,32 3,57 3,26 3,25 3,80 4,07 4,19 3,50 3,32 3,19 3,34 2,42 2,92 2,53 2,03 1,09
0,000325182 0,046185105 0,000408201 4,60382E-07 0,000257099 0,001964355 0,017803394 0,000136433 1,5118E-05 0,523908889 0,301244304 1,64956E-07 0,000926221 1,29778E-05 2,0997E-06 0,00019267 0,001150103 8,9712E-06 0,002154559 0,000180499 0,001159776 0,058015404 0,001651394 0,140033378 0,186924951 0,000360498 0,001117946 0,001145619 0,000142097 4,61251E-05 2,7707E-05 0,000457766 0,000915249 0,001404205 0,000833448 0,015417694 0,003450529 0,011371055 0,042810642 0,277040845
0,000813568 0,076888362 0,001005181 1,64193E-06 0,000651203 0,004288654 0,032355416 0,000361417 4,48309E-05 0,608935222 0,383887825 6,12133E-07 0,002141835 3,8831E-05 6,9217E-06 0,000498463 0,002614048 2,74298E-05 0,004669383 0,000468804 0,002629287 0,093983509 0,003661627 0,201352022 0,25827332 0,000892861 0,002547499 0,002606087 0,000376047 0,000129005 8,0019E-05 0,001115857 0,002118306 0,003145845 0,001942519 0,028487352 0,007184996 0,021642473 0,072129282 0,359422619
Locus USA300HOU 0751 USA300HOU 1320 USA300HOU_2221 USA300HOU 1923 USA300HOU_2550 USA300HOU_0227 USA300HOU 1890 USA300HOU 1344 USA300HOU_2583 USA300HOU 2058 USA300HOU_1785 USA300HOU 2439 USA300HOU 1697 USA300HOU_1363 USA300HOU 2539 USA300HOU_0744 USA300HOU_2499 USA300HOU 1362 USA300HOU_1290 USA300HOU_2519 USA300HOU 1345 USA300HOU_1765 USA300HOU_2218 USA300HOU 2240 USA300HOU 0149 USA300HOU_1000 USA300HOU 2510 USA300HOU 0885 USA300HOU_1561 USA300HOU 2179 USA300HOU_0524 USA300HOU 0674 USA300HOU_0684 USA300HOU 1397 USA300HOU 1714 USA300HOU_2483 USA300HOU 1860 USA300HOU_1386 USA300HOU_2357 USA300HOU 1160 USA300HOU_0543 USA300HOU_1562 USA300HOU 1667 USA300HOU_1236 USA300HOU_1317 USA300HOU 1353 USA300HOU 1346 USA300HOU_0031 USA300HOU 1027 USA300HOU 0346 USA300HOU_0899 USA300HOU 2324 USA300HOU_2423 USA300HOU_0203 USA300HOU 0687 USA300HOU_0886 USA300HOU_2223 USA300HOU 1642 USA300HOU_2190 USA300HOU_1736 USA300HOU 1526 USA300HOU 1045 USA300HOU_1296 USA300HOU 2569 USA300HOU 0697 USA300HOU_1456 USA300HOU 1133 USA300HOU_0501 USA300HOU_0295 USA300HOU 0522 USA300HOU_0139 USA300HOU_2305 USA300HOU 1685 USA300HOU 1370 USA300HOU_1413 USA300HOU 0345 USA300HOU 0072 USA300HOU_1047 USA300HOU 2696 USA300HOU_1062 USA300HOU_1077 USA300HOU 0723 USA300HOU_1846 USA300HOU_0914 USA300HOU 1209 USA300HOU_0707 USA300HOU_1134 USA300HOU 0626 USA300HOU_1845 USA300HOU_0439 USA300HOU 1591 USA300HOU 0156 USA300HOU_0926 USA300HOU 0975 USA300HOU_1032 USA300HOU_1706 USA300HOU 2331 USA300HOU_1874 USA300HOU_1669 USA300HOU 2561 USA300HOU_2302 USA300HOU_0576 USA300HOU 0532 USA300HOU_1908 USA300HOU_1046 USA300HOU 2549 USA300HOU 0586 USA300HOU_1459 USA300HOU 0148 USA300HOU_0708 USA300HOU_0987 USA300HOU 1116 USA300HOU_0769 USA300HOU_0853 USA300HOU 2151 USA300HOU_1735 USA300HOU_0627 USA300HOU 1534 USA300HOU_2317 USA300HOU_2239 USA300HOU 0998 USA300HOU_2127 USA300HOU_1060 USA300HOU 2298 USA300HOU 0388 USA300HOU_1527 USA300HOU 1089 USA300HOU_0619 USA300HOU_2541 USA300HOU 0244 USA300HOU_2222 USA300HOU_1374 USA300HOU 1990 USA300HOU_1873 USA300HOU_1061 USA300HOU 2137 USA300HOU_1306 USA300HOU_0441 USA300HOU 1348 USA300HOU 1755 USA300HOU_1621 USA300HOU 1709 USA300HOU_1861 USA300HOU_0743 USA300HOU 0344 USA300HOU_0401 USA300HOU_1862 USA300HOU 1570 USA300HOU_1293 USA300HOU_2350 USA300HOU 0898 USA300HOU_1125 USA300HOU_0054 USA300HOU 1637 USA300HOU 0662 USA300HOU_0266 USA300HOU 1409 USA300HOU_1840 USA300HOU_1569 USA300HOU 1571
Gene symbol dtpT pstB secY aldH USA300HOU_2550 USA300HOU_0227 murT USA300HOU 1344 pyrD USA300HOU 2058 USA300HOU 1785 USA300HOU 2439 uspA1 dfrA mvaA recQ1 USA300HOU_2499 fakB2 alsT USA300HOU_2519 USA300HOU 1345 USA300HOU 1765 rpmJ USA300HOU 2240 tet38 USA300HOU_1000 USA300HOU 2510 lipA USA300HOU_1561 USA300HOU 2179 mrnC USA300HOU 0674 pitR USA300HOU 1397 USA300HOU 1714 USA300HOU_2483 USA300HOU 1860 USA300HOU_1386 USA300HOU_2357 thiN kbl trmK tig bsaA USA300HOU_1317 USA300HOU 1353 USA300HOU 1346 mecA USA300HOU 1027 USA300HOU 0346 USA300HOU_0899 USA300HOU 2324 USA300HOU 2423 glcA USA300HOU 0687 USA300HOU_0886 rpmD thrR cobB USA300HOU_1736 nusB USA300HOU 1045 msrR USA300HOU 2569 USA300HOU 0697 USA300HOU_1456 lspA divIC USA300HOU_0295 cysE USA300HOU_0139 USA300HOU_2305 pfkA USA300HOU 1370 rpsA gcvH-L USA300HOU 0072 typA USA300HOU 2696 coaD USA300HOU_1077 fruA USA300HOU_1846 USA300HOU_0914 USA300HOU 1209 USA300HOU_0707 USA300HOU_1134 USA300HOU 0626 fumC USA300HOU_0439 comEA USA300HOU 0156 addA ugtP rpoY USA300HOU_1706 USA300HOU 2331 ampS thrS USA300HOU 2561 USA300HOU_2302 USA300HOU_0576 rplA hisR USA300HOU_1046 rocA USA300HOU 0586 USA300HOU_1459 deoD1 USA300HOU_0708 USA300HOU_0987 USA300HOU 1116 USA300HOU_0769 USA300HOU_0853 glmM USA300HOU_1735 USA300HOU_0627 lipM USA300HOU 2317 USA300HOU_2239 USA300HOU 0998 deoD USA300HOU_1060 USA300HOU 2298 ssb USA300HOU_1527 USA300HOU 1089 USA300HOU_0619 USA300HOU_2541 fadX rplO USA300HOU_1374 USA300HOU 1990 USA300HOU_1873 rsmD USA300HOU 2137 trpF lpl3 sucA USA300HOU_1755 mnmA USA300HOU 1709 USA300HOU_1861 USA300HOU_0743 USA300HOU 0344 USA300HOU_0401 USA300HOU_1862 dgkA USA300HOU_1293 USA300HOU_2350 USA300HOU 0898 USA300HOU_1125 USA300HOU_0054 yajC pbp4 tarI USA300HOU 1409 USA300HOU_1840 cdd ybeY
Regulon -
Function proton-dependent oligopeptide transporter family protein phosphate transporter ATP-binding protein preprotein translocase subunit SecY aldehyde dehydrogenase galactoside O-acetyltransferase hypothetical protein Mur ligase CbbQ/NirQ/NorQ/GpvN family protein dihydroorotate dehydrogenase 2 S1 RNA-binding domain-containing protein hypothetical protein hypothetical protein universal stress protein dihydrofolate reductase hydroxymethylglutaryl-CoA reductase, degradative ATP-dependent DNA helicase RecQ1 transporter hypothetical protein sodium:alanine symporter family protein hypothetical protein hypothetical protein N-acetylmuramoyl-L-alanine amidase 50S ribosomal protein L36 hypothetical protein tetracycline resistance protein hypothetical protein MarR family transcriptional regulator lipoyl synthase hypothetical protein alcohol dehydrogenase, zinc-containing hypothetical protein hypothetical protein hypothetical protein hypothetical protein HAD superfamily hydrolase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein 2-amino-3-ketobutyrate coenzyme A ligase hypothetical protein trigger factor glutathione peroxidase hypothetical protein IS200 family transposase hypothetical protein penicillin-binding protein 2' hypothetical protein hypothetical protein
USA300HOU_1448 USA300HOU 0425 USA300HOU 2143 USA300HOU_2194 USA300HOU 0478 USA300HOU_0422 USA300HOU_1768 USA300HOU 1217 USA300HOU_2086 USA300HOU_1914
USA300HOU_1448 USA300HOU 0425 USA300HOU 2143 USA300HOU_2194 USA300HOU 0478 ssl1 USA300HOU_1768 recA USA300HOU_2086 nadE
-
hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein superantigen-like protein 1 hypothetical protein recombinase A hypothetical protein NAD synthetase
hypothetical protein hypothetical protein PTS system, IIABC components hypothetical protein hypothetical protein 50S ribosomal protein L30 hypothetical protein NAD-dependent deacetylase hypothetical protein transcription antitermination protein NusB hypothetical protein transcriptional regulator glyoxalase hypothetical protein SNF2 family protein lipoprotein signal peptidase cell-division protein divIC hypothetical protein serine acetyltransferase hypothetical protein hypothetical protein 6-phosphofructokinase hypothetical protein 30S ribosomal protein S1 glycine cleavage system H protein universal stress protein GTP-binding protein TypA anion transporter family protein phosphopantetheine adenylyltransferase hypothetical protein hypothetical protein cyclophilin type peptidyl-prolyl cis-trans isomerase GntR family transcriptional regulator ABC transporter ATP-binding protein ribosomal large subunit pseudouridine synthase D putative lipoprotein fumarate hydratase hypothetical protein comE operon protein 1-like protein hypothetical protein exonuclease RexA diacylglycerol glucosyltransferase hypothetical protein GAF domain-containing protein esterase aminopeptidase PepS threonyl-tRNA synthetase staphyloxanthin biosynthesis protein hypothetical protein hypothetical protein 50S ribosomal protein L1 hypothetical protein hypothetical protein 1-pyrroline-5-carboxylate dehydrogenase hypothetical protein hypothetical bacteriophage protein purine nucleoside phosphorylase ABC transporter ATP-binding protein hypothetical protein hypothetical protein glycerate kinase pathogenicity island protein phosphoglucosamine mutase glutamyl aminopeptidase hypothetical protein lipoate-protein ligase A family protein hypothetical protein hypothetical protein acetyltransferase purine nucleoside phosphorylase hypothetical protein RpiR family phosphosugar-binding transcriptional regulator single-stranded DNA-binding protein hypothetical protein hypothetical protein hypothetical protein methylated-DNA--protein-cysteine methyltransferase propionate CoA-transferase 50S ribosomal protein L15 amino acid permease phiPVL ORF044-like protein hypothetical protein hypothetical protein N-(5'-phosphoribosyl)anthranilate isomerase hypothetical protein 2-oxoglutarate dehydrogenase E1 component lysophospholipase tRNA-specific 2-thiouridylase MnmA glycerophosphoryl diester phosphodiesterase toxin exporting ABC transporter permease/ATP-binding protein ABC transporter ATP-binding protein hypothetical protein hypothetical protein hypothetical protein diacylglycerol kinase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein preprotein translocase, YajC subunit penicillin-binding protein 4 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase hypothetical protein hypothetical protein cytidine deaminase hypothetical protein
Base mean A-value M-value Fold change Standard error Wald statistic P-value Adjusted P-value 2191,36 11,10 0,43 1,34 0,10 4,10 4,04345E-05 0,000113928 42,99 5,43 0,42 1,34 0,30 1,44 0,150556181 0,214722368 1519,17 10,57 0,41 1,33 0,10 4,00 6,3961E-05 0,00017466 1563,67 10,61 0,41 1,33 0,10 4,06 4,86768E-05 0,000135287 158,59 7,31 0,41 1,33 0,16 2,51 0,012009149 0,022754007 12,57 3,65 0,41 1,33 0,50 0,81 0,416839752 0,501831998 181,60 7,50 0,41 1,33 0,16 2,47 0,013460828 0,02516919 447,46 8,81 0,41 1,33 0,12 3,53 0,000416182 0,001023884 718,26 9,49 0,41 1,32 0,12 3,47 0,00051432 0,001243447 1686,89 10,72 0,40 1,32 0,10 4,04 5,24125E-05 0,000144761 334,34 8,39 0,40 1,32 0,14 2,96 0,003101594 0,00653006 523,83 9,03 0,40 1,32 0,13 3,16 0,001583017 0,003522676 5547,99 12,44 0,40 1,32 0,18 2,29 0,022187069 0,039622272 781,47 9,61 0,40 1,32 0,11 3,69 0,000226061 0,000579214 291,87 8,19 0,40 1,32 0,14 2,91 0,003606515 0,007486337 1680,96 10,72 0,40 1,32 0,11 3,50 0,000465615 0,001132911 851,82 9,73 0,40 1,32 0,13 3,00 0,002678517 0,005711733 887,70 9,79 0,40 1,32 0,11 3,61 0,000312148 0,00078243 1097,18 10,10 0,39 1,31 0,11 3,72 0,000196555 0,000507528 56,89 5,83 0,39 1,31 0,26 1,53 0,126830583 0,184955466 691,54 9,43 0,39 1,31 0,11 3,63 0,000282142 0,000710571 7212,26 12,82 0,39 1,31 0,11 3,66 0,000256681 0,000650764 461,78 8,85 0,39 1,31 0,13 3,04 0,002370328 0,00509132 265,56 8,05 0,39 1,31 0,15 2,61 0,009016063 0,017434993 118,65 6,89 0,39 1,31 0,20 1,94 0,052211876 0,085739774 4085,83 12,00 0,38 1,31 0,09 4,39 1,1493E-05 3,46224E-05 273,26 8,09 0,38 1,30 0,14 2,66 0,007829367 0,015341171 1821,54 10,83 0,38 1,30 0,10 3,77 0,000161504 0,000422774 739,33 9,53 0,38 1,30 0,10 3,72 0,000201298 0,000518767 641,00 9,32 0,38 1,30 0,11 3,41 0,000649415 0,00154476 352,38 8,46 0,38 1,30 0,16 2,36 0,018154227 0,032947939 2195,09 11,10 0,38 1,30 0,15 2,58 0,009916958 0,019066105 9,35 0,38 1,30 0,11 3,46 0,000531141 0,001281783 651,17 75,71 6,24 0,37 1,30 0,23 1,62 0,104571942 0,1567989 2287,69 11,16 0,37 1,29 0,09 4,27 1,94213E-05 5,70822E-05 529,99 9,05 0,37 1,29 0,13 2,86 0,004214773 0,008645493 1318,12 10,36 0,37 1,29 0,10 3,69 0,000225042 0,000577158 3,00 0,37 1,29 0,57 0,65 0,517595957 0,602916466 7,97 263,97 8,04 0,37 1,29 0,15 2,48 0,013085046 0,024570295 352,23 8,46 0,36 1,29 0,13 2,86 0,004178256 0,008585945 1515,45 10,57 0,36 1,28 0,11 3,41 0,000647812 0,001542326 526,48 9,04 0,36 1,28 0,13 2,70 0,006862521 0,013566756 11,07 0,36 1,28 0,11 3,30 0,000972782 0,002241701 2154,49 1172,69 10,20 0,36 1,28 0,10 3,52 0,000439215 0,001073591 288,76 8,17 0,35 1,28 0,16 2,20 0,028116363 0,049375529 25,19 4,65 0,35 1,28 0,39 0,91 0,364148449 0,450019735 1101,08 10,10 0,35 1,28 0,12 3,04 0,002331157 0,005015291 2384,34 11,22 0,35 1,27 0,10 3,53 0,00041786 0,001027063 542,92 9,08 0,35 1,27 0,18 1,98 0,048038285 0,079624281 67,11 6,07 0,35 1,27 0,26 1,35 0,178113482 0,247385008 0 1970,40 10,94 0,35 1,27 0,13 2,65 0,007970478 0,015571735 286,76 8,16 0,35 1,27 0,14 2,45 0,014141086 0,02631153 295,44 8,21 0,35 1,27 0,14 2,55 0,010705587 0,020478579 427,73 8,74 0,35 1,27 0,14 2,42 0,015484755 0,028591378 533,11 9,06 0,34 1,27 0,12 2,98 0,002897954 0,00613535 432,41 8,76 0,34 1,27 0,13 2,70 0,006959924 0,013749084 241,60 7,92 0,34 1,26 0,17 2,02 0,043373749 0,072847061 412,92 8,69 0,33 1,26 0,14 2,33 0,019687982 0,0355615 441,19 8,79 0,33 1,26 0,14 2,29 0,021826736 0,039105622 684,83 9,42 0,33 1,26 0,16 2,11 0,035010095 0,060208299 724,12 9,50 0,33 1,25 0,12 2,72 0,006553016 0,013042219 1091,89 10,09 0,33 1,25 0,12 2,84 0,004550379 0,009271746 341,04 8,41 0,32 1,25 0,13 2,45 0,014455715 0,02687812 79,45 6,31 0,32 1,25 0,24 1,36 0,174863016 0,243506831 639,47 9,32 0,32 1,25 0,12 2,76 0,005737613 0,011514229 76,90 6,26 0,32 1,25 0,24 1,34 0,180838339 0,250907294 0,146421986 110,57 6,79 0,32 1,25 0,19 1,66 0,096494128 1017,67 9,99 0,32 1,25 0,10 3,11 0,001892604 0,004142216 1,80 0,32 1,25 0,18 0,072391834 0,113881055 157,72 7,30 712,34 9,48 0,32 1,25 0,11 2,76 0,005723782 0,011495153 0,550926225 18,89 4,24 0,32 1,24 0,43 0,73 0,464669051 1183,35 10,21 0,32 1,24 0,11 2,96 0,003095992 0,006523434 2901,80 11,50 0,31 1,24 0,10 3,21 0,001336572 0,00300446 1,08 0,31 1,24 0,73 0,43 0,668757726 0,734859089 2,12 4174,39 12,03 0,31 1,24 0,12 2,51 0,012112342 0,022922004 0,453001075 64,79 6,02 0,31 1,24 0,34 0,90 0,367754354 6508,98 12,67 0,31 1,24 0,13 2,42 0,015523221 0,028622622 501,74 8,97 0,31 1,24 0,13 2,30 0,021413558 0,038443123 0,033763119 550,48 9,10 0,30 1,24 0,13 2,35 0,018654218 379,85 8,57 0,30 1,23 0,12 2,49 0,012635319 0,023793084 8,53 0,30 1,23 0,16 1,91 0,056488203 0,091741538 368,61 0 178,38 7,48 0,30 1,23 0,16 1,85 0,064336939 0,10297786 538,84 9,07 0,30 1,23 0,12 2,47 0,013478908 0,025185274 0,026901192 1524,75 10,57 0,30 1,23 0,12 2,45 0,014478248 481,11 8,91 0,30 1,23 0,12 2,44 0,014768011 0,027401261 9,13 0,30 1,23 0,11 2,68 0,007324353 0,014404741 560,70 227,22 7,83 0,30 1,23 0,15 2,02 0,043549184 0,073003269 590,65 9,21 0,30 1,23 0,11 2,58 0,009934089 0,019085232 0,037034472 1229,04 10,26 0,29 1,23 0,13 2,32 0,020587096 60,75 5,92 0,29 1,22 0,27 1,08 0,279972805 0,362695145 7,83 0,29 1,22 0,16 1,78 0,074330998 0,116311815 227,15 253,50 7,99 0,29 1,22 0,14 2,10 0,035678563 0,061199445 627,47 9,29 0,29 1,22 0,11 2,72 0,006440597 0,012828086 1132,56 10,15 0,29 1,22 0,12 2,37 0,017593222 0,032039198 1029,53 10,01 0,29 1,22 0,10 2,89 0,003856118 0,007973311 9,16 0,29 1,22 0,15 1,95 0,050860952 0,083936366 571,77 1495,15 10,55 0,29 1,22 0,12 2,32 0,020413531 0,036747121 2072,25 11,02 0,29 1,22 0,09 3,04 0,002398233 0,005142942 31241,11 14,93 0,29 1,22 0,09 3,25 0,00114483 0,002606087 111,97 6,81 0,28 1,22 0,21 1,35 0,17753899 0,246716054 9,64 0,28 1,22 0,15 1,93 0,053357629 0,087405192 795,41 122,76 6,94 0,28 1,21 0,19 1,50 0,134467736 0,19449144 1097,15 10,10 0,28 1,21 0,13 2,19 0,028764032 0,050379718 1449,91 10,50 0,28 1,21 0,13 2,20 0,0280623 0,049313182 160,75 7,33 0,27 1,21 0,23 1,21 0,226159762 0,303948654 8,79 0,27 1,21 0,14 2,02 0,043586476 0,073019715 441,28 237,87 7,89 0,27 1,21 0,15 1,77 0,076373851 0,11894802 0,382575331 72,60 6,18 0,27 1,21 0,26 1,04 0,299782401 66,84 6,06 0,27 1,21 0,27 1,01 0,310733241 0,393901824 616,63 9,27 0,27 1,20 0,11 2,38 0,017294155 0,031559456 293,75 8,20 0,27 1,20 0,15 1,83 0,066772639 0,106400756 22,49 4,49 0,27 1,20 0,43 0,62 0,536466015 0,620544276 0,015449281 851,12 9,73 0,26 1,20 0,10 2,66 0,007901985 1205,10 10,23 0,26 1,20 0,09 2,83 0,004714446 0,009566531 1648,11 10,69 0,26 1,20 0,09 2,85 0,004388409 0,008948581 364,94 8,51 0,26 1,20 0,12 2,11 0,034541532 0,059479489 120,11 6,91 0,26 1,20 0,20 1,29 0,197888936 0,27158621 0,024634976 951,11 9,89 0,26 1,20 0,10 2,48 0,013128764 431,31 8,75 0,26 1,20 0,13 1,95 0,050893256 0,083937542 7,60 2,93 0,26 1,19 0,61 0,42 0,673885817 0,739576462 350,42 8,45 0,26 1,19 0,12 2,06 0,039842344 0,067513462 807,89 9,66 0,26 1,19 0,16 1,57 0,11730397 0,173346301 0,514274901 39,29 5,30 0,25 1,19 0,32 0,79 0,428723713 3654,09 11,84 0,25 1,19 0,09 2,67 0,007683452 0,015077498 589,75 9,20 0,25 1,19 0,13 1,86 0,062246476 0,100053773 677,80 9,40 0,25 1,19 0,12 2,05 0,04029002 0,068141683 17,98 4,17 0,25 1,19 0,43 0,59 0,557764382 0,639059924 5301,21 12,37 0,24 1,18 0,12 2,02 0,042963991 0,072295963 280,93 8,13 0,24 1,18 0,14 1,64 0,100598579 0,152128871 782,60 9,61 0,24 1,18 0,12 1,95 0,0516828 0,08497599 772,20 9,59 0,23 1,18 0,12 2,00 0,045874024 0,076418358 106,43 6,73 0,23 1,17 0,21 1,08 0,278534051 0,361104897 13,45 3,75 0,23 1,17 0,50 0,46 0,646929592 0,716730973 1,99 0,046516023 0,077390778 1126,69 10,14 0,23 1,17 0,11 341,21 8,41 0,23 1,17 0,13 1,76 0,077929276 0,120874539 0 2772,20 11,44 0,23 1,17 0,09 2,38 0,017199909 0,031430645 93,06 6,54 0,23 1,17 0,23 0,97 0,331169166 0,415446872 73,37 6,20 0,22 1,17 0,24 0,94 0,347765953 0,432924337 1,95 0,051396446 0,084714862 665,09 9,38 0,22 1,17 0,11 884,41 9,79 0,22 1,17 0,11 2,09 0,036786882 0,06289752 952,16 9,90 0,22 1,17 0,11 2,05 0,040030608 0,067789245 146,03 7,19 0,22 1,16 0,18 1,24 0,215517899 0,292158703 576,05 9,17 0,22 1,16 0,11 1,92 0,055153114 0,089869682 2104,71 11,04 0,22 1,16 0,10 2,21 0,027194552 0,047915069 87,59 6,45 0,22 1,16 0,27 0,81 0,420351784 0,505601942 473,65 8,89 0,22 1,16 0,12 1,75 0,080396535 0,124266197 582,39 9,19 0,21 1,16 0,11 1,92 0,054298467 0,088673034 465,30 8,86 0,21 1,16 0,12 1,77 0,076105624 0,118669392 2087,33 11,03 0,21 1,16 0,10 2,08 0,037433177 0,063838223 978,82 9,93 0,21 1,16 0,11 1,92 0,054420639 0,088817959 360,00 8,49 0,21 1,16 0,14 1,55 0,122324786 0,179567379 2251,09 11,14 0,21 1,16 0,10 2,10 0,035578402 0,061067063 65,29 6,03 0,21 1,16 0,26 0,81 0,419202114 0,504447471 730,54 9,51 0,21 1,16 0,15 1,37 0,170342686 0,238336238 547,68 9,10 0,20 1,15 0,12 1,75 0,080344578 0,124258175 1511,71 10,56 0,20 1,15 0,15 1,36 0,173522439 0,2419898 321,71 8,33 0,20 1,15 0,14 1,46 0,143340824 0,205664176 164,04 7,36 0,20 1,15 0,18 1,09 0,274811849 0,357403369 479,28 8,90 0,20 1,15 0,13 1,55 0,120148215 0,177099938 667,89 9,38 0,20 1,15 0,11 1,79 0,072688604 0,114212667 12,27 6,04 995,97 86,49 1611,94 336,92 1091,41 42855,36 6,91 303,34
3,62 2,59 9,96 6,43 10,65 8,40 10,09 15,39 2,79 8,24
0,20 0,19 0,19 0,19 0,19 0,19 0,19 0,19 0,19 0,19
1,15 1,14 1,14 1,14 1,14 1,14 1,14 1,14 1,14 1,14
0,51 0,63 0,11 0,21 0,14 0,14 0,11 0,10 0,63 0,14
0,39 0,31 1,81 0,90 1,35 1,32 1,70 1,82 0,30 1,33
0,699645318 0,756173452 0,070694711 0,369995114 0,175949469 0,186210012 0,089207032 0,069100812 0,763871051 0,184273978
0,762180242 0,813285765 0,111674107 0,455550054 0,244635133 0,257419356 0,136063769 0,109416482 0,819214839 0,254875564
Locus USA300HOU 2109 USA300HOU 2276 USA300HOU_2534 USA300HOU 0851 USA300HOU 1998 USA300HOU_0110 USA300HOU 2697 USA300HOU_2152 USA300HOU_0039 USA300HOU 1321 USA300HOU_0606 USA300HOU_1504 USA300HOU 0664 USA300HOU_1532 USA300HOU_1912 USA300HOU 1626 USA300HOU_0373 USA300HOU_2398 USA300HOU 1565 USA300HOU 0455 USA300HOU_1025 USA300HOU 1319 USA300HOU_2433 USA300HOU_2116 USA300HOU 1705 USA300HOU_0811 USA300HOU_0147 USA300HOU 1737 USA300HOU_1159 USA300HOU_1915 USA300HOU 1643 USA300HOU 2356 USA300HOU_0357 USA300HOU 1627 USA300HOU 2111 USA300HOU_1779 USA300HOU 2585 USA300HOU_0852 USA300HOU_1268 USA300HOU 0779 USA300HOU_1414 USA300HOU_1528 USA300HOU 1153 USA300HOU_1925 USA300HOU_0057 USA300HOU 0989 USA300HOU 1369 USA300HOU_1452 USA300HOU 1610 USA300HOU 1568 USA300HOU_0831 USA300HOU 1445 USA300HOU_2600 USA300HOU_1875 USA300HOU 0456 USA300HOU_2716 USA300HOU_2316 USA300HOU 2245 USA300HOU_0715 USA300HOU_2586 USA300HOU 1560 USA300HOU 1208 USA300HOU_1641 USA300HOU 0267 USA300HOU 0371 USA300HOU_2064 USA300HOU 1154 USA300HOU_0738 USA300HOU_1248 USA300HOU 0289 USA300HOU_0781 USA300HOU_1695 USA300HOU 2238 USA300HOU 2591 USA300HOU_0855 USA300HOU 2642 USA300HOU 0694 USA300HOU_0671 USA300HOU 1533 USA300HOU_1044 USA300HOU_0160 USA300HOU 2675 USA300HOU_0527 USA300HOU_2592 USA300HOU 1085 USA300HOU_0056 USA300HOU_1145 USA300HOU 0580 USA300HOU_0628 USA300HOU_0908 USA300HOU 2518 USA300HOU 1696 USA300HOU_2340 USA300HOU 1285 USA300HOU_2453 USA300HOU_1576 USA300HOU 1030 USA300HOU_1590 USA300HOU_1969 USA300HOU 1960 USA300HOU_2159 USA300HOU_0548 USA300HOU 1440 USA300HOU_2065 USA300HOU_1198 USA300HOU 1162 USA300HOU 1252 USA300HOU_1460 USA300HOU 2713 USA300HOU_1924 USA300HOU_1751 USA300HOU 2265 USA300HOU_0362 USA300HOU_1493 USA300HOU 0383 USA300HOU_0500 USA300HOU_2318 USA300HOU 0844 USA300HOU_1617 USA300HOU_0820 USA300HOU 2120 USA300HOU_1920 USA300HOU_0103 USA300HOU 0893 USA300HOU 1118 USA300HOU_2047 USA300HOU 0693 USA300HOU_0764 USA300HOU_1420 USA300HOU 0864 USA300HOU_2286 USA300HOU_0559 USA300HOU 2584 USA300HOU_2502 USA300HOU_1292 USA300HOU 2485 USA300HOU_1895 USA300HOU_0370 USA300HOU 1615 USA300HOU 0382 USA300HOU_1059 USA300HOU 0575 USA300HOU_0609 USA300HOU_2608 USA300HOU 2548 USA300HOU_2335 USA300HOU_1727 USA300HOU 1906 USA300HOU_2309 USA300HOU_2565 USA300HOU 1764 USA300HOU_2136 USA300HOU_0384 USA300HOU 1215 USA300HOU 1441 USA300HOU_1492 USA300HOU 0261 USA300HOU_1341 USA300HOU_0566 USA300HOU 2287 USA300HOU_2414 USA300HOU_0445 USA300HOU 2508 USA300HOU_2337 USA300HOU_1801 USA300HOU 2063 USA300HOU 1907 USA300HOU_1601 USA300HOU 1572 USA300HOU_0973
Gene symbol rho sarR cidR sek USA300HOU 1998 USA300HOU_0110 rarD USA300HOU_2152 ccrB pstA iolS proC USA300HOU 0664 USA300HOU_1532 USA300HOU_1912 USA300HOU 1626 USA300HOU_0373 gpmA USA300HOU 1565 USA300HOU 0455 ptsH phoU USA300HOU_2433 rpoE ezrA smpB USA300HOU_0147 USA300HOU 1737 cfxE USA300HOU_1915 obgE USA300HOU 2356 glpT USA300HOU 1627 USA300HOU 2111 tnp2 USA300HOU 2585 seq nucI saHPF USA300HOU_1414 accC fmt USA300HOU_1925 speG menA USA300HOU 1369 USA300HOU_1452 greA era USA300HOU_0831 USA300HOU 1445 lqo USA300HOU_1875 USA300HOU 0456 rnpA rpiA USA300HOU 2245 USA300HOU_0715 USA300HOU_2586 cshB ftsK ruvA tarJ USA300HOU 0371 mazE sun USA300HOU 0738 USA300HOU_1248 lytM USA300HOU_0781 USA300HOU_1695 glcU panD USA300HOU_0855 pmi ccpE dhaK USA300HOU 1533 USA300HOU_1044 USA300HOU_0160 hisA sigH panC sdhB USA300HOU_0056 USA300HOU_1145 hemQ USA300HOU 0628 mnhE USA300HOU 2518 ald2 USA300HOU_2340 USA300HOU 1285 USA300HOU_2453 rpsU ktrA comEB USA300HOU_1969 USA300HOU 1960 sepA USA300HOU_0548 USA300HOU 1440 alr nusA fakA USA300HOU 1252 USA300HOU_1460 gidB USA300HOU_1924 USA300HOU_1751 USA300HOU 2265 USA300HOU_0362 srrB USA300HOU 0383 USA300HOU_0500 USA300HOU_2318 USA300HOU 0844 USA300HOU 1617 vwb USA300HOU 2120 pncA USA300HOU_0103 dltA mraZ USA300HOU_2047 USA300HOU 0693 murB recQ2 USA300HOU 0864 USA300HOU_2286 USA300HOU_0559 USA300HOU 2584 USA300HOU_2502 USA300HOU_1292 USA300HOU 2485 USA300HOU_1895 USA300HOU_0370 USA300HOU 1615 USA300HOU_0382 USA300HOU_1059 USA300HOU 0575 USA300HOU_0609 USA300HOU_2608 USA300HOU 2548 USA300HOU_2335 aroA2 pcrA USA300HOU_2309 USA300HOU_2565 arsC USA300HOU_2136 ychF pgsA USA300HOU_1441 USA300HOU_1492 USA300HOU 0261 tnp1 USA300HOU_0566 USA300HOU 2287 USA300HOU_2414 lpl7 USA300HOU 2508 tcaB splF mazF pcrB USA300HOU_1601 phoH USA300HOU_0973
Regulon -
Function transcription termination factor Rho accessory regulator R LysR family transcriptional regulator enterotoxin hypothetical protein hypothetical protein rarD protein hypothetical protein phosphate ABC transporter permease aldo/keto reductase oxidoreductase pyrroline-5-carboxylate reductase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein phosphoglyceromutase hypothetical protein hypothetical protein phosphocarrier protein ptsH phosphate transport system protein PhoU drug transporter DNA-directed RNA polymerase subunit delta septation ring formation regulator EzrA SsrA-binding protein GntR family transcriptional regulator metallo-beta-lactamase ribulose-phosphate 3-epimerase nicotinate phosphoribosyltransferase GTPase ObgE hypothetical protein glycerol-3-phosphate transporter hypothetical protein hypothetical protein IS200 family transposase hypothetical protein enterotoxin type I thermonuclease ribosomal subunit interface protein hypothetical protein acetyl-CoA carboxylase biotin carboxylase subunit methionyl-tRNA formyltransferase hypothetical protein spermidine N(1)-acetyltransferase 1,4-dihydroxy-2-naphthoate octaprenyltransferase hypothetical protein prophage L54a, HK97 family portal protein transcription elongation factor GreA GTP-binding protein Era phosphoglycerate mutase prophage L54a, major tail protein malate:quinone oxidoreductase hypothetical protein hypothetical protein ribonuclease P ribose-5-phosphate isomerase A hypothetical protein hypothetical protein hypothetical protein DEAD/DEAH box helicase FtsK/SpoIIIE family protein Holliday junction DNA helicase RuvA alcohol dehydrogenase, zinc-containing hypothetical protein hypothetical protein sun protein hypothetical protein hypothetical protein peptidoglycan hydrolase LytM hypothetical protein hypothetical protein sugar transporter aspartate alpha-decarboxylase transcriptional regulator mannose-6-phosphate isomerase LysR family transcriptional regulator dihydroxyacetone kinase subunit DhaK hypothetical protein hypothetical protein hypothetical protein 1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino] imidazole-4hypothetical protein pantoate--beta-alanine ligase succinate dehydrogenase iron-sulfur subunit hypothetical protein hypothetical protein heme peroxidase traG protein monovalent cation/H+ antiporter subunit E acetyltransferase alanine dehydrogenase hypothetical protein hypothetical protein transporter 30S ribosomal protein S21 TrkA potassium uptake family protein comE operon protein 2 phi77 ORF015-like protein protease phi77 ORF100-like protein hypothetical protein hypothetical protein hypothetical protein alanine racemase transcription elongation factor NusA DAK2 domain-containing protein hypothetical protein hypothetical protein 16S rRNA methyltransferase GidB hypothetical protein hypothetical protein inosine-uridine preferring nucleoside hydrolase hypothetical protein sensor histidine kinase SrrB hypothetical protein S4 domain-containing protein hypothetical protein hypothetical protein hypothetical protein staphylocoagulase precursor hypothetical protein isochorismatase hypothetical protein D-alanine--poly(phosphoribitol) ligase subunit 1 DltA cell division protein MraZ hypothetical protein hypothetical protein UDP-N-acetylenolpyruvoylglucosamine reductase ATP-dependent DNA helicase RecQ2 hypothetical protein glycerate dehydrogenase glycosyl transferase, group 1 family protein hypothetical protein MarR family transcriptional regulator hypothetical protein permease hypothetical protein Cro/CI family transcriptional regulator hypothetical protein hypothetical protein hypothetical protein hypothetical protein HD domain-containing protein hypothetical protein hypothetical protein hypothetical protein bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase ATP-dependent DNA helicase PcrA M20/M25/M40 family peptidase hypothetical protein arsenate reductase hypothetical protein GTP-dependent nucleic acid-binding protein CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase possible bacteriophage tail protein hypothetical protein hexitol dehydrogenase HAD superfamily hydrolase hypothetical protein hypothetical protein hypothetical protein phospholipase/carboxylesterase tcaB protein serine protease SplF PemK family protein geranylgeranylglyceryl phosphate synthase hypothetical protein PhoH family protein hypothetical protein
Base mean A-value M-value Fold change Standard error Wald statistic P-value Adjusted P-value 2078,64 11,02 0,19 1,14 0,09 2,13 0,033372971 0,057804422 3181,24 11,64 0,18 1,14 0,11 1,70 0,089826791 0,136930455 8,43 0,18 1,14 0,13 1,38 0,168422456 0,236271629 344,07 711,35 9,47 0,18 1,14 0,15 1,23 0,219650337 0,296550277 1907,00 10,90 0,18 1,13 0,32 0,57 0,5653128 0,645759291 225,94 7,82 0,18 1,13 0,22 0,84 0,401661024 0,486644272 373,83 8,55 0,18 1,13 0,13 1,39 0,165879405 0,233866123 10,13 0,18 1,13 0,10 1,76 0,077657468 0,120523302 1118,25 0 150,47 7,23 0,18 1,13 0,18 1,01 0,310490013 0,393781368 28,26 4,82 0,18 1,13 0,35 0,51 0,611244501 0,685264405 296,39 8,21 0,18 1,13 0,13 1,36 0,173119253 0,241711958 2862,39 11,48 0,18 1,13 0,10 1,81 0,070642022 0,11165726 7,15 0,18 1,13 0,20 0,89 0,374682768 0,459889336 142,38 377,72 8,56 0,18 1,13 0,12 1,44 0,150456931 0,214696061 374,54 8,55 0,18 1,13 0,21 0,84 0,401843257 0,486644272 544,43 9,09 0,18 1,13 0,13 1,38 0,167946691 0,235728663 378,16 8,56 0,18 1,13 0,13 1,36 0,173509967 0,2419898 10,72 0,17 1,13 0,11 1,53 0,12575032 0,183783609 1690,98 377,37 8,56 0,17 1,13 0,12 1,40 0,16006634 0,226462335 97,83 6,61 0,17 1,13 0,21 0,80 0,423007047 0,50833547 3091,10 11,59 0,17 1,13 0,11 1,51 0,130305268 0,189502517 65,80 6,04 0,17 1,13 0,24 0,70 0,481816388 0,568718855 10,04 0,17 1,13 0,14 1,22 0,22384103 0,301289573 1049,21 1847,24 10,85 0,17 1,12 0,11 1,50 0,133248462 0,193043164 5302,04 12,37 0,17 1,12 0,11 1,53 0,125418045 0,183499859 261,60 8,03 0,17 1,12 0,14 1,18 0,238874306 0,318779022 203,45 7,67 0,17 1,12 0,15 1,09 0,275147155 0,357489482 9,38 0,17 1,12 0,12 1,44 0,149685165 0,213709556 667,46 302,10 8,24 0,17 1,12 0,14 1,16 0,245984633 0,326464121 318,61 8,32 0,16 1,12 0,13 1,27 0,205129237 0,28007625 1058,65 10,05 0,16 1,12 0,11 1,56 0,119389 0,17623143 7,26 2,86 0,16 1,12 0,59 0,28 0,782035158 0,834149906 8,20 0,16 1,12 0,14 1,16 0,246292288 0,326709241 293,17 61,67 5,95 0,16 1,12 0,26 0,63 0,530135347 0,615095903 5852,52 12,51 0,16 1,12 0,14 1,18 0,237458524 0,317208295 5,31 2,41 0,16 1,12 0,64 0,25 0,801708419 0,851657884 74,98 6,23 0,16 1,12 0,24 0,66 0,511656766 0,597307569 9,59 0,16 1,12 0,14 1,11 0,267348384 0,349063713 769,73 37,27 5,22 0,16 1,12 0,32 0,49 0,626046275 0,699791735 9907,51 13,27 0,16 1,12 0,11 1,41 0,158763649 0,22485875 133,51 7,06 0,15 1,11 0,24 0,64 0,524439393 0,609285294 945,21 9,88 0,15 1,11 0,10 1,51 0,131031052 0,190245631 9,20 0,15 1,11 0,11 1,31 0,190618945 0,263240404 588,68 1987,14 10,96 0,15 1,11 0,09 1,58 0,113089498 0,167771522 1091,52 10,09 0,15 1,11 0,09 1,57 0,115892917 0,171547343 530,56 9,05 0,15 1,11 0,11 1,28 0,20005635 0,273994702 176,29 7,46 0,15 1,11 0,17 0,89 0,375935931 0,461104269 63,54 5,99 0,15 1,11 0,24 0,61 0,542731537 0,625612882 770,17 9,59 0,15 1,11 0,13 1,14 0,252863276 0,33392531 732,50 9,52 0,14 1,10 0,10 1,38 0,167708278 0,23564299 404,67 8,66 0,14 1,10 0,13 1,11 0,265078531 0,346611052 64,93 6,02 0,14 1,10 0,26 0,53 0,595027958 0,670194695 12430,41 13,60 0,14 1,10 0,13 1,06 0,290194314 0,373242011 445,03 8,80 0,14 1,10 0,13 1,08 0,281800965 0,364370148 71,08 6,15 0,14 1,10 0,24 0,58 0,560230507 0,641056183 41,99 5,39 0,14 1,10 0,29 0,48 0,632535116 0,704082867 836,50 9,71 0,14 1,10 0,11 1,25 0,20989158 0,285990732 420,25 8,72 0,14 1,10 0,13 1,07 0,283847981 0,366286588 477,17 8,90 0,14 1,10 0,18 0,76 0,449283001 0,535311629 617,52 9,27 0,14 1,10 0,12 1,15 0,251187298 0,332186283 1028,75 10,01 0,13 1,10 0,10 1,28 0,199496727 0,273510218 1289,19 10,33 0,13 1,10 0,12 1,13 0,260393687 0,341823164 345,17 8,43 0,13 1,10 0,13 1,01 0,313362194 0,396477786 1853,81 10,86 0,13 1,10 0,11 1,22 0,223319401 0,300892316 224,07 7,81 0,13 1,10 0,15 0,86 0,387227995 0,472389707 2526,06 11,30 0,13 1,09 0,12 1,12 0,261316082 0,342703273 0,293451553 716,71 9,49 0,13 1,09 0,10 1,24 0,216692491 101,45 6,66 0,13 1,09 0,21 0,61 0,54183214 0,624847221 0,66 0,12 1,09 0,19 0,507960715 0,593514345 135,96 7,09 472,85 8,89 0,12 1,09 0,14 0,92 0,359275265 0,445239915 0,725378145 55,82 5,80 0,12 1,09 0,28 0,44 0,657126532 17,67 4,14 0,12 1,09 0,41 0,30 0,764991236 0,819305367 431,98 8,75 0,12 1,09 0,13 0,96 0,337707341 0,421856325 9,48 0,12 1,09 0,11 1,07 0,282764756 0,365243537 715,31 591,95 9,21 0,12 1,09 0,12 1,03 0,30198581 0,384648273 9,11 0,12 1,09 0,12 1,02 0,30946724 0,393047063 553,50 1873,15 10,87 0,12 1,09 0,09 1,30 0,194863425 0,267980607 115,56 6,85 0,12 1,09 0,20 0,61 0,544591126 0,626684427 0,559414102 201,37 7,65 0,12 1,09 0,16 0,72 0,47288072 3960,92 11,95 0,12 1,09 0,09 1,31 0,191402369 0,264047817 6,38 0,12 1,09 0,26 0,46 0,646809027 0,716730973 83,45 1915,39 10,90 0,12 1,09 0,15 0,80 0,42604108 0,51151882 187,84 7,55 0,12 1,09 0,18 0,66 0,50766932 0,593434836 0,375933623 1551,02 10,60 0,12 1,08 0,11 1,05 0,293021653 944,66 9,88 0,12 1,08 0,11 1,08 0,282157477 0,364636389 3,15 0,11 1,08 0,54 0,21 0,83314463 0,875658735 8,87 399,26 8,64 0,11 1,08 0,14 0,77 0,44408613 0,530547143 1062,64 10,05 0,11 1,08 0,12 0,91 0,36404327 0,450019735 0,608598879 170,88 7,42 0,11 1,08 0,17 0,64 0,5231614 147,84 7,21 0,11 1,08 0,17 0,63 0,53101667 0,615849538 7,96 0,11 1,08 0,16 0,69 0,492124634 0,578061517 249,86 116,44 6,86 0,11 1,08 0,19 0,56 0,573689725 0,652522945 997,11 9,96 0,10 1,07 0,12 0,88 0,376902237 0,461913857 226,35 7,82 0,10 1,07 0,15 0,69 0,493226463 0,57909974 190,76 7,58 0,10 1,07 0,17 0,60 0,550702515 0,632879145 13,57 0,10 1,07 0,30 0,33 0,73818404 0,797298778 12133,31 1128,73 10,14 0,10 1,07 0,10 1,02 0,307870377 0,391393107 802,79 9,65 0,10 1,07 0,14 0,66 0,507057404 0,592980424 58,82 5,88 0,09 1,07 0,27 0,35 0,72642686 0,787159938 6,16 2,62 0,09 1,07 0,63 0,15 0,882229156 0,914585591 8,22 0,09 1,07 0,16 0,56 0,576378107 0,654732681 298,11 1344,86 10,39 0,09 1,07 0,16 0,56 0,577454448 0,655402165 48,73 5,61 0,09 1,06 0,29 0,31 0,757069356 0,813727055 458,90 8,84 0,09 1,06 0,12 0,73 0,465144284 0,551243694 395,27 8,63 0,09 1,06 0,13 0,69 0,491636744 0,577743842 10,02 0,09 1,06 0,11 0,82 0,410170078 0,494923659 1035,48 154,02 7,27 0,09 1,06 0,20 0,42 0,674746529 0,740215329 0,905391464 9,96 3,32 0,09 1,06 0,52 0,16 0,869952732 128,87 7,01 0,08 1,06 0,18 0,46 0,647134966 0,716730973 158,90 7,31 0,08 1,06 0,24 0,35 0,723363401 0,784480227 2198,66 11,10 0,08 1,06 0,12 0,69 0,487518118 0,573411084 137,31 7,10 0,08 1,06 0,18 0,46 0,644159443 0,71462699 0,858124023 31,14 4,96 0,08 1,06 0,33 0,24 0,810970803 627,12 9,29 0,08 1,06 0,11 0,70 0,480912329 0,567904026 247,59 7,95 0,08 1,06 0,15 0,52 0,602176146 0,677384429 653,73 9,35 0,08 1,05 0,15 0,52 0,600529616 0,675818377 108,83 6,77 0,08 1,05 0,23 0,32 0,745953914 0,804709521 0,882556344 37,01 5,21 0,07 1,05 0,37 0,20 0,84170033 3528,62 11,78 0,07 1,05 0,09 0,83 0,408668308 0,494002492 86,23 6,43 0,07 1,05 0,22 0,34 0,733757586 0,793808594 1321,36 10,37 0,07 1,05 0,10 0,70 0,486013971 0,572402092 4755,62 12,22 0,07 1,05 0,09 0,79 0,427048616 0,512496917 0,796330127 188,92 7,56 0,07 1,05 0,21 0,34 0,736681723 3231,07 11,66 0,07 1,05 0,10 0,66 0,508434562 0,59380687 5052,71 12,30 0,07 1,05 0,13 0,52 0,602864357 0,677584854 142,07 7,15 0,07 1,05 0,18 0,37 0,7098626 0,772677153 1226,89 10,26 0,07 1,05 0,09 0,72 0,472013525 0,558636942 500,08 8,97 0,07 1,05 0,16 0,40 0,688261245 0,752555609 820,01 9,68 0,06 1,05 0,10 0,63 0,531641805 0,61630553 317,08 8,31 0,06 1,04 0,14 0,44 0,661360194 0,728538158 1852,48 10,86 0,06 1,04 0,12 0,50 0,616190823 0,690227241 1341,81 10,39 0,06 1,04 0,09 0,68 0,49563555 0,581638547 1035,13 10,02 0,06 1,04 0,13 0,49 0,621435503 0,695515641 108,58 6,76 0,06 1,04 0,22 0,28 0,779247622 0,831844488 420,73 8,72 0,06 1,04 0,12 0,49 0,626529323 0,699797211 153,24 7,26 0,06 1,04 0,19 0,32 0,747300672 0,805835181 4164,72 12,02 0,06 1,04 0,10 0,59 0,554821591 0,63623693 86,74 6,44 0,06 1,04 0,21 0,28 0,782779174 0,834608453 0,49 0,624948169 0,699152541 3737,59 11,87 0,06 1,04 0,12 771,25 9,59 0,06 1,04 0,10 0,56 0,57271605 0,651694451 131,29 7,04 0,06 1,04 0,19 0,30 0,761421019 0,817412383 132,52 7,05 0,06 1,04 0,20 0,28 0,78002627 0,832341285 1248,97 10,29 0,05 1,04 0,09 0,61 0,543151529 0,625825504 707,58 9,47 0,05 1,04 0,11 0,49 0,627017647 0,699994071 19,73 4,30 0,05 1,04 0,41 0,13 0,894795622 0,924726553 142,57 7,16 0,05 1,04 0,23 0,23 0,816031391 0,862448451 47077,24 15,52 0,05 1,04 0,12 0,44 0,656773524 0,725378145 604,75 9,24 0,05 1,04 0,12 0,43 0,666484942 0,733271425 766,92 9,58 0,05 1,04 0,11 0,46 0,645916828 0,716277551 3592,22 11,81 0,05 1,03 0,11 0,44 0,660214039 0,728181279 78,00 6,29 0,05 1,03 0,23 0,21 0,836157058 0,877436534 24,12 4,59 0,05 1,03 0,45 0,10 0,917787663 0,941893326 656,11 9,36 0,05 1,03 0,13 0,35 0,722739541 0,784123708 771,22 9,59 0,05 1,03 0,12 0,37 0,7113507 0,773979856 236,80 7,89 0,04 1,03 0,18 0,25 0,801454215 0,851657884 134,06 7,07 0,04 1,03 0,19 0,23 0,819305168 0,865220124 108,93 6,77 0,04 1,03 0,19 0,22 0,825697941 0,870587075 0,46 0 14,18 3,83 0,04 1,03 0,09 0,928308564 0,949024954 199,36 7,64 0,04 1,03 0,17 0,25 0,805374957 0,853501825 969,62 9,92 0,04 1,03 0,11 0,37 0,714776786 0,777071162 379,61 8,57 0,04 1,03 0,15 0,25 0,803395821 0,852825687 96,33 6,59 0,04 1,03 0,23 0,16 0,873708455 0,907522816 0,25 0,14 0,886001806 0,917180887 71,38 6,16 0,04 1,03 109,13 6,77 0,04 1,02 0,21 0,17 0,866997769 0,9026697 23,50 4,55 0,04 1,02 0,38 0,09 0,926549431 0,947956041 3469,55 11,76 0,04 1,02 0,12 0,30 0,76767543 0,821471453 261,77 8,03 0,03 1,02 0,14 0,25 0,804154822 0,85329048 0,51 0,07 0,946885604 0,962692804 12,89 3,69 0,03 1,02 966,17 9,92 0,03 1,02 0,11 0,30 0,767223235 0,821318346 3879,68 11,92 0,03 1,02 0,15 0,20 0,84480389 0,884763081
Locus USA300HOU 2209 USA300HOU 1529 USA300HOU_0829 USA300HOU 0446 USA300HOU_1897 USA300HOU_0859 USA300HOU 2189 USA300HOU 2593 USA300HOU_0402 USA300HOU 0774 USA300HOU_0330 USA300HOU_2164 USA300HOU 2334 USA300HOU_0620 USA300HOU_0961 USA300HOU 2319 USA300HOU 1175 USA300HOU_0534 USA300HOU 1567 USA300HOU_0338 USA300HOU_2535 USA300HOU 2367 USA300HOU 0706 USA300HOU_2012 USA300HOU 0438 USA300HOU_0111 USA300HOU_2566 USA300HOU 1269 USA300HOU_1266 USA300HOU_0480 USA300HOU 2246 USA300HOU_2446 USA300HOU_2085 USA300HOU 2420 USA300HOU_0856 USA300HOU_1049 USA300HOU 1611 USA300HOU 0717 USA300HOU_0308 USA300HOU 1913 USA300HOU_1604 USA300HOU_0257 USA300HOU 0311 USA300HOU_1763 USA300HOU_2248 USA300HOU 2590 USA300HOU_1680 USA300HOU_1900 USA300HOU 1864 USA300HOU 0112 USA300HOU_0737 USA300HOU 1984 USA300HOU 0603 USA300HOU_0843
Gene symbol rplM accB USA300HOU_0829 lpl8 dgkB USA300HOU_0859 lacR panB USA300HOU_0402 tagO USA300HOU 0330 USA300HOU_2164 USA300HOU 2334 USA300HOU_0620 USA300HOU_0961 galM rnhB rplL recO nanE USA300HOU_2535 USA300HOU 2367 uppP USA300HOU_2012 lpl1 USA300HOU 0111 USA300HOU_2566 USA300HOU 1269 USA300HOU_1266 USA300HOU_0480 USA300HOU 2246 USA300HOU_2446 USA300HOU_2085 USA300HOU 2420 USA300HOU_0856 USA300HOU_1049 udk USA300HOU 0717 esaG USA300HOU 1913 USA300HOU 1604 USA300HOU_0257 USA300HOU 0311 arsB sarV USA300HOU 2590 phoP gatB USA300HOU 1864 USA300HOU 0112 pabB USA300HOU 1984 USA300HOU 0603 USA300HOU_0843
Regulon -
Function 50S ribosomal protein L13 acetyl-CoA carboxylase, biotin carboxyl carrier protein hypothetical protein hypothetical protein lipid kinase hypothetical protein lactose phosphotransferase system repressor LacR 3-methyl-2-oxobutanoate hydroxymethyltransferase hypothetical protein glycosyl transferase, group 4 family protein perfringolysin O regulator protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein aldose 1-epimerase ribonuclease HII 50S ribosomal protein L7/L12 RecO family DNA repair protein N-acetylmannosamine-6-phosphate 2-epimerase hypothetical protein hypothetical protein UDP pyrophosphate phosphatase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein LuxR family DNA-binding response regulator Orn/Lys/Arg decarboxylase MarR family transcriptional regulator addiction module antitoxin hypothetical protein bicyclomycin resistance protein pathogenicity island protein hypothetical protein uridine kinase hypothetical protein hypothetical protein hypothetical protein hypothetical protein PTS system, sorbitol-specific IIB component hypothetical protein arsenical pump membrane protein hypothetical protein CocE/NonD family hydrolase alkaline phosphatase synthesis transcriptional regulatory protein aspartyl/glutamyl-tRNA amidotransferase subunit B hypothetical protein tandem lipoprotein
USA300HOU_1354 USA300HOU 1343 USA300HOU 1616 USA300HOU_0608 USA300HOU 1322 USA300HOU_0049 USA300HOU_2445 USA300HOU 1776 USA300HOU_1222 USA300HOU_1887 USA300HOU 1392 USA300HOU_0810 USA300HOU_0067 USA300HOU 2708 USA300HOU_0294 USA300HOU_1048 USA300HOU 2153 USA300HOU_1665 USA300HOU_0574 USA300HOU 0105 USA300HOU_1439 USA300HOU_1566 USA300HOU 0716 USA300HOU_1300 USA300HOU_1286 USA300HOU 1218 USA300HOU 1323 USA300HOU_1312 USA300HOU 1158 USA300HOU 0400 USA300HOU_0191 USA300HOU 1905 USA300HOU_0897 USA300HOU_0468 USA300HOU 0695 USA300HOU_0858 USA300HOU_0696 USA300HOU 0109 USA300HOU_0001 USA300HOU_1602 USA300HOU 0225 USA300HOU 0043 USA300HOU_1738 USA300HOU 1033 USA300HOU_2068 USA300HOU_1265 USA300HOU 1458 USA300HOU_2709 USA300HOU_1078 USA300HOU 0970 USA300HOU_2570 USA300HOU_1612 USA300HOU 0996 USA300HOU_1084 USA300HOU_0201 USA300HOU 0022 USA300HOU 1918 USA300HOU_2355 USA300HOU 0983 USA300HOU_0916 USA300HOU_0865 USA300HOU 1098 USA300HOU 2447 USA300HOU_0667 USA300HOU 2332 USA300HOU_0894 USA300HOU_2555 USA300HOU 2077 USA300HOU_1651 USA300HOU_1638 USA300HOU 0224 USA300HOU_0350 USA300HOU_0995 USA300HOU 2387 USA300HOU_1284 USA300HOU_0881 USA300HOU 1274 USA300HOU 2067 USA300HOU_0713 USA300HOU 2594 USA300HOU_1076 USA300HOU_2360 USA300HOU 1670 USA300HOU_2639 USA300HOU_2336 USA300HOU 2489 USA300HOU 1148 USA300HOU_1063 USA300HOU 1191 USA300HOU_0636 USA300HOU_1976
USA300HOU_1354 USA300HOU 1343 USA300HOU 1616 USA300HOU_0608 pstC USA300HOU_0049 USA300HOU_2445 USA300HOU 1776 USA300HOU_1222 USA300HOU_1887 asnC rnr arcB USA300HOU 2708 USA300HOU_0294 USA300HOU_1048 cdaA engB ung USA300HOU 0105 USA300HOU_1439 glyS USA300HOU 0716 tyrA plsY rny/cvfA USA300HOU 1323 USA300HOU_1312 rsgA USA300HOU 0400 USA300HOU_0191 ligA nfu USA300HOU_0468 USA300HOU 0695 USA300HOU_0858 USA300HOU_0696 csa1A dnaA USA300HOU_1602 USA300HOU 0225 USA300HOU 0043 trmB USA300HOU 1033 USA300HOU_2068 USA300HOU_1265 USA300HOU 1458 USA300HOU_2709 polX USA300HOU 0970 USA300HOU_2570 USA300HOU_1612 sspA sdhA USA300HOU_0201 walJ sdcS iruO comK1 rocD USA300HOU_0865 USA300HOU 1098 USA300HOU 2447 USA300HOU_0667 USA300HOU 2332 dltB USA300HOU_2555 murF USA300HOU_1651 tgt USA300HOU 0224 ulaA sspB USA300HOU 2387 USA300HOU_1284 USA300HOU_0881 thrC USA300HOU 2067 USA300HOU_0713 panE USA300HOU_1076 USA300HOU_2360 USA300HOU 1670 USA300HOU_2639 USA300HOU_2336 gtaB rpoZ USA300HOU_1063 pyrH USA300HOU_0636 USA300HOU_1976
-
hypothetical protein hypothetical protein Holliday junction resolvase-like protein
USA300HOU_2046 USA300HOU 0809 USA300HOU_0414 USA300HOU_1400 USA300HOU 1221 USA300HOU 0477 USA300HOU_0610 USA300HOU 2348 USA300HOU_0509 USA300HOU_1261 USA300HOU 0348 USA300HOU_1253 USA300HOU_0994 USA300HOU 0925 USA300HOU 0887 USA300HOU_1411 USA300HOU 1152 USA300HOU_1587 USA300HOU_1415 USA300HOU 2117 USA300HOU 0827 USA300HOU_2333 USA300HOU 2425 USA300HOU_0891 USA300HOU_0499
USA300HOU_2046 est guaA USA300HOU_1400 USA300HOU 1221 dnaX adh1 mqo1 folB USA300HOU_1261 lplA2 USA300HOU_1253 sspC addB USA300HOU 0887 gpsA def2 rpsT cmk USA300HOU 2117 USA300HOU 0827 USA300HOU_2333 USA300HOU 2425 USA300HOU_0891 USA300HOU_0499
-
hypothetical protein carboxylesterase GMP synthase hypothetical protein pyruvate ferredoxin oxidoreductase subunit alpha DNA polymerase III subunits gamma and tau alcohol dehydrogenase malate:quinone oxidoreductase dihydroneopterin aldolase hypothetical protein lipoate-protein ligase A family protein hypothetical protein sspC protein exonuclease RexB hypothetical protein NAD(P)H-dependent glycerol-3-phosphate dehydrogenase peptide deformylase 30S ribosomal protein S20 cytidylate kinase hypothetical protein hypothetical protein EmrB/QacA family drug resistance transporter Na+/H+ antiporter hypothetical protein tetrapyrrole methylase
phi PVL orf 51-like protein hypothetical protein hypothetical protein
Base mean A-value M-value Fold change Standard error Wald statistic P-value Adjusted P-value 1711,66 10,74 0,03 1,02 0,11 0,26 0,791199352 0,842571815 467,00 8,87 0,03 1,02 0,12 0,24 0,813190013 0,860129723 232,67 7,86 0,03 1,02 0,19 0,14 0,885530775 0,917180887 110,85 6,79 0,03 1,02 0,24 0,11 0,9119083 0,937670416 698,89 9,45 0,03 1,02 0,11 0,24 0,809484795 0,857234397 246,45 7,95 0,03 1,02 0,14 0,18 0,858689797 0,895774948 473,57 8,89 0,02 1,02 0,13 0,19 0,849798109 0,888242949 1622,23 10,66 0,02 1,01 0,11 0,18 0,853325301 0,89087832 153,00 7,26 0,02 1,01 0,18 0,11 0,915772579 0,940551891 448,51 8,81 0,02 1,01 0,12 0,16 0,872037762 0,906496218 2700,84 11,40 0,02 1,01 0,11 0,18 0,859126224 0,895878484 904,67 9,82 0,02 1,01 0,15 0,12 0,902347245 0,931443912 59,44 5,89 0,02 1,01 0,26 0,07 0,947112905 0,962692804 1367,90 10,42 0,02 1,01 0,13 0,13 0,896042277 0,925654872 235,59 7,88 0,02 1,01 0,20 0,08 0,933460736 0,952459744 499,43 8,96 0,02 1,01 0,12 0,13 0,89478231 0,924726553 281,41 8,14 0,01 1,01 0,15 0,10 0,922993078 0,945045321 336,68 8,40 0,01 1,01 0,14 0,10 0,918426824 0,942185356 367,08 8,52 0,01 1,01 0,14 0,10 0,920844738 0,94393691 133,01 7,06 0,01 1,01 0,18 0,07 0,940590217 0,958262349 1021,27 10,00 0,01 1,01 0,30 0,04 0,967271264 0,979062761 328,70 8,36 0,01 1,01 0,18 0,07 0,948066909 0,963293987 285,71 8,16 0,01 1,01 0,15 0,08 0,939375765 0,957759558 8,45 3,08 0,01 1,01 0,56 0,02 0,985126141 0,989595523 52,45 5,71 0,01 1,01 0,30 0,03 0,972485924 0,982718724 166,60 7,38 0,01 1,01 0,21 0,04 0,967020326 0,979062761 889,18 9,80 0,01 1,01 0,11 0,08 0,937849296 0,95657028 2028,52 10,99 0,01 1,01 0,11 0,07 0,942178029 0,959512082 120,96 6,92 0,01 1,01 0,20 0,04 0,967696756 0,979120442 165,30 7,37 0,01 1,01 0,17 0,05 0,962515481 0,975363704 45,84 5,52 0,01 1,00 0,29 0,02 0,983100168 0,988681736 5458,08 12,41 0,01 1,00 0,10 0,06 0,952486356 0,966675419 7,50 2,91 0,01 1,00 0,63 0,01 0,993226572 0,995099171 2233,66 11,13 0,00 1,00 0,10 0,04 0,970004554 0,98108188 565,59 9,14 0,00 1,00 0,12 0,03 0,979449687 0,987189113 999,20 9,96 0,00 1,00 0,12 0,02 0,980872886 0,987189113 716,09 9,48 0,00 1,00 0,11 0,02 0,980636416 0,987189113 207,01 7,69 0,00 1,00 0,17 0,01 0,988397198 0,992131226 236,11 7,88 0,00 1,00 0,16 0,01 0,995221858 0,996722381 777,87 9,60 0,00 1,00 0,12 0,00 0,997534082 0,99790966 1674,21 10,71 0,00 1,00 0,10 -0,02 0,986965454 0,991068485 11,69 3,55 0,00 1,00 0,49 0,00 0,997145911 0,997897057 121,16 6,92 0,00 1,00 0,22 -0,01 0,991978988 0,994974772 144,51 7,18 0,00 1,00 0,19 -0,01 0,990113008 0,993478196 361,27 8,50 0,00 1,00 0,14 -0,02 0,982281219 0,988232185 367,02 8,52 0,00 1,00 0,13 -0,02 0,980816753 0,987189113 494,42 8,95 0,00 1,00 0,12 -0,03 0,979021941 0,987189113 954,72 9,90 0,00 1,00 0,12 -0,03 0,979632797 0,987189113 634,51 9,31 0,00 1,00 0,12 -0,03 0,972396715 0,982718724 148,04 7,21 -0,01 1,00 0,18 -0,03 0,977508549 0,986793395 0 121,91 6,93 -0,01 1,00 0,19 -0,03 0,977184052 0,986793395 6,93 2,79 -0,01 1,00 0,60 -0,01 0,992360369 0,994981698 98,88 6,63 -0,01 1,00 0,23 -0,03 0,978943595 0,987189113 33,94 5,08 -0,01 1,00 0,32 -0,02 0,984061563 0,989274148
0 phosphate ABC transporter permease hypothetical protein glutamyl-aminopeptidase hypothetical protein 2-oxoglutarate ferredoxin oxidoreductase subunit beta hypothetical protein asparaginyl-tRNA synthetase VacB/RNase II family exoribonuclease ornithine carbamoyltransferase integrase/recombinase core subunit hypothetical protein hypothetical protein hypothetical protein ribosome biogenesis GTP-binding protein engB uracil-DNA glycosylase hypothetical protein hypothetical protein glycyl-tRNA synthetase hypothetical protein prephenate dehydrogenase hypothetical protein phosphodiesterase hypothetical protein hypothetical protein hypothetical protein hypothetical protein drug transporter DNA ligase, NAD-dependent NifU domain-containing protein acetyltransferase hypothetical protein hypothetical protein sugar efflux transporter hypothetical protein chromosomal replication initiation protein hypothetical protein Gfo/Idh/MocA family oxidoreductase hypothetical protein tRNA (guanine-N(7)-)-methyltransferase hypothetical protein hypothetical protein sensor histidine kinase hypothetical bacteriophage protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein U32 family peptidase V8 protease sspA succinate dehydrogenase flavoprotein subunit indole-3-pyruvate decarboxylase metallo-beta-lactamase YycJ sodium-dependent transporter pyridine nucleotide-disulfide oxidoreductase ComK family protein ornithine--oxo-acid transaminase hypothetical protein hypothetical protein addiction module antitoxin hypothetical protein hypothetical protein DltB protein aminotransferase, class I UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase hypothetical protein queuine tRNA-ribosyltransferase Gfo/Idh/MocA family oxidoreductase PTS system ascorbate-specific transporter subunit IIC cysteine protease precursor SspB addiction module antitoxin hypothetical protein hypothetical protein threonine synthase hypothetical protein anion transporter family protein 2-dehydropantoate 2-reductase hypothetical protein TetR family transcriptional regulator hypothetical protein hypothetical protein TetR family transcriptional regulator UTP-glucose-1-phosphate uridylyltransferase DNA-directed RNA polymerase subunit omega hypothetical protein uridylate kinase hypothetical protein hypothetical protein
983,54 504,69 4824,18 327,60 20,42 10,91 1792,65 4074,32 1548,71 53,89 1477,78 1419,54 233,36 41,69 129,58 755,83 959,12 240,04 129,63 359,17 78,35 2281,74 744,36 1251,66 969,13 9833,97 6,73 209,69 297,72 317,05 303,95 431,90 3657,24 969,56 349,66 220,82 1006,90 88,29 2220,63 31,42 66,23 274,75 2366,76 522,20 891,71 139,58 10,08 37,30 304,82 2817,14 96,53 732,82 537,80 2045,09 48,67 137,04 1116,01 64,81 2077,65 1423,39 109,68 466,72 5009,41 791,30 1236,77 1991,16 1855,58 2376,34 171,66 473,10 82,13 55,84 707,05 5864,67 540,23 117,38 11060,43 253,60 519,54 423,31 232,27 356,07 7556,04 825,38 630,87 410,09 1335,29 102,58 310,03 71,52 20,90
9,94 8,98 12,24 8,36 4,35 3,45 10,81 11,99 10,60 5,75 10,53 10,47 7,87 5,38 7,02 9,56 9,91 7,91 7,02 8,49 6,29 11,16 9,54 10,29 9,92 13,26 2,75 7,71 8,22 8,31 8,25 8,75 11,84 9,92 8,45 7,79 9,98 6,46 11,12 4,97 6,05 8,10 11,21 9,03 9,80 7,12 3,33 5,22 8,25 11,46 6,59 9,52 9,07 11,00 5,60 7,10 10,12 6,02 11,02 10,48 6,78 8,87 12,29 9,63 10,27 10,96 10,86 11,21 7,42 8,89 6,36 5,80 9,47 12,52 9,08 6,88 13,43 7,99 9,02 8,73 7,86 8,48 12,88 9,69 9,30 8,68 10,38 6,68 8,28 6,16 4,39
-0,01 -0,01 -0,01 -0,01 -0,01 -0,01 -0,01 -0,01 -0,01 -0,01 -0,01 -0,02 -0,02 -0,02 -0,02 -0,02 -0,02 -0,02 -0,02 -0,02 -0,02 -0,02 -0,02 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,03 -0,04 -0,04 -0,04 -0,04 -0,04 -0,04 -0,04 -0,04 -0,04 -0,04 -0,04 -0,04 -0,04 -0,04 -0,04 -0,04 -0,04 -0,05 -0,05 -0,05 -0,05 -0,05 -0,05 -0,05 -0,05 -0,06 -0,06 -0,06 -0,06 -0,06 -0,06 -0,06 -0,06 -0,06 -0,06 -0,06 -0,06 -0,06 -0,06 -0,06 -0,07 -0,07 -0,07 -0,07 -0,07 -0,07 -0,07
1,00 1,00 1,00 0,99 0,99 0,99 0,99 0,99 0,99 0,99 0,99 0,99 0,99 0,99 0,99 0,99 0,99 0,99 0,99 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,98 0,97 0,97 0,97 0,97 0,97 0,97 0,97 0,97 0,97 0,97 0,97 0,97 0,97 0,97 0,97 0,97 0,97 0,97 0,96 0,96 0,96 0,96 0,96 0,96 0,96 0,96 0,96 0,96 0,96 0,96 0,96 0,96 0,96 0,96 0,96 0,96 0,96 0,96 0,96 0,95 0,95 0,95 0,95
0,10 0,11 0,08 0,14 0,39 0,54 0,11 0,10 0,09 0,28 0,13 0,10 0,15 0,30 0,20 0,12 0,11 0,14 0,19 0,14 0,24 0,14 0,12 0,11 0,13 0,09 0,62 0,15 0,13 0,13 0,14 0,14 0,12 0,15 0,14 0,17 0,10 0,29 0,10 0,34 0,28 0,16 0,09 0,12 0,10 0,18 0,57 0,34 0,14 0,12 0,22 0,12 0,12 0,09 0,29 0,19 0,12 0,33 0,11 0,10 0,21 0,17 0,08 0,12 0,10 0,14 0,12 0,09 0,19 0,12 0,25 0,28 0,10 0,10 0,12 0,20 0,10 0,14 0,12 0,16 0,17 0,13 0,12 0,11 0,14 0,13 0,09 0,20 0,15 0,23 0,48
-0,07 -0,06 -0,09 -0,07 -0,02 -0,02 -0,10 -0,11 -0,14 -0,05 -0,11 -0,16 -0,11 -0,06 -0,09 -0,16 -0,18 -0,14 -0,11 -0,16 -0,09 -0,17 -0,19 -0,22 -0,20 -0,29 -0,04 -0,19 -0,22 -0,22 -0,21 -0,21 -0,25 -0,20 -0,22 -0,19 -0,32 -0,11 -0,32 -0,10 -0,12 -0,22 -0,40 -0,28 -0,35 -0,20 -0,06 -0,11 -0,28 -0,31 -0,17 -0,32 -0,34 -0,43 -0,14 -0,22 -0,35 -0,13 -0,41 -0,42 -0,22 -0,27 -0,57 -0,42 -0,47 -0,36 -0,45 -0,62 -0,28 -0,48 -0,22 -0,21 -0,56 -0,59 -0,48 -0,30 -0,60 -0,42 -0,49 -0,38 -0,36 -0,48 -0,53 -0,57 -0,48 -0,51 -0,73 -0,33 -0,47 -0,30 -0,15
0,94596947 0,950171455 0,928876102 0,94686148 0,980624345 0,985008676 0,919495065 0,911758126 0,888707895 0,96081265 0,913579989 0,874585339 0,912444092 0,95307144 0,927268891 0,87036181 0,85824712 0,886113413 0,909881132 0,876609529 0,924655344 0,862653085 0,849668359 0,824493094 0,84370924 0,773425849 0,964617616 0,852849116 0,829374156 0,825443383 0,832760941 0,831056484 0,804974805 0,838339998 0,829085684 0,850993582 0,751600652 0,909023808 0,75006671 0,92123797 0,904391603 0,828824601 0,691117086 0,77795661 0,729180621 0,842767022 0,950378306 0,916281091 0,78324734 0,754507562 0,864080931 0,751493312 0,737512461 0,667748934 0,888753986 0,827271079 0,723988859 0,899943094 0,681781144 0,67253769 0,82803962 0,784572625 0,568479908 0,676987268 0,638594053 0,718169931 0,655526711 0,53317143 0,778167525 0,630846817 0,825266207 0,836000254 0,574861387 0,554290171 0,628521986 0,764719603 0,551416256 0,675050625 0,626577932 0,700856539 0,717398202 0,62921352 0,59331806 0,571750474 0,631177358 0,609295517 0,46426087 0,738485004 0,641105665 0,763844382 0,884472381
0,962635343 0,964904531 0,949239924 0,962692804 0,987189113 0,989595523 0,942917171 0,937670416 0,919197875 0,974009619 0,938662812 0,908078643 0,937858396 0,966899892 0,94832696 0,905462541 0,895664807 0,917180887 0,936310677 0,909824812 0,946382608 0,898850685 0,888242949 0,870352861 0,883965083 0,826958745 0,977121237 0,890731172 0,872731538 0,870587075 0,875601829 0,874155613 0,853478874 0,879379934 0,872731538 0,889142725 0,809486394 0,935790879 0,808489756 0,943975815 0,9324674 0,872731538 0,754436359 0,831025367 0,789821814 0,883326224 0,964904531 0,940710533 0,834772636 0,811958927 0,899985509 0,809486394 0,79689736 0,734357995 0,919197875 0,871899745 0,784838188 0,92932328 0,746699299 0,738401919 0,872363707 0,835849825 0,647706311 0,742060714 0,709637975 0,779802822 0,724515171 0,617809198 0,831025367 0,703087245 0,870587075 0,877436534 0,653575825 0,635901979 0,701378797 0,819305367 0,633286679 0,740243298 0,699797211 0,763186813 0,779283329 0,701855719 0,668835844 0,651153455 0,703160688 0,683367745 0,550688005 0,797299738 0,711536238 0,819214839 0,916553477
194,22 619,22 3243,19 324,93 2757,87 1052,53 232,74 222,99 188,65 773,03 40,02 319,46 228,00 1178,78 382,29 973,35 250,51 822,47 759,35 372,12 566,97 183,86 3178,69 156,93 555,57
7,60 9,27 11,66 8,34 11,43 10,04 7,86 7,80 7,56 9,59 5,32 8,32 7,83 10,20 8,58 9,93 7,97 9,68 9,57 8,54 9,15 7,52 11,63 7,29 9,12
-0,07 -0,07 -0,07 -0,07 -0,07 -0,07 -0,07 -0,07 -0,08 -0,08 -0,08 -0,08 -0,08 -0,08 -0,08 -0,08 -0,08 -0,08 -0,08 -0,08 -0,09 -0,09 -0,09 -0,09 -0,09
0,95 0,95 0,95 0,95 0,95 0,95 0,95 0,95 0,95 0,95 0,95 0,95 0,95 0,95 0,95 0,94 0,94 0,94 0,94 0,94 0,94 0,94 0,94 0,94 0,94
0,16 0,11 0,11 0,13 0,09 0,10 0,16 0,15 0,15 0,18 0,33 0,18 0,17 0,10 0,14 0,10 0,15 0,11 0,13 0,13 0,12 0,17 0,12 0,17 0,11
-0,45 -0,62 -0,64 -0,53 -0,76 -0,70 -0,44 -0,49 -0,49 -0,44 -0,23 -0,44 -0,48 -0,82 -0,56 -0,85 -0,54 -0,75 -0,67 -0,65 -0,69 -0,51 -0,76 -0,54 -0,82
0,655456177 0,53489526 0,519154953 0,596806439 0,447941571 0,485618169 0,662113102 0,625343483 0,621168477 0,661205723 0,815038777 0,656999614 0,634731114 0,414479197 0,575895229 0,395929547 0,586021407 0,453699218 0,50381199 0,517375833 0,491571751 0,606884886 0,448197919 0,589350669 0,412496297
0,724515171 0,619536489 0,604467445 0,671913012 0,534192439 0,572189567 0,729065276 0,699300351 0,695509753 0,728538158 0,861742153 0,725378145 0,706231395 0,499216331 0,654471182 0,481678025 0,662296418 0,539847211 0,589964063 0,602916466 0,577743842 0,681239182 0,534258353 0,665492872 0,497053361
Locus USA300HOU 1539 USA300HOU 0763 USA300HOU_0048 USA300HOU 2069 USA300HOU_1985 USA300HOU_2256 USA300HOU 0530 USA300HOU 2327 USA300HOU_0547 USA300HOU 0193 USA300HOU_2464 USA300HOU_1970 USA300HOU 1949 USA300HOU_1672 USA300HOU_1952 USA300HOU 1418 USA300HOU 0076 USA300HOU_1371 USA300HOU 2366 USA300HOU_1435 USA300HOU_0497 USA300HOU 1488 USA300HOU 0268 USA300HOU 1694 USA300HOU_1355 USA300HOU 0860 USA300HOU_0015 USA300HOU_0982 USA300HOU 2392 USA300HOU_1115 USA300HOU_1692 USA300HOU 0243 USA300HOU_0315 USA300HOU_2294 USA300HOU 0981 USA300HOU_1107 USA300HOU_0399 USA300HOU 1226 USA300HOU 0136 USA300HOU_1294 USA300HOU 0157 USA300HOU_0629 USA300HOU_2388 USA300HOU 0857 USA300HOU 2714 USA300HOU_0637 USA300HOU 1247 USA300HOU_2066 USA300HOU_2605 USA300HOU 1408 USA300HOU_1399 USA300HOU_1174 USA300HOU 2297 USA300HOU_0451 USA300HOU_0343 USA300HOU 0979 USA300HOU_0068 USA300HOU_0954 USA300HOU 0677 USA300HOU 0800 USA300HOU_0974 USA300HOU 0605 USA300HOU_0784 USA300HOU_0924 USA300HOU 2242 USA300HOU_1347 USA300HOU_2204 USA300HOU 1940 USA300HOU_1476 USA300HOU_0101 USA300HOU 2236 USA300HOU_2427 USA300HOU_1975 USA300HOU 1451 USA300HOU_0720 USA300HOU_2629 USA300HOU 1752 USA300HOU_2235 USA300HOU_0600 USA300HOU 0631 USA300HOU 0265 USA300HOU_0341 USA300HOU 0387 USA300HOU 2027 USA300HOU_0008 USA300HOU 0840 USA300HOU_1826 USA300HOU_2354 USA300HOU 1671 USA300HOU_1412 USA300HOU_2359 USA300HOU 1807 USA300HOU_1119 USA300HOU_2146 USA300HOU 0782 USA300HOU 1955 USA300HOU_1072 USA300HOU 1382 USA300HOU_0765 USA300HOU_0549 USA300HOU 1054 USA300HOU_1075 USA300HOU_2670 USA300HOU 1291 USA300HOU_1884 USA300HOU_1486 USA300HOU 1161 USA300HOU_0623 USA300HOU_0396 USA300HOU 0002 USA300HOU_0044 USA300HOU_1739 USA300HOU 2119 USA300HOU 2155 USA300HOU_2205
Gene symbol aroK USA300HOU 0763 USA300HOU_0048 USA300HOU 2069 USA300HOU_1985 moaC nusG fni ilvE USA300HOU 0193 USA300HOU 2464 USA300HOU_1970 sak dnaB USA300HOU_1952 USA300HOU 1418 USA300HOU 0076 USA300HOU_1371 gltT USA300HOU_1435 mfd USA300HOU 1488 tarL pepQ murG USA300HOU 0860 rplI USA300HOU_0982 fmhA USA300HOU_1115 uspA2 fadE USA300HOU_0315 USA300HOU_2294 ktrD arcC1 USA300HOU_0399 USA300HOU 1226 USA300HOU 0136 fmtC USA300HOU 0157 USA300HOU_0629 USA300HOU_2388 USA300HOU 0857 gidA USA300HOU_0637 USA300HOU 1247 acpS betA ubiE USA300HOU_1399 rbgA USA300HOU 2297 USA300HOU_0451 USA300HOU_0343 USA300HOU 0979 USA300HOU_0068 trpS USA300HOU 0677 USA300HOU 0800 ltaA USA300HOU 0605 USA300HOU_0784 spsB USA300HOU 2242 sucB USA300HOU_2204 USA300HOU 1940 USA300HOU_1476 USA300HOU_0101 USA300HOU 2236 kimA USA300HOU_1975 USA300HOU 1451 USA300HOU_0720 estA USA300HOU 1752 topB USA300HOU_0600 USA300HOU 0631 tarF USA300HOU_0341 rpsF sdrH hutH gcvH USA300HOU_1826 USA300HOU_2354 dnaI engA USA300HOU_2359 USA300HOU 1807 mraW mtlF prfB USA300HOU 1955 USA300HOU_1072 USA300HOU 1382 USA300HOU_0765 USA300HOU_0549 ctaB rnhC USA300HOU_2670 glcT map USA300HOU_1486 USA300HOU 1161 USA300HOU 0623 USA300HOU_0396 dnaN USA300HOU_0044 USA300HOU_1739 coaA tnp4 USA300HOU_2205
Regulon -
Function shikimate kinase hypothetical protein hypothetical protein hypothetical protein phiPVL ORF050-like protein molybdenum cofactor biosynthesis protein MoaC transcription antitermination protein isopentenyl pyrophosphate isomerase branched-chain amino acid aminotransferase 4'-phosphopantetheinyl transferase transporter possible bacteriophage portal protein staphylokinase replication initiation and membrane attachment protein hypothetical protein hypothetical protein ISSep1-like transposase cell wall enzyme EbsB proton/sodium-glutamate symport protein hypothetical protein transcription-repair coupling factor phiSLT ORF144-like protein lipoprotein teichoic acid biosynthesis protein proline dipeptidase UDPdiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase hypothetical protein 50S ribosomal protein L9 5' nucleotidase fmhA protein hypothetical protein universal stress protein long-chain-fatty-acid--CoA ligase hypothetical protein hypothetical protein sodium transport family protein carbamate kinase phosphoglycerate mutase hypothetical protein hypothetical protein fmtC protein 5' nucleotidase hypothetical protein addiction module antitoxin pathogenicity island protein tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA hypothetical protein hypothetical protein 4'-phosphopantetheinyl transferase choline dehydrogenase ubiquinone/menaquinone biosynthesis methyltransferase hypothetical protein ribosomal biogenesis GTPase hypothetical protein hypothetical protein hypothetical protein hypothetical protein cyclic nucleotide-binding domain-containing protein tryptophanyl-tRNA synthetase hypothetical protein hypothetical protein hypothetical protein hypothetical protein HD domain-containing protein signal peptidase IB hypothetical protein dihydrolipoamide succinyltransferase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein phi77 ORF071-like protein prophage L54a, Clp protease ebsC protein tributyrin esterase EstA hypothetical protein DNA topoisomerase III hypothetical protein hypothetical protein TagF domain-containing protein hypothetical protein 30S ribosomal protein S6 sdrH protein histidine ammonia-lyase glycine cleavage system protein H hypothetical protein acetyltransferase primosomal protein DnaI GTP-binding protein EngA hypothetical protein hypothetical protein S-adenosyl-methyltransferase MraW PTS system, mannitol-specific IIBC components peptide chain release factor 2 hypothetical protein RNA methyltransferase hypothetical protein hypothetical protein HAD superfamily hydrolase protoheme IX farnesyltransferase ribonuclease HIII hypothetical protein transcription antiterminator methionine aminopeptidase phiSLT ORF104a-like protein, repressor hypothetical protein hypothetical protein hypothetical protein DNA polymerase III subunit beta hypothetical protein hypothetical protein pantothenate kinase
USA300HOU_1525 USA300HOU_1872 USA300HOU 0318 USA300HOU_1910 USA300HOU_0287 USA300HOU 0442 USA300HOU 0079 USA300HOU_0724 USA300HOU 0896 USA300HOU_2516 USA300HOU_2247 USA300HOU 0808 USA300HOU 0591 USA300HOU_2263 USA300HOU 1462 USA300HOU_0459 USA300HOU_1155 USA300HOU 1410 USA300HOU_1449 USA300HOU_0508 USA300HOU 2380 USA300HOU 1485 USA300HOU_2432 USA300HOU 1932 USA300HOU_1911 USA300HOU_1041 USA300HOU 1618 USA300HOU 0312 USA300HOU_1182 USA300HOU 0104 USA300HOU_2715 USA300HOU_2307 USA300HOU 1428 USA300HOU_2706 USA300HOU_1837 USA300HOU 1961 USA300HOU 0659 USA300HOU_1673 USA300HOU 0137
xseA USA300HOU_1872 USA300HOU 0318 SspB USA300HOU_0287 lpl4 opp-3B nagA dltD USA300HOU_2516 USA300HOU_2247 secG USA300HOU 0591 USA300HOU_2263 USA300HOU 1462 mpsC rlmN hup USA300HOU_1449 folP nasF USA300HOU_1485 USA300HOU_2432 USA300HOU 1932 USA300HOU_1911 USA300HOU_1041 alaS USA300HOU 0312 gid USA300HOU 0104 trmE USA300HOU_2307 USA300HOU 1428 USA300HOU_2706 USA300HOU_1837 USA300HOU 1961 tagB nrdR USA300HOU 0137
-
exodeoxyribonuclease VII large subunit hypothetical protein hypothetical protein cysteine protease precursor SspB drug transporter hypothetical protein oligopeptide permease, channel-forming protein N-acetylglucosamine-6-phosphate deacetylase DltD protein hypothetical protein drug transporter preprotein translocase subunit SecG hypothetical protein acetyltransferase hypothetical protein hypothetical protein ribosomal RNA large subunit methyltransferase N DNA-binding protein HU prophage L54a, DNA packaging protein dihydropteroate synthase uroporphyrinogen III methylase putative phage regulatory protein 2-dehydropantoate 2-reductase hypothetical protein hypothetical protein Cro/CI family transcriptional regulator alanyl-tRNA synthetase hypothetical protein tRNA (uracil-5-)-methyltransferase Gid hypothetical protein tRNA modification GTPase TrmE hypothetical protein hypothetical protein integrase/recombinase core subunit hypothetical protein hypothetical protein teichoic acid biosynthesis protein B transcriptional regulator NrdR hypothetical protein
USA300HOU_0011 USA300HOU_1603 USA300HOU 0632 USA300HOU_2711 USA300HOU_1750 USA300HOU 0836 USA300HOU 1717 USA300HOU_1446 USA300HOU 0533 USA300HOU_1287 USA300HOU_2601 USA300HOU 1381 USA300HOU 2306 USA300HOU_1622 USA300HOU_1939
USA300HOU_0011 USA300HOU_1603 USA300HOU 0632 USA300HOU_2711 USA300HOU_1750 aroD tyrS USA300HOU_1446 rplJ parE USA300HOU_2601 USA300HOU 1381 USA300HOU 2306 iscS USA300HOU_1939
-
hypothetical protein enterotoxin type A hypothetical protein hypothetical protein drug transporter 3-dehydroquinate dehydratase tyrosyl-tRNA synthetase hypothetical protein 50S ribosomal protein L10 DNA topoisomerase IV subunit B hypothetical protein hypothetical protein Na+/H+ antiporter family protein class V aminotransferase hypothetical protein
ClpA-like protein
Base mean A-value M-value Fold change Standard error Wald statistic P-value Adjusted P-value 918,58 9,84 -0,09 0,94 0,10 -0,92 0,359140937 0,445239915 273,58 8,10 -0,09 0,94 0,15 -0,62 0,535245881 0,619672464 697,93 9,45 -0,10 0,94 0,12 -0,83 0,408362288 0,493863723 289,36 8,18 -0,10 0,94 0,14 -0,70 0,486639514 0,572884887 10,84 3,44 -0,10 0,93 0,50 -0,19 0,846818337 0,886174211 1227,70 10,26 -0,10 0,93 0,13 -0,76 0,445617825 0,531659883 1600,88 10,64 -0,10 0,93 0,10 -0,94 0,345929133 0,431113371 944,70 9,88 -0,10 0,93 0,12 -0,82 0,409585338 0,494442636 6163,27 12,59 -0,10 0,93 0,10 -1,00 0,315911553 0,399323024 542,37 9,08 -0,10 0,93 0,11 -0,87 0,383160925 0,468404397 10352,46 13,34 -0,10 0,93 0,12 -0,89 0,376068103 0,461104269 79,14 6,31 -0,11 0,93 0,24 -0,45 0,655464409 0,724515171 106,03 6,73 -0,11 0,93 0,20 -0,52 0,605764577 0,680269012 3065,97 11,58 -0,11 0,93 0,09 -1,16 0,244759122 0,325162494 7,84 2,97 -0,11 0,93 0,62 -0,17 0,861407296 0,897904741 160,56 7,33 -0,11 0,93 0,18 -0,60 0,545425143 0,627356972 558,94 9,13 -0,11 0,93 0,13 -0,85 0,397108818 0,482449991 14,94 3,90 -0,11 0,93 0,44 -0,25 0,80197517 0,851657884 2971,89 11,54 -0,11 0,93 0,12 -0,91 0,36403162 0,450019735 16,80 4,07 -0,11 0,92 0,45 -0,25 0,800897972 0,851534978 1192,00 10,22 -0,11 0,92 0,09 -1,20 0,231359484 0,31030901 807,17 9,66 -0,12 0,92 0,14 -0,82 0,412293862 0,497034842 3463,98 11,76 -0,12 0,92 0,09 -1,23 0,21907062 0,295917965 1220,18 10,25 -0,12 0,92 0,10 -1,12 0,26379765 0,345106034 1787,86 10,80 -0,12 0,92 0,09 -1,28 0,200627936 0,274635974 136,28 7,09 -0,12 0,92 0,19 -0,63 0,529508057 0,614826233 10,45 -0,12 0,92 0,10 -1,20 0,231945522 0,310938069 1395,37 776,41 9,60 -0,12 0,92 0,11 -1,10 0,27074763 0,352981577 466,90 8,87 -0,12 0,92 0,12 -0,99 0,319829967 0,403508178 1558,57 10,61 -0,12 0,92 0,11 -1,14 0,255713306 0,336684962 5799,48 12,50 -0,12 0,92 0,12 -1,01 0,314811735 0,398122218 8,07 -0,12 0,92 0,14 -0,87 0,385165691 0,470089683 268,89 87,10 6,44 -0,12 0,92 0,26 -0,46 0,647636393 0,716987456 1490,04 10,54 -0,12 0,92 0,10 -1,21 0,226612085 0,304402583 2060,10 11,01 -0,12 0,92 0,11 -1,15 0,25129636 0,332186283 67,69 6,08 -0,12 0,92 0,24 -0,51 0,608044258 0,682252362 6,71 -0,12 0,92 0,20 -0,63 0,529671527 0,614826233 104,66 545,15 9,09 -0,13 0,91 0,11 -1,14 0,253360733 0,334416029 78,87 6,30 -0,13 0,91 0,24 -0,54 0,591037003 0,667113559 748,17 9,55 -0,14 0,91 0,13 -1,09 0,274560398 0,357251213 417,00 8,70 -0,14 0,91 0,13 -1,08 0,281814322 0,364370148 8,60 -0,14 0,91 0,12 -1,11 0,268791559 0,350775625 387,21 4739,14 12,21 -0,14 0,91 0,10 -1,36 0,175132399 0,243754209 267,05 8,06 -0,14 0,91 0,18 -0,76 0,444780202 0,530898921 299,99 8,23 -0,14 0,90 0,15 -0,93 0,351179659 0,436428603 72,99 6,19 -0,14 0,90 0,26 -0,55 0,584624244 0,661493508 6,72 -0,15 0,90 0,20 -0,73 0,464193283 0,550688005 105,39 197,25 7,62 -0,15 0,90 0,16 -0,89 0,374731055 0,459889336 65,25 6,03 -0,15 0,90 0,25 -0,59 0,556271841 0,637624798 479,97 8,91 -0,15 0,90 0,12 -1,25 0,211210934 0,287231799 370,87 8,53 -0,15 0,90 0,12 -1,18 0,239768211 0,319811313 8,23 -0,15 0,90 0,14 -1,01 0,312597985 0,395887915 299,47 49,85 5,64 -0,15 0,90 0,28 -0,54 0,591340101 0,667123843 164,57 7,36 -0,15 0,90 0,16 -0,91 0,364721054 0,450517824 27,52 4,78 -0,15 0,90 0,38 -0,39 0,694396095 0,757581612 1364,11 10,41 -0,15 0,90 0,12 -1,25 0,210137935 0,286179649 6,35 -0,15 0,90 0,23 -0,66 0,506072568 0,592350138 81,72 1872,72 10,87 -0,15 0,90 0,10 -1,54 0,124040192 0,181784219 1113,49 10,12 -0,15 0,90 0,13 -1,16 0,244178327 0,324553184 4,98 2,32 -0,15 0,90 0,64 -0,24 0,810402728 0,857864561 707,95 9,47 -0,15 0,90 0,15 -1,00 0,317448344 0,400693706 6,35 -0,15 0,90 0,25 -0,62 0,536307252 0,620544276 81,74 5476,67 12,42 -0,15 0,90 0,11 -1,44 0,149299302 0,213451533 751,28 9,55 -0,15 0,90 0,12 -1,29 0,197995853 0,27159266 1227,31 10,26 -0,15 0,90 0,10 -1,49 0,136366279 0,196808911 417,70 8,71 -0,15 0,90 0,12 -1,25 0,211592278 0,287423661 1097,23 10,10 -0,15 0,90 0,15 -1,01 0,312096303 0,395441047 -1,51 -0,15 0,90 0,10 0,132258895 0,191818714 3608,85 11,82 7,41 2,89 -0,16 0,90 0,61 -0,26 0,797148224 0,847898496 -0,16 0,90 0,28 73,14 6,19 -0,57 0,567855415 0,647550145 46,88 5,55 -0,16 0,90 0,28 -0,56 0,576618169 0,654732681 2005,86 10,97 -0,16 0,90 0,14 -1,13 0,25920082 0,340433306 4,84 -0,16 0,89 0,43 -0,37 0,712247048 0,774637907 28,71 17,95 4,17 -0,16 0,89 0,41 -0,40 0,689213033 0,752976575 0,417774144 150,94 7,24 -0,16 0,89 0,17 -0,97 0,333653268 1025,13 10,00 -0,16 0,89 0,11 -1,44 0,1491886 0,213451533 1548,66 10,60 -0,17 0,89 0,12 -1,42 0,154912276 0,220225744 9,43 -0,17 0,89 0,11 -1,53 0,12607389 0,18415521 689,69 40,02 5,32 -0,17 0,89 0,30 -0,55 0,57905827 0,656381324 0,525127393 119,05 6,90 -0,17 0,89 0,22 -0,77 0,438759056 421,26 8,72 -0,17 0,89 0,14 -1,21 0,225646649 0,30353185 388,11 8,60 -0,17 0,89 0,13 -1,26 0,208046888 0,283622669 8,69 -0,17 0,89 0,15 -1,14 0,255377222 0,336409162 413,47 8317,07 13,02 -0,17 0,89 0,09 -1,96 0,049764118 0,082279565 0,383034321 182,65 7,51 -0,17 0,89 0,16 -1,04 0,300430382 5190,15 12,34 -0,17 0,89 0,12 -1,46 0,143353426 0,205664176 34,97 5,13 -0,17 0,89 0,32 -0,55 0,584813041 0,661493508 0,678807261 38,50 5,27 -0,17 0,89 0,33 -0,52 0,604207442 2057,04 11,01 -0,17 0,89 0,09 -1,93 0,053665084 0,08780384 0,165722979 1590,93 10,64 -0,18 0,89 0,11 -1,59 0,111459151 98,87 6,63 -0,18 0,89 0,20 -0,87 0,385124486 0,470089683 105,29 6,72 -0,18 0,88 0,20 -0,89 0,374384546 0,459889336 12,86 -0,18 0,88 0,09 -1,92 0,054279702 0,088673034 7430,03 119,53 6,90 -0,18 0,88 0,19 -0,93 0,351161019 0,436428603 0,116575938 1478,92 10,53 -0,18 0,88 0,10 -1,78 0,074587541 11,99 3,58 -0,18 0,88 0,50 -0,36 0,715223879 0,777239202 689,49 9,43 -0,18 0,88 0,11 -1,60 0,108526881 0,161744438 15,15 -0,18 0,88 0,13 -1,44 0,149343771 0,213451533 36433,06 104,23 6,70 -0,18 0,88 0,21 -0,86 0,387656093 0,472694923 11,68 -0,19 0,88 0,12 -1,51 0,131696545 0,191107439 3291,50 1049,13 10,03 -0,19 0,88 0,10 -1,79 0,072950312 0,11448847 94,24 6,56 -0,19 0,88 0,21 -0,90 0,367600844 0,453001075 6,42 -0,19 0,88 0,22 -0,85 0,39552346 0,481457888 85,45 704,86 9,46 -0,19 0,88 0,12 -1,60 0,110041499 0,163706754 8,29 -0,19 0,88 0,14 -1,30 0,193693941 0,266793572 312,22 1445,99 10,50 -0,19 0,88 0,10 -1,80 0,071129933 0,112161562 489,23 8,93 -0,19 0,88 0,12 -1,62 0,105441243 0,157730787 0,709926257 27,23 4,77 -0,19 0,88 0,41 -0,47 0,639120665 3137,76 11,62 -0,19 0,88 0,11 -1,74 0,082701978 0,127329686 11,54 -0,19 0,87 0,10 -1,85 0,064801132 0,103533739 2984,57 1021,90 10,00 -0,19 0,87 0,12 -1,64 0,101472941 0,153276638 3039,02 11,57 -0,19 0,87 0,10 -1,92 0,055220335 0,089902224 0,318446425 170,94 7,42 -0,19 0,87 0,17 -1,18 0,238505226 0 12,85 3,68 -0,20 0,87 0,50 -0,39 0,697679219 0,76066216 0,241000476 414,66 8,70 -0,20 0,87 0,14 -1,36 0,172518971 1029,29 811,37 525,58 240,10 131,41 65,16 102,42 121,78 1965,01 62,44 88,31 1372,77 577,41 265,03 17,88 272,36 785,51 24385,68 10,60 198,20 82,91 12,24 764,92 4136,37 166,09 68,34 2875,05 50,30 1875,49 284,42 244,92 622,04 26,16 45,45 29,96 13,12 642,45 1575,69 177,36
10,01 9,66 9,04 7,91 7,04 6,03 6,68 6,93 10,94 5,96 6,46 10,42 9,17 8,05 4,16 8,09 9,62 14,57 3,41 7,63 6,37 3,61 9,58 12,01 7,38 6,09 11,49 5,65 10,87 8,15 7,94 9,28 4,71 5,51 4,90 3,71 9,33 10,62 7,47
-0,20 -0,20 -0,20 -0,20 -0,20 -0,20 -0,20 -0,20 -0,20 -0,20 -0,20 -0,21 -0,21 -0,21 -0,21 -0,21 -0,21 -0,21 -0,21 -0,21 -0,21 -0,21 -0,21 -0,21 -0,21 -0,22 -0,22 -0,22 -0,22 -0,22 -0,22 -0,22 -0,22 -0,22 -0,22 -0,22 -0,22 -0,22 -0,22
0,87 0,87 0,87 0,87 0,87 0,87 0,87 0,87 0,87 0,87 0,87 0,87 0,87 0,87 0,87 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86 0,86
0,12 0,11 0,16 0,15 0,18 0,27 0,20 0,20 0,12 0,29 0,24 0,11 0,11 0,14 0,48 0,14 0,11 0,17 0,52 0,17 0,22 0,49 0,11 0,12 0,17 0,24 0,11 0,33 0,09 0,14 0,15 0,11 0,36 0,28 0,34 0,48 0,11 0,12 0,16
-1,67 -1,83 -1,22 -1,35 -1,08 -0,74 -0,99 -0,99 -1,62 -0,71 -0,85 -1,82 -1,82 -1,52 -0,44 -1,48 -1,91 -1,20 -0,41 -1,23 -0,95 -0,44 -2,02 -1,76 -1,29 -0,91 -1,89 -0,65 -2,48 -1,55 -1,45 -2,08 -0,61 -0,78 -0,65 -0,47 -2,01 -1,88 -1,38
0,095526269 0,066878602 0,222447231 0,175652472 0,278609349 0,458402371 0,32280868 0,321275057 0,105223238 0,477735034 0,396567691 0,068881608 0,068297732 0,128674745 0,660713918 0,138108869 0,055507266 0,22826788 0,682607285 0,218536064 0,343790018 0,659834737 0,043471878 0,079087443 0,195604836 0,361302098 0,05940308 0,512493553 0,01301253 0,120729694 0,147461194 0,037307064 0,539998667 0,433497802 0,514361718 0,640467936 0,044003292 0,060674288 0,168614248
0,145262816 0,106468812 0,300021468 0,244350062 0,361104897 0,544711583 0,406301594 0,404754778 0,157508814 0,564653908 0,482233572 0,109199542 0,108403269 0,187541853 0,72843024 0,198999601 0,090275548 0,306471833 0,747296068 0,295496347 0,428849802 0,728065156 0,072965749 0,122456489 0,268590206 0,447542971 0,095908073 0,598021683 0,024451409 0,177685149 0,211101504 0,063704176 0,624087194 0,519532548 0,599674894 0,711125494 0,073671548 0,09776547 0,236415862
1151,53 41,35 59,95 45,24 105,55 244,32 124,10 13,88 477,35 1834,70 186,29 226,27 1561,27 997,28 1809,13
10,17 5,37 5,91 5,50 6,72 7,93 6,96 3,79 8,90 10,84 7,54 7,82 10,61 9,96 10,82
-0,22 -0,22 -0,23 -0,23 -0,23 -0,23 -0,23 -0,23 -0,23 -0,23 -0,23 -0,23 -0,23 -0,23 -0,23
0,86 0,86 0,86 0,86 0,85 0,85 0,85 0,85 0,85 0,85 0,85 0,85 0,85 0,85 0,85
0,11 0,29 0,32 0,29 0,21 0,15 0,18 0,48 0,14 0,10 0,16 0,15 0,11 0,11 0,14
-2,01 -0,77 -0,69 -0,78 -1,07 -1,51 -1,25 -0,48 -1,67 -2,20 -1,41 -1,54 -2,12 -2,19 -1,73
0,044728348 0,440724735 0,487279829 0,435715054 0,284703668 0,130801681 0,211311137 0,630186485 0,094931214 0,027542812 0,158141468 0,124599484 0,033981737 0,028600944 0,084001229
0,074744385 0,527242512 0,573384634 0,521719197 0,367034278 0,190016439 0,287231799 0,70264603 0,144462908 0,048496522 0,224097003 0,182503213 0,05870577 0,050127116 0,12908691
Locus USA300HOU 0812 USA300HOU 1977 USA300HOU_1055 USA300HOU 2640 USA300HOU_2424 USA300HOU_1326 USA300HOU 1220 USA300HOU 1196 USA300HOU_1957 USA300HOU 1613 USA300HOU_1564 USA300HOU_0611 USA300HOU 0612 USA300HOU_1715 USA300HOU_1816 USA300HOU 1288 USA300HOU 2421 USA300HOU_1726 USA300HOU 0892 USA300HOU_1097 USA300HOU_0866 USA300HOU 2264 USA300HOU 0635 USA300HOU_1461 USA300HOU 1335 USA300HOU_0014 USA300HOU_0454 USA300HOU 1042 USA300HOU_0842 USA300HOU_1820 USA300HOU 0604 USA300HOU_1725 USA300HOU_2303 USA300HOU 0521 USA300HOU_0882 USA300HOU_0016 USA300HOU 1149 USA300HOU 0189 USA300HOU_0922 USA300HOU 2571 USA300HOU_1001 USA300HOU_2320 USA300HOU 2473 USA300HOU_0863 USA300HOU_2039 USA300HOU 1129 USA300HOU_1971 USA300HOU_1206 USA300HOU 2509 USA300HOU 2075 USA300HOU_0058 USA300HOU 0736 USA300HOU 2682 USA300HOU_1271 USA300HOU 2442 USA300HOU_0895 USA300HOU 1635 USA300HOU_2003 USA300HOU_1631 USA300HOU 0322 USA300HOU_1503 USA300HOU_1262 USA300HOU 1475 USA300HOU_1356 USA300HOU_1968 USA300HOU 0793 USA300HOU_2547 USA300HOU_0003 USA300HOU 0319 USA300HOU_1377 USA300HOU_1273 USA300HOU 1225 USA300HOU 0259 USA300HOU_1771 USA300HOU 1494 USA300HOU_0381 USA300HOU_0096 USA300HOU 2449 USA300HOU_0260 USA300HOU_2118 USA300HOU 1279 USA300HOU_2212 USA300HOU_1436 USA300HOU 1655 USA300HOU 0592 USA300HOU_1378 USA300HOU 0013 USA300HOU 1305 USA300HOU_0787 USA300HOU 0467 USA300HOU_1110 USA300HOU_1830 USA300HOU 1901 USA300HOU_1863 USA300HOU_0052 USA300HOU 1147 USA300HOU_0412 USA300HOU_1447 USA300HOU 1929 USA300HOU_1531 USA300HOU_2700 USA300HOU 1170 USA300HOU 0099 USA300HOU_2361 USA300HOU 2299 USA300HOU_1821 USA300HOU_1264 USA300HOU 1324 USA300HOU_0342 USA300HOU_0748 USA300HOU 0070 USA300HOU_1372 USA300HOU_2078 USA300HOU 2241 USA300HOU_2680 USA300HOU_1214 USA300HOU 1275 USA300HOU_1380 USA300HOU_1224 USA300HOU 1802 USA300HOU 0034 USA300HOU_2352 USA300HOU 0235 USA300HOU_0984 USA300HOU_0062 USA300HOU 0006 USA300HOU_1263 USA300HOU_1401 USA300HOU 0498 USA300HOU_2484 USA300HOU_2237 USA300HOU 2693 USA300HOU_2515 USA300HOU_0263 USA300HOU 1552 USA300HOU 0339 USA300HOU_1241 USA300HOU 0767 USA300HOU_2213 USA300HOU_0535 USA300HOU 0683 USA300HOU_2017 USA300HOU_0602 USA300HOU 0698 USA300HOU_0861 USA300HOU_0461 USA300HOU 2384 USA300HOU_1295 USA300HOU_1270 USA300HOU 0286 USA300HOU 2643 USA300HOU_2198 USA300HOU 0496 USA300HOU_1762 USA300HOU_1021 USA300HOU 1083 USA300HOU_0095 USA300HOU_0739 USA300HOU 0630 USA300HOU 0413 USA300HOU_1614 USA300HOU 0302 USA300HOU_0778 USA300HOU_2627 USA300HOU 1679 USA300HOU 0618 USA300HOU_0740 USA300HOU 1434 USA300HOU_0462
Gene symbol USA300HOU 0812 USA300HOU 1977 ctaM USA300HOU 2640 USA300HOU_2424 cvfB USA300HOU 1220 polC USA300HOU_1957 USA300HOU 1613 dnaG USA300HOU_0611 USA300HOU 0612 ptaA USA300HOU_1816 parC USA300HOU 2421 USA300HOU_1726 dltX USA300HOU_1097 USA300HOU_0866 bioY USA300HOU 0635 rinB lysA USA300HOU 0014 USA300HOU_0454 potA USA300HOU_0842 USA300HOU_1820 USA300HOU 0604 ccpA glvC gltX USA300HOU_0882 dnaC coaBC USA300HOU 0189 USA300HOU_0922 USA300HOU 2571 fmtA USA300HOU_2320 USA300HOU 2473 USA300HOU_0863 scrR USA300HOU 1129 USA300HOU_1971 pnpA USA300HOU 2509 kdpE USA300HOU_0058 pabA USA300HOU 2682 thrD USA300HOU 2442 dltC USA300HOU 1635 USA300HOU_2003 dtd USA300HOU 0322 USA300HOU_1503 cls1 USA300HOU 1475 USA300HOU_1356 USA300HOU_1968 USA300HOU 0793 USA300HOU_2547 USA300HOU_0003 USA300HOU 0319 USA300HOU_1377 hom USA300HOU 1225 USA300HOU 0259 USA300HOU_1771 srrA parB USA300HOU_0096 USA300HOU 2449 USA300HOU_0260 USA300HOU_2118 tkt cbiO1 USA300HOU_1436 valS USA300HOU 0592 USA300HOU_1378 USA300HOU 0013 trpC uvrA USA300HOU 0467 eta hit gatA mutY USA300HOU_0052 gmk pbuX USA300HOU_1447 USA300HOU 1929 pepQ2 USA300HOU_2700 rnc USA300HOU 0099 cobI USA300HOU 2299 USA300HOU_1821 USA300HOU_1264 pstS USA300HOU_0342 USA300HOU_0748 arcA ebh ddl USA300HOU 2241 hisG USA300HOU_1214 thrB USA300HOU_1380 miaB splE USA300HOU 0034 paiA USA300HOU 0235 tarM USA300HOU_0062 gyrA USA300HOU_1263 USA300HOU_1401 USA300HOU 0498 USA300HOU_2484 USA300HOU_2237 USA300HOU 2693 USA300HOU_2515 tarJ' USA300HOU 1552 USA300HOU_0339 USA300HOU_1241 USA300HOU 0767 cbiO rsmC vraG fhuD1 USA300HOU_0602 USA300HOU 0698 USA300HOU_0861 USA300HOU_0461 USA300HOU 2384 msrA2 USA300HOU_1270 USA300HOU 0286 USA300HOU 2643 USA300HOU_2198 pth USA300HOU_1762 thiV sdhC USA300HOU_0095 USA300HOU_0739 USA300HOU 0630 guaB USA300HOU_1614 essC comFC USA300HOU_2627 phoR USA300HOU 0618 USA300HOU_0740 USA300HOU 1434 USA300HOU_0462
Regulon -
Function hypothetical protein hypothetical protein hypothetical protein BglG family transcriptional antiterminator amino acid permease hypothetical protein hypothetical protein DNA polymerase III PolC hypothetical protein U32 family peptidase DNA primase hypothetical protein hypothetical protein PTS system, IIBC components hypothetical protein DNA topoisomerase IV subunit A hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein BioY family protein replication initiation factor family protein hypothetical protein diaminopimelate decarboxylase hypothetical protein hypothetical protein spermidine/putrescine ABC transporter ATP-binding protein hypothetical protein hypothetical protein hypothetical protein catabolite control protein A PTS system, IIBC components glutamyl-tRNA synthetase hypothetical protein replicative DNA helicase phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase hypothetical protein hypothetical protein hypothetical protein fmt protein hypothetical protein hypothetical protein hypothetical protein sucrose operon repressor hypothetical protein phi77 ORF003-like protein, phage terminase, large subunit polynucleotide phosphorylase/polyadenylase hypothetical protein DNA-binding response regulator KdpE hypothetical protein para-aminobenzoate synthase, glutamine amidotransferase, component II hypothetical protein aspartate kinase drug transporter D-alanine--poly(phosphoribitol) ligase subunit 2 DltC hypothetical protein transcriptional regulator D-tyrosyl-tRNA(Tyr) deacylase hypothetical protein short chain dehydrogenase/reductase oxidoreductase cardiolipin synthetase phi APSE P51-like protein
USA300HOU_2343
htrB
-
ABC transporter permease
phi77 ORF006-like protein capsid protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein 5'-3' exonuclease homoserine dehydrogenase hypothetical protein sorbitol dehydrogenase hypothetical protein DNA-binding response regulator SrrA spoOJ protein hypothetical protein lipoprotein hypothetical protein acetyltransferase transketolase cobalt transporter ATP-binding subunit hypothetical protein valyl-tRNA synthetase hypothetical protein hypothetical protein hypothetical protein indole-3-glycerol-phosphate synthase excinuclease ABC subunit A MutT/nudix family protein exfoliative toxin HIT family protein aspartyl/glutamyl-tRNA amidotransferase subunit A A/G-specific adenine glycosylase hypothetical protein guanylate kinase xanthine permease hypothetical protein hypothetical protein proline dipeptidase hypothetical protein ribonuclease III permease CorA family protein amino acid permease hypothetical protein ABC transporter permease phosphate ABC transporter substrate-binding protein Oye family NADH-dependent flavin oxidoreductase hypothetical protein arginine deiminase cell wall associated fibronectin-binding protein D-alanyl-alanine synthetase A hypothetical protein ATP phosphoribosyltransferase catalytic subunit transcriptional regulator homoserine kinase hypothetical protein (dimethylallyl)adenosine tRNA methylthiotransferase serine protease SplE IS1272 transposase acetyltransferase hypothetical protein glycosyl transferase, group 1 family protein hypothetical protein DNA gyrase, A subunit ABC transporter ATP-binding protein hypothetical protein polysaccharide biosynthesis protein hypothetical protein acetyltransferase hypothetical protein ABC transporter ATP-binding protein alcohol dehydrogenase, zinc-containing 5-formyltetrahydrofolate cyclo-ligase hypothetical protein hypothetical protein hypothetical protein cobalt transporter ATP-binding subunit hypothetical protein ABC transporter permease iron compound ABC transporter iron compound-binding protein hypothetical protein hypothetical protein putative DNA primase hypothetical protein acetyltransferase methionine sulfoxide reductase A hypothetical protein hypothetical protein phage infection protein M23/M37 peptidase domain-containing protein peptidyl-tRNA hydrolase hypothetical protein hypothetical protein succinate dehydrogenase, cytochrome b558 subunit hypothetical protein hypothetical protein FtsK/SpoIIIE family protein inosine-5'-monophosphate dehydrogenase O-methyltransferase diarrheal toxin hypothetical protein hypothetical protein sensory box histidine kinase PhoR alpha/beta fold family hydrolase hypothetical protein hypothetical protein hypothetical protein
Base mean A-value M-value Fold change Standard error Wald statistic P-value Adjusted P-value 19,78 4,31 -0,23 0,85 0,44 -0,53 0,594579844 0,66997398 38,75 5,28 -0,23 0,85 0,42 -0,55 0,580443272 0,657670692 598,82 9,23 -0,24 0,85 0,11 -2,13 0,032999262 0,057246651 422,32 8,72 -0,24 0,85 0,13 -1,83 0,066926461 0,106481202 160,10 7,32 -0,24 0,85 0,17 -1,38 0,16626509 0,234230586 748,92 9,55 -0,24 0,85 0,13 -1,84 0,065335652 0,104199777 983,79 9,94 -0,24 0,85 0,10 -2,32 0,020118871 0,036265834 1460,82 10,51 -0,24 0,85 0,10 -2,48 0,013293214 0,024890816 257,90 8,01 -0,24 0,85 0,16 -1,46 0,143208322 0,205664176 550,40 9,10 -0,24 0,85 0,11 -2,10 0,036022678 0,061749842 1393,32 10,44 -0,24 0,85 0,11 -2,20 0,027796324 0,048878116 17,26 4,11 -0,24 0,85 0,44 -0,55 0,579054613 0,656381324 455,79 8,83 -0,24 0,85 0,12 -2,06 0,03958176 0,067193725 685,06 9,42 -0,24 0,84 0,12 -2,11 0,034495812 0,059439282 6,28 2,65 -0,24 0,84 0,61 -0,40 0,688824374 0,752861522 1653,84 10,69 -0,24 0,84 0,10 -2,53 0,011403023 0,02167227 63,32 5,98 -0,25 0,84 0,24 -1,03 0,302652095 0,385312227 87,93 6,46 -0,25 0,84 0,24 -1,04 0,300005514 0,382676261 435,08 8,77 -0,25 0,84 0,14 -1,82 0,069022976 0,109358407 272,01 8,09 -0,25 0,84 0,23 -1,10 0,272346017 0,354880851 766,84 9,58 -0,25 0,84 0,14 -1,75 0,079784312 0,12346355 264,11 8,04 -0,25 0,84 0,15 -1,69 0,091894174 0,140001617 97,74 6,61 -0,25 0,84 0,20 -1,23 0,217436666 0,294159482 8,48 3,08 -0,25 0,84 0,63 -0,40 0,686869711 0,751343278 1215,88 10,25 -0,25 0,84 0,11 -2,37 0,017652489 0,032125113 4838,18 12,24 -0,25 0,84 0,10 -2,46 0,013745779 0,025611876 15,15 3,92 -0,25 0,84 0,44 -0,58 0,562716724 0,643070252 129,88 7,02 -0,26 0,84 0,18 -1,42 0,156192723 0,221690206 246,46 7,95 -0,26 0,84 0,15 -1,77 0,075903548 0,118423798 1541,44 10,59 -0,26 0,83 0,12 -2,23 0,025767914 0,045582788 65,74 6,04 -0,26 0,83 0,25 -1,05 0,29552016 0,378225947 3422,70 11,74 -0,26 0,83 0,10 -2,71 0,006644828 0,013195297 224,79 7,81 -0,26 0,83 0,15 -1,73 0,083860366 0,128945019 2546,68 11,31 -0,27 0,83 0,09 -2,95 0,003187137 0,00668896 316,37 8,31 -0,27 0,83 0,14 -1,88 0,060675672 0,09776547 1442,60 10,49 -0,27 0,83 0,10 -2,70 0,007014239 0,013846087 834,54 9,70 -0,27 0,83 0,11 -2,41 0,015775119 0,029006569 1911,97 10,90 -0,27 0,83 0,12 -2,29 0,022071755 0,039491349 1327,12 10,37 -0,27 0,83 0,11 -2,51 0,012135663 0,022933468 28,62 4,84 -0,27 0,83 0,35 -0,79 0,432114231 0,518108083 115,99 6,86 -0,27 0,83 0,20 -1,38 0,166793524 0,234730081 176,93 7,47 -0,27 0,83 0,17 -1,64 0,100095613 0,151454466 332,10 8,38 -0,27 0,83 0,13 -2,11 0,034779818 0,059851022 89,27 6,48 -0,27 0,83 0,25 -1,11 0,266611746 0,348444372 159,38 7,32 -0,27 0,83 0,17 -1,57 0,117021055 0,173024453 4552,75 12,15 -0,27 0,83 0,10 -2,80 0,005113005 0,010323141 52,04 5,70 -0,28 0,83 0,30 -0,90 0,36589912 0,451762993 1872,31 10,87 -0,28 0,83 0,11 -2,59 0,009665967 0,018610489 60,15 5,91 -0,28 0,82 0,30 -0,92 0,357994101 0,444066446 93,02 6,54 -0,28 0,82 0,21 -1,33 0,18196996 0,252345608 9,25 3,21 -0,28 0,82 0,55 -0,50 0,61478536 0,688943358 41,53 5,38 -0,28 0,82 0,30 -0,95 0,343238764 0,428564566 6,14 2,62 -0,28 0,82 0,65 -0,43 0,664526387 0,731419474 3503,06 11,77 -0,28 0,82 0,10 -2,71 0,006684499 0,013247248 593,44 9,21 -0,28 0,82 0,14 -2,01 0,044325833 0,074164822 716,58 9,48 -0,29 0,82 0,12 -2,40 0,016356418 0,029971726 10,65 3,41 -0,29 0,82 0,53 -0,55 0,58570452 0,662219961 69,60 6,12 -0,29 0,82 0,25 -1,16 0,247591227 0,327941122 2309,78 11,17 -0,29 0,82 0,09 -3,06 0,002200824 0,004758005 401,70 8,65 -0,29 0,82 0,13 -2,21 0,026943397 0,047504051 7,33 -0,29 0,82 0,17 -1,73 0,083602814 0,128623438 160,44 584,12 9,19 -0,29 0,82 0,11 -2,62 0,008811964 0,017052724 16,37 4,03 -0,29 0,82 0,44 -0,66 0,50653005 0,592624545 0 1187,32 10,21 -0,29 0,82 0,10 -2,83 0,004716656 0,009566531 33,82 5,08 -0,29 0,82 0,32 -0,90 0,366694784 0,452324996 4,68 -0,29 0,82 0,41 -0,71 0,478409072 0,565199157 25,58 -0,29 0,82 0,10 -2,92 0,003473461 0,007227084 978,55 9,93 1318,33 10,36 -0,30 0,81 0,16 -1,84 0,065101361 0,103888478 205,15 7,68 -0,30 0,81 0,18 -1,63 0,102381524 0,154428774 304,68 8,25 -0,30 0,81 0,14 -2,14 0,03271704 0,056853613 15135,23 13,89 -0,30 0,81 0,08 -3,86 0,000115649 0,000308822 9,22 -0,30 0,81 0,12 -2,49 0,012735671 0,023948109 597,70 45,65 5,51 -0,30 0,81 0,33 -0,90 0,366577589 0,452324996 161,67 7,34 -0,30 0,81 0,26 -1,14 0,255071602 0,336173237 0,031976184 603,81 9,24 -0,30 0,81 0,13 -2,38 0,017546585 557,05 9,12 -0,30 0,81 0,12 -2,59 0,00948628 0,01827777 8,57 -0,30 0,81 0,14 -2,13 0,033409082 0,05782927 380,23 3920,10 11,94 -0,30 0,81 0,08 -3,66 0,0002537 0,000644438 23,98 4,58 -0,30 0,81 0,37 -0,82 0,412207556 0,497034842 253,93 7,99 -0,31 0,81 0,15 -2,01 0,044922512 0,074927254 12224,62 13,58 -0,31 0,81 0,11 -2,87 0,004121371 0,008475606 10,80 -0,31 0,81 0,09 -3,44 0,000573344 0,00137613 1788,62 39,31 5,30 -0,31 0,81 0,33 -0,94 0,345192261 0,430396921 1867,30 10,87 -0,31 0,81 0,10 -3,10 0,001957061 0,004276242 174,10 7,44 -0,31 0,81 0,19 -1,65 0,098558698 0,149213938 1103,25 10,11 -0,31 0,81 0,10 -3,07 0,002146599 0,004659733 11,40 -0,31 0,81 0,11 -2,82 0,004764639 0,009641772 2708,70 166,63 7,38 -0,31 0,81 0,18 -1,71 0,086394342 0,132229128 1621,23 10,66 -0,31 0,81 0,10 -3,04 0,002376937 0,005101391 698,46 9,45 -0,31 0,80 0,12 -2,63 0,008577027 0,01662229 43,37 5,44 -0,32 0,80 0,29 -1,08 0,2802478 0,362874466 11,20 -0,32 0,80 0,11 -2,92 0,003511147 0,007299779 2355,07 1062,62 10,05 -0,32 0,80 0,14 -2,20 0,027687929 0,048719753 365,96 8,52 -0,32 0,80 0,14 -2,30 0,021651556 0,038817938 58,46 5,87 -0,32 0,80 0,29 -1,09 0,276149954 0,358617022 2310,78 11,17 -0,32 0,80 0,09 -3,51 0,000450601 0,00110041 11,07 -0,32 0,80 0,12 -2,66 0,007846815 0,015352917 2144,59 17,12 4,10 -0,32 0,80 0,43 -0,74 0,457430568 0,543800009 0,004017571 918,68 9,84 -0,32 0,80 0,10 -3,12 0,001829605 996,43 9,96 -0,32 0,80 0,10 -3,08 0,002061398 0,004489455 7,40 2,89 -0,33 0,80 0,57 -0,57 0,567771646 0,647550145 7,86 -0,33 0,80 0,15 -2,24 0,025137961 0,044557414 232,36 457,83 8,84 -0,33 0,80 0,14 -2,31 0,02062852 0,037083882 0,006075585 968,94 9,92 -0,33 0,80 0,11 -2,98 0,002862865 3062,32 11,58 -0,33 0,80 0,10 -3,39 0,000707287 0,00167194 9,23 3,21 -0,33 0,80 0,54 -0,61 0,540420424 0,624281079 5,60 -0,33 0,80 0,28 -1,17 0,243609326 0,323958948 48,49 27,10 4,76 -0,33 0,80 0,35 -0,94 0,34787108 0,432924337 0,0310954 325,90 8,35 -0,33 0,79 0,14 -2,39 0,017004748 1807,34 10,82 -0,33 0,79 0,10 -3,30 0,000978534 0,002251052 257,64 8,01 -0,33 0,79 0,15 -2,29 0,022189665 0,039622272 0,020541063 530,60 9,05 -0,33 0,79 0,13 -2,55 0,010761445 2790,36 11,45 -0,34 0,79 0,08 -3,97 7,26582E-05 0,000197396 0,166276214 197,72 7,63 -0,34 0,79 0,21 -1,59 0,111893816 15385,08 13,91 -0,34 0,79 0,08 -4,00 6,39198E-05 0,00017466 631,11 9,30 -0,34 0,79 0,11 -2,98 0,002894851 0,006133667 0,000285701 5337,26 12,38 -0,34 0,79 0,09 -3,87 0,000106775 82,99 6,37 -0,34 0,79 0,22 -1,55 0,121173616 0,178172826 10,57 -0,34 0,79 0,09 -3,67 0,000246658 0,000628955 1524,46 18,89 4,24 -0,34 0,79 0,41 -0,83 0,405254355 0,490328243 31,35 4,97 -0,34 0,79 0,34 -1,01 0,313138842 0,396383946 0,067172769 194,80 7,61 -0,34 0,79 0,17 -2,06 0,039540162 17,05 4,09 -0,34 0,79 0,46 -0,75 0,454650612 0,540737097 8,95 -0,34 0,79 0,12 -2,90 0,003694566 0,007651178 494,63 35,81 5,16 -0,34 0,79 0,37 -0,93 0,350070453 0,435457488 996,45 9,96 -0,34 0,79 0,11 -3,01 0,002582706 0,005520717 5,68 -0,34 0,79 51,14 0,28 -1,24 0,214984883 0,291584908 670,72 9,39 -0,34 0,79 0,11 -3,07 0,002109118 0,004582115 257,25 8,01 -0,34 0,79 0,14 -2,47 0,013497351 0,025202012 166,35 7,38 -0,35 0,79 0,17 -2,05 0,040854671 0,068964969 1184,32 10,21 -0,35 0,79 0,12 -2,95 0,003142108 0,006604891 1038,06 10,02 -0,35 0,79 0,10 -3,40 0,000673165 0,001598066 40,95 5,36 -0,35 0,79 0,33 -1,05 0,293305701 0,376116432 574,22 9,17 -0,35 0,79 0,12 -3,01 0,002636692 0,005631584 440,04 8,78 -0,35 0,79 0,13 -2,78 0,005439091 0,010939943 56,20 5,81 -0,35 0,79 0,27 -1,29 0,195342562 0,268368762 41,90 5,39 -0,35 0,79 0,31 -1,12 0,262366046 0,34374092 628,21 9,30 -0,35 0,78 0,13 -2,64 0,008271252 0,016053116 1673,47 10,71 -0,35 0,78 0,10 -3,46 0,000533033 0,001285181 162,10 7,34 -0,35 0,78 0,18 -1,91 0,055517593 0,090275548 355,20 8,47 -0,35 0,78 0,13 -2,75 0,005965786 0,011918115 37,33 5,22 -0,35 0,78 0,35 -1,02 0,310076026 0,393444127 63,73 5,99 -0,35 0,78 0,26 -1,38 0,166350439 0,234230586 267,81 8,07 -0,35 0,78 0,15 -2,42 0,015521269 0,028622622 429,70 8,75 -0,36 0,78 0,15 -2,31 0,020834737 0,037429275 370,96 8,54 -0,36 0,78 0,14 -2,53 0,011486804 0,021815895 7,86 -0,36 0,78 0,15 -2,37 0,017674724 0,03214356 232,17 1925,71 10,91 -0,36 0,78 0,10 -3,66 0,000251384 0,000639164 227,31 7,83 -0,36 0,78 0,16 -2,29 0,022056092 0,039489917 48,58 5,60 -0,36 0,78 0,28 -1,27 0,203561517 0,278364874 3384,32 11,72 -0,36 0,78 0,09 -4,02 5,85694E-05 0,000160763 7,06 -0,36 0,78 0,20 -1,82 0,068430253 0,108548766 133,82 509,73 8,99 -0,37 0,78 0,12 -3,07 0,002151432 0,004666411 62,39 5,96 -0,37 0,77 0,26 -1,41 0,157157541 0,22282155 240,99 7,91 -0,37 0,77 0,15 -2,40 0,016198394 0,029743699 1028,62 10,01 -0,37 0,77 0,10 -3,78 0,000159476 0,000417878 4,67 -0,37 0,77 0,37 -1,00 0,317140882 0,400495876 25,52 211,55 7,72 -0,37 0,77 0,15 -2,49 0,012654553 0,023812428 28,81 4,85 -0,37 0,77 0,38 -0,99 0,32002377 0,403561062 4627,84 12,18 -0,37 0,77 0,08 -4,46 8,34928E-06 2,56167E-05 319,07 8,32 -0,37 0,77 0,14 -2,76 0,005811054 0,01164402 136,75 7,10 -0,38 0,77 0,27 -1,38 0,167929588 0,235728663 113,62 6,83 -0,38 0,77 0,21 -1,83 0,067772807 0,107698773 3322,46 11,70 -0,38 0,77 0,13 -2,82 0,004792991 0,009691763 661,85 9,37 -0,38 0,77 0,13 -2,93 0,003443355 0,007179643 555,28 9,12 -0,38 0,77 0,11 -3,49 0,000485308 0,001175445 685,07 9,42 -0,38 0,77 0,11 -3,46 0,000545602 0,001311913 16,01 4,00 -0,38 0,77 0,47 -0,80 0,423758035 0,50900773 330,96 8,37 -0,38 0,77 0,14 -2,72 0,006624322 0,013164415 101,82
6,67
-0,38
0,77
0,21
-1,80
0,07152181
0,112645791
Locus USA300HOU 1871 USA300HOU 0279 USA300HOU_0398 USA300HOU_1974
Gene symbol USA300HOU 1871 USA300HOU 0279 USA300HOU_0398 USA300HOU_1974
Regulon -
Function hypothetical protein hypothetical protein hypothetical protein phage transcriptional activator
USA300HOU_1711 USA300HOU_2606 USA300HOU 0336 USA300HOU_2342 USA300HOU_1806 USA300HOU 0777 USA300HOU_0347 USA300HOU_2074 USA300HOU 0510 USA300HOU 0004 USA300HOU_2365 USA300HOU 0230 USA300HOU_1773 USA300HOU_1128 USA300HOU_0841 USA300HOU_2478 USA300HOU 2661 USA300HOU 1640 USA300HOU_0313 USA300HOU_1474 USA300HOU 0862 USA300HOU_0638 USA300HOU_0741 USA300HOU 1797 USA300HOU_1130 USA300HOU_0658 USA300HOU 1654 USA300HOU 0613 USA300HOU_1956 USA300HOU 1120 USA300HOU_2249 USA300HOU_0634 USA300HOU 2206 USA300HOU 1019 USA300HOU_0747 USA300HOU 2122 USA300HOU_1894 USA300HOU_1740 USA300HOU 1917 USA300HOU_2705 USA300HOU_0316 USA300HOU 0060 USA300HOU 1896 USA300HOU_0839 USA300HOU 2481 USA300HOU_2681 USA300HOU_2325 USA300HOU 0785 USA300HOU 0923 USA300HOU_0051 USA300HOU 1633 USA300HOU_1995 USA300HOU_2679 USA300HOU 1844 USA300HOU_1639 USA300HOU_1438 USA300HOU 0240 USA300HOU_1741 USA300HOU_0025 USA300HOU 2002 USA300HOU_2607 USA300HOU_1804 USA300HOU 1966 USA300HOU_1298 USA300HOU_1689 USA300HOU 0071 USA300HOU_0654 USA300HOU_0061 USA300HOU 2628 USA300HOU 2385 USA300HOU_0305 USA300HOU 1819 USA300HOU 0932 USA300HOU_1425 USA300HOU 1746 USA300HOU_0053 USA300HOU_0665 USA300HOU 1540 USA300HOU_0288 USA300HOU_2121 USA300HOU 2377 USA300HOU_0269 USA300HOU_1972 USA300HOU 1953 USA300HOU 1179 USA300HOU_1443 USA300HOU 1272 USA300HOU 1466 USA300HOU_2211 USA300HOU 1487 USA300HOU_0807 USA300HOU_2044 USA300HOU 0482 USA300HOU_1442 USA300HOU_1432 USA300HOU 1712 USA300HOU_1437 USA300HOU_0888 USA300HOU 0324 USA300HOU_2621 USA300HOU_2144 USA300HOU 1192 USA300HOU_1783 USA300HOU_1630 USA300HOU 0598 USA300HOU_0262 USA300HOU_2130 USA300HOU 1276 USA300HOU_1784 USA300HOU_1477 USA300HOU 0850 USA300HOU_1242 USA300HOU_1210 USA300HOU 1336 USA300HOU_0038 USA300HOU_1250 USA300HOU 1404 USA300HOU 1916 USA300HOU_2364 USA300HOU 1502 USA300HOU_2429 USA300HOU_0978 USA300HOU 2612 USA300HOU 1803 USA300HOU_1632 USA300HOU 0834 USA300HOU_0417 USA300HOU_0786 USA300HOU 2641 USA300HOU_1792 USA300HOU_0363 USA300HOU 1798 USA300HOU 1766 USA300HOU_0012 USA300HOU 0063 USA300HOU_1999 USA300HOU_0080 USA300HOU 1233 USA300HOU_1800 USA300HOU_1992 USA300HOU 2114 USA300HOU_2521 USA300HOU_1232 USA300HOU 2045 USA300HOU_0633 USA300HOU_1989 USA300HOU 2507 USA300HOU 0529 USA300HOU_1772 USA300HOU 0351 USA300HOU_0936 USA300HOU_1235 USA300HOU 2036 USA300HOU_0692 USA300HOU_1634 USA300HOU 1213 USA300HOU 2328 USA300HOU_1767 USA300HOU 0877 USA300HOU_0890 USA300HOU_0306 USA300HOU 1506 USA300HOU 1793 USA300HOU_1997 USA300HOU_2381
USA300HOU_1711 betB nanK hrtA splA comFA sirTM kdpD USA300HOU 0510 recF USA300HOU_2365 hptR crcB2 USA300HOU_1128 USA300HOU 0841 USA300HOU_2478 USA300HOU 2661 ruvB USA300HOU_0313 USA300HOU_1474 USA300HOU 0862 USA300HOU_0638 USA300HOU_0741 USA300HOU 1797 ileS tagG folC argS USA300HOU_1956 ftsL USA300HOU_2249 USA300HOU_0634 USA300HOU 2206 thiX hisC hmrA dinP USA300HOU_1740 pheA USA300HOU_2705 USA300HOU_0316 USA300HOU 0060 rumA USA300HOU_0839 USA300HOU 2481 hisZ USA300HOU_2325 csbA spsA USA300HOU_0051 apt USA300HOU_1995 hisD USA300HOU 1844 queA USA300HOU_1438 fadA dat USA300HOU_0025 USA300HOU 2002 USA300HOU_2607 splC USA300HOU 1966 dmpI dnaE argR mntR USA300HOU_0061 USA300HOU 2628 USA300HOU 2385 esaE USA300HOU 1819 USA300HOU 0932 USA300HOU_1425 USA300HOU 1746 USA300HOU_0053 nupG USA300HOU 1540 USA300HOU_0288 USA300HOU_2121 narJ tarS USA300HOU_1972 USA300HOU 1953 fmhC USA300HOU_1443 USA300HOU 1272 USA300HOU 1466 ecfT USA300HOU 1487 USA300HOU_0807 gcp pstA USA300HOU_1442 USA300HOU_1432 serA USA300HOU 1437 USA300HOU_0888 USA300HOU 0324 USA300HOU_2621 USA300HOU_2144 uppS menC lytH USA300HOU 0598 tarI' USA300HOU_2130 USA300HOU 1276 menE USA300HOU_1477 int USA300HOU 1242 USA300HOU_1210 msa USA300HOU_0038 USA300HOU_1250 aroC nos USA300HOU_2364 USA300HOU 1502 flp prfC USA300HOU 2612 splD relA USA300HOU 0834 USA300HOU_0417 uvrB manP USA300HOU_1792 USA300HOU_0363 USA300HOU 1798 sigS metX USA300HOU 0063 USA300HOU_1999 opp-3C USA300HOU 1233 hsdM2 USA300HOU_1992 USA300HOU 2114 sdaAA glpD rimI USA300HOU_0633 ssb2 USA300HOU 2507 secE crcB1 USA300HOU 0351 USA300HOU_0936 hfq USA300HOU 2036 USA300HOU_0692 recJ USA300HOU 1213 corA comK2 USA300HOU 0877 USA300HOU_0890 esxD USA300HOU 1506 USA300HOU 1793 USA300HOU_1997 nasE
-
class V aminotransferase betaine aldehyde dehydrogenase ROK family protein ABC transporter ATP-binding protein serine protease SplA comf operon protein 1 hypothetical protein sensor histidine kinase KdpD GntR family transcriptional regulator recombination protein F hypothetical protein AraC family DNA-binding response regulator camphor resistance protein CrcB2 YlmH protein hypothetical protein hypothetical protein acetyltransferase Holliday junction DNA helicase RuvB hypothetical protein hypothetical protein pathogenicity island protein hypothetical protein hypothetical protein hypothetical protein isoleucyl-tRNA synthetase tagG protein, teichoic acid ABC transporter protein folylpolyglutamate synthase/dihydrofolate synthase arginyl-tRNA synthetase hypothetical protein cell division protein hypothetical protein hypothetical protein hypothetical protein cobalt transport family protein histidinol-phosphate aminotransferase M20/M25/M40 family peptidase DNA polymerase IV hypothetical protein prephenate dehydratase hypothetical protein hypothetical protein hypothetical protein RNA methyltransferase hypothetical protein MutT/nudix family protein ATP phosphoribosyltransferase regulatory subunit DNA-3-methyladenine glycosylase hypothetical protein signal peptidase IA, inactive hypothetical protein adenine phosphoribosyltransferase hypothetical protein histidinol dehydrogenase ribosomal large subunit pseudouridine synthase D S-adenosylmethionine:tRNA ribosyltransferase-isomerase hypothetical protein acetyl-CoA acetyltransferase D-alanine aminotransferase hypothetical protein hypothetical protein hypothetical protein serine protease SplC hypothetical bacteriophage protein 4-oxalocrotonate tautomerase DNA polymerase III subunit alpha arginine repressor iron-dependent repressor hypothetical protein transcriptional regulator formate/nitrite transporter family protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein nucleoside permease NupG hypothetical protein choloylglycine hydrolase hypothetical protein respiratory nitrate reductase subunit delta glycosyl transferase, group 2 family protein hypothetical protein hypothetical protein endopeptidase resistance gene hypothetical protein hypothetical protein hypothetical protein cobalt transport family protein phiSLT ORF153-like protein hypothetical protein DNA-binding/iron metalloprotein/AP endonuclease hypothetical protein hypothetical protein bacteriophage amidase D-3-phosphoglycerate dehydrogenase hypothetical protein hypothetical protein formate/nitrite transporter family protein ABC transporter permease ABC transporter ATP-binding protein UDP pyrophosphate synthase o-succinylbenzoic acid (OSB) synthetase N-acetylmuramoyl-L-alanine amidase hypothetical protein 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase hypothetical protein HAD superfamily hydrolase O-succinylbenzoic acid--CoA ligase hypothetical protein pathogenicity island protein, integrase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein chorismate synthase nitric-oxide synthase, oxygenase subunit transcriptional regulator hypothetical protein fmtA-like protein peptide chain release factor 3 hypothetical protein serine protease SplD GTP pyrophosphokinase hypothetical protein IS3 family transposase excinuclease ABC subunit B PTS system, fructose-specific IIABC components hypothetical protein ribosomal-protein-serine acetyltransferase hypothetical protein RNA polymerase sigma-70 family protein homoserine O-acetyltransferase hypothetical protein hypothetical bacteriophage protein oligopeptide permease, channel-forming protein alpha/beta fold family hydrolase type I restriction-modification system, M subunit hypothetical protein hypothetical protein L-serine dehydratase, iron-sulfur-dependent subunit alpha aerobic glycerol-3-phosphate dehydrogenase ribosomal-protein-alanine acetyltransferase hypothetical protein single-strand binding protein hypothetical protein preprotein translocase subunit SecE camphor resistance protein CrcB1 hypothetical protein Sua5/YciO/YrdC/YwlC family protein hfq protein hypothetical protein hypothetical protein single-stranded-DNA-specific exonuclease RecJ ACT domain-containing protein magnesium and cobalt transport protein CorA hypothetical protein hypothetical protein D-isomer specific 2-hydroxyacid dehydrogenase hypothetical protein hypothetical protein hypothetical protein hypothetical protein nitrite reductase [NAD(P)H], small subunit
Base mean A-value M-value Fold change Standard error Wald statistic P-value Adjusted P-value 134,80 7,07 -0,38 0,77 0,21 -1,86 0,062317046 0,100106646 30,72 4,94 -0,38 0,77 0,35 -1,10 0,269863675 0,352001858 35,96 5,17 -0,38 0,77 0,34 -1,13 0,260516337 0,341823164 39,66 5,31 -0,38 0,77 0,34 -1,13 0,257534893 0,338439521 16424,61 147,50 83,58 111,02 31,54 132,16 37,22 249,74 101,90 2730,38 1476,03 124,19 79,74 2781,70 66,87 161,75 52,84 369,55 58,39 15,07 92,28 31,47 851,33 490,72 999,91 1097,06 837,74 1633,38 22,54 2348,36 2,23 56,76 375,40 158,16 3607,68 1144,12 291,25 2,31 311,33 30,08 84,79 5,50 359,76 1225,14 183,41 23581,94 205,45 1224,33 1017,62 44,15 475,51 31,65 21614,51 857,71 236,48 21,64 28,07 1294,03 1106,41 68,92 2,21 29,23 12,71 2405,90 663,81 69,73 1241,34 13,02 933,35 420,56 30,71 133,69 85,53 115,28 181,97 530,41 969,23 161,93 146,83 1174,61 21,67 4411,28 13,42 62,11 82,72 8,22 54,12 14,20 1218,37 1199,86 933,49 188,24 3197,13 9,79 21,89 10060,58 67,02 400,80 63,70 349,95 589,89 303,46 83,19 2080,88 74,17 549,79 1027,52 3451,97 120,62 10,27 105,45 34,03 251,51 115,06 13,52 31,49 894,70 313,11 2243,90 67,68 720,03 649,65 11,27 28,69 6379,57 11,80 104,00 1738,94 603,86 38,30 4994,41 544,16 193,83 3083,35 27,41 27,17 72,20 358,96 100,84 102,55 374,63 200,20 1610,73 118,06 52,45 16,67 523,29 839,18 217,92 27,42 33,72 422,96 46,38 15,13 1548,91 874,81 582,33 193,84 158,07 585,43 16,14 6,45 74,08 48,65 42,83
14,00 7,20 6,39 6,79 4,98 7,05 5,22 7,96 6,67 11,41 10,53 6,96 6,32 11,44 6,06 7,34 5,72 8,53 5,87 3,91 6,53 4,98 9,73 8,94 9,97 10,10 9,71 10,67 4,49 11,20 1,16 5,83 8,55 7,31 11,82 10,16 8,19 1,21 8,28 4,91 6,41 2,46 8,49 10,26 7,52 14,53 7,68 10,26 9,99 5,46 8,89 4,98 14,40 9,74 7,89 4,44 4,81 10,34 10,11 6,11 1,15 4,87 3,67 11,23 9,37 6,12 10,28 3,70 9,87 8,72 4,94 7,06 6,42 6,85 7,51 9,05 9,92 7,34 7,20 10,20 4,44 12,11 3,75 5,96 6,37 3,04 5,76 3,83 10,25 10,23 9,87 7,56 11,64 3,29 4,45 13,30 6,07 8,65 5,99 8,45 9,20 8,25 6,38 11,02 6,21 9,10 10,00 11,75 6,91 3,36 6,72 5,09 7,97 6,85 3,76 4,98 9,81 8,29 11,13 6,08 9,49 9,34 3,49 4,84 12,64 3,56 6,70 10,76 9,24 5,26 12,29 9,09 7,60 11,59 4,78 4,76 6,17 8,49 6,66 6,68 8,55 7,65 10,65 6,88 5,71 4,06 9,03 9,71 7,77 4,78 5,08 8,72 5,54 3,92 10,60 9,77 9,19 7,60 7,30 9,19 4,01 2,69 6,21 5,60 5,42
-0,39 -0,39 -0,39 -0,39 -0,39 -0,39 -0,39 -0,40 -0,40 -0,40 -0,40 -0,40 -0,40 -0,40 -0,40 -0,40 -0,41 -0,41 -0,41 -0,41 -0,41 -0,41 -0,41 -0,42 -0,42 -0,42 -0,42 -0,42 -0,42 -0,42 -0,42 -0,42 -0,42 -0,42 -0,42 -0,42 -0,42 -0,42 -0,43 -0,43 -0,43 -0,43 -0,43 -0,43 -0,43 -0,43 -0,43 -0,43 -0,43 -0,43 -0,44 -0,44 -0,44 -0,44 -0,44 -0,44 -0,44 -0,44 -0,44 -0,45 -0,45 -0,45 -0,45 -0,45 -0,45 -0,45 -0,45 -0,45 -0,45 -0,46 -0,46 -0,46 -0,46 -0,46 -0,46 -0,46 -0,46 -0,47 -0,47 -0,47 -0,47 -0,47 -0,47 -0,47 -0,47 -0,47 -0,47 -0,47 -0,47 -0,47 -0,48 -0,48 -0,48 -0,48 -0,48 -0,48 -0,48 -0,48 -0,49 -0,49 -0,49 -0,49 -0,49 -0,49 -0,49 -0,49 -0,49 -0,49 -0,49 -0,49 -0,49 -0,50 -0,50 -0,50 -0,50 -0,50 -0,50 -0,51 -0,51 -0,51 -0,51 -0,51 -0,51 -0,51 -0,51 -0,51 -0,51 -0,52 -0,52 -0,52 -0,52 -0,52 -0,52 -0,52 -0,52 -0,52 -0,53 -0,53 -0,53 -0,53 -0,53 -0,53 -0,53 -0,54 -0,54 -0,54 -0,54 -0,54 -0,54 -0,54 -0,54 -0,54 -0,54 -0,55 -0,55 -0,55 -0,55 -0,55 -0,55 -0,55 -0,56 -0,56 -0,56 -0,56 -0,56
0,77 0,77 0,76 0,76 0,76 0,76 0,76 0,76 0,76 0,76 0,76 0,76 0,76 0,76 0,76 0,76 0,76 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,75 0,74 0,74 0,74 0,74 0,74 0,74 0,74 0,74 0,74 0,74 0,74 0,74 0,74 0,74 0,74 0,74 0,74 0,74 0,74 0,74 0,74 0,73 0,73 0,73 0,73 0,73 0,73 0,73 0,73 0,73 0,73 0,73 0,73 0,73 0,73 0,73 0,73 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,72 0,71 0,71 0,71 0,71 0,71 0,71 0,71 0,71 0,71 0,71 0,71 0,71 0,71 0,71 0,71 0,71 0,71 0,71 0,71 0,71 0,70 0,70 0,70 0,70 0,70 0,70 0,70 0,70 0,70 0,70 0,70 0,70 0,70 0,70 0,70 0,70 0,70 0,70 0,70 0,69 0,69 0,69 0,69 0,69 0,69 0,69 0,69 0,69 0,69 0,69 0,69 0,69 0,69 0,69 0,69 0,69 0,68 0,68 0,68 0,68 0,68 0,68 0,68 0,68 0,68 0,68 0,68 0,68
0,12 0,18 0,25 0,21 0,33 0,23 0,33 0,15 0,21 0,11 0,12 0,19 0,22 0,09 0,27 0,20 0,32 0,13 0,27 0,48 0,22 0,36 0,10 0,19 0,13 0,13 0,13 0,11 0,40 0,12 0,73 0,27 0,13 0,17 0,11 0,10 0,14 0,73 0,14 0,35 0,24 0,66 0,13 0,11 0,16 0,10 0,16 0,12 0,10 0,35 0,12 0,34 0,09 0,13 0,17 0,43 0,41 0,09 0,11 0,26 0,73 0,34 0,48 0,11 0,11 0,25 0,10 0,52 0,11 0,13 0,40 0,20 0,22 0,19 0,16 0,13 0,14 0,17 0,17 0,10 0,41 0,09 0,55 0,25 0,26 0,62 0,30 0,51 0,10 0,11 0,10 0,18 0,10 0,58 0,45 0,12 0,28 0,14 0,25 0,13 0,11 0,14 0,23 0,11 0,23 0,12 0,10 0,10 0,19 0,58 0,20 0,35 0,17 0,23 0,47 0,33 0,11 0,14 0,11 0,25 0,11 0,11 0,61 0,42 0,09 0,49 0,21 0,10 0,13 0,35 0,10 0,18 0,17 0,09 0,36 0,37 0,25 0,13 0,21 0,23 0,15 0,16 0,11 0,20 0,35 0,45 0,13 0,11 0,15 0,39 0,33 0,14 0,30 0,47 0,11 0,12 0,12 0,19 0,19 0,12 0,52 0,64 0,26 0,28 0,31
-3,14 -2,12 -1,59 -1,89 -1,18 -1,73 -1,18 -2,58 -1,92 -3,46 -3,27 -2,13 -1,79 -4,38 -1,49 -2,06 -1,27 -3,25 -1,51 -0,85 -1,90 -1,14 -4,18 -2,23 -3,31 -3,14 -3,24 -3,79 -1,06 -3,56 -0,57 -1,53 -3,27 -2,48 -3,82 -4,21 -3,00 -0,58 -3,06 -1,23 -1,80 -0,65 -3,35 -3,87 -2,69 -4,31 -2,68 -3,48 -4,25 -1,24 -3,64 -1,27 -4,84 -3,40 -2,60 -1,03 -1,07 -4,68 -3,93 -1,72 -0,61 -1,30 -0,93 -3,90 -4,23 -1,77 -4,43 -0,87 -4,07 -3,57 -1,14 -2,25 -2,07 -2,41 -2,86 -3,63 -3,27 -2,69 -2,70 -4,67 -1,15 -5,37 -0,85 -1,85 -1,78 -0,77 -1,59 -0,93 -4,78 -4,16 -4,66 -2,71 -4,86 -0,83 -1,06 -4,11 -1,74 -3,58 -1,97 -3,83 -4,47 -3,58 -2,14 -4,60 -2,14 -4,03 -4,76 -5,16 -2,54 -0,85 -2,52 -1,42 -2,97 -2,14 -1,06 -1,50 -4,65 -3,70 -4,79 -2,06 -4,59 -4,70 -0,85 -1,23 -5,76 -1,04 -2,40 -5,23 -3,97 -1,49 -5,38 -2,93 -3,05 -5,71 -1,46 -1,43 -2,09 -4,17 -2,48 -2,33 -3,58 -3,32 -4,65 -2,66 -1,53 -1,19 -4,13 -5,00 -3,57 -1,37 -1,63 -3,84 -1,83 -1,17 -4,84 -4,76 -4,74 -2,95 -2,94 -4,64 -1,06 -0,87 -2,10 -1,99 -1,81
0,001696253 0,033663461 0,112515221 0,058141016 0,236264609 0,084340816 0,236425061 0,009813863 0,055073163 0,000544348 0,001073688 0,033215548 0,07279121 1,18066E-05 0,137321974 0,039697542 0,205769095 0,001151621 0,130284869 0,397455882 0,057632228 0,253919584 2,92784E-05 0,02573385 0,000933405 0,00170898 0,001191752 0,000151894 0,2902213 0,000373454 0,56722022 0,125005856 0,001094467 0,013198901 0,000133756 2,5743E-05 0,002715723 0,559116229 0,002242185 0,220528615 0,071577974 0,512847046 0,000798531 0,000110184 0,007149184 1,66766E-05 0,007412127 0,00049231 2,1604E-05 0,214486527 0,000274733 0,204471193 1,29884E-06 0,00067363 0,009243133 0,304101392 0,283389924 2,80103E-06 8,53817E-05 0,084902732 0,541401379 0,194687604 0,352692607 9,64491E-05 2,31242E-05 0,076288975 9,54597E-06 0,383556934 4,77274E-05 0,000359874 0,255949362 0,024432645 0,038142853 0,016165643 0,004247272 0,000284698 0,00107908 0,007216156 0,006857262 2,9776E-06 0,251047651 7,78989E-08 0,396960285 0,064681129 0,074382998 0,443062289 0,112902851 0,353930056 1,73916E-06 3,23399E-05 3,11287E-06 0,006676447 1,16441E-06 0,409127419 0,287605665 3,97748E-05 0,081019259 0,000342595 0,048779115 0,000129023 7,72007E-06 0,000338737 0,032430138 4,30276E-06 0,032177539 5,63137E-05 1,9588E-06 2,43278E-07 0,011229979 0,395567395 0,011860198 0,155791641 0,002933038 0,032475903 0,290192115 0,134377338 3,27357E-06 0,000214023 1,64196E-06 0,039227725 4,33008E-06 2,64462E-06 0,397946668 0,216956565 8,21947E-09 0,298273819 0,016266169 1,71981E-07 7,33182E-05 0,135679865 7,42042E-08 0,003362511 0,002289633 1,15484E-08 0,144449066 0,15192352 0,036737819 3,02878E-05 0,013240576 0,020038949 0,000348127 0,000914117 3,27671E-06 0,007846918 0,126306283 0,232392545 3,62802E-05 5,79504E-07 0,00036139 0,170073042 0,102676182 0,000125458 0,067962849 0,243520544 1,27293E-06 1,95938E-06 2,11142E-06 0,003132854 0,003267737 3,43231E-06 0,289979049 0,382733122 0,035436695 0,047055775 0,069776168
0,003752661 0,058231652 0,167106172 0,094023542 0,316090164 0,129459011 0,31614564 0,018881559 0,089827743 0,001310535 0,002457182 0,057569283 0,114306291 3,55269E-05 0,197973133 0,06731102 0,280805591 0,002615263 0,189502517 0,48265095 0,093485245 0,334987256 8,42825E-05 0,045552858 0,002156572 0,003777671 0,002694882 0,000399191 0,373242011 0,000922181 0,647381497 0,182997553 0,002500429 0,024749104 0,000355036 7,47531E-05 0,005781791 0,640056794 0,00483955 0,297584829 0,112667463 0,598171467 0,001864408 0,000294527 0,014081084 4,92329E-05 0,014566584 0,001191318 6,33576E-05 0,29105756 0,000693224 0,279465 4,42438E-06 0,001598066 0,017848115 0,386971934 0,365873191 9,08711E-06 0,000231017 0,130096055 0,624847221 0,267980607 0,438103907 0,000259904 6,74436E-05 0,118885517 2,90867E-05 0,468556678 0,000132787 0,000892797 0,336828853 0,043365089 0,064968643 0,029704089 0,008687454 0,000716327 0,002467397 0,014202464 0,013566452 9,63638E-06 0,332186283 3,00839E-07 0,482449991 0,103404187 0,116324676 0,529562079 0,167588198 0,439435588 5,81985E-06 9,24943E-05 1,00375E-05 0,013247248 4,00238E-06 0,494114342 0,370595661 0,000112189 0,125155914 0,000852318 0,080751469 0,000342815 2,37961E-05 0,00084351 0,05650287 1,36263E-05 0,056099554 0,000154892 6,49137E-06 8,8668E-07 0,021389287 0,481457888 0,022492895 0,221239118 0,006204683 0,056545527 0,373242011 0,19449144 1,05275E-05 0,000550492 5,50843E-06 0,066684622 1,36802E-05 8,62177E-06 0,483026174 0,293659497 3,48868E-08 0,38083303 0,029847522 6,35539E-07 0,000198985 0,196031214 2,88246E-07 0,007034796 0,004933945 4,83214E-08 0,207124215 0,216440103 0,062854079 8,69998E-05 0,02480974 0,036170847 0,00086446 0,002117532 1,05275E-05 0,015352917 0,184393294 0,311380229 0,000102768 2,05026E-06 0,000894054 0,238209843 0,154654544 0,00033401 0,107936216 0,323958948 4,34168E-06 6,49137E-06 6,95172E-06 0,006590651 0,006847301 1,09875E-05 0,373242011 0,468196088 0,060863154 0,078093188 0,110420059
Locus USA300HOU 1245 USA300HOU 2676 USA300HOU_0976 USA300HOU 1357 USA300HOU_0210 USA300HOU_0254 USA300HOU 1453 USA300HOU 0234 USA300HOU_1514 USA300HOU 2378 USA300HOU_0528 USA300HOU_2210 USA300HOU 2589 USA300HOU_0050 USA300HOU_1541 USA300HOU 1843 USA300HOU 1547 USA300HOU_2656 USA300HOU 1954 USA300HOU_1938 USA300HOU_1551 USA300HOU 0035 USA300HOU 0284 USA300HOU_1020 USA300HOU 1234 USA300HOU_2156 USA300HOU_2707 USA300HOU 2467 USA300HOU_1223 USA300HOU_1959 USA300HOU 0481 USA300HOU_1246 USA300HOU_1742 USA300HOU 0256 USA300HOU_2142 USA300HOU_1318 USA300HOU 0045 USA300HOU 0010 USA300HOU_1902 USA300HOU 0770 USA300HOU_2466 USA300HOU_2322 USA300HOU 1794 USA300HOU_0750 USA300HOU 0935 USA300HOU_0766 USA300HOU_1178 USA300HOU 1818 USA300HOU 1965 USA300HOU_2375 USA300HOU 0617 USA300HOU_1791 USA300HOU_1524 USA300HOU 1471 USA300HOU_0320 USA300HOU_1173 USA300HOU 1463 USA300HOU_1967 USA300HOU_1836 USA300HOU 0909 USA300HOU_1978 USA300HOU_0872 USA300HOU 0258 USA300HOU_1588 USA300HOU_1427 USA300HOU 1719 USA300HOU_2000 USA300HOU_2660 USA300HOU 0943 USA300HOU_1991 USA300HOU_1691 USA300HOU 0361 USA300HOU 0264 USA300HOU_0411 USA300HOU 0476 USA300HOU_1450 USA300HOU_1454 USA300HOU 2474 USA300HOU_2704 USA300HOU_0317 USA300HOU 2374 USA300HOU_1841 USA300HOU_0601 USA300HOU 0064 USA300HOU 0494 USA300HOU_2376 USA300HOU 0374 USA300HOU 1421 USA300HOU_1876 USA300HOU 2480 USA300HOU_0209 USA300HOU_1723 USA300HOU 2001 USA300HOU_0207 USA300HOU_1789 USA300HOU 1267 USA300HOU_2312 USA300HOU_0824 USA300HOU 0023 USA300HOU_2207 USA300HOU_2522 USA300HOU 1996 USA300HOU 1983 USA300HOU_2041 USA300HOU 0275 USA300HOU_2450 USA300HOU_1251 USA300HOU 1156 USA300HOU_2694 USA300HOU_0078 USA300HOU 1589 USA300HOU_2523 USA300HOU_0354 USA300HOU 0036 USA300HOU_0972 USA300HOU_1930 USA300HOU 2554 USA300HOU 2004 USA300HOU_1426 USA300HOU 0884 USA300HOU_1197 USA300HOU_0037 USA300HOU 1834 USA300HOU_0660 USA300HOU_0065 USA300HOU 1964 USA300HOU_0912 USA300HOU_1109 USA300HOU 1079 USA300HOU_0514 USA300HOU_0977 USA300HOU 0682 USA300HOU_1817 USA300HOU_1280 USA300HOU 1071 USA300HOU 1835 USA300HOU_0026 USA300HOU 0938 USA300HOU_0239 USA300HOU_1259 USA300HOU 0503 USA300HOU_2454 USA300HOU_2456 USA300HOU 0321 USA300HOU_0593 USA300HOU_0042 USA300HOU 1962 USA300HOU_0255 USA300HOU_0028 USA300HOU 1073 USA300HOU 0937 USA300HOU_0889 USA300HOU 2321 USA300HOU_1790 USA300HOU_1928 USA300HOU 0419 USA300HOU_1479 USA300HOU_2192 USA300HOU 0304 USA300HOU 1496 USA300HOU_0333 USA300HOU 0055 USA300HOU_2506 USA300HOU 0757 USA300HOU_1193 USA300HOU_2288 USA300HOU 1986 USA300HOU_1548 USA300HOU_1405 USA300HOU_1464
Gene symbol USA300HOU 1245 hisH murE ctpA USA300HOU_0210 USA300HOU_0254 USA300HOU 1453 pflA USA300HOU_1514 narH rpmG1 truA USA300HOU 2589 USA300HOU_0050 comGF airS USA300HOU 1547 USA300HOU_2656 USA300HOU 1954 USA300HOU_1938 USA300HOU_1551 USA300HOU 0035 USA300HOU 0284 thiW miaA USA300HOU 2156 USA300HOU_2707 USA300HOU 2467 USA300HOU_1223 USA300HOU_1959 tmk USA300HOU_1246 USA300HOU_1742 USA300HOU 0256 USA300HOU_2142 USA300HOU_1318 USA300HOU 0045 USA300HOU 0010 gatC pepT USA300HOU 2466 USA300HOU_2322 USA300HOU 1794 USA300HOU_0750 USA300HOU 0935 USA300HOU_0766 lytN lukE USA300HOU 1965 nreA USA300HOU 0617 USA300HOU_1791 xseB USA300HOU 1471 USA300HOU_0320 USA300HOU_1173 USA300HOU 1463 USA300HOU_1967 USA300HOU_1836 mnhD USA300HOU_1978 USA300HOU_0872 USA300HOU 0258 holA USA300HOU_1427 USA300HOU 1719 USA300HOU_2000 msrA3 USA300HOU 0943 recT USA300HOU_1691 USA300HOU 0361 tarL' xpt USA300HOU 0476 USA300HOU_1450 USA300HOU_1454 USA300HOU 2474 vraE USA300HOU_0317 nreB USA300HOU_1841 USA300HOU_0601 USA300HOU 0064 veg narI USA300HOU 0374 USA300HOU 1421 USA300HOU_1876 USA300HOU 2480 USA300HOU_0209 acuA USA300HOU 2001 USA300HOU_0207 USA300HOU_1789 USA300HOU 1267 hutR cspC adsA USA300HOU 2207 sdaAB USA300HOU 1996 USA300HOU 1983 USA300HOU_2041 bglR USA300HOU_2450 USA300HOU_1251 stp1 USA300HOU_2694 USA300HOU_0078 comEC USA300HOU_2523 mepR USA300HOU 0036 USA300HOU_0972 USA300HOU_1930 USA300HOU 2554 USA300HOU 2004 USA300HOU_1426 USA300HOU 0884 rimP USA300HOU_0037 cbf1 tagX USA300HOU_0065 USA300HOU 1964 mnhA USA300HOU_1109 mutS2 nupC USA300HOU_0977 vraF lukD USA300HOU_1280 USA300HOU 1071 USA300HOU_1835 tnp USA300HOU 0938 USA300HOU_0239 USA300HOU_1259 tilS cntF cnzC USA300HOU 0321 USA300HOU_0593 USA300HOU_0042 USA300HOU 1962 USA300HOU_0255 USA300HOU_0028 pheS USA300HOU 0937 USA300HOU_0889 USA300HOU 2321 USA300HOU_1790 USA300HOU_1928 USA300HOU 0419 USA300HOU_1479 USA300HOU_2192 esxB scpA USA300HOU_0333 USA300HOU 0055 USA300HOU_2506 USA300HOU 0757 cdsA USA300HOU_2288 rusA USA300HOU_1548 USA300HOU_1405 USA300HOU_1464
Regulon -
Function hypothetical protein imidazole glycerol phosphate synthase subunit HisH UDP-N-acetylmuramoylalanyl-D-glutamate--L-lysine ligase carboxyl-terminal protease hypothetical protein hypothetical protein prophage L54a, terminase, large subunit pyruvate formate-lyase-activating enzyme hypothetical protein respiratory nitrate reductase subunit beta ribosomal protein L33 tRNA pseudouridine synthase A hypothetical protein hypothetical protein hypothetical protein sensor histidine kinase metallo-beta-lactamase hypothetical protein hypothetical protein hypothetical protein rhomboid family protein hypothetical protein hypothetical protein ABC transporter ATP-binding protein tRNA delta(2)-isopentenylpyrophosphate transferase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein thymidylate kinase hypothetical protein dipeptidase PepV PTS system, sugar-specific IIA component hypothetical protein oligoendopeptidase F metallo-beta-lactamase hypothetical protein aspartyl/glutamyl-tRNA amidotransferase subunit C peptidase T hypothetical protein hypothetical protein hypothetical protein hypothetical protein isopropylmalate synthase-like protein hypothetical protein cell wall hydrolase leukotoxin LukE hypothetical protein hypothetical protein HAD superfamily hydrolase hypothetical protein exodeoxyribonuclease VII small subunit phiSLT ORF122-like protein, DNA polymerase hypothetical protein hypothetical protein phiSLT ORF 78B-like protein hypothetical protein DNA repair exonuclease monovalent cation/H+ antiporter subunit D hypothetical protein hypothetical protein PTS system, sorbitol-specific IIC component DNA polymerase III subunit delta hypothetical protein hypothetical protein anti repressor methionine sulfoxide reductase A hypothetical protein hypothetical protein hypothetical protein hypothetical protein teichoic acid biosynthesis protein xanthine phosphoribosyltransferase acetyltransferase prophage L54a, major capsid protein prophage L54a, terminase, small subunit hypothetical protein ABC transporter permease hypothetical protein sensory box histidine kinase transcriptional regulator hypothetical protein hypothetical protein hypothetical protein respiratory nitrate reductase subunit gamma hypothetical protein hypothetical protein hypothetical protein helicase hypothetical protein acetoin utilization protein AcuA hypothetical protein RpiR family phosphosugar-binding transcriptional regulator hypothetical protein hypothetical protein LysR family transcriptional regulator CSD family cold shock protein 5'-nucleotidase hypothetical protein L-serine dehydratase, iron-sulfur-dependent subunit beta hypothetical protein phiPV083 ORF027-like protein hypothetical protein GntR family transcriptional regulator glutamate synthase hypothetical protein protein phosphatase 2C domain-containing protein hypothetical protein peptide ABC transporter peptide-binding protein competence protein ComEC/Rec2 perfringolysin O regulator protein MarR family transcriptional regulator hypothetical protein hypothetical protein hypothetical protein D-lactate dehydrogenase hypothetical protein hypothetical protein 5'-nucleotidase hypothetical protein hypothetical protein 3'-5' exoribonuclease cbf1 teichoic acid biosynthesis protein X putative transposase hypothetical protein monovalent cation/H+ antiporter subunit A hypothetical protein recombination and DNA strand exchange inhibitor protein nucleoside permease NupC hypothetical protein ABC transporter ATP-binding protein leukotoxin LukD hypothetical protein hypothetical protein hypothetical protein IS431mec, transposase hypothetical protein hypothetical protein hypothetical protein hypothetical protein peptide ABC transporter ATP-binding protein peptide ABC transporter permease hypothetical protein hypothetical protein hypothetical protein hypothetical protein BglG family transcriptional antiterminator hypothetical protein phenylalanyl-tRNA synthetase subunit alpha hypothetical protein HAD superfamily hydrolase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein nucleoside permease hypothetical protein hypothetical protein hypothetical protein phosphatidate cytidylyltransferase N-acetylmuramoyl-L-alanine amidase endodeoxyribonuclease RusA hypothetical protein hypothetical protein phiSLT ORF 77-like protein
Base mean A-value M-value Fold change Standard error Wald statistic P-value Adjusted P-value 49,44 5,63 -0,56 0,68 0,29 -1,92 0,055166523 0,089869682 2275,33 11,15 -0,56 0,68 0,11 -4,92 8,54958E-07 2,97333E-06 715,65 9,48 -0,56 0,68 0,12 -4,85 1,24427E-06 4,25488E-06 928,85 9,86 -0,56 0,68 0,10 -5,40 6,56714E-08 2,55474E-07 829,57 9,70 -0,56 0,68 0,12 -4,76 1,93966E-06 6,44208E-06 4,44 2,15 -0,57 0,68 0,67 -0,84 0,401374883 0,486520558 51,66 5,69 -0,57 0,68 0,29 -1,94 0,052725667 0,086530017 82,85 6,37 -0,57 0,68 0,25 -2,28 0,022861169 0,040766528 249,69 7,96 -0,57 0,68 0,18 -3,19 0,001420112 0,003176127 71,74 6,16 -0,57 0,67 0,28 -2,07 0,038626477 0,065704577 542,57 9,08 -0,57 0,67 0,11 -5,03 4,93819E-07 1,75646E-06 1114,14 10,12 -0,57 0,67 0,10 -5,77 7,77104E-09 3,30362E-08 27,58 4,79 -0,57 0,67 0,36 -1,58 0,11402221 0,168966543 111,79 6,80 -0,57 0,67 0,24 -2,37 0,017820228 0,032363874 28,11 4,81 -0,57 0,67 0,35 -1,63 0,102410049 0,154428774 551,94 9,11 -0,57 0,67 0,12 -4,77 1,85398E-06 6,18071E-06 493,83 8,95 -0,58 0,67 0,14 -4,22 2,40372E-05 6,99527E-05 59,05 5,88 -0,58 0,67 0,26 -2,19 0,028599929 0,050127116 22,67 4,50 -0,58 0,67 0,40 -1,45 0,146222695 0,209441347 36,61 5,19 -0,58 0,67 0,36 -1,61 0,106581728 0,159183615 911,62 9,83 -0,58 0,67 0,11 -5,43 5,61668E-08 2,20436E-07 7,11 2,83 -0,58 0,67 0,65 -0,89 0,374650014 0,459889336 12,87 3,69 -0,58 0,67 0,53 -1,10 0,272471561 0,354880851 475,06 8,89 -0,58 0,67 0,13 -4,60 4,24885E-06 1,34716E-05 633,73 9,31 -0,58 0,67 0,13 -4,56 5,0466E-06 1,58123E-05 7,93 2,99 -0,58 0,67 0,58 -1,02 0,309781241 0,393257886 0,91 -0,14 -0,59 0,67 0,70 -0,84 0,402508518 0,487227851 111,01 6,79 -0,59 0,67 0,20 -2,97 0,002994223 0,006329078 272,05 8,09 -0,59 0,66 0,15 -3,97 7,05892E-05 0,000192168 95,78 6,58 -0,59 0,66 0,32 -1,86 0,06333518 0,101496726 1390,62 10,44 -0,59 0,66 0,10 -6,12 9,60014E-10 4,4361E-09 59,06 5,88 -0,59 0,66 0,25 -2,36 0,018337991 0,033236045 2889,57 11,50 -0,59 0,66 0,12 -4,80 1,56553E-06 5,26532E-06 14,19 3,83 -0,59 0,66 0,46 -1,31 0,191557072 0,2641241 43,55 5,44 -0,59 0,66 0,31 -1,94 0,052097939 0,085605581 176,47 7,46 -0,60 0,66 0,17 -3,46 0,000544535 0,001310535 76,67 6,26 -0,60 0,66 0,23 -2,54 0,01111003 0,021191206 1707,76 10,74 -0,60 0,66 0,12 -5,02 5,04584E-07 1,78996E-06 302,45 8,24 -0,60 0,66 0,15 -4,06 4,91761E-05 0,000136532 1380,16 10,43 -0,60 0,66 0,11 -5,62 1,95115E-08 8,05001E-08 164,66 7,36 -0,60 0,66 0,18 -3,29 0,001016673 0,002332728 410,49 8,68 -0,60 0,66 0,13 -4,69 2,66654E-06 8,67197E-06 177,83 7,47 -0,60 0,66 0,19 -3,23 0,00123276 0,002782873 46,83 5,55 -0,60 0,66 0,32 -1,90 0,05776973 0,093651113 20,57 4,36 -0,60 0,66 0,42 -1,42 0,156727841 0,222330952 6,77 -0,60 0,66 0,20 -2,99 0,002776839 0,005907174 108,86 57,93 5,86 -0,60 0,66 0,28 -2,17 0,029934584 0,05232644 108,97 6,77 -0,60 0,66 0,21 -2,82 0,004758911 0,009637521 14,30 3,84 -0,60 0,66 0,53 -1,14 0,254262861 0,335273658 509,20 8,99 -0,60 0,66 0,12 -5,09 3,5554E-07 1,27486E-06 8,82 -0,61 0,66 0,13 -4,77 1,79857E-06 6,01106E-06 452,51 180,76 7,50 -0,61 0,66 0,18 -3,42 0,000624979 0,001491976 240,76 7,91 -0,61 0,66 0,16 -3,89 9,86024E-05 0,000265437 9,95 3,32 -0,61 0,66 0,57 -1,07 0,28425408 0,366632569 161,98 7,34 -0,61 0,66 0,20 -3,00 0,002692116 0,005736128 8,06 -0,61 0,66 0,14 -4,35 1,36762E-05 4,06462E-05 266,26 15,10 3,92 -0,61 0,66 0,50 -1,23 0,21879388 0,295694475 15,97 4,00 -0,61 0,65 0,45 -1,36 0,173591478 0,2419898 2066,44 11,01 -0,61 0,65 0,11 -5,33 9,66651E-08 3,70619E-07 437,14 8,77 -0,61 0,65 0,13 -4,80 1,59356E-06 5,35282E-06 4,96 -0,61 0,65 0,46 -1,34 0,178716797 0,248093276 31,19 5,96 2,58 -0,62 0,65 0,64 -0,96 0,337035743 0,421215413 40,30 5,33 -0,62 0,65 0,36 -1,71 0,087900453 0,134147905 336,73 8,40 -0,62 0,65 0,13 -4,86 1,186E-06 4,07132E-06 40,34 5,33 -0,62 0,65 0,31 -1,97 0,049100397 0,081232724 4,34 -0,62 0,65 0,44 -1,43 0,153138135 0,217936811 20,27 -0,62 0,65 0,20 -3,16 0,001593343 0,003542688 112,92 6,82 55,51 5,79 -0,62 0,65 0,32 -1,97 0,04871872 0,08070177 64,64 6,01 -0,62 0,65 0,26 -2,38 0,017516513 0,031943291 50,83 5,67 -0,63 0,65 0,28 -2,23 0,025901372 0,045757943 1119,66 10,13 -0,63 0,65 0,11 -5,59 2,30702E-08 9,44595E-08 8,73 -0,64 0,64 0,20 -3,13 0,00173062 0,003822325 424,28 627,18 9,29 -0,64 0,64 0,11 -5,90 3,70382E-09 1,62931E-08 1246,07 10,28 -0,64 0,64 0,12 -5,49 3,967E-08 1,58263E-07 0,001457181 128,39 7,00 -0,64 0,64 0,19 -3,43 0,000609307 21,56 4,43 -0,64 0,64 0,39 -1,64 0,101862724 0,153777987 3,02 -0,64 0,64 0,57 -1,12 0,262855446 0,344212381 8,11 51,47 5,69 -0,64 0,64 0,30 -2,17 0,030313513 0,05295398 74,03 6,21 -0,64 0,64 0,25 -2,60 0,009312307 0,017968626 733,55 9,52 -0,64 0,64 0,15 -4,20 2,62688E-05 7,60956E-05 844,86 9,72 -0,65 0,64 0,12 -5,29 1,20242E-07 4,53167E-07 8,06 -0,65 0,64 0,16 -4,07 4,66816E-05 0,000130287 267,29 66,00 6,04 -0,65 0,64 0,25 -2,56 0,010437084 0,020008177 26,60 4,73 -0,65 0,64 0,38 -1,73 0,084116085 0,129188693 1655,49 10,69 -0,65 0,64 0,15 -4,23 2,28682E-05 6,68437E-05 271,29 8,08 -0,65 0,64 0,14 -4,52 6,09162E-06 1,89303E-05 9,74 -0,65 0,64 0,13 -4,83 1,34919E-06 4,58413E-06 852,51 305,61 8,26 -0,65 0,64 0,14 -4,71 2,49223E-06 8,14433E-06 15,96 4,00 -0,66 0,63 0,46 -1,42 0,155365764 0,220752318 588,19 9,20 -0,66 0,63 0,13 -5,22 1,81934E-07 6,71386E-07 975,72 9,93 -0,66 0,63 0,11 -6,01 1,82704E-09 8,22789E-09 9,07 -0,66 0,63 0,14 -4,82 1,40303E-06 4,74886E-06 539,18 276,57 8,11 -0,66 0,63 0,22 -3,02 0,002552931 0,005461464 54,38 5,77 -0,66 0,63 0,38 -1,74 0,082687974 0,127329686 49,56 5,63 -0,66 0,63 0,27 -2,43 0,015022052 0,02785317 219,96 7,78 -0,66 0,63 0,18 -3,62 0,000296721 0,000745872 6,10 -0,66 0,63 0,24 -2,76 0,005838841 0,011682079 68,41 4828,07 12,24 -0,67 0,63 0,14 -4,85 1,22947E-06 4,20966E-06 4,58779E-07 709,46 9,47 -0,67 0,63 0,13 -5,29 1,22076E-07 68,08 6,09 -0,67 0,63 0,25 -2,66 0,007748434 0,015193794 95,33 6,57 -0,67 0,63 0,21 -3,25 0,001154366 0,002619258 4,71 -0,67 0,63 0,36 -1,87 0,06085042 0,097886589 26,13 16,58 4,05 -0,67 0,63 0,49 -1,38 0,166897777 0,234752458 0,097847021 30,60 4,94 -0,67 0,63 0,36 -1,88 0,06076311 72,20 6,17 -0,68 0,63 0,26 -2,55 0,010618922 0,020327433 199,65 7,64 -0,68 0,63 0,17 -4,07 4,66591E-05 0,000130287 1,65 -0,68 0,63 0,70 -0,97 0,334412424 0,418527467 3,14 417,86 8,71 -0,68 0,62 0,12 -5,49 3,91701E-08 1,56504E-07 2,08605E-06 373,03 8,54 -0,69 0,62 0,14 -4,99 5,91192E-07 176,12 7,46 -0,69 0,62 0,18 -3,89 9,95275E-05 0,000267656 710,23 9,47 -0,69 0,62 0,11 -6,12 9,07361E-10 4,2001E-09 7,26 -0,69 0,62 0,17 -3,99 6,49879E-05 0,000177282 153,10 659,00 9,36 -0,69 0,62 0,12 -5,51 3,51292E-08 1,41636E-07 18,11 4,18 -0,69 0,62 0,44 -1,55 0,120177339 0,177099938 419,53 8,71 -0,69 0,62 0,15 -4,65 3,38381E-06 1,08453E-05 379,29 8,57 -0,69 0,62 0,16 -4,37 1,25004E-05 3,7487E-05 10,24 -0,70 0,62 0,13 -5,33 1,00768E-07 3,85237E-07 1209,84 6903,29 12,75 -0,70 0,62 0,14 -5,15 2,56667E-07 9,32918E-07 0,042330311 36,71 5,20 -0,70 0,62 0,31 -2,26 0,02381777 331,05 8,37 -0,70 0,61 0,13 -5,27 1,38402E-07 5,17937E-07 225,23 7,82 -0,70 0,61 0,17 -4,23 2,30167E-05 6,72036E-05 0,230337502 12,33 3,62 -0,70 0,61 0,50 -1,39 0,163152119 897,48 9,81 -0,70 0,61 0,12 -5,93 3,06325E-09 1,36333E-08 9,36 -0,71 0,61 0,11 -6,46 1,04096E-10 5,18919E-10 659,22 112,99 6,82 -0,71 0,61 0,20 -3,54 0,00040633 0,001001502 17,94 4,17 -0,71 0,61 0,47 -1,51 0,130701846 0,189975276 10,73 -0,71 0,61 1697,75 0,10 -7,26 3,83582E-13 2,32689E-12 551,76 9,11 -0,72 0,61 0,16 -4,48 7,38909E-06 2,28289E-05 293,47 8,20 -0,72 0,61 0,15 -4,89 1,00926E-06 3,49166E-06 1375,42 10,43 -0,72 0,61 0,16 -4,47 7,92639E-06 2,44037E-05 172,61 7,43 -0,72 0,61 0,17 -4,15 3,25946E-05 9,31224E-05 207,11 7,69 -0,72 0,61 0,17 -4,36 1,30528E-05 3,90117E-05 90,25 6,50 -0,72 0,61 0,22 -3,31 0,00094171 0,00217387 2294,73 11,16 -0,72 0,61 0,09 -8,01 1,11399E-15 8,15389E-15 21,58 4,43 -0,73 0,60 0,42 -1,71 0,086828503 0,132740697 3270,27 11,68 -0,73 0,60 0,09 -7,89 2,93883E-15 2,08226E-14 1121,74 10,13 -0,73 0,60 0,12 -6,06 1,38942E-09 6,36498E-09 56,42 5,82 -0,73 0,60 0,29 -2,55 0,010725443 0,020487061 16,01 4,00 -0,73 0,60 0,53 -1,38 0,169118557 0,236997893 11,07 3,47 -0,73 0,60 0,52 -1,41 0,160015473 0,226462335 613,83 9,26 -0,73 0,60 0,11 -6,61 3,95435E-11 2,05209E-10 44,62 5,48 -0,73 0,60 0,29 -2,51 0,012015006 0,022754007 30,96 4,95 -0,73 0,60 0,37 -2,01 0,04472848 0,074744385 58,87 5,88 -0,74 0,60 0,26 -2,88 0,003959856 0,008175086 156,47 7,29 -0,74 0,60 0,20 -3,68 0,000230955 0,000590614 70,25 6,13 -0,74 0,60 0,24 -3,02 0,002510437 0,005374884 4,07 -0,74 0,60 0,45 -1,66 0,097273823 0,147520861 16,76 38,33 5,26 -0,74 0,60 0,35 -2,13 0,032940448 0,057204426 31,97 5,00 -0,74 0,60 0,33 -2,23 0,026073892 0,046032114 361,19 8,50 -0,74 0,60 0,14 -5,42 5,9825E-08 2,33757E-07 43,03 5,43 -0,74 0,60 0,31 -2,40 0,016334104 0,029951493 9,08 -0,74 0,60 0,13 -5,89 3,76412E-09 1,6531E-08 541,32 138,62 7,12 -0,74 0,60 0,18 -4,05 5,21692E-05 0,000144239 81,52 6,35 -0,74 0,60 0,23 -3,22 0,001285965 0,002898056 414,13 8,69 -0,75 0,60 0,14 -5,35 8,77138E-08 3,36786E-07 361,72 8,50 -0,75 0,60 0,14 -5,45 4,90058E-08 1,93763E-07 3,32 -0,75 0,60 0,55 -1,37 0,170805996 0,2388587 9,98 116,10 6,86 -0,75 0,60 0,20 -3,67 0,000240979 0,000615656 29,42 4,88 -0,75 0,59 0,40 -1,86 0,062974535 0,101040664 837,30 9,71 -0,75 0,59 0,11 -7,07 1,59331E-12 9,12378E-12 57,75 5,85 -0,75 0,59 0,29 -2,64 0,00836814 0,016229306 68,10 6,09 -0,75 0,59 0,24 -3,15 0,001654077 0,003662402 41,80 5,39 -0,76 0,59 0,32 -2,34 0,019172275 0,03467715 20,84 4,38 -0,76 0,59 0,43 -1,74 0,081748391 0,126208876 280,25 8,13 -0,76 0,59 0,17 -4,57 4,83229E-06 1,51587E-05 850,01 9,73 -0,76 0,59 0,11 -6,61 3,90268E-11 2,02924E-10 11,39 3,51 -0,76 0,59 0,50 -1,52 0,129625499 0,188720521 403,06 8,65 -0,76 0,59 0,12 -6,15 7,63963E-10 3,56114E-09 5,27 2,40 -0,77 0,59 0,68 -1,12 0,263450423 0,344821563 13,41 3,75 -0,77 0,59 0,55 -1,39 0,16591556 0,233866123
Locus USA300HOU 0597 USA300HOU 0910 USA300HOU_0041 USA300HOU 0356 USA300HOU_0353 USA300HOU_1081 USA300HOU 1586 USA300HOU 1481 USA300HOU 0725 USA300HOU_0211 USA300HOU 1473 USA300HOU_1106 USA300HOU_1958 USA300HOU 1799 USA300HOU_1121 USA300HOU_1769 USA300HOU 1403 USA300HOU_2083 USA300HOU_2482 USA300HOU 0771 USA300HOU_2475 USA300HOU_0069 USA300HOU 0005 USA300HOU 1963 USA300HOU_0980 USA300HOU 0251 USA300HOU_1074 USA300HOU_0310 USA300HOU 0206 USA300HOU_0661 USA300HOU_2622 USA300HOU 0077 USA300HOU_1482 USA300HOU_1842 USA300HOU 0098 USA300HOU_0232 USA300HOU_2296 USA300HOU 2710 USA300HOU 2636 USA300HOU_0086 USA300HOU 1157 USA300HOU_0666 USA300HOU_2452 USA300HOU 0453 USA300HOU 1855 USA300HOU_1822 USA300HOU 1070 USA300HOU_2543 USA300HOU_0233 USA300HOU 1402 USA300HOU_1994 USA300HOU_1542 USA300HOU 2079 USA300HOU_2524 USA300HOU_1988 USA300HOU 1722 USA300HOU_0676 USA300HOU_2382 USA300HOU 2289 USA300HOU 2132 USA300HOU_2488 USA300HOU 0443 USA300HOU_0911 USA300HOU_0276 USA300HOU 0208 USA300HOU_2281 USA300HOU_1778 USA300HOU 2284 USA300HOU_1724 USA300HOU_0616 USA300HOU 2363 USA300HOU_0504 USA300HOU_0653 USA300HOU 0460 USA300HOU_1472 USA300HOU_0185 USA300HOU 1993 USA300HOU_2616 USA300HOU_2657 USA300HOU 0934 USA300HOU 1468 USA300HOU_1690 USA300HOU 0081 USA300HOU 1478 USA300HOU_1465 USA300HOU 1628 USA300HOU_1550 USA300HOU_2479 USA300HOU 2597 USA300HOU_0652 USA300HOU_2358 USA300HOU 1653 USA300HOU_1718 USA300HOU_2016 USA300HOU 0241 USA300HOU 1244 USA300HOU_1523 USA300HOU 1304 USA300HOU_0205 USA300HOU_2369 USA300HOU 1433 USA300HOU_2140 USA300HOU_0334 USA300HOU 0204 USA300HOU 1484 USA300HOU_2323 USA300HOU_2678 USA300HOU 0202 USA300HOU_2310 USA300HOU_1424 USA300HOU 0024 USA300HOU_0303 USA300HOU_1931 USA300HOU 1554 USA300HOU_1620 USA300HOU 0433 USA300HOU 1407 USA300HOU_1342 USA300HOU 1490 USA300HOU_0913 USA300HOU_1505 USA300HOU 2692 USA300HOU_0444 USA300HOU 2620 USA300HOU 0463 USA300HOU_0880 USA300HOU 1379 USA300HOU_0386 USA300HOU_1467 USA300HOU 2677 USA300HOU_0457 USA300HOU_1500 USA300HOU 2145 USA300HOU_0009 USA300HOU_0277 USA300HOU 0231 USA300HOU 0335 USA300HOU_2690 USA300HOU 2372 USA300HOU_2131 USA300HOU_1979
Gene symbol USA300HOU 0597 mnhC USA300HOU_0041 mepB USA300HOU_0353 USA300HOU_1081 lepA USA300HOU 1481 USA300HOU 0725 USA300HOU_0211 USA300HOU 1473 argF USA300HOU_1958 hsdS2 pbp1 spdA aroB cls2 pgcA USA300HOU 0771 USA300HOU_2475 arcD gyrB USA300HOU 1963 htrA2 ldh1 pheT USA300HOU_0310 USA300HOU 0206 tagD USA300HOU_2622 USA300HOU 0077 USA300HOU_1482 airR USA300HOU 0098 hptA spdB USA300HOU 2710 argR USA300HOU_0086 pknB USA300HOU_0666 USA300HOU_2452 USA300HOU 0453 tnp3 USA300HOU_1822 USA300HOU 1070 USA300HOU_2543 pflB aroA USA300HOU_1994 comGE USA300HOU 2079 USA300HOU_2524 dnaD2 acsA USA300HOU_0676 nasD USA300HOU 2289 manA sarU lpl5 mnhB USA300HOU_0276 hsdR USA300HOU_2281 pckA USA300HOU 2284 acuC USA300HOU_0616 USA300HOU 2363 hpt mntA USA300HOU 0460 USA300HOU_1472 ssuB USA300HOU 1993 USA300HOU_2616 USA300HOU_2657 USA300HOU 0934 USA300HOU 1468 USA300HOU_1690 USA300HOU 0081 USA300HOU 1478 USA300HOU_1465 aspS USA300HOU_1550 USA300HOU_2479 USA300HOU 2597 mntB USA300HOU_2358 comC sgtA TcmP fadB USA300HOU 1244 ispA trpD murQ narK USA300HOU 1433 USA300HOU_2140 nanT USA300HOU 0204 USA300HOU 1484 USA300HOU_2323 USA300HOU_2678 USA300HOU 0202 hutI USA300HOU_1424 orfX esxC USA300HOU_1931 pbp3 USA300HOU_1620 hsdM1 hepT brnQ3 int1 kapB rnz pcp lpl6 USA300HOU 2620 USA300HOU 0463 USA300HOU_0880 USA300HOU 1379 USA300HOU_0386 USA300HOU_1467 hisB mpsA nudF glmS serS bglA hptS nanA drp35 USA300HOU 2372 USA300HOU_2131 USA300HOU_1979
Regulon -
Function hypothetical protein monovalent cation/H+ antiporter subunit C hypothetical protein hypothetical protein BglG family transcriptional antiterminator hypothetical protein GTP-binding protein LepA hypothetical protein hemolysin hypothetical protein phage encoded DNA polymerase I ornithine carbamoyltransferase hypothetical protein type I restriction-modification enzyme, S subunit, EcoA family protein penicillin-binding protein 1 hypothetical protein 3-dehydroquinate synthase cardiolipin synthetase phosphoglucomutase/phosphomannomutase hypothetical protein hypothetical protein arginine/oirnithine antiporter DNA gyrase, B subunit hypothetical protein serine protease L-lactate dehydrogenase phenylalanyl-tRNA synthetase subunit beta hypothetical protein PTS system, IIBC components glycerol-3-phosphate cytidylyltransferase ABC transporter ATP-binding protein hypothetical protein phiSLT ORF71-like protein LuxR family DNA-binding response regulator hypothetical protein iron compound ABC transporter iron compound-binding protein hypothetical protein hypothetical protein ArgR family transcriptional regulator hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein IS1181 transposase hypothetical protein hypothetical protein hypothetical protein formate acetyltransferase 3-phosphoshikimate 1-carboxyvinyltransferase hypothetical protein hypothetical protein cell cycle protein FtsW hypothetical protein phage regulatory protein acetyl-CoA synthetase lipase/esterase nitrite reductase [NAD(P)H], large subunit hypothetical protein mannose-6-phosphate isomerase, class I accessory regulator U hypothetical protein monovalent cation/H+ antiporter subunit B PTS system, IIA component type I restriction-modification enzyme, R subunit hypothetical protein phosphoenolpyruvate carboxykinase hypothetical protein acetoin utilization protein AcuC iron compound ABC transporter permease hypothetical protein hypoxanthine phosphoribosyltransferase ABC transporter ATP-binding protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein LysR family transcriptional regulator hypothetical protein hypothetical protein ABC transporter ATP-binding protein hypothetical bacteriophage protein hypothetical protein aspartyl-tRNA synthetase hypothetical protein hypothetical protein hypothetical protein ABC transporter permease hypothetical protein type III leader peptidase transglycosylase domain-containing protein tetracenomycin polyketide synthesis O-methyltransferase TcmP 3-hydroxyacyl-CoA dehydrogenase hypothetical protein geranyltranstransferase anthranilate phosphoribosyltransferase N-acetylmuramic acid-6-phosphate etherase nitrite extrusion protein prophage L54a, holin SAP domain-containing protein sodium:solute symporter family protein hypothetical protein hypothetical bacteriophage protein ABC transporter ATP-binding protein histidinol-phosphate aminotransferase hypothetical protein imidazolonepropionase hypothetical protein rRNA large subunit methyltransferase hypothetical protein hypothetical protein penicillin-binding protein 3 TPR domain-containing protein type I restriction-modification system, M subunit polyprenyl synthetase branched-chain amino acid transport system II carrier protein prophage L54a, integrase hypothetical protein AtsA/ElaC family protein pyrrolidone-carboxylate peptidase staphyloccoccus tandem lipoprotein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical bacteriophage protein imidazoleglycerol-phosphate dehydratase NADH dehydrogenase subunit 5 MutT/nudix family protein glucosamine--fructose-6-phosphate aminotransferase seryl-tRNA synthetase 6-phospho-beta-glucosidase sensor histidine kinase N-acetylneuraminate lyase drP35 protein MerR family transcriptional regulator hypothetical protein hypothetical bacteriophage protein
USA300HOU_2162 USA300HOU_1987 USA300HOU 2203 USA300HOU_1483 USA300HOU_0040 USA300HOU 2373 USA300HOU_1051 USA300HOU_0471 USA300HOU 1549 USA300HOU 1469 USA300HOU_1756 USA300HOU 1885 USA300HOU_1150 USA300HOU_0883 USA300HOU 0278 USA300HOU_1302 USA300HOU_0651 USA300HOU 0772 USA300HOU 2043 USA300HOU_1470 USA300HOU 2703 USA300HOU_1982 USA300HOU_2455 USA300HOU 0082 USA300HOU 1629 USA300HOU_0106 USA300HOU 0390 USA300HOU_1311
USA300HOU_2162 USA300HOU_1987 USA300HOU 2203 USA300HOU_1483 ccrA nreC FtsW gltC glk USA300HOU 1469 putA USA300HOU 1885 priA USA300HOU_0883 USA300HOU 0278 trpE mntC USA300HOU 0772 USA300HOU 2043 USA300HOU_1470 vraD USA300HOU_1982 cntD USA300HOU 0082 hisS USA300HOU_0106 USA300HOU 0390 USA300HOU_1311
-
UTP-glucose-1-phosphate uridylyltransferase hypothetical protein hypothetical protein phiSLT ORF78-like protein cassette chromosome recombinase A1 transcriptional regulatory protein cell cycle protein FtsW transcriptional regulatory protein GltC glucokinase hypothetical bacteriophage protein proline dehydrogenase hypothetical protein primosomal protein N` hypothetical protein hypothetical protein anthranilate synthase component I ABC transporter substrate-binding protein hypothetical protein hypothetical protein hypothetical protein ABC transporter ATP-binding protein phi PVL/orf 52-like protein peptide ABC transporter ATP-binding protein ABC transporter ATP-binding protein histidyl-tRNA synthetase hypothetical protein hypothetical protein hydrolase-like protein
Locus
Gene symbol
Regulon
Function
Base mean A-value M-value Fold change Standard error Wald statistic P-value Adjusted P-value 101,57 6,67 -0,77 0,59 0,22 -3,50 0,000462472 0,001126296 225,07 7,81 -0,77 0,59 0,16 -4,93 8,41574E-07 2,93446E-06 261,95 8,03 -0,77 0,59 0,15 -5,26 1,4708E-07 5,49635E-07 112,68 6,82 -0,77 0,59 0,23 -3,39 0,000710015 0,001676898 81,81 6,35 -0,77 0,59 0,24 -3,18 0,001490466 0,003322288 4,49 2,17 -0,77 0,59 0,66 -1,17 0,241900988 0,32233246 1475,21 10,53 -0,77 0,59 0,10 -7,69 1,47734E-14 9,86491E-14 8,08 3,01 -0,77 0,59 0,57 -1,36 0,173952741 0,242366247 2850,53 11,48 -0,77 0,59 0,12 -6,35 2,08877E-10 1,0146E-09 732,85 9,52 -0,77 0,59 0,11 -6,92 4,41925E-12 2,47721E-11 31,70 4,99 -0,78 0,58 0,43 -1,81 0,070399762 0,111340576 80,76 6,34 -0,78 0,58 0,22 -3,52 0,000433111 0,001061602 38,85 5,28 -0,78 0,58 0,42 -1,85 0,064176953 0,102783703 181,88 7,51 -0,78 0,58 0,17 -4,54 5,55668E-06 1,73287E-05 2433,65 11,25 -0,78 0,58 0,11 -7,27 3,69763E-13 2,25853E-12 162,91 7,35 -0,78 0,58 0,21 -3,69 0,000228024 0,00058368 9,07 -0,79 0,58 0,11 -6,93 4,15925E-12 2,34631E-11 538,72 1273,79 10,31 -0,79 0,58 0,11 -7,42 1,17163E-13 7,39434E-13 169,39 7,40 -0,79 0,58 0,17 -4,55 5,38578E-06 1,68353E-05 161,05 7,33 -0,79 0,58 0,17 -4,54 5,72928E-06 1,78252E-05 59,33 5,89 -0,79 0,58 0,27 -2,93 0,003392842 0,007087092 7,55 -0,79 0,58 0,19 -4,20 2,63909E-05 7,6301E-05 187,82 2325,84 11,18 -0,80 0,58 0,10 -7,82 5,44532E-15 3,79743E-14 11,90 3,57 -0,80 0,58 0,52 -1,53 0,125698404 0,183783609 685,87 9,42 -0,80 0,57 0,12 -6,60 4,20979E-11 2,17615E-10 489,15 8,93 -0,80 0,57 0,15 -5,48 4,35051E-08 1,72527E-07 9,31 -0,80 0,57 0,12 -6,88 6,0574E-12 3,36002E-11 632,63 89,72 6,49 -0,80 0,57 0,23 -3,49 0,000484802 0,001175292 105,18 6,72 -0,81 0,57 0,26 -3,15 0,001625853 0,003608931 285,33 8,16 -0,81 0,57 0,14 -5,71 1,12433E-08 4,71191E-08 248,47 7,96 -0,81 0,57 0,15 -5,31 1,09607E-07 4,16633E-07 6,45 -0,81 0,57 0,22 -3,66 0,000254214 0,000645125 87,16 8,82 3,14 -0,81 0,57 0,54 -1,50 0,134430797 0,19449144 345,36 8,43 -0,82 0,57 0,14 -6,04 1,56081E-09 7,0769E-09 155,01 7,28 -0,82 0,57 0,17 -4,70 2,65396E-06 8,64165E-06 115,21 6,85 -0,82 0,57 0,20 -4,15 3,27379E-05 9,34315E-05 7,38 -0,82 0,57 0,17 -4,75 2,01463E-06 6,65781E-06 166,20 68,52 6,10 -0,82 0,57 0,30 -2,77 0,005578871 0,011212602 87,86 6,46 -0,82 0,57 0,23 -3,55 0,000392258 0,000967715 66,23 6,05 -0,83 0,56 0,26 -3,21 0,001325152 0,002983837 790,26 9,63 -0,83 0,56 0,11 -7,59 3,19914E-14 2,06815E-13 4,94 -0,83 0,56 0,34 -2,46 0,013949133 0,025972562 30,66 222,44 7,80 -0,83 0,56 0,16 -5,29 1,21378E-07 4,568E-07 5,30 2,41 -0,83 0,56 0,68 -1,22 0,223767626 0,301289573 118,78 6,89 -0,83 0,56 0,24 -3,39 0,000697217 0,001649605 250,85 7,97 -0,83 0,56 0,15 -5,48 4,25443E-08 1,68969E-07 2,53 -0,83 0,56 0,64 -1,31 0,191887149 0,264441989 5,78 15,57 3,96 -0,83 0,56 0,51 -1,63 0,103633243 0,155654905 161,68 7,34 -0,84 0,56 0,17 -4,83 1,38523E-06 4,70058E-06 575,63 9,17 -0,84 0,56 0,12 -6,80 1,03844E-11 5,6194E-11 33,77 5,08 -0,84 0,56 0,35 -2,43 0,015217731 0,028176662 4,45 -0,84 0,56 0,40 -2,12 0,033949569 0,058688358 21,87 483,52 8,92 -0,84 0,56 0,17 -4,87 1,09342E-06 3,76813E-06 1164,75 10,19 -0,84 0,56 0,12 -7,19 6,36505E-13 3,73332E-12 39,27 5,30 -0,85 0,56 0,35 -2,44 0,014662595 0,027224679 164,26 7,36 -0,85 0,56 0,20 -4,26 2,00018E-05 5,87235E-05 9,02 -0,85 0,56 0,12 -6,99 2,7262E-12 1,54446E-11 518,39 151,39 7,24 -0,85 0,56 0,21 -4,07 4,6769E-05 0,000130394 216,67 7,76 -0,85 0,55 0,17 -5,00 5,83304E-07 2,06095E-06 832,24 9,70 -0,86 0,55 0,11 -7,61 2,72336E-14 1,77788E-13 20,24 4,34 -0,86 0,55 0,43 -2,01 0,044910753 0,074927254 5,59 -0,86 0,55 0,33 -2,57 0,010215538 0,019611767 48,03 302,73 8,24 -0,86 0,55 0,14 -6,30 3,02156E-10 1,45704E-09 32,75 5,03 -0,86 0,55 0,36 -2,39 0,016932902 0,030985345 2063,68 11,01 -0,86 0,55 0,10 -8,33 8,17042E-17 6,29241E-16 3581,60 11,81 -0,86 0,55 0,28 -3,04 0,002366596 0,005087415 246,66 7,95 -0,86 0,55 0,18 -4,75 2,06293E-06 6,80895E-06 -8,26 -0,87 0,55 0,10 1,42901E-16 1,08793E-15 2003,15 10,97 645,54 9,33 -0,87 0,55 0,12 -7,30 2,81224E-13 1,73367E-12 -0,87 0,55 0,13 377,22 8,56 -6,81 1,00915E-11 5,48328E-11 103,89 6,70 -0,87 0,55 0,20 -4,31 1,63965E-05 4,84599E-05 468,57 8,87 -0,87 0,55 0,12 -7,20 5,91804E-13 3,48653E-12 6,61 -0,87 0,55 0,21 -4,13 3,56162E-05 0,000101103 97,60 306,26 8,26 -0,87 0,55 0,14 -6,07 1,24601E-09 5,7377E-09 0,218579792 7,33 2,87 -0,87 0,55 0,61 -1,43 0,153672206 73,95 6,21 -0,88 0,54 0,24 -3,58 0,000337542 0,000841322 33,29 5,06 -0,88 0,54 0,35 -2,51 0,012134517 0,022933468 7,43 -0,88 0,54 0,17 -5,25 1,53048E-07 5,70336E-07 172,83 50,17 5,65 -0,88 0,54 0,28 -3,20 0,001392573 0,003122419 0,004438379 48,03 5,59 -0,88 0,54 0,29 -3,08 0,002036275 6,53 2,71 -0,88 0,54 0,63 -1,40 0,162282256 0,229231236 564,58 9,14 -0,88 0,54 0,12 -7,21 5,70321E-13 3,38246E-12 5,77 -0,89 0,54 0,29 -3,06 0,002183517 0,004724434 54,44 11,36 3,51 -0,89 0,54 0,55 -1,63 0,103176726 0,15514463 0,192030521 12,20 3,61 -0,89 0,54 0,59 -1,50 0,132477209 401,62 8,65 -0,90 0,54 0,12 -7,20 5,90156E-13 3,48454E-12 217,34 7,76 -0,90 0,54 0,16 -5,50 3,86785E-08 1,55006E-07 0,287213219 3,35 1,74 -0,90 0,54 0,72 -1,25 0,21100497 1553,12 10,60 -0,90 0,54 0,11 -7,97 1,55491E-15 1,12267E-14 9,35709E-05 89,96 6,49 -0,90 0,54 0,22 -4,15 3,2822E-05 11,93 3,58 -0,90 0,54 0,50 -1,79 0,074025321 0,116038513 117,24 6,87 -0,90 0,53 0,21 -4,39 1,13658E-05 3,42779E-05 8,22 -0,91 0,53 0,14 -6,56 5,28013E-11 2,69794E-10 298,72 46,38 5,54 -0,91 0,53 0,29 -3,10 0,0019241 0,004207682 0,008305794 44,54 5,48 -0,91 0,53 0,32 -2,88 0,00402942 52,46 5,71 -0,91 0,53 0,32 -2,86 0,004216996 0,008645493 437,57 8,77 -0,91 0,53 0,12 -7,32 2,50704E-13 1,55635E-12 7,82 -0,91 0,53 0,16 -5,51 3,49876E-08 1,4128E-07 226,65 51,76 5,69 -0,91 0,53 0,32 -2,83 0,004614788 0,009388585 0,000179372 83,83 6,39 -0,91 0,53 0,23 -3,99 6,58215E-05 10,26 3,36 -0,91 0,53 0,59 -1,55 0,120775077 0,177685149 387,80 8,60 -0,91 0,53 0,15 -6,05 1,42965E-09 6,52677E-09 5,60 -0,91 0,53 0,30 -3,05 0,002311927 0,004977949 48,38 58,21 5,86 -0,92 0,53 0,30 -3,11 0,001879772 0,00412092 9,71 3,28 -0,92 0,53 0,56 -1,64 0,101095629 0,152793565 250,36 7,97 -0,92 0,53 0,16 -5,89 3,8673E-09 1,69004E-08 13,35 -0,92 0,53 0,10 -9,39 5,97011E-21 5,46986E-20 10462,59 7,91 2,98 -0,92 0,53 0,62 -1,48 0,140044613 0,201352022 4,24842E-08 189,58 7,57 -0,92 0,53 0,16 -5,73 1,00574E-08 67,33 6,07 -0,92 0,53 0,29 -3,18 0,001484522 0,003311819 722,28 9,50 -0,93 0,53 0,11 -8,31 9,70692E-17 7,43265E-16 0,054527574 19,63 4,30 -0,93 0,53 0,43 -2,15 0,031255361 322,08 8,33 -0,93 0,52 0,15 -6,35 2,183E-10 1,05651E-09 10,63 -0,94 0,52 0,10 -9,48 2,49159E-21 2,33104E-20 1588,93 7,65 -0,94 0,52 0,17 -5,40 6,53002E-08 2,54403E-07 200,19 491,23 8,94 -0,95 0,52 0,17 -5,61 2,04086E-08 8,39407E-08 444,56 8,80 -0,95 0,52 0,12 -7,71 1,24655E-14 8,44923E-14 303,04 8,24 -0,95 0,52 0,13 -7,08 1,42743E-12 8,20928E-12 1042,16 10,03 -0,95 0,52 0,13 -7,24 4,4426E-13 2,68272E-12 6,15 -0,95 0,52 0,27 -3,47 0,000528574 0,001276746 71,21 543,12 9,09 -0,95 0,52 0,15 -6,29 3,26766E-10 1,56718E-09 919,29 9,84 -0,95 0,52 0,12 -8,07 7,24814E-16 5,34953E-15 24,67 4,62 -0,96 0,52 0,47 -2,05 0,040354889 0,068207977 22,16 4,47 -0,96 0,52 0,43 -2,23 0,025832232 0,045666161 33,92 5,08 -0,96 0,51 0,44 -2,18 0,029048914 0,050845168 9,92 3,31 -0,96 0,51 0,56 -1,71 0,087831818 0,134120196 22,05 4,46 -0,96 0,51 0,41 -2,36 0,018460588 0,033435435 665,48 9,38 -0,96 0,51 0,17 -5,71 1,10105E-08 4,62162E-08 10,09 3,34 -0,96 0,51 0,59 -1,63 0,103727209 0,155708019 4375,44 12,10 -0,96 0,51 0,11 -8,59 8,50476E-18 6,78593E-17 1010,76 9,98 -0,97 0,51 0,13 -7,41 1,24464E-13 7,83651E-13 140,37 7,13 -0,97 0,51 0,19 -5,12 3,01382E-07 1,08801E-06 338,20 8,40 -0,97 0,51 0,13 -7,23 4,82398E-13 2,8933E-12 -7,70 1,40847E-14 9,47422E-14 6608,84 12,69 -0,97 0,51 0,13 63,91 6,00 -0,98 0,51 0,36 -2,75 0,006029287 0,012035924 179,89 7,49 -0,98 0,51 0,18 -5,55 2,91143E-08 1,18645E-07 36,45 5,19 -0,98 0,51 0,33 -2,96 0,003058882 0,00645548 84,88 6,41 -0,98 0,51 0,23 -4,24 2,20439E-05 6,45762E-05 -5,81 6,19191E-09 2,65782E-08 173,41 7,44 -0,98 0,51 0,17 -6,85 7,63283E-12 4,19017E-11 267,55 8,06 -0,98 0,51 0,14 19,52 4,29 -0,98 0,51 0,46 -2,12 0,034150699 0,058882807 2882,76 12,26 16,38 268,07 143,21 504,70 948,42 371,41 665,62 9,59 148,47 188,75 997,07 222,50 34,37 588,71 140,72 104,70 327,46 11,15 42,30 18,23 37,57 51,35 331,72 530,27 249,43 279,18 Base mean
11,49 3,62 4,03 8,07 7,16 8,98 9,89 8,54 9,38 3,26 7,21 7,56 9,96 7,80 5,10 9,20 7,14 6,71 8,36 3,48 5,40 4,19 5,23 5,68 8,37 9,05 7,96 8,13 A-value
-0,98 -0,99 -0,99 -0,99 -0,99 -1,00 -1,00 -1,00 -1,01 -1,01 -1,01 -1,01 -1,01 -1,02 -1,02 -1,02 -1,03 -1,03 -1,04 -1,04 -1,04 -1,06 -1,06 -1,06 -1,07 -1,07 -1,07 -1,07 M-value
0,51 0,51 0,50 0,50 0,50 0,50 0,50 0,50 0,50 0,50 0,50 0,50 0,50 0,49 0,49 0,49 0,49 0,49 0,49 0,49 0,48 0,48 0,48 0,48 0,48 0,48 0,48 0,48 Fold change
0,09 0,50 0,47 0,22 0,19 0,12 0,13 0,14 0,12 0,60 0,21 0,22 0,10 0,15 0,35 0,12 0,20 0,21 0,17 0,58 0,31 0,49 0,34 0,27 0,13 0,12 0,15 0,16 Standard error
-10,76 -1,98 -2,12 -4,57 -5,21 -8,18 -7,89 -7,00 -8,72 -1,67 -4,92 -4,59 -10,01 -6,80 -2,87 -8,26 -5,15 -4,81 -6,18 -1,79 -3,42 -2,16 -3,12 -3,88 -7,96 -8,65 -7,31 -6,78 Wald statistic
5,41774E-27 0,04741669 0,034079214 4,77407E-06 1,92409E-07 2,87544E-16 3,14094E-15 2,59446E-12 2,78799E-18 0,095566203 8,76952E-07 4,46695E-06 1,35094E-23 1,04145E-11 0,00411222 1,50794E-16 2,67065E-07 1,50396E-06 6,27608E-10 0,074207481 0,000635627 0,030575664 0,001821365 0,000103334 1,66767E-15 5,04307E-18 2,57983E-13 1,20263E-11 P-value
6,57303E-26 0,078643038 0,058797709 1,49938E-05 7,09057E-07 2,15213E-15 2,21954E-14 1,47297E-11 2,27929E-17 0,145262816 3,04583E-06 1,40958E-05 1,39667E-22 5,62424E-11 0,008463337 1,14474E-15 9,69389E-07 5,0711E-06 2,95142E-09 0,116186964 0,001516032 0,053376833 0,004002784 0,000277332 1,20081E-14 4,08519E-17 1,59781E-12 6,4684E-11 Adjusted P-value
USA300HOU_1805 USA300HOU 1333 USA300HOU 2611 USA300HOU_0985 USA300HOU 1584 USA300HOU_2313 USA300HOU_1406 USA300HOU 0352 USA300HOU_2141 USA300HOU_2417 USA300HOU 0245 USA300HOU_2301 USA300HOU_2428 USA300HOU 2304 USA300HOU_1495 USA300HOU_1352 USA300HOU 2163 USA300HOU 0590 USA300HOU_2438 USA300HOU 2379 USA300HOU_2022 USA300HOU_0186 USA300HOU 2431 USA300HOU_1171 USA300HOU_0552 USA300HOU 0640 USA300HOU_0594 USA300HOU_1510 USA300HOU 1652 USA300HOU_2514 USA300HOU_0187 USA300HOU 1981 USA300HOU 2005 USA300HOU_1708 USA300HOU 0097 USA300HOU_2196 USA300HOU_1674 USA300HOU 2021 USA300HOU_0385 USA300HOU_2084 USA300HOU 0355 USA300HOU_2626 USA300HOU_1111 USA300HOU 0595 USA300HOU_2015 USA300HOU_1781 USA300HOU 1006 USA300HOU 0758 USA300HOU_1704 USA300HOU 0119 USA300HOU_1619 USA300HOU_2160 USA300HOU 0300 USA300HOU_1249 USA300HOU_2161 USA300HOU 0615 USA300HOU_0596 USA300HOU_1334 USA300HOU 0046 USA300HOU_1211 USA300HOU_2530 USA300HOU 0250 USA300HOU_2399 USA300HOU_2529 USA300HOU 0490 USA300HOU_1052 USA300HOU 0393 USA300HOU_2451 USA300HOU 1585 USA300HOU_0326 USA300HOU_1212 USA300HOU 0491 USA300HOU_0327 USA300HOU_0434 USA300HOU 2006 USA300HOU 1289 USA300HOU_1299 USA300HOU 1922 USA300HOU 0545 USA300HOU_2487 USA300HOU 1303 USA300HOU_0242 USA300HOU_0493 USA300HOU 0458 USA300HOU_0298 USA300HOU_2400 USA300HOU 0146 USA300HOU_1973 USA300HOU_2370 USA300HOU 1301 USA300HOU_1172 USA300HOU_1509 USA300HOU 0331 USA300HOU 0641 USA300HOU_2007 USA300HOU 2468 USA300HOU_0492 USA300HOU_0332 USA300HOU 1847 USA300HOU_1926 USA300HOU_0546 USA300HOU 0486 USA300HOU_2311 USA300HOU_2448 USA300HOU 1281 USA300HOU_0118 USA300HOU_1780 USA300HOU 2528 USA300HOU 2009 USA300HOU_1892 USA300HOU 2008 USA300HOU_0299 USA300HOU_pUSA10 HOUMR0006 USA300HOU_pUSA10 HOUMR0005 USA300HOU_pUSA10 HOUMR0002 USA300HOU_pUSA10 HOUMR0001 USA300HOU_pUSA10 HOUMR0004 USA300HOU_pUSA10 HOUMR0003 USA300HOU_pUSA300 HOUMR0031 USA300HOU_pUSA300 HOUMR0032 USA300HOU_pUSA300 HOUMR0001 USA300HOU_pUSA300 HOUMR0016 USA300HOU_pUSA300 HOUMR0014 USA300HOU_pUSA300 HOUMR0003 USA300HOU_pUSA300 HOUMR0011 USA300HOU_pUSA300 HOUMR0018 USA300HOU_pUSA300 HOUMR0021 USA300HOU_pUSA300 HOUMR0029 USA300HOU_pUSA300 HOUMR0008
splB dapL USA300HOU 2611 USA300HOU_0985 hemN fosB ndk USA300HOU 0352 USA300HOU_2141 USA300HOU_2417 prsS USA300HOU_2301 USA300HOU_2428 USA300HOU 2304 rluB USA300HOU_1352 USA300HOU 2163 USA300HOU 0590 USA300HOU_2438 narG USA300HOU 2022 ssuA USA300HOU 2431 smc tadA USA300HOU 0640 USA300HOU_0594 malR radC USA300HOU_2514 ssuC USA300HOU 1981 USA300HOU 2005 USA300HOU_1708 USA300HOU 0097 USA300HOU 2196 gapB USA300HOU 2021 USA300HOU_0385 USA300HOU_2084 mepA phoB USA300HOU_1111 USA300HOU 0595 USA300HOU_2015 USA300HOU_1781 USA300HOU 1006 USA300HOU 0758 USA300HOU_1704 norG recD2 sdrM esaB USA300HOU_1249 USA300HOU_2161 USA300HOU 0615 USA300HOU_0596 alr2 USA300HOU 0046 USA300HOU_1211 glcB USA300HOU 0250 USA300HOU_2399 USA300HOU_2529 metS pycA USA300HOU 0393 USA300HOU_2451 USA300HOU 1585 USA300HOU 0326 USA300HOU_1212 USA300HOU 0491 USA300HOU_0327 hsdS1 USA300HOU 2006 USA300HOU 1289 USA300HOU_1299 USA300HOU 1922 araB sarT trpG fadD ksgA mpsB esaA USA300HOU_2400 sasD USA300HOU_1973 USA300HOU_2370 USA300HOU 1301 ftsY malA USA300HOU 0331 USA300HOU 0641 USA300HOU_2007 USA300HOU 2468 rnmV psuG USA300HOU 1847 USA300HOU_1926 USA300HOU_0546 USA300HOU 0486 hutU USA300HOU_2448 sbcC USA300HOU 0118 USA300HOU_1780 USA300HOU 2528 int3 USA300HOU_1892 USA300HOU 2008 essA USA300HOU_pUSA10HOU MR0006 USA300HOU_pUSA10HOU MR0005 USA300HOU_pUSA10HOU MR0002 USA300HOU_pUSA10HOU MR0001 USA300HOU_pUSA10HOU MR0004 USA300HOU_pUSA10HOU MR0003 USA300HOU_pUSA300HO UMR0031 USA300HOU_pUSA300HO UMR0032 USA300HOU_pUSA300HO UMR0001 USA300HOU_pUSA300HO UMR0016 USA300HOU_pUSA300HO UMR0014 USA300HOU_pUSA300HO UMR0003 USA300HOU_pUSA300HO UMR0011 USA300HOU_pUSA300HO UMR0018 USA300HOU_pUSA300HO UMR0021 USA300HOU_pUSA300HO UMR0029 USA300HOU_pUSA300HO UMR0008
USA300HOU_pUSA300 HOUMR0006 USA300HOU_pUSA300 HOUMR0004 USA300HOU_pUSA300 HOUMR0005 USA300HOU_pUSA300 HOUMR0007 USA300HOU_pUSA300 HOUMR0012 USA300HOU_pUSA300 HOUMR0030 USA300HOU_pUSA300 HOUMR0019 USA300HOU_pUSA300 HOUMR0013 USA300HOU_pUSA300 HOUMR0024 USA300HOU_pUSA300 HOUMR0010 USA300HOU_pUSA300 HOUMR0033 USA300HOU_pUSA300 HOUMR0027
USA300HOU_pUSA300HO UMR0006 USA300HOU_pUSA300HO UMR0004 USA300HOU_pUSA300HO UMR0005 USA300HOU_pUSA300HO UMR0007 USA300HOU_pUSA300HO UMR0012 USA300HOU_pUSA300HO UMR0030 USA300HOU_pUSA300HO UMR0019 USA300HOU_pUSA300HO UMR0013 USA300HOU_pUSA300HO UMR0024 USA300HOU_pUSA300HO UMR0010 USA300HOU_pUSA300HO UMR0033 USA300HOU_pUSA300HO UMR0027
Locus
Gene symbol
-1,07 -1,07 -1,08 -1,09 -1,10 -1,10 -1,11 -1,11 -1,12 -1,12 -1,12 -1,12 -1,12 -1,12 -1,13 -1,13 -1,13 -1,13 -1,13 -1,13 -1,16 -1,17 -1,18 -1,18 -1,18 -1,19 -1,19 -1,19 -1,19 -1,19 -1,19 -1,19 -1,20 -1,20 -1,21 -1,21 -1,21 -1,21 -1,22 -1,22 -1,23 -1,24 -1,24 -1,24 -1,24 -1,25 -1,25 -1,26 -1,26 -1,26 -1,26 -1,27 -1,28 -1,28 -1,30 -1,31 -1,32 -1,32 -1,38 -1,39 -1,40 -1,40 -1,40 -1,41 -1,41 -1,42 -1,43 -1,44 -1,45 -1,45 -1,46 -1,47 -1,47 -1,49 -1,50 -1,51 -1,52 -1,52 -1,52 -1,53 -1,53 -1,53 -1,54 -1,56 -1,60 -1,61 -1,61 -1,61 -1,62 -1,62 -1,63 -1,64 -1,69 -1,73 -1,73 -1,74 -1,75 -1,75 -1,75 -1,79 -1,80 -1,82 -1,83 -1,83 -1,87 -1,89 -1,95 -1,96 -2,04 -2,08 -2,12 -2,66
0,48 0,48 0,47 0,47 0,47 0,46 0,46 0,46 0,46 0,46 0,46 0,46 0,46 0,46 0,46 0,46 0,46 0,46 0,46 0,46 0,45 0,45 0,44 0,44 0,44 0,44 0,44 0,44 0,44 0,44 0,44 0,44 0,44 0,43 0,43 0,43 0,43 0,43 0,43 0,43 0,43 0,42 0,42 0,42 0,42 0,42 0,42 0,42 0,42 0,42 0,42 0,41 0,41 0,41 0,41 0,40 0,40 0,40 0,38 0,38 0,38 0,38 0,38 0,38 0,38 0,37 0,37 0,37 0,37 0,37 0,36 0,36 0,36 0,36 0,35 0,35 0,35 0,35 0,35 0,35 0,35 0,35 0,34 0,34 0,33 0,33 0,33 0,33 0,33 0,33 0,32 0,32 0,31 0,30 0,30 0,30 0,30 0,30 0,30 0,29 0,29 0,28 0,28 0,28 0,27 0,27 0,26 0,26 0,24 0,24 0,23 0,16
0,34 0,11 0,54 0,26 0,16 0,38 0,18 0,40 0,53 0,44 0,14 0,12 0,59 0,15 0,11 0,39 0,10 0,60 0,63 0,28 0,37 0,25 0,49 0,12 0,14 0,27 0,23 0,17 0,19 0,20 0,35 0,52 0,11 0,45 0,22 0,53 0,18 0,36 0,11 0,12 0,14 0,25 0,15 0,22 0,61 0,34 0,50 0,38 0,73 0,18 0,12 0,13 0,44 0,34 0,11 0,11 0,27 0,10 0,28 0,19 0,17 0,37 0,11 0,34 0,11 0,14 0,35 0,40 0,24 0,40 0,24 0,12 0,17 0,19 0,17 0,56 0,10 0,36 0,15 0,45 0,17 0,32 0,15 0,12 0,12 0,44 0,15 0,58 0,28 0,10 0,21 0,15 0,22 0,31 0,14 0,23 0,16 0,27 0,46 0,13 0,15 0,22 0,14 0,56 0,13 0,32 0,33 0,47 0,26 0,47 0,15 0,23
9,38
0,44
1,36
0,10
11,28
-0,42
0,75
0,18
8,09
-0,21
0,87
0,12
-1,75
0,08068976
0,16137952
4084,66
12,00
0,13
1,09
0,16
0,79
0,431723147
0,533774334
hypothetical protein
407,01
8,67
0,09
1,06
0,11
0,76
0,444811945
0,533774334
possible membrane protein
315,91
8,30
-0,01
0,99
0,12
-0,12
0,908419074
0,908419074
hypothetical protein
2607,45
11,35
1,34
2,54
0,12
11,16
6,25221E-29
1,62558E-27
-
possible transcriptional regulator
1668,36
10,70
1,32
2,50
0,14
9,14
6,00242E-20
7,80314E-19
-
replication protein A
4446,70
12,12
0,84
1,80
0,11
7,63
2,294E-14
1,98813E-13
-
IS257 transposase
765,84
9,58
-0,77
0,58
0,17
-4,46
8,35597E-06
5,43138E-05
-
recombinase
796,83
9,64
0,69
1,61
0,16
4,38
1,18074E-05
6,13983E-05
-
hypothetical protein
542,68
9,08
-0,69
0,62
0,16
-4,19
2,80981E-05
9,1319E-05
-
beta-lactamase
5393,89
12,40
0,50
1,42
0,12
4,20
2,61218E-05
9,1319E-05
-
3',5' aminoglycoside phosphotransferase
16954,81
14,05
0,63
1,54
0,15
4,23
2,34309E-05
9,1319E-05
-
IS431 mec transposase
409,72
8,68
-0,56
0,68
0,16
-3,37
0,000747921
0,002160661
-
macrolide 2'-phosphotransferase
827,76
9,69
-0,51
0,70
0,15
-3,30
0,000981298
0,002551374
-
cadmium efflux regulator
1023,62
10,00
0,52
1,44
0,18
2,90
0,003781879
0,008938986
-
hypothetical protein
86,79
6,44
-0,66
0,63
0,26
-2,49
0,012776835
0,027683143
-
hypothetical protein
2654,93
11,37
-0,31
0,81
0,13
-2,41
0,016025362
0,032050723
-
hypothetical protein
199,88
7,64
-0,46
0,73
0,20
-2,29
0,02182307
0,040528558
-
cadmium binding protein
1124,90
10,14
0,42
1,34
0,19
2,24
0,025292932
0,043321429
-
beta-lactamase regulator BlaR
976,34
9,93
-0,29
0,82
0,13
-2,22
0,026659341
0,043321429
-
Sin recombinase
669,00
9,39
0,28
1,22
0,15
1,89
0,059389343
0,090830761
-
strepthothricin acetyltransferase
4877,68
12,25
0,23
1,17
0,13
1,81
0,070970627
0,102513127
-
beta-lactamase regulator BlaI
362,40
8,50
-0,24
0,84
0,17
-1,47
0,14278074
0,195384171
-
bacitracin ABC ATP binding cassette transporter, ABC protein
355,66
8,47
-0,22
0,86
0,16
-1,40
0,160825613
0,209073297
-
MarR family transcriptional regulator
315,45
8,30
-0,19
0,88
0,18
-1,06
0,290042098
0,35909974
-
partitioning protein
2284,18
11,16
0,12
1,09
0,13
0,96
0,335236659
0,396188779
-
IS431mec transposase
Regulon
Function
-
serine protease SplB M20/M25/M40 family peptidase hypothetical protein iron compound ABC transporter iron compound-binding protein coproporphyrinogen III oxidase fosfomycin resistance protein FosB nucleoside diphosphate kinase PTS system, IIA component hypothetical protein hypothetical protein hypothetical protein sodium/bile acid symporter family protein hypothetical protein phosphosugar-binding transcriptional regulator ribosomal large subunit pseudouridine synthase B hypothetical protein hypothetical protein hypothetical protein hypothetical protein respiratory nitrate reductase subunit alpha hypothetical protein hypothetical protein hypothetical protein chromosome segregation protein SMC hypothetical protein hypothetical protein hypothetical protein maltose operon transcriptional repressor DNA repair protein RadC HAD superfamily hydrolase ABC transporter permease hypothetical protein ATP-dependent helicase hypothetical protein hypothetical protein hypothetical protein glyceraldehyde 3-phosphate dehydrogenase 2 phage terminase hypothetical protein HD domain-containing protein MATE efflux family protein alkaline phosphatase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein GntR family transcriptional regulator recombinase D drug transporter hypothetical protein hypothetical protein hemolysin III iron compound ABC transporter iron compound-binding protein hypothetical protein alanine racemase hypothetical protein M16 family peptidase PTS system, IIABC components hypothetical protein cation efflux family protein hypothetical protein methionyl-tRNA synthetase pyruvate carboxylase hypothetical protein hypothetical protein hypothetical protein hypothetical protein acetoacetyl-CoA reductase TatD family deoxyribonuclease 5'-nucleotidase type I restriction-modification system S subunit hypothetical protein hypothetical protein ImpB/MucB/SamB family protein hypothetical protein ribulokinase accessory regulator T anthranilate synthase component II acyl-CoA dehydrogenase dimethyladenosine transferase hypothetical protein hypothetical protein hypothetical protein cell wall surface anchor family protein phage HNH endonuclease hypothetical protein glutamyl aminopeptidase cell division protein FtsY alpha-D-1,4-glucosidase carbohydrate kinase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein urocanate hydratase hypothetical protein exonuclease SbcC integral membrane domain-containing protein hypothetical protein hypothetical protein integrase hypothetical protein phi77 ORF017-like protein hypothetical protein
32,18 3003,15 10,28 64,97 193,71 27,62 173,39 22,16 11,43 21,55 309,86 3649,52 7,78 682,99 671,73 24,81 1175,12 7,62 7,82 116,46 30,17 66,92 14,07 539,95 408,70 60,70 141,17 250,78 144,10 114,81 44,91 17,61 1170,93 16,04 85,44 12,12 300,03 47,09 1275,50 550,40 280,06 75,55 302,88 101,64 6,75 34,62 12,58 32,55 1,85 164,30 428,99 974,95 17,19 34,06 1070,37 677,77 57,65 1591,64 61,46 160,38 237,95 30,19 1824,59 37,87 1814,83 6073,01 33,87 24,89 77,60 24,74 76,41 651,95 253,96 230,34 553,66 9,88 3407,74 33,51 261,18 18,13 203,07 47,53 251,64 747,46 840,05 21,37 713,38 10,21 56,74 1361,43 105,58 296,20 116,94 50,43 495,67 116,35 230,32 84,67 17,05 978,61 350,34 184,01 386,22 16,49 724,01 49,43 43,17 16,71 91,81 16,98 791,14 127,15
-
possible membrane protein
665,52
-
hypothetical protein
2481,26
-
hypothetical protein
273,12
-
replication initiation protein
-
5,01 11,55 3,36 6,02 7,60 4,79 7,44 4,47 3,51 4,43 8,28 11,83 2,96 9,42 9,39 4,63 10,20 2,93 2,97 6,86 4,92 6,06 3,81 9,08 8,67 5,92 7,14 7,97 7,17 6,84 5,49 4,14 10,19 4,00 6,42 3,60 8,23 5,56 10,32 9,10 8,13 6,24 8,24 6,67 2,76 5,11 3,65 5,02 0,88 7,36 8,74 9,93 4,10 5,09 10,06 9,40 5,85 10,64 5,94 7,33 7,89 4,92 10,83 5,24 10,83 12,57 5,08 4,64 6,28 4,63 6,26 9,35 7,99 7,85 9,11 3,30 11,73 5,07 8,03 4,18 7,67 5,57 7,98 9,55 9,71 4,42 9,48 3,35 5,83 10,41 6,72 8,21 6,87 5,66 8,95 6,86 7,85 6,40 4,09 9,93 8,45 7,52 8,59 4,04 9,50 5,63 5,43 4,06 6,52 4,09 9,63 6,99
155,32 Base mean
7,28 A-value
0,18 M-value
1,13 Fold change
0,19 Standard error
-3,13 -10,13 -1,99 -4,14 -6,93 -2,94 -6,14 -2,76 -2,10 -2,54 -7,82 -9,29 -1,89 -7,74 -10,50 -2,91 -11,77 -1,89 -1,81 -4,01 -3,17 -4,61 -2,43 -9,77 -8,41 -4,37 -5,14 -7,21 -6,43 -5,91 -3,41 -2,28 -11,39 -2,65 -5,38 -2,30 -6,81 -3,33 -10,94 -10,39 -8,80 -5,03 -8,04 -5,66 -2,04 -3,64 -2,50 -3,30 -1,71 -7,03 -10,21 -9,55 -2,91 -3,82 -11,89 -11,66 -4,82 -12,57 -4,91 -7,27 -8,09 -3,80 -12,32 -4,18 -13,20 -10,51 -4,08 -3,61 -5,94 -3,63 -6,03 -12,57 -8,90 -8,04 -8,66 -2,69 -14,87 -4,19 -10,10 -3,36 -9,06 -4,81 -10,31 -12,59 -13,77 -3,66 -10,47 -2,78 -5,79 -16,48 -7,62 -11,29 -7,73 -5,67 -12,00 -7,61 -11,08 -6,59 -3,78 -13,48 -11,97 -8,37 -12,97 -3,27 -13,99 -5,99 -5,89 -4,15 -7,95 -4,37 -14,53 -11,77
0,00174824 4,10172E-24 0,046813127 3,40194E-05 4,20951E-12 0,003329036 8,44061E-10 0,005763977 0,035303904 0,011123067 5,49233E-15 1,50227E-20 0,058131729 9,68517E-15 8,81297E-26 0,00357573 5,33285E-32 0,059421037 0,071023838 6,04837E-05 0,001528432 4,07307E-06 0,015291352 1,58065E-22 4,12449E-17 1,24948E-05 2,73716E-07 5,68019E-13 1,31439E-10 3,51704E-09 0,000658467 0,022379197 4,77926E-30 0,008023918 7,43753E-08 0,02151579 9,76272E-12 0,000853788 7,30703E-28 2,87815E-25 1,42507E-18 4,99634E-07 8,83427E-16 1,47844E-08 0,041810542 0,000270704 0,012373034 0,000977727 0,086496689 2,00893E-12 1,71036E-24 1,28749E-21 0,003650439 0,00013602 1,402E-32 1,95026E-31 1,44472E-06 3,03398E-36 9,21831E-07 3,71906E-13 6,112E-16 0,000143474 7,43046E-35 2,91261E-05 8,51834E-40 7,86494E-26 4,53334E-05 0,00030105 2,91229E-09 0,000279149 1,64883E-09 3,02351E-36 5,6671E-19 9,27631E-16 4,83521E-18 0,007093236 5,43014E-50 2,82198E-05 5,63241E-24 0,000782384 1,35935E-19 1,53003E-06 6,14702E-25 2,43171E-36 3,76963E-43 0,000248065 1,13102E-25 0,005417748 7,19203E-09 4,82372E-61 2,55348E-14 1,42063E-29 1,03871E-14 1,42832E-08 3,46493E-33 2,70812E-14 1,49428E-28 4,29433E-11 0,000159448 2,11472E-41 4,83059E-33 5,69602E-17 1,92803E-38 0,001065274 1,8896E-44 2,12901E-09 3,82481E-09 3,37418E-05 1,92362E-15 1,21548E-05 8,16314E-48 5,7556E-32
0,003854834 4,39447E-23 0,077836344 9,67768E-05 2,36964E-11 0,006970252 3,92762E-09 0,011558406 0,060674303 0,021200854 3,82019E-14 1,35767E-19 0,094023542 6,63234E-14 1,00931E-24 0,007428237 7,70076E-31 0,095908073 0,11206077 0,000165846 0,003404061 1,29451E-05 0,028293261 1,56708E-21 3,20432E-16 3,7487E-05 9,92174E-07 3,37635E-12 6,4793E-10 1,55229E-08 0,001564891 0,039933866 6,41337E-29 0,015664621 2,88489E-07 0,038600576 5,31548E-11 0,001984702 9,03014E-27 3,22668E-24 1,19445E-17 1,77477E-06 6,50212E-15 6,15707E-08 0,070533721 0,000683708 0,02334883 0,002251052 0,132309558 1,14543E-11 1,87787E-23 1,22611E-20 0,007565691 0,000360684 2,08107E-31 2,69887E-30 4,88373E-06 5,16749E-35 3,19753E-06 2,26641E-12 4,52356E-15 0,000379313 1,20383E-33 8,3935E-05 1,64009E-38 9,04639E-25 0,000126924 0,000755325 1,29831E-08 0,0007037 7,45057E-09 5,16749E-35 4,87297E-18 6,8086E-15 3,92879E-17 0,013981252 1,45736E-48 8,14116E-05 5,96228E-23 0,001828316 1,19993E-18 5,15246E-06 6,83373E-24 4,19548E-35 8,14301E-42 0,000631935 1,28976E-24 0,010905269 3,06729E-08 1,54417E-59 1,67936E-13 1,87792E-28 7,09475E-14 5,95769E-08 5,32157E-32 1,77228E-13 1,91802E-27 2,21554E-10 0,000417878 4,25667E-40 7,37637E-32 4,41234E-16 3,53295E-37 0,002440029 4,36581E-43 9,55535E-09 1,67422E-08 9,60899E-05 1,37394E-14 3,65331E-05 2,08552E-46 8,22184E-31
4,30
1,71348E-05
0,000102809
-2,39
0,016963928
0,050891785
0,93 Wald statistic
0,353879515 P-value
0,400037713 Adjusted P-value
USA300HOU_pUSA300 USA300HOU_pUSA300HO HOUMR0023 UMR0023 bacitracin ABC ATP binding cassette transporter, membrane protein 522,56 9,03 -0,12 0,92 0,14 -0,86 0,392158192 0,424838041 USA300HOU_pUSA300 USA300HOU_pUSA300HO macrolide transporter 793,58 9,63 0,03 1,02 0,15 0,19 0,849850972 0,883845011 HOUMR0028 UMR0028 USA300HOU_pUSA300 USA300HOU_pUSA300HO HOUMR0015 UMR0015 hypothetical protein 576,14 9,17 0,02 1,01 0,19 0,11 0,914066052 0,914066052 Table S1: DESeq2 differential gene expression analysis of Staphylococcus aureus USA300 wild type after 30 min of NaOCl treatment in three biological replicates. S. aureus wild type cells were grown in 3 biological replicates and harvested before and 30 min after exposure to 1 mM NaOCl stress. The RNAisolation, library preparation, sequencing and mapping was performed as described in the methods section. Transcripts were analyzed for differential gene expression using the software DEseq2 included in the ReadXplorer v2.2 software. The signal intensity value (A-value) was calculated by log2 base mean of normalized read counts and the signal intensity ratio (M-value) by log2 fold change. The evaluation of the differential RNAseq data was performed using an adjusted p-value cut-off of P ≤ 0.05 and a signal intensity ratio (M-value) cut-off of ≥ 1.98 or ≤ - 1.98 (printed in bold). Genes were classified into regulons according to the RegPrecise database and those published previously (Mäder et al., 2016).
Table S2: RNA-Seq transcriptome analysis of gene expression changes in S. aureus USA300 wild type cells 30min after NaOCl stress Regulon SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS SaeRS HypR HypR TetR TetR QsrR QsrR QsrR QsrR QsrR QsrR NsrR NsrR CstR CstR CstR CstR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR PerR Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Fur Zur Zur Zur Zur Zur Zur Zur Zur Zur Zur Zur Zur CzrA CzrA CtsR CtsR CtsR CtsR CtsR CtsR CtsR HrcA HrcA HrcA HrcA HrcA HrcA CymR CymR CymR CymR CymR CymR CymR CymR CymR CymR CymR
Operon coa efb hlgA hlgCB hlgCB hla lukSF lukSF map SACOL0199 selX ssl9 SCIN ear ecb scc sbi saeSRQP saeSRQP saeSRQP saeSRQP hypR merA hypR merA SACOL2588 SACOL2589 SACOL2588 SACOL2589 catE2 frp yodC catE SACOL0409 azoR1 catE SACOL0409 azoR1 catE SACOL0409 azoR1 SACOL0219 hmp SACOL0219 hmp cstR tauE cstR tauE cstAB sqr cstAB sqr ahpCF ahpCF bcp SACOL1920 bcp SACOL1920 SACOL1762 dps hemEHY hemEHY hemEHY katA perR sufCDSUB sufCDSUB sufCDSUB sufCDSUB sufCDSUB trxB arlRS arlRS citB efeOBU efeOBU efeOBU feoAB feoAB fhuABG fhuABG fhuABG fhuD2 ftnA isdACDEFG isdACDEFG isdACDEFG isdACDEFG isdACDEFG isdACDEFG isdH iucB SACOL0874 sbnABCDEFGHI sbnABCDEFGHI sbnABCDEFGHI sbnABCDEFGHI sbnABCDEFGHI sbnABCDEFGHI sbnABCDEFGHI sbnABCDEFGHI sbnABCDEFGHI sirABC sirABC sirABC sstABCD sstABCD sstABCD sstABCD tatAC tatAC htsABC htsABC htsABC rpmG2 rpsN2 SACOL0948 SACOL2413 SACOL2600 SACOL2599 SACOL2598 SACOL2600 SACOL2599 SACOL2598 SACOL2600 SACOL2599 SACOL2598 yciC zinT znuCB zur znuCB zur znuCB zur czrAB czrAB clpB clpP ctsR mcsA mcsB clpC ctsR mcsA mcsB clpC ctsR mcsA mcsB clpC ctsR mcsA mcsB clpC SACOL2018 groEL-groES groEL-groES hrcA-grpE-dnaKJ hrcA-grpE-dnaKJ hrcA-grpE-dnaKJ hrcA-grpE-dnaKJ cysJ-sirC cysJ-sirC cysK luxS metN1-SACOL0505-SACOL0506 srpF oppF_2 tcyP yedE caiA tcyABC
SACOL-numbers SACOL0209 SACOL1168 SACOL2419 SACOL2421 SACOL2422 SACOL1173 SACOL2004 SACOL2006 SACOL2002 SACOL0199 SACOL0442 SACOL0473 SACOL0480 SACOL0908 SACOL1164 SACOL1169 SACOL2418 SACOL0765 SACOL0766 SACOL0767 SACOL0768 SACOL0640 SACOL0641 SACOL2588 SACOL2589 SACOL2533 SACOL2534 SACOL2020 SACOL0408 SACOL0409 SACOL0410 SACOL0219 SACOL0220 SACOL0061 SACOL0062 SACOL0063 SACOL0064 SACOL0451 SACOL0452 SACOL1920 SACOL1921 SACOL1762 SACOL2131 SACOL1887 SACOL1888 SACOL1889 SACOL1368 SACOL1919 SACOL0914 SACOL0915 SACOL0916 SACOL0917 SACOL0918 SACOL0829 SACOL1450 SACOL1451 SACOL1385 SACOL0414 SACOL0415 SACOL0416 SACOL2564 SACOL2565 SACOL0704 SACOL0705 SACOL0706 SACOL2277 SACOL1952 SACOL1140 SACOL1141 SACOL1142 SACOL1143 SACOL1144 SACOL1146 SACOL1781 SACOL2171 SACOL0874 SACOL0100 SACOL0101 SACOL0102 SACOL0103 SACOL0104 SACOL0105 SACOL0106 SACOL0107 SACOL0108 SACOL0097 SACOL0098 SACOL0099 SACOL0796 SACOL0797 SACOL0798 SACOL0799 SACOL0417 SACOL0418 SACOL2165 SACOL2166 SACOL2167 SACOL1608 SACOL2226 SACOL0948 SACOL2413 SACOL2598 SACOL2599 SACOL2600 SACOL0491 SACOL2403 SACOL1611 SACOL1612 SACOL1613 SACOL2137 SACOL2138 SACOL0979 SACOL0833 SACOL0567 SACOL0568 SACOL0569 SACOL0570 SACOL2018 SACOL2016 SACOL2017 SACOL1636 SACOL1637 SACOL1638 SACOL1639 SACOL2638 SACOL2639 SACOL0557 SACOL2126 SACOL0506 SACOL0157 SACOL0184 SACOL0454 SACOL2034 SACOL2278 SACOL2410
USA300-numbers USA300HOU_0238 USA300HOU_1094 USA300HOU_2402 USA300HOU_2404 USA300HOU_2405 USA300HOU_1099 USA300HOU_2011 USA300HOU_2013 USA300HOU_1942 USA300HOU_0228 USA300HOU_0392 USA300HOU_0431 USA300HOU_0437 USA300HOU_0867 USA300HOU_1090 USA300HOU_1095 USA300HOU_2401 USA300HOU_0728 USA300HOU_0729 USA300HOU_0730 USA300HOU_0731 USA300HOU_0587 USA300HOU_0588 USA300HOU_2567 USA300HOU_2568 USA300HOU_2511 USA300HOU_2512 USA300HOU_2028 USA300HOU_0358 USA300HOU_0359 USA300HOU_0360 USA300HOU_0248 USA300HOU_0249 USA300HOU_0090 USA300HOU_0091 USA300HOU_0092 USA300HOU_0093 USA300HOU_0403 USA300HOU_0404 USA300HOU_1857 USA300HOU_1858 USA300HOU_1700 USA300HOU_2128 USA300HOU_1823 USA300HOU_1824 USA300HOU_1825 USA300HOU_1277 USA300HOU_1856 USA300HOU_0870 USA300HOU_0871 USA300HOU_0873 USA300HOU_0874 USA300HOU_0875 USA300HOU_0792 USA300HOU_1349 USA300HOU_1350 USA300HOU_1283 USA300HOU_0364 USA300HOU_0365 USA300HOU_0366 USA300HOU_2544 USA300HOU_2545 USA300HOU_0668 USA300HOU_0669 USA300HOU_0670 USA300HOU_2266 USA300HOU_1891 USA300HOU_1064 USA300HOU_1065 USA300HOU_1066 USA300HOU_1067 USA300HOU_1068 USA300HOU_1069 USA300HOU_1720 USA300HOU_2173 USA300HOU_0837 USA300HOU_0127 USA300HOU_0128 USA300HOU_0129 USA300HOU_0130 USA300HOU_0131 USA300HOU_0132 USA300HOU_0133 USA300HOU_0134 USA300HOU_0135 USA300HOU_0124 USA300HOU_0125 USA300HOU_0126 USA300HOU_0759 USA300HOU_0760 USA300HOU_0761 USA300HOU_0762 USA300HOU_0367 USA300HOU_0368 USA300HOU_2167 USA300HOU_2168 USA300HOU_2169 USA300HOU_1553 USA300HOU_2228 USA300HOU_0905 USA300HOU_2396 USA300HOU_2576 USA300HOU_2577 USA300HOU_2578 USA300HOU_0452 USA300HOU_2386 USA300HOU_1556 USA300HOU_1557 USA300HOU_1558 USA300HOU_2134 USA300HOU_2135 USA300HOU_0933 USA300HOU_0797 USA300HOU_0515 USA300HOU_0516 USA300HOU_0517 USA300HOU_0518 USA300HOU_2026 USA300HOU_2024 USA300HOU_2025 USA300HOU_1580 USA300HOU_1581 USA300HOU_1582 USA300HOU_1583 USA300HOU_2617 USA300HOU_2618 USA300HOU_0507 USA300HOU_2123 USA300HOU_0464 USA300HOU_0184 USA300HOU_0212 USA300HOU_0406 USA300HOU_2042 USA300HOU_2267 USA300HOU_2393
Gene symbol coa efb hlgA hlgC hlgB hla lukF lukS map USA300HOU_0228 selX ssl9 SCIN ear ecb scc sbi saeS saeR saeQ saeP merA hypR USA300HOU_2567 USA300HOU_2568 catE2 frp yodC catE USA300HOU_0359 azoR1 USA300HOU_0248 hmp tauE cstR cstA cstB ahpF ahpC USA300HOU_1857 bcp tpx dps hemY hemH hemE katA perR sufC sufD sufS sufU sufB trxB arlS arlR citB efeO efeB efeU feoB feoA fhuA fhuB fhuG fhuD2 ftn isdA isdC isdD isdE isdF isdG isdH iucB fbiB sbnA sbnB sbnC sbnD sbnE sbnF sbnG sbnH sbnl sirC sirB sirA sstA sstB sstC sstD tatC tatA htsC htsB htsA rpmG_2 rpsN_2 mnmC lmrB2 cobW_3 feoB_3 USA300HOU_2578 yciC zinT zur znuB znuC czrA czrB clpB clpP ctsR mcsA mcsB clpC USA300HOU_2026 groEL groES dnaJ dnaK grpE hrcA cysG cysJ cysK luxS USA300HOU_0464 srpF oppF_2 tcyP yedE caiA tcyC
log2-fold change NaOCl 5,08 2,43 6,87 6,18 5,62 1,27 4,75 4,77 6,50 1,92 4,69 1,60 7,37 5,72 7,30 7,06 7,36 4,79 5,03 5,89 7,61 7,47 7,50 0,56 0,66 3,25 2,31 2,79 2,08 2,24 2,28 2,33 2,37 2,17 2,08 1,85 1,31 2,53 2,02 0,40 0,25 1,76 1,35 0,41 0,55 0,43 1,58 0,12 0,28 0,39 0,70 1,06 1,32 2,19 0,69 0,65 0,37 -0,73 -1,06 -1,23 -0,77 -0,82 0,71 0,79 0,59 0,53 0,33 -0,05 0,39 -0,25 0,14 -0,29 -1,31 -0,67 0,15 0,70 1,29 0,88 0,73 -0,30 0,11 0,02 -0,17 -0,14 -0,11 0,46 -0,53 -0,15 -0,38 0,22 0,16 0,32 1,01 1,03 1,11 1,32 1,68 -0,42 0,64 2,71 0,31 -0,31 -0,11 0,43 -0,81 1,40 0,13 0,51 1,07 0,20 0,57 -0,22 0,84 0,27 0,24 0,40 0,46 -1,00 0,52 0,11 0,78 1,50 1,34 1,29 -0,83 -0,61 0,94 -0,31 -0,11 0,65 -0,19 -1,15 -0,73 0,45 0,76
Function staphylocoagulase fibrinogen-binding protein gamma-hemolysin component A gamma hemolysin component C gamma hemolysin component B alpha-hemolysin possible leukocidin subunit possible leukocidin subunit cell surface protein MapW2 hypothetical protein possible staphylococcal enterotoxin staphylococcal exotoxin Staphylococcal complement inhibitor SCIN Ear protein fibrinogen binding-like protein fibrinogen-binding protein precursor-like protein immunoglobulin G-binding protein SBI sensor histidine kinase SaeS response regulator SaeR hypothetical membrane protein hypothetical lipoprotein pyridine nucleotide-disulfide reductase Rrf2-family repressor of the hypR-merA operon hypothetical protein hypothetical protein possible dioxygenase FMN reductase possible nitroreductase possible lactoylglutathione lyase possible alkanal monooxygenase (FMN-linked) possible FMN reductase hypothetical protein flavohemoprotein hypothetical membrane protein repressor of hydrogen sulfide detoxification cstAB-sqr operon rhodanese domain-containing protein hydroxyacylglutathione hydrolase peroxiredoxin subunit F peroxiredoxin subunit C D-3-phosphoglycerate dehydrogenase possible peroxiredoxin possible peroxiredoxin Dps family stress protein protoporphyrinogen oxidase ferrochelatase uroporphyrinogen decarboxylase catalase peroxide regulon repressor PerR FeS assembly ATPase SufC FeS assembly protein SufD SufS subfamily cysteine desulfurase NifU family SUF system FeS assembly protein FeS assembly protein SufB thioredoxin-disulfide reductase sensor histidine kinase response regulator aconitate hydratase iron (Fe2+)-binding lipoprotein iron (Fe2+)-dependent Dyp family peroxidase OFeT family oxidase-dependent iron (Fe2+) transporter FeoB family ferrous iron (Fe2+) uptake protein hypothetical protein iron (Fe3+) ABC transporter, ATP-binding protein iron (Fe3+) ABC transporter, membrane protein iron (Fe3+) ABC transporter, membrane protein iron (Fe+3) ABC transporter, iron-binding protein ferritin iron (Fe2+)-regulated surface determinant protein IsdA iron (Fe2+)-regulated surface determinant protein IsdC hemoglobin iron ABC transporter, membrane component IsdD hemoglobin iron ABC transporter, lipoprotein IsdE hemoglobin iron ABC transporter, permease IsdF heme-degrading monooxygenase IsdG cell wall surface anchored protein possible Iuc family aerobactin synthesis protein possible nitroreductase possible pyridoxal-phosphate dependent enzyme possible ornithine cyclodeaminase IucA/IucC family siderophore biosynthesis protein MFS family major facilitator transporter IucA/IucC family siderophore biosynthesis protein IucA/IucC family siderophore biosynthesis protein HpcH/HpaI family aldolase diaminopimelate decarboxylase hypothetical protein Siderophore staphylobactin ABC transporter, permease protein SirC Siderophore staphylobactin ABC transporter, permease protein SirB Siderophore staphylobactin ABC transporter, siderophore-binding protein SirA siderophore-Fe(III) ABC transporter permease siderophore-Fe(III) ABC transporter permease siderophore-Fe(III) ABC transporter, ATP-binding protein siderophore-Fe(III) ABC transporter,lipoprotein Tat family twin arginine targeting transporter TatC Tat family twin arginine targeting transporter TatA heme ABC transporter, permease HtsC heme ABC transporter, permease HtsB heme ABC transporter, heme-binding protein HtsA ribosomal protein L33 ribosomal protein S14 hypothetical protein MFS family major facilitator transporter, multidrug :cation symporter cobalamin (vitamin B12) biosynthesis protein FeoB family ferrous iron (Fe2+) uptake protein hypothetical protein cobalamin (vitamin B12) biosynthesis protein ABC transporter, binding protein Zn-uptake transcriptional regulator zinc ABC transporter, permease zinc ABC transporter, ATP-binding protein transcriptional regulator CzrA CDF family cation diffusion facilitator CzrB S14 family endopeptidase ClpB S14 family endopeptidase ClpP CtsR family transcriptional regulator hypothetical protein ATP:guanido phosphotransferase AAA family ATP-binding protein hypothetical membrane protein chaperone GroEL chaperone GroES chaperone DnaJ chaperone DnaK chaperone GrpE heat shock transcriptional repressor HrcA possible sirohydrochlorin ferrochelatase sulfite reductase (NADPH) alpha subunit cysteine synthase S-ribosylhomocysteine lyase ABC transporter, binding protein hypothetical protein oligopeptide ABC transporter, ATP-binding protein DAACS family dicarboxylate/amino acid:sodium (Na+) or proton (H+) symporter hypothetical membrane protein acyl-CoA dehydrogenase ABC transporter, ATP-binding protein
Regulon CymR CymR BSH BSH BSH BSH BSH BSH BSH BSH BSH BSH BSH BSH BSH BSH CggR CggR CggR CggR CggR CggR PDH PDH PDH PDH Translation Translation Translation Translation CidR CidR CidR CidR CidR CidR CidR CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY CodY FapR FapR FapR FapR FapR FapR FapR FruR FruR GlnR GlnR GlnR GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS
Operon tcyABC tcyABC dinG birA papS bshA dinG birA papS bshA dinG birA papS bshA dinG birA papS bshA bshB2 bshC brx SACOL1465 SACOL1466 SACOL1467 brx SACOL1465 SACOL1466 SACOL1467 brx SACOL1465 SACOL1466 SACOL1467 brx SACOL1465 SACOL1466 SACOL1467 SACOL1557 brxB SACOL1557 brxB brxC ypdA cggR gap pgk tpiA pgm eno cggR gap pgk tpiA pgm eno cggR gap pgk tpiA pgm eno cggR gap pgk tpiA pgm eno cggR gap pgk tpiA pgm eno cggR gap pgk tpiA pgm eno pdhA pdhB pdhC pdhD pdhA pdhB pdhC pdhD pdhA pdhB pdhC pdhD pdhA pdhB pdhC pdhD SACOL0590 rpsL rpsG fusA tuf SACOL0590 rpsL rpsG fusA tuf SACOL0590 rpsL rpsG fusA tuf SACOL0590 rpsL rpsG fusA tuf budA1 alsS budA1 alsS lrgA lrgB lrgA lrgB cidCBA cidCBA cidCBA ilvDBNC-leuABCD-ilvA2 ilvDBNC-leuABCD-ilvA2 ilvDBNC-leuABCD-ilvA2 ilvDBNC-leuABCD-ilvA2 ilvDBNC-leuABCD-ilvA2 ilvDBNC-leuABCD-ilvA2 ilvDBNC-leuABCD-ilvA2 ilvDBNC-leuABCD-ilvA2 ilvDBNC-leuABCD-ilvA2 lysC asd dapA dapB dapD lysC asd dapA dapB dapD lysC asd dapA dapB dapD lysC asd dapA dapB dapD lysC asd dapA dapB dapD ribHBAED ribHBAED ribHBAED ribHBAED SACOL0427 SACOL0870 SACOL0882 SACOL0883 SACOL0884 SACOL0882 SACOL0883 SACOL0884 SACOL0882 SACOL0883 SACOL0884 SACOL1476 ilvA1 ald1 SACOL1476 ilvA1 ald1 fnbA isaA SACOL2295 fabHF fabHF fabI fapR plsX fabDG fapR plsX fabDG fapR plsX fabDG fapR plsX fabDG fruRK fruRK glnRA glnRA nrgA ackA SACOL1761 ackA SACOL1761 atpCDGAHFEBI mnaA upp glyA SACOL2106 atpCDGAHFEBI mnaA upp glyA SACOL2106 atpCDGAHFEBI mnaA upp glyA SACOL2106 atpCDGAHFEBI mnaA upp glyA SACOL2106 atpCDGAHFEBI mnaA upp glyA SACOL2106 atpCDGAHFEBI mnaA upp glyA SACOL2106 atpCDGAHFEBI mnaA upp glyA SACOL2106 atpCDGAHFEBI mnaA upp glyA SACOL2106 atpCDGAHFEBI mnaA upp glyA SACOL2106 atpCDGAHFEBI mnaA upp glyA SACOL2106 atpCDGAHFEBI mnaA upp glyA SACOL2106 atpCDGAHFEBI mnaA upp glyA SACOL2106 atpCDGAHFEBI mnaA upp glyA SACOL2106 coaE fpg polA coaE fpg polA coaE fpg polA cydA cydB cydA cydB deoC1 deoB deoC1 deoB deoC2 femAB femAB fhs glpF gntPKR SACOL2517 gntPKR SACOL2518 gntPKR SACOL2519 gntPKR SACOL2520 mutSL glpP mutSL glpP mutSL glpP hprK lgt SACOL0827 SACOL0828 trxB hprK lgt SACOL0827 SACOL0828 trxB hprK lgt SACOL0827 SACOL0828 trxB hprK lgt SACOL0827 SACOL0828 trxB citCZ citCZ murI SACOL1162 SACOL1163 murI SACOL1162 SACOL1163 murI SACOL1162 SACOL1163 pdp radA SACOL0573 radA SACOL0573 SACOL0166 SACOL0466 SACOL0467 SACOL0466 SACOL0467 SACOL0511 SACOL0512 SACOL0511 SACOL0512 SACOL0555 SACOL0556 SACOL0656 SACOL0973 SACOL0975 SACOL0976 SACOL0975 SACOL0976 SACOL0977 SACOL1004 pepF
SACOL-numbers SACOL2411 SACOL2412 SACOL1495 SACOL1496 SACOL1497 SACOL1498 SACOL0614 SACOL1190 SACOL1464 SACOL1465 SACOL1466 SACOL1467 SACOL1557 SACOL1558 SACOL0804 SACOL1520 SACOL0837 SACOL0838 SACOL0839 SACOL0840 SACOL0841 SACOL0842 SACOL1102 SACOL1103 SACOL1104 SACOL1105 SACOL0590 SACOL0591 SACOL0592 SACOL0594 SACOL2198 SACOL2199 SACOL0247 SACOL0248 SACOL2553 SACOL2554 SACOL2554.1 SACOL2042 SACOL2043 SACOL2044 SACOL2045 SACOL2046 SACOL2047 SACOL2048 SACOL2049 SACOL2050 SACOL1428 SACOL1429 SACOL1430 SACOL1431 SACOL1432 SACOL1817 SACOL1818 SACOL1819 SACOL1820 SACOL0427 SACOL0870 SACOL0882 SACOL0883 SACOL0884 SACOL1477 SACOL1478 SACOL2511 SACOL2584 SACOL2295 SACOL0987 SACOL0988 SACOL1016 SACOL1242 SACOL1243 SACOL1244 SACOL1245 SACOL0757 SACOL0758 SACOL1328 SACOL1329 SACOL2031 SACOL1760 SACOL1761 SACOL2094 SACOL2095 SACOL2096 SACOL2097 SACOL2098 SACOL2099 SACOL2100 SACOL2101 SACOL2102 SACOL2103 SACOL2104 SACOL2105 SACOL2106 SACOL1735 SACOL1736 SACOL1737 SACOL1094 SACOL1095 SACOL0123 SACOL0124 SACOL2129 SACOL1410 SACOL1411 SACOL1782 SACOL1319 SACOL2514 SACOL2515 SACOL2516 SACOL2517 SACOL1315 SACOL1316 SACOL1317 SACOL0825 SACOL0826 SACOL0827 SACOL0828 SACOL1741 SACOL1742 SACOL1161 SACOL1162 SACOL1163 SACOL2128 SACOL0572 SACOL0573 SACOL0166 SACOL0466 SACOL0467 SACOL0511 SACOL0512 SACOL0555 SACOL0556 SACOL0656 SACOL0973 SACOL0975 SACOL0976 SACOL0977 SACOL1005
USA300-numbers USA300HOU_2394 USA300HOU_2395 USA300HOU_1393 USA300HOU_1394 USA300HOU_1395 USA300HOU_1396 USA300HOU_0561 USA300HOU_1117 USA300HOU_1365 USA300HOU_1366 USA300HOU_1367 USA300HOU_1368 USA300HOU_1515 USA300HOU_1516 USA300HOU_0768 USA300HOU_1417 USA300HOU_0801 USA300HOU_0802 USA300HOU_0803 USA300HOU_0804 USA300HOU_0805 USA300HOU_0806 USA300HOU_1036 USA300HOU_1037 USA300HOU_1038 USA300HOU_1039 USA300HOU_0538 USA300HOU_0539 USA300HOU_0540 USA300HOU_0541 USA300HOU_2201 USA300HOU_2202 USA300HOU_0273 USA300HOU_0274 USA300HOU_2531 USA300HOU_2532 USA300HOU_2533 USA300HOU_2048 USA300HOU_2049 USA300HOU_2050 USA300HOU_2051 USA300HOU_2052 USA300HOU_2053 USA300HOU_2054 USA300HOU_2055 USA300HOU_2056 USA300HOU_1328 USA300HOU_1329 USA300HOU_1330 USA300HOU_1331 USA300HOU_1332 USA300HOU_1757 USA300HOU_1758 USA300HOU_1759 USA300HOU_1760 USA300HOU_0376 USA300HOU_0832 USA300HOU_0847 USA300HOU_0848 USA300HOU_0849 USA300HOU_1375 USA300HOU_1376 USA300HOU_2491 USA300HOU_2564 USA300HOU_2285 USA300HOU_0941 USA300HOU_0942 USA300HOU_0969 USA300HOU_1164 USA300HOU_1165 USA300HOU_1166 USA300HOU_1167 USA300HOU_0721 USA300HOU_0722 USA300HOU_1239 USA300HOU_1240 USA300HOU_2040 USA300HOU_1698 USA300HOU_1699 USA300HOU_2092 USA300HOU_2093 USA300HOU_2094 USA300HOU_2095 USA300HOU_2096 USA300HOU_2097 USA300HOU_2098 USA300HOU_2099 USA300HOU_2100 USA300HOU_2101 USA300HOU_2102 USA300HOU_2103 USA300HOU_2104 USA300HOU_1675 USA300HOU_1676 USA300HOU_1677 USA300HOU_1028 USA300HOU_1029 USA300HOU_0150 USA300HOU_0151 USA300HOU_2126 USA300HOU_1309 USA300HOU_1310 USA300HOU_1721 USA300HOU_1230 USA300HOU_2492 USA300HOU_2493 USA300HOU_2494 USA300HOU_2495 USA300HOU_1227 USA300HOU_1228 USA300HOU_1229 USA300HOU_0788 USA300HOU_0789 USA300HOU_0790 USA300HOU_0791 USA300HOU_1681 USA300HOU_1682 USA300HOU_1086 USA300HOU_1087 USA300HOU_1088 USA300HOU_2125 USA300HOU_0519 USA300HOU_0520 USA300HOU_0194 USA300HOU_0420 USA300HOU_0421 USA300HOU_0469 USA300HOU_0470 USA300HOU_0505 USA300HOU_0506 USA300HOU_0607 USA300HOU_0927 USA300HOU_0929 USA300HOU_0930 USA300HOU_0931 USA300HOU_0958
Gene symbol tcyB tcyA dinG birA papS bshA bshB bshC brx USA300HOU_1366 USA300HOU_1367 USA300HOU_1368 USA300HOU_1515 brxB brxC ypdA gapR gap pgk tpiA pgm eno pdhA pdhB pdhC pdhD rplL3 rpsL rpsG tuf budA1 alsS lrgA lrgB cidC cidB cidA ilvD ilvB ilvN ilvC leuA leuB leuC leuD ilvA2 lysC asd dapA dapB dapD ribH ribA ribB ribD USA300HOU_0376 lysE metN2 metI2 metQ ilvA1 ald fnbA isaA ssaA fabH fab fabI fapR plsX fabD fabG deoR fruB glnR glnA nrgA ackA USA300HOU_1699 atpC atpD atpG atpA atpH atpF atpE atpB atpI mnaA upp glyA USA300HOU_2104 coaE fpg polA cydA cydB deoC1 deoB deoC2 femA femB fhs glpF gntP gntK gntR USA300HOU_2495 mutS mutL glpP hprK lgt USA300HOU_0790 USA300HOU_0791 citC citZ murI USA300HOU_1087 USA300HOU_1088 pdp radA USA300HOU_0520 USA300HOU_0194 USA300HOU_0420 USA300HOU_0421 USA300HOU_0469 USA300HOU_0470 ftsH hslO USA300HOU_0607 USA300HOU_0927 cdr USA300HOU_0930 yitW pepF
log2-fold change NaOCl 0,73 0,67 -0,35 0,17 0,27 0,59 0,83 1,29 0,38 0,18 -0,07 -0,19 1,11 0,96 0,39 0,26 0,88 1,25 1,17 0,76 0,97 1,19 1,77 1,94 1,88 1,88 1,75 1,67 1,59 0,93 0,26 0,33 1,69 1,17 2,57 2,47 2,67 0,55 0,71 0,86 1,16 1,88 2,69 3,22 3,27 3,23 0,59 0,55 0,58 0,53 0,46 1,45 1,22 1,29 1,26 0,71 -0,24 1,14 1,29 1,14 1,70 1,98 4,84 1,69 1,31 2,74 2,48 0,55 0,42 0,43 0,74 0,91 0,62 0,51 -0,04 0,18 -0,62 1,38 0,53 1,37 1,39 1,88 1,78 1,39 1,18 0,99 0,83 0,46 -0,14 0,01 -0,12 -0,55 -0,55 -0,49 -0,02 -0,07 -0,08 0,14 0,24 -0,12 0,79 0,77 0,84 -0,36 -0,08 -0,66 -0,21 -0,04 -0,51 -1,01 -0,61 0,37 0,91 1,14 0,81 1,24 1,19 1,19 1,41 1,63 0,01 0,20 0,36 0,65 1,08 1,23 -1,21 -0,93 1,10 1,03 0,30 0,48 0,29 0,42 0,45 -0,52
Function ABC transporter, membrane protein amino acid ABC transporter, binding protein DNA-directed DNA polymerase III epsilon subunit biotin--[acetyl-CoA-carboxylase] ligase/biotin operon transcriptional regulator polynucleotide adenylyltransferase glycosyltransferase bacillithiol biosynthesis deacetylase BshB2 bacillithiol biosynthesis cysteine-adding enzyme BshC bacillredoxin BrxA hypothetical protein hypothetical protein hypothetical protein hypothetical protein bacillredoxin BrxB bacillredoxin YtxJ putative bacillithiol system oxidoreductase, YpdA family DeoR family transcriptional regulator glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) phosphoglycerate kinase triose-phosphate isomerase bisphosphoglycerate mutase phosphopyruvate hydratase pyruvate dehydrogenase (acetyl-transferring) alpha subunit pyruvate dehydrogenase (acetyl-transferring) beta subunit dihydrolipoyllysine-residue acetyltransferase dihydrolipoyl dehydrogenase possible RNA-binding ribosomal protein ribosomal protein S12 ribosomal protein S7 elongation factor EF1A acetolactate decarboxylase acetolactate synthase murein hydrolase regulator LrgA murein hydrolase regulator LrgB pyruvate oxidase hypothetical membrane protein hypothetical membrane protein dihydroxy-acid dehydratase acetolactate synthase large subunit acetolactate synthase small subunit ketol-acid reductoisomerase 2-isopropylmalate synthase 3-isopropylmalate dehydrogenase 3-isopropylmalate dehydratase large subunit 3-isopropylmalate dehydratase small subunit threonine ammonia-lyase aspartate kinase aspartate-semialdehyde dehydrogenase dihydrodipicolinate synthase dihydrodipicolinate reductase 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase riboflavin synthase beta subunit bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II riboflavin synthase alpha subunit diaminohydroxyphosphoribosylaminopyrimidine deaminase hypothetical protein LysE family L-lysine exporter ABC transporter, ATP-binding protein ABC transporter, membrane protein ABC transporter, binding protein threonine ammonia-lyase alanine dehydrogenase fibronectin-binding protein A immunodominant antigen A secretory antigen SsaA 3-oxoacyl-[acyl-carrier-protein] synthase 3-oxoacyl-[acyl-carrier-protein] synthase enoyl-[acyl-carrier-protein] reductase (NADH) hypothetical protein fatty acid/phospholipid synthesis protein [acyl-carrier-protein] S-malonyltransferase 3-oxoacyl-[acyl-carrier-protein] reductase DeoR family transcriptional regulator 1-phosphofructokinase glutamate--ammonia ligase repressor glutamate--ammonia ligase AMT family ammonium or ammonia transporter acetate kinase hypothetical protein proton- translocating F-type ATPase epsilon subunit proton-translocating F-type ATPase delta subunit proton-translocating F-type ATPase gamma subunit proton-translocating F-type ATPase alpha subunit proton-translocating F-type ATPase beta subunit proton-translocating F-type ATPase subunit B proton-translocating F-type ATPase epsilon subunit C proton-translocating F-type ATPase beta subunit A hypothetical protein UDP-N-acetylglucosamine 2-epimerase uracil phosphoribosyltransferase glycine hydroxymethyltransferase hypothetical protein dephospho-CoA kinase DNA-formamidopyrimidine glycosylase DNA-directed DNA polymerase I cytochrome d ubiquinol oxidase subunit I cytochrome d ubiquinol oxidase subunit II deoxyribose-phosphate aldolase phosphopentomutase deoxyribose-phosphate aldolase methicillin resistance factor FemA methicillin resistance factor FemB formate--tetrahydrofolate ligase MIP family major intrinsic protein channel protein GntP family gluconate:proton (H+) symporter gluconokinase gluconate operon transcriptional repressor MerR family transcriptional regulator DNA mismatch repair protein MutS DNA mismatch repair protein MutL glycerol uptake operon antiterminator HPr kinase prolipoprotein diacylglyceryl transferase possible acetyltransferase hypothetical TPR domain protein isocitrate dehydrogenase (NADP(+)) citrate (Si)-synthase glutamate racemase possible HAM1 family protein hypothetical protein pyrimidine nucleoside phosphorylase DNA repair protein RadA hypothetical protein hypothetical membrane protein hypothetical membrane protein hypothetical protein hypothetical protein hypothetical membrane protein cell division protein FtsH heat shock protein Hsp33 hypothetical protein fumarylacetoacetase coenzyme A disulfide reductase possible HAD superfamily hydrolase hypothetical protein M03 family oligopeptidase F
Regulon GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS
Operon SACOL1006 SACOL1007 SACOL1006 SACOL1007 SACOL1281 proS SACOL1281 proS SACOL1303 opp-2FDCB opp-2FDCB opp-2FDCB opp-2FDCB SACOL1439 SACOL1440 SACOL1441 SACOL1439 SACOL1440 SACOL1441 SACOL1456 SACOL1457 SACOL1456 SACOL1457 SACOL1484 SACOL1485 SACOL1486 SACOL1484 SACOL1485 SACOL1486 SACOL1484 SACOL1485 SACOL1486 SACOL1522 bfmBB bfmAB bfmAA lpdA bfmBB bfmAB bfmAA lpdA bfmBB bfmAB bfmAA lpdA bfmBB bfmAB bfmAA lpdA gcvPB gcvPA gcvT gcvPB gcvPA gcvT gcvPB gcvPA gcvT mtaB rsmE prmA dnaJ dnaK grpE hrcA mtaB rsmE prmA dnaJ dnaK grpE hrcA mtaB rsmE prmA dnaJ dnaK grpE hrcA aapA traP SACOL1928 SACOL1929 SACOL1930 SACOL1931 SACOL1928 SACOL1929 SACOL1930 SACOL1931 SACOL1928 SACOL1929 SACOL1930 SACOL1931 SACOL1928 SACOL1929 SACOL1930 SACOL1931 SACOL2127 SACOL2192 SACOL2196 SACOL2242 SACOL2252 femX SACOL2252 femX SACOL2343 SACOL2344 SACOL2343 SACOL2344 SACOL2367 opuCD opuCC opuCB opuCA opuCD opuCC opuCB opuCA opuCD opuCC opuCB opuCA opuCD opuCC opuCB opuCA opuBA opuBB opuBA opuBB SACOL2518 SACOL2522 SACOL2527 SACOL2550 SACOL2551 SACOL2550 SACOL2551 SACOL2582 SACOL2645 SACOL2646 SACOL2647 SACOL2645 SACOL2646 SACOL2647 SACOL2645 SACOL2646 SACOL2647 secA sucC sucD sucC sucD xerC hslV hslU codY xerC hslV hslU codY xerC hslV hslU codY xerC hslV hslU codY walRKHI walRKHI walRKHI walRKHI zwf ureABCEFGD ureABCEFGD ureABCEFGD ureABCEFGD ureABCEFGD ureABCEFGD ureABCEFGD atl brnQ1 icaADBC icaADBC icaADBC icaADBC mgrA rot ugpQ maoC ugpQ maoC SACOL0077 SACOL0088 SACOL0093 phnE1 phnE2 phnC phnD phnE1 phnE2 phnC phnD phnE1 phnE2 phnC phnD phnE1 phnE2 phnC phnD SACOL0135 SACOL0152 SACOL0153 SACOL0152 SACOL0153 acpD malKEFD malKEFD malKEFD malKEFD SACOL0207 SACOL0208 SACOL0259 SACOL0264 SACOL0265 SACOL0266 SACOL0267 SACOL0264 SACOL0265 SACOL0266 SACOL0267 SACOL0264 SACOL0265 SACOL0266 SACOL0267 SACOL0264 SACOL0265 SACOL0266 SACOL0267 SACOL0270 SACOL0271 SACOL0272-0273-0274-0275 yukA SACOL0277-0278-0279-0280-0281 SACOL0272-0273-0274-0275 yukA SACOL0277-0278-0279-0280-0281 SACOL0283 SACOL0300 SACOL0352 SACOL0353 SACOL0354 SACOL0355 SACOL0356 dut SACOL0463 SACOL0507 SACOL0508 SACOL0603 SACOL0604 SACOL0603 SACOL0604 SACOL0606 SACOL0607 SACOL0606 SACOL0607 graXRS graXRS graXRS SACOL0725 sarX SACOL0755 SACOL0849 SACOL0850 SACOL0849 SACOL0850 SACOL0851 opp-4A opp-4D opp-4F opp-4B opp-4C opp-4A opp-4D opp-4F opp-4B opp-4C opp-4A opp-4D opp-4F opp-4B opp-4C opp-4A opp-4D opp-4F opp-4B opp-4C opp-4A opp-4D opp-4F opp-4B opp-4C SACOL1002
SACOL-numbers SACOL1006 SACOL1007 SACOL1281 SACOL1282 SACOL1303 SACOL1414 SACOL1415 SACOL1416 SACOL1417 SACOL1440 SACOL1441 SACOL1456 SACOL1457 SACOL1484 SACOL1485 SACOL1486 SACOL1522 SACOL1560 SACOL1561 SACOL1562 SACOL1563 SACOL1593 SACOL1594 SACOL1595 SACOL1633 SACOL1634 SACOL1635 SACOL1743 SACOL1891 SACOL1928 SACOL1929 SACOL1930 SACOL1931 SACOL2127 SACOL2192 SACOL2196 SACOL2242 SACOL2252 SACOL2253 SACOL2343 SACOL2344 SACOL2367 SACOL2450 SACOL2451 SACOL2452 SACOL2453 SACOL0781 SACOL0783 SACOL2518 SACOL2522 SACOL2527 SACOL2550 SACOL2551 SACOL2582 SACOL2645 SACOL2646 SACOL2647 SACOL0816 SACOL1262 SACOL1263 SACOL1269 SACOL1270 SACOL1271 SACOL1272 SACOL0019 SACOL0020 SACOL0021 SACOL0022 SACOL1549 SACOL2280 SACOL2281 SACOL2282 SACOL2283 SACOL2284 SACOL2285 SACOL2286 SACOL1062 SACOL0171 SACOL2689 SACOL2690 SACOL2691 SACOL2692 SACOL0746 SACOL1812 SACOL0031 SACOL0032 SACOL0077 SACOL0088 SACOL0093 SACOL0125 SACOL0126 SACOL0127 SACOL0128 SACOL0135 SACOL0152 SACOL0153 SACOL0190 SACOL0192 SACOL0193 SACOL0194 SACOL0195 SACOL0207 SACOL0208 SACOL0259 SACOL0264 SACOL0265 SACOL0266 SACOL0267 SACOL0270 SACOL0271 SACOL0275 SACOL0281 SACOL0283 SACOL0300 SACOL0357 SACOL0463 SACOL0507 SACOL0508 SACOL0603 SACOL0604 SACOL0606 SACOL0607 SACOL0715 SACOL0716 SACOL0717 SACOL0726 SACOL0755 SACOL0849 SACOL0850 SACOL0851 SACOL0996 SACOL0997 SACOL0998 SACOL0999 SACOL1000 SACOL1002
USA300-numbers USA300HOU_0959 USA300HOU_0960 USA300HOU_1194 USA300HOU_1195 USA300HOU_1216 USA300HOU_1313 USA300HOU_1314 USA300HOU_1315 USA300HOU_1316 USA300HOU_1338 USA300HOU_1339 USA300HOU_1358 USA300HOU_1359 USA300HOU_1383 USA300HOU_1384 USA300HOU_1385 USA300HOU_1419 USA300HOU_1517 USA300HOU_1518 USA300HOU_1519 USA300HOU_1520 USA300HOU_1536 USA300HOU_1537 USA300HOU_1538 USA300HOU_1577 USA300HOU_1578 USA300HOU_1579 USA300HOU_1683 USA300HOU_1827 USA300HOU_1865 USA300HOU_1866 USA300HOU_1867 USA300HOU_1868 USA300HOU_2124 USA300HOU_2193 USA300HOU_2199 USA300HOU_2234 USA300HOU_2243 USA300HOU_2244 USA300HOU_2329 USA300HOU_2330 USA300HOU_2353 USA300HOU_2434 USA300HOU_2435 USA300HOU_2436 USA300HOU_2437 USA300HOU_0745 USA300HOU_0746 USA300HOU_2496 USA300HOU_2500 USA300HOU_2505 USA300HOU_2526 USA300HOU_2527 USA300HOU_2562 USA300HOU_2623 USA300HOU_2624 USA300HOU_2625 USA300HOU_0780 USA300HOU_1176 USA300HOU_1177 USA300HOU_1183 USA300HOU_1184 USA300HOU_1185 USA300HOU_1186 USA300HOU_0018 USA300HOU_0019 USA300HOU_0020 USA300HOU_0021 USA300HOU_1507 USA300HOU_2269 USA300HOU_2270 USA300HOU_2271 USA300HOU_2272 USA300HOU_2273 USA300HOU_2274 USA300HOU_2275 USA300HOU_0997 USA300HOU_0199 USA300HOU_2666 USA300HOU_2667 USA300HOU_2668 USA300HOU_2669 USA300HOU_0709 USA300HOU_1753 USA300HOU_0029 USA300HOU_0030 USA300HOU_0107 USA300HOU_0116 USA300HOU_0121 USA300HOU_0152 USA300HOU_0153 USA300HOU_0154 USA300HOU_0155 USA300HOU_0162 USA300HOU_0179 USA300HOU_0180 USA300HOU_0218 USA300HOU_0220 USA300HOU_0221 USA300HOU_0222 USA300HOU_0223 USA300HOU_0236 USA300HOU_0237 USA300HOU_0285 USA300HOU_0290 USA300HOU_0291 USA300HOU_0292 USA300HOU_0293 USA300HOU_0296 USA300HOU_0297 USA300HOU_0301 USA300HOU_0307 USA300HOU_0309 USA300HOU_0323 USA300HOU_1980 USA300HOU_0416 USA300HOU_0465 USA300HOU_0466 USA300HOU_0550 USA300HOU_0551 USA300HOU_0553 USA300HOU_0554 USA300HOU_0679 USA300HOU_0680 USA300HOU_0681 USA300HOU_0689 USA300HOU_0719 USA300HOU_0813 USA300HOU_0814 USA300HOU_0815 USA300HOU_0949 USA300HOU_0950 USA300HOU_0951 USA300HOU_0952 USA300HOU_0953 USA300HOU_0955
Gene symbol USA300HOU_0959 USA300HOU_0960 USA300HOU_1194 proS cinA opp-2F opp-2D opp-2C opp-2B USA300HOU_1338 USA300HOU_1339 USA300HOU_1358 crr gpsB USA300HOU_1384 USA300HOU_1385 ebpS bfmBB bfmBAB bfmBAA lpdA gcvPB gcvPA gcvT mtaB rsmE prmA aapA traP USA300HOU_1865 USA300HOU_1866 USA300HOU_1867 recX USA300HOU_2124 USA300HOU_2193 USA300HOU_2199 pbuG USA300HOU_2243 femX USA300HOU_2329 USA300HOU_2330 USA300HOU_2353 opuCD opuCC opuCB opuCA opuBA opuBB relP USA300HOU_2500 fbp trxA_6 USA300HOU_2527 USA300HOU_2562 nsaS nsaR USA300HOU_2625 secA sucC sucD xerC hslV hslU codY walR walK walH walI zwf ureA ureB ureC ureE ureF ureG ureD atl brnQ1 icaA icaD icaB icaC mgrA rot ugpQ maoC USA300HOU_0107 nptA lctP phnE1 phnE2 phnC phnD adhE isdI USA300HOU_0180 acpD malK malE malF malD glpQ1 SCIN_2 USA300HOU_0285 USA300HOU_0290 USA300HOU_0291 USA300HOU_0292 USA300HOU_0293 USA300HOU_0296 esxA essB USA300HOU_0307 USA300HOU_0309 USA300HOU_0323 dut USA300HOU_0416 sle1 USA300HOU_0466 dck dgk USA300HOU_0553 azo1 graX graR graS sarX USA300HOU_0719 USA300HOU_0813 USA300HOU_0814 USA300HOU_0815 opp-4A opp-4D opp-4F opp-4B opp-4C spxA
log2-fold change NaOCl 1,26 0,98 0,03 0,38 0,58 0,37 -0,05 -0,35 -0,16 1,12 1,21 1,37 1,23 1,48 1,50 1,08 0,34 -0,69 -1,26 -1,42 -1,24 -0,38 -0,18 -0,08 0,03 -0,16 0,77 -0,76 -0,16 -0,54 -0,57 -0,13 -0,10 0,64 0,70 -0,16 0,82 0,03 0,43 0,43 0,42 0,42 1,17 0,83 0,69 0,92 1,17 1,24 -0,18 0,13 -0,49 1,76 1,59 -0,47 0,20 0,41 0,44 0,38 0,89 0,95 -0,74 -0,49 -0,08 0,15 0,02 0,22 0,17 0,69 1,51 -0,24 -0,48 0,26 0,35 0,45 0,53 0,49 0,23 0,07 -0,38 -0,42 -0,31 -0,73 0,69 0,32 1,31 0,22 -0,84 1,20 -0,71 -0,12 0,33 0,10 -0,19 -0,74 0,74 0,26 3,12 -0,26 -1,12 -1,37 -0,54 -1,33 4,28 0,05 -1,13 -1,73 -1,02 -0,33 -1,23 -0,17 -0,98 -0,81 -0,63 0,70 -1,02 -0,91 0,76 0,48 0,08 -0,56 -1,14 -0,47 -0,09 -0,02 -0,13 -1,34 -0,30 -0,16 -0,26 -0,34 -0,01 -0,64 -0,68 -0,52 -0,11 0,01
Function possible dithiol-disulfide isomerase globin M50 family peptidase proline--tRNA ligase competence-damage inducible protein CinA oligopeptide ABC transporter, ATP-binding protein oligopeptide ABC transporter, ATP-binding protein oligopeptide ABC transporter, membrane protein oligopeptide ABC transporter, membrane protein hypothetical protein tellurite resistance protein hypothetical protein PTS family glucose/glucoside (glc) porter component IIA hypothetical protein hypothetical protein hypothetical protein elastin-binding protein dihydrolipoyllysine-residue acetyltransferase 2-oxoisovalerate dehydrogenase (acylating) beta subunit pyruvate dehydrogenase (acetyl-transferring) alpha subunit dihydrolipoyl dehydrogenase glycine dehydrogenase (decarboxylating) subunit 2 glycine dehydrogenase (decarboxylating) subunit 1 aminomethyltransferase possible 2-methylthioadenine synthase hypothetical protein ribosomal protein L11 methyltransferase APC family amino acid-polyamine-organocation transporter RNAIII-activating protein TRAP teichoic acid ABC transporter, membrane protein teichoic acid ABC transporter, ATP-binding protein hypothetical protein hypothetical protein hypothetical membrane protein possible aldo/keto reductase possible HAD superfamily hydrolase NCS2 family nucleobase:cation symporter-2 RND resistance-nodulation-cell division acriflavin:proton (H+) antiporter peptidoglycan pentaglycine interpeptide biosynthesis protein FmhB hypothetical protein hypothetical protein possible zinc (Zn2+) dependent dehydrogenase glycine betaine/L-proline ABC transporter, membrane protein glycine betaine/L-proline ABC transporter, binding protein glycine betaine/choline ABC transporter, membrane protein glycine betaine/choline ABC transporter, ATP-binding protein glycine/betaine/carnitine/choline ABC transporter, ATP-binding protein glycine betaine/carnitine/choline ABC transporter, membrane protein hypothetical protein alkaline phosphatase fructose-bisphosphatase possible thioredoxin possible thioesterase possible acetyltransferase sensor histidine kinase response regulator hypothetical protein Sec Type I general secretory pathway preprotein translocase subunit SecA succinate--CoA ligase (ADP-forming) beta subunit succinate--CoA ligase (ADP-forming) alpha subunit tyrosine recombinase XerC T01 family HslV component of HsIUV peptidase T01 family HslU component of HsIUV peptidase CodY family transcriptional regulator response regulator VicR sensor histidine kinase VicK hypothetical protein YycH hypothetical protein YycI glucose-6-phosphate 1-dehydrogenase urease gamma subunit urease beta subunit urease alpha subunit urease accessory protein UreE urease accessory protein UreF urease accessory protein UreG urease accessory protein UreD MurNAc-L-alanine amidase/mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase possible LIVCS family branched chain amino acid:cation symporter intercellular adhesion protein A intercellular adhesion protein D intercellular adhesion protein B intercellular adhesion protein C possible MarR family transcriptional regulator repressor of toxins Rot glycerophosphodiester phosphodiesterase possible acyl dehydratase MaoC hypothetical membrane protein possible PnaS family phosphate:sodium (Na+) symporter LctP family L-lactate permease phosphonate ABC transporter, permease phosphonate ABC transporter, permease phosphonate ABC transporter, ATP-binding protein phosphonate ABC transporter, phosphonate-binding protein alcohol dehydrogenase heme-degrading enzyme IsdG hypothetical membrane protein azoreductase maltose ABC transporter ATP-binding protein maltose ABC transporter, binding protein maltose ABC transporter, permease maltose ABC transporter, permease possible glycerophosphodiester phosphodiesterase hypothetical protein hypothetical protein ABC transporter, ATP-binding protein hypothetical protein hypothetical membrane protein hypothetical protein hypothetical protein ESAT-6 family virulence protein virulence protein EssB hypothetical protein hypothetical membrane protein hypothetical membrane protein deoxyuridine 5'-triphosphate nucleotidohydrolase hypothetical protein possible LysM family autolysin hypothetical protein deoxynucleoside kinase deoxynucleoside kinase hydrolase hypothetical protein hypothetical protein response regulator sensor histidine kinase possible staphylococcal accessory protein X hypothetical protein hypothetical protein hypothetical protein hypothetical lipoprotein oligopeptide ABC transporter, oligopeptide-binding protein oligopeptide ABC transporter, ATP-binding protein oligopeptide ABC transporter, ATP-binding protein oligopeptide ABC transporter, permease oligopeptide ABC transporter, permease transcriptional regulator Spx
Regulon GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS GraRS MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA
Operon SACOL1225 SACOL1333 SACOL1902 SACOL1903 SACOL1902 SACOL1903 hssRS SACOL2360 SACOL2361 hssRS SACOL2360 SACOL2361 hssRS SACOL2360 SACOL2361 hssRS SACOL2360 SACOL2361 SACOL2363 SACOL2406 SACOL2407 SACOL2408 SACOL2406 SACOL2407 SACOL2408 SACOL2406 SACOL2407 SACOL2408 SACOL2430 SACOL2431 SACOL2430 SACOL2431 SACOL2477 SACOL2478 SACOL2479 SACOL2477 SACOL2478 SACOL2479 SACOL2477 SACOL2478 SACOL2479 SACOL2557 SACOL2566 SACOL2706 SACOL2707 SACOL2708 SACOL2709 SACOL2710 SACOL2707 SACOL2708 SACOL2709 SACOL2710 SACOL2707 SACOL2708 SACOL2709 SACOL2710 SACOL2707 SACOL2708 SACOL2709 SACOL2710 sarZ abcA cap1C cap1B cap1A cap1C cap1B cap1A cap1C cap1B cap1A clfA gpxA2 hemLBDCXA hemLBDCXA hemLBDCXA hemLBDCXA hemLBDCXA hemLBDCXA isaB lacGEFDCBA SACOL2187 lacGEFDCBA SACOL2187 lacGEFDCBA SACOL2187 lacGEFDCBA SACOL2187 lacGEFDCBA SACOL2187 lacGEFDCBA SACOL2187 lacGEFDCBA SACOL2187 metEFCI metEFCI metEFCI metEFCI moaA mobA moaD moaE mobB moeA moaA mobA moaD moaE mobB moeA moaA mobA moaD moaE mobB moeA moaA mobA moaD moaE mobB moeA moaA mobA moaD moaE mobB moeA moaA mobA moaD moaE mobB moeA moaB moeB modC modB modA moaB moeB modC modB modA moaB moeB modC modB modA moaB moeB modC modB modA moaB moeB modC modB modA mraY murD divIB mraY murD divIB mraY murD divIB norA SACOL0113 SACOL0114 SACOL0113 SACOL0114 SACOL0115 SACOL0116 SACOL0117 SACOL0115 SACOL0116 SACOL0117 SACOL0115 SACOL0116 SACOL0117 SACOL0200 SACOL0217 SACOL0223 SACOL0224 SACOL0225 SACOL0526 SACOL0527 SACOL0528 SACOL0526 SACOL0527 SACOL0528 SACOL0526 SACOL0527 SACOL0528 SACOL0529 SACOL0530 SACOL0531 SACOL0529 SACOL0530 SACOL0531 SACOL0529 SACOL0530 SACOL0531 SACOL0664 SACOL0820 SACOL0990 oppB oppC oppD oppF oppA SACOL0990 oppB oppC oppD oppF oppA SACOL0990 oppB oppC oppD oppF oppA SACOL0990 oppB oppC oppD oppF oppA SACOL0990 oppB oppC oppD oppF oppA menF menD menH menB menF menD menH menB menF menD menH menB menF menD menH menB SACOL1174 SACOL1175 SACOL1174 SACOL1175 dprA topA dprA topA SACOL1326 SACOL1327 SACOL1326 SACOL1327 SACOL1345 SACOL1346 SACOL1347 SACOL1348 SACOL1346 SACOL1347 SACOL1348 SACOL1346 SACOL1347 SACOL1348 SACOL1349 comGD comGC comGB comGA comGD comGC comGB comGA comGD comGC comGB comGA comGD comGC comGB comGA SACOL1659 lamB accC accB ahs2 SACOL1664 SACOL1659 lamB accC accB ahs2 SACOL1664 SACOL1659 lamB accC accB ahs2 SACOL1664 SACOL1659 lamB accC accB ahs2 SACOL1664 SACOL1659 lamB accC accB ahs2 SACOL1664 SACOL1678 SACOL1738 SACOL1806 SACOL1847 SACOL2065 kdpC kdpB kdpA kdpF SACOL2065 kdpC kdpB kdpA kdpF SACOL2065 kdpC kdpB kdpA kdpF SACOL2065 kdpC kdpB kdpA kdpF SACOL2279 SACOL2288 sarY SACOL2290 SACOL2288 sarY SACOL2290 SACOL2288 sarY SACOL2290 SACOL2458 SACOL2535 SACOL2543 sdaAA sdaAB SACOL2546 SACOL2601 SACOL2602 SACOL2603 SACOL2601 SACOL2602 SACOL2603 SACOL2601 SACOL2602 SACOL2603 SACOL2609 SACOL2675 SACOL2676 SACOL2678 SACOL2705 emp gltB gltD gltB gltD
SACOL-numbers SACOL1225 SACOL1333 SACOL1902 SACOL1903 SACOL2358 SACOL2359 SACOL2360 SACOL2361 SACOL2363 SACOL2406 SACOL2407 SACOL2408 SACOL2430 SACOL2431 SACOL2477 SACOL2478 SACOL2479 SACOL2557 SACOL2566 SACOL2706 SACOL2707 SACOL2708 SACOL2709 SACOL2710 SACOL2384 SACOL0700 SACOL2685 SACOL2686 SACOL2687 SACOL0856 SACOL2641 SACOL1714 SACOL1715 SACOL1716 SACOL1717 SACOL1718 SACOL1719 SACOL2660 SACOL2180 SACOL2181 SACOL2182 SACOL2183 SACOL2184 SACOL2185 SACOL2186 SACOL0428 SACOL0429 SACOL0430 SACOL0431 SACOL2261 SACOL2262 SACOL2263 SACOL2264 SACOL2265 SACOL2266 SACOL2268 SACOL2269 SACOL2270 SACOL2271 SACOL2272 SACOL1195 SACOL1196 SACOL1197 SACOL0754 SACOL0113 SACOL0114 SACOL0115 SACOL0116 SACOL0117 SACOL0200 SACOL0217 SACOL0224 SACOL0225 SACOL0526 SACOL0527 SACOL0528 SACOL0529 SACOL0530 SACOL0531 SACOL0664 SACOL0820 SACOL0991 SACOL0992 SACOL0993 SACOL0994 SACOL0995 SACOL1051 SACOL1052 SACOL1053 SACOL1054 SACOL1174 SACOL1175 SACOL1266 SACOL1267 SACOL1326 SACOL1327 SACOL1345 SACOL1346 SACOL1347 SACOL1348 SACOL1349 SACOL1598 SACOL1599 SACOL1600 SACOL1601 SACOL1660 SACOL1661 SACOL1662 SACOL1663 SACOL1664 SACOL1678 SACOL1738 SACOL1806 SACOL1847 SACOL2066 SACOL2067 SACOL2068 SACOL2069 SACOL2279 SACOL2288 SACOL2289 SACOL2290 SACOL2458 SACOL2535 SACOL2543 SACOL2601 SACOL2602 SACOL2603 SACOL2609 SACOL2675 SACOL2676 SACOL2678 SACOL2705 SACOL0858 SACOL0514 SACOL0515
USA300-numbers USA300HOU_1151 USA300HOU_1243 USA300HOU_1838 USA300HOU_1839 USA300HOU_2344 USA300HOU_2345 USA300HOU_2346 USA300HOU_2347 USA300HOU_2349 USA300HOU_2389 USA300HOU_2390 USA300HOU_2391 USA300HOU_2412 USA300HOU_2413 USA300HOU_2459 USA300HOU_2460 USA300HOU_2461 USA300HOU_2536 USA300HOU_2546 USA300HOU_2684 USA300HOU_2685 USA300HOU_2686 USA300HOU_2687 USA300HOU_2688 USA300HOU_2368 USA300HOU_0663 USA300HOU_2662 USA300HOU_2663 USA300HOU_2664 USA300HOU_0819 USA300HOU_2619 USA300HOU_1659 USA300HOU_1660 USA300HOU_1661 USA300HOU_1662 USA300HOU_1663 USA300HOU_1664 USA300HOU_2638 USA300HOU_2182 USA300HOU_2183 USA300HOU_2184 USA300HOU_2185 USA300HOU_2186 USA300HOU_2187 USA300HOU_2188 USA300HOU_0377 USA300HOU_0378 USA300HOU_0379 USA300HOU_0380 USA300HOU_2250 USA300HOU_2251 USA300HOU_2252 USA300HOU_2253 USA300HOU_2254 USA300HOU_2255 USA300HOU_2257 USA300HOU_2258 USA300HOU_2259 USA300HOU_2260 USA300HOU_2261 USA300HOU_1122 USA300HOU_1123 USA300HOU_1124 USA300HOU_0718 USA300HOU_0140 USA300HOU_0141 USA300HOU_0142 USA300HOU_0143 USA300HOU_0144 USA300HOU_0229 USA300HOU_0246 USA300HOU_0252 USA300HOU_0253 USA300HOU_0483 USA300HOU_0484 USA300HOU_0485 USA300HOU_0487 USA300HOU_0488 USA300HOU_0489 USA300HOU_0614 USA300HOU_0783 USA300HOU_0944 USA300HOU_0945 USA300HOU_0946 USA300HOU_0947 USA300HOU_0948 USA300HOU_0990 USA300HOU_0991 USA300HOU_0992 USA300HOU_0993 USA300HOU_1100 USA300HOU_1101 USA300HOU_1180 USA300HOU_1181 USA300HOU_1237 USA300HOU_1238 USA300HOU_1255 USA300HOU_1256 USA300HOU_1257 USA300HOU_1258 USA300HOU_1260 USA300HOU_1543 USA300HOU_1544 USA300HOU_1545 USA300HOU_1546 USA300HOU_1605 USA300HOU_1606 USA300HOU_1607 USA300HOU_1608 USA300HOU_1609 USA300HOU_1623 USA300HOU_1678 USA300HOU_1747 USA300HOU_1787 USA300HOU_2070 USA300HOU_2071 USA300HOU_2072 USA300HOU_2073 USA300HOU_2268 USA300HOU_2277 USA300HOU_2278 USA300HOU_2279 USA300HOU_2440 USA300HOU_2513 USA300HOU_2520 USA300HOU_2579 USA300HOU_2580 USA300HOU_2581 USA300HOU_2587 USA300HOU_2653 USA300HOU_2654 USA300HOU_2655 USA300HOU_2683 USA300HOU_0821 USA300HOU_0472 USA300HOU_0473
Gene symbol USA300HOU_1151 USA300HOU_1243 USA300HOU_1838 USA300HOU_1839 hssR hssS USA300HOU_2346 USA300HOU_2347 lctP_2 USA300HOU_2389 dsbA USA300HOU_2391 USA300HOU_2412 msbA3 USA300HOU_2459 USA300HOU_2460 dapF amiD2 mmpL USA300HOU_2684 USA300HOU_2685 USA300HOU_2686 USA300HOU_2687 USA300HOU_2688 sarZ abcA cap1C cap1B cap1A clfA gpxA2 hemL hemB hemD hemC hemX hemA isaB lacG lacE lacF lacD lacC lacB lacA metE metF metC metI moaA mobA moaD moaE mobB moeA moaB moeB modC modB modA mraY murD divIB norA galE cap5M2 cap8H USA300HOU_0143 USA300HOU_0144 uhpT USA300HOU_0246 glcC USA300HOU_0253 holB USA300HOU_0484 yabA USA300HOU_0487 USA300HOU_0488 rsmI USA300HOU_0614 USA300HOU_0783 oppB oppC oppD oppF oppA menF menD menH menB USA300HOU_1100 USA300HOU_1101 dprA topA hflX USA300HOU_1238 USA300HOU_1255 USA300HOU_1256 USA300HOU_1257 USA300HOU_1258 USA300HOU_1260 comGD comGC comGB comGA lamB accC accB ahs2 USA300HOU_1609 USA300HOU_1623 USA300HOU_1678 sasC USA300HOU_1787 kdpC kdpB kdpA kdpF USA300HOU_2268 USA300HOU_2277 sarY USA300HOU_2279 USA300HOU_2440 ddh USA300HOU_2520 USA300HOU_2579 USA300HOU_2580 USA300HOU_2581 USA300HOU_2587 secY2 sasA USA300HOU_2655 USA300HOU_2683 emp gltB gltD
log2-fold change NaOCl -0,35 -0,38 0,77 0,89 -0,39 -0,21 -0,70 -0,16 -0,75 0,00 0,10 -0,18 -0,49 -0,59 1,06 1,42 1,84 0,95 0,12 -0,40 -0,05 -0,07 0,09 0,14 0,38 0,16 -1,37 -1,61 -1,14 1,06 -0,65 1,00 0,32 -0,36 -0,21 0,54 0,65 -0,13 -0,06 -0,07 0,17 -0,47 -0,87 -0,93 -0,93 -0,76 -1,38 -0,88 -0,59 0,34 0,49 0,48 0,29 0,26 0,40 0,05 -0,16 0,01 -0,06 0,06 -1,61 -0,30 0,47 -0,37 -0,49 -0,55 -0,78 -0,89 -0,44 -0,39 0,45 -0,31 0,04 -1,43 -1,97 -1,88 -2,02 -1,94 -1,63 -2,05 -0,20 -0,43 -1,18 -1,35 -1,21 -0,59 0,39 0,52 0,45 0,79 0,27 0,49 -0,02 0,28 -0,76 -0,11 -0,48 -0,04 -0,24 -0,50 -0,18 -1,48 -1,90 -1,74 -1,24 -0,34 -0,71 -0,25 -0,31 -0,12 2,49 -0,81 -0,25 0,71 0,04 -0,40 -1,07 -1,58 -0,24 0,23 -0,84 -1,91 1,06 -0,11 -0,58 -0,28 -0,49 -0,77 0,52 0,35 0,89 0,60 -0,80 2,85 -1,25 -0,67
Function hypothetical lipoprotein hypothetical protein hypothetical protein hypothetical protein hemin DNA-binding response regulator hemin sensor histidine kinase hypothetical protein hypothetical membrane protein LctP family L-lactate permease hypothetical protein possible lipoprotein possible lipoprotein ABC transporter, ATP-binding protein ABC transporter, ATP-binding protein hypothetical protein hypothetical protein hypothetical protein possible secretory antigen MmpL efflux pump hypothetical protein cobalt (Co2+) ABC transporter, membrane protein ABC transporter, membrane protein hypothetical protein hypothetical protein MarR/SarA family transcriptional regulator ABC transporter, ATP-binding protein/permease capsular polysaccharide biosynthesis protein CapC capsular polysaccharide biosynthesis protein CapB capsular polysaccharide biosynthesis protein CapA fibrinogen-binding protein glutathione peroxidase glutamate-1-semialdehyde 2,1-aminomutase porphobilinogen synthase uroporphyrinogen-III synthase hydroxymethylbilane synthase possible cytochrome c assembly protein glutamyl-tRNA reductase immunodominant antigen B 6-phospho-beta-galactosidase PTS lactose-N,N-diacetylchitobiose-beta-glucoside (lac) porter component IIBC PTS lactose-N,N-diacetylchitobiose-beta-glucoside (lac) porter component IIA tagatose-bisphosphate aldolase tagatose-6-phosphate kinase galactose-6-phosphate isomerase LacB subunit galactose-6-phosphate isomerase LacA subunit 5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase methylenetetrahydrofolate reductase/homocysteine S-methyltransferase bifunctional cystathionine gamma-lyase/gamma-synthase bifunctional cystathionine gamma-lyase/gamma-synthase molybdenum (Mo2+) cofactor biosynthesis protein A molybdenum (Mo2+) cofactor biosynthesis protein A molybdopterin synthase small subunit molybdopterin synthase large subunit molybdopterin-guanine dinucleotide biosynthesis protein B molybdopterin biosynthesis protein MoeA molybdopterin cofactor biosynthesis protein MoaB molybdopterin biosynthesis protein MoeB molybdenum (Mo2+) ABC transporter, ATP-binding protein molybdenum (Mo2+) ABC transporter, membrane protein molybdenum (Mo2+) ABC transporter, binding protein phospho-N-acetylmuramoyl-pentapeptide- transferase UDP-N-acetylmuramoylalanine--D-glutamate ligase cell division protein FtsQ MFS family major facilitator transporter UDP-glucose 4-epimerase capsular polysaccharide biosynthesis protein glycosyltransferase polysaccharide extrusion protein polysaccharide biosynthesis protein MFS family major facilitator transporter, hexose phosphate:cation symporter ABC transporter, binding protein PTS system, IIBC components purine nucleosidase DNA-directed DNA polymerase III delta' subunit hypothetical protein DNA replication intiation control protein YabA hypothetical protein hypothetical protein tetrapyrrole methylase deoxyribonuclease (pyrimidine dimer) possible LysM family autolysin oligopeptide ABC transporter, membrane protein oligopeptide ABC transporter, membrane protein oligopeptide ABC transporter, ATP-binding protein oligopeptide ABC transporter, ATP-binding protein oligopeptide ABC transporter, binding protein isochorismate synthase 2-oxoglutarate decarboxylase S33 family peptidase naphthoate synthase hypothetical protein hypothetical protein DNA processing protein DprA DNA topoisomerase A GTP-binding protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein competence protein ComGD competence protein ComGC competence protein ComGB competence protein ComGA possible lactam utilization protein biotin carboxylase acetyl-CoA carboxylase biotin carboxyl carrier subunit Allophanate hydrolase subunit 2 allophanate hydrolase subunit 1 dehydrogenase hypothetical membrane protein cell surface anchored protein hypothetical protein K+-transporting ATPase, C subunit K+-transporting ATPase, B subunit K+-transporting ATPase, A subunit K+-transporting ATPase, F subunit UT family urea transporter hypothetical protein staphylococcal accessory regulator Y AraC family transcriptional regulator amino acid permease D-lactate dehydrogenase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein Sec family Type I general secretory pathway protein SecY LPXTG cell wall surface anchor family protein hypothetical protein hypothetical protein secretory extracellular matrix and plasma binding protein glutamate synthase (NADPH), large subunit glutamate synthase (NADPH) small subunit
Regulon MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA MgrA NrdR NrdR NrdR NrdR NrdR PdxR PdxR PurR PurR PurR PurR PurR PurR PurR PurR PurR PurR PurR PurR PurR PyrR PyrR PyrR PyrR PyrR PyrR PyrR PyrR ArcR ArcR ArcR ArcR ArgR ArgR ArgR ArgR ArgR ArgR ArgR ArgR ArgR ArgR ArgR ArgR ScrR ScrR ScrR SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB
Operon lytS lytR lytS lytR pyrG SACOL0185 SACOL0186 SACOL0187 ggt SACOL0185 SACOL0186 SACOL0187 ggt SACOL0185 SACOL0186 SACOL0187 ggt SACOL0185 SACOL0186 SACOL0187 ggt SACOL0426 SACOL0472 SACOL0474 SACOL0611 SACOL0747 SACOL0748 SACOL0749 SACOL0748 SACOL0749 SACOL0809 SACOL0859 SACOL0871 SACOL0986 SACOL1009 relA1 SACOL1011 SACOL1012 mgtE SACOL1014 SACOL1009 relA1 SACOL1011 SACOL1012 mgtE SACOL1014 SACOL1009 relA1 SACOL1011 SACOL1012 mgtE SACOL1014 SACOL1009 relA1 SACOL1011 SACOL1012 mgtE SACOL1014 SACOL1009 relA1 SACOL1011 SACOL1012 mgtE SACOL1014 SACOL1009 relA1 SACOL1011 SACOL1012 mgtE SACOL1014 SACOL1018 SACOL1101 SACOL1121 SACOL1166 SACOL1475 SACOL1539 SACOL1777 ecsBA ecsBA ptpB SACOL2108 hemK prfA tdk ptpB SACOL2108 hemK prfA tdk ptpB SACOL2108 hemK prfA tdk SACOL2164 SACOL2310 SACOL2311 SACOL2423 SACOL2439 SACOL2525 SACOL2526 SACOL2525 SACOL2526 SACOL2561 SACOL2610 SACOL2620 SACOL2693 geh srtA tcaR ywpF nrdDG nrdDG nrdIEF nrdIEF nrdIEF pdxST pdxST folD purA purB purEKCSQLFMNHD purEKCSQLFMNHD purEKCSQLFMNHD purEKCSQLFMNHD purEKCSQLFMNHD purEKCSQLFMNHD purEKCSQLFMNHD purEKCSQLFMNHD purEKCSQLFMNHD purEKCSQLFMNHD uraA pyrB pyrC carA carB pyrF pyrE SACOL1218 uraA pyrB pyrC carA carB pyrF pyrE SACOL1218 uraA pyrB pyrC carA carB pyrF pyrE SACOL1218 uraA pyrB pyrC carA carB pyrF pyrE SACOL1218 uraA pyrB pyrC carA carB pyrF pyrE SACOL1218 uraA pyrB pyrC carA carB pyrF pyrE SACOL1218 uraA pyrB pyrC carA carB pyrF pyrE SACOL1218 uraA pyrB pyrC carA carB pyrF pyrE SACOL1218 arcCDBA arcCDBA arcCDBA arcCDBA argBJCD argBJCD argBJCD argBJCD argH argG argH argG argR-recN argR-recN artQM artQM cudT SACOL2653 scrA scrBK scrBK aur bioWFBAD bioWFBAD bioWFBAD bioWFBAD bioWFBAD nuc cap5ABCDEFGHIJKLMNOP cap5ABCDEFGHIJKLMNOP cap5ABCDEFGHIJKLMNOP cap5ABCDEFGHIJKLMNOP cap5ABCDEFGHIJKLMNOP cap5ABCDEFGHIJKLMNOP cap5ABCDEFGHIJKLMNOP cap5ABCDEFGHIJKLMNOP cap5ABCDEFGHIJKLMNOP cap5ABCDEFGHIJKLMNOP cap5ABCDEFGHIJKLMNOP cap5ABCDEFGHIJKLMNOP cap5ABCDEFGHIJKLMNOP cap5ABCDEFGHIJKLMNOP crtNMQIO crtNMQIO crtNMQIO crtNMQIO crtNMQIO epiGEFPDCBA epiGEFPDCBA epiGEFPDCBA epiGEFPDCBA epiGEFPDCBA epiGEFPDCBA epiGEFPDCBA epiGEFPDCBA fabZ murA1 SACOL2093 fabZ murA1 SACOL2093 fabZ murA1 SACOL2093 hutG mvaK1 mvaD mvaK2 mvaK1 mvaD mvaK3
SACOL-numbers SACOL0245 SACOL0246 SACOL2119 SACOL0185 SACOL0186 SACOL0187 SACOL0188 SACOL0426 SACOL0472 SACOL0474 SACOL0611 SACOL0747 SACOL0748 SACOL0749 SACOL0809 SACOL0859 SACOL0871 SACOL0986 SACOL1009 SACOL1010 SACOL1011 SACOL1012 SACOL1013 SACOL1014 SACOL1018 SACOL1101 SACOL1121 SACOL1166 SACOL1475 SACOL1539 SACOL1777 SACOL1892 SACOL1893 SACOL2109 SACOL2110 SACOL2111 SACOL2164 SACOL2310 SACOL2423 SACOL2439 SACOL2525 SACOL2526 SACOL2561 SACOL2610 SACOL2620 SACOL2694 SACOL2539 SACOL2353 SACOL2090 SACOL2634 SACOL2635 SACOL0791 SACOL0792 SACOL0793 SACOL0564 SACOL0565 SACOL1072 SACOL0018 SACOL1969 SACOL1073 SACOL1074 SACOL1075 SACOL1076 SACOL1077 SACOL1078 SACOL1079 SACOL1080 SACOL1082 SACOL1083 SACOL1211 SACOL1212 SACOL1213 SACOL1214 SACOL1215 SACOL1216 SACOL1217 SACOL1218 SACOL2654 SACOL2655 SACOL2656 SACOL2657 SACOL0167 SACOL0168 SACOL0169 SACOL0170 SACOL0963 SACOL0964 SACOL1564 SACOL1565 SACOL1915 SACOL1916 SACOL2632 SACOL2653 SACOL2376 SACOL2028 SACOL2029 SACOL2659 SACOL2424 SACOL2425 SACOL2426 SACOL2427 SACOL2428 SACOL0860 SACOL0136 SACOL0137 SACOL0138 SACOL0140 SACOL0141 SACOL0143 SACOL0144 SACOL0145 SACOL0146 SACOL0147 SACOL0148 SACOL0149 SACOL0150 SACOL0151 SACOL2576 SACOL2577 SACOL2578 SACOL2579 SACOL2580 SACOL1871 SACOL1872 SACOL1873 SACOL1874 SACOL1875 SACOL1876 SACOL1877 SACOL1878 SACOL2091 SACOL2092 SACOL2093 SACOL2327 SACOL0636 SACOL0637
USA300-numbers USA300HOU_0271 USA300HOU_0272 USA300HOU_2115 USA300HOU_0213 USA300HOU_0214 USA300HOU_0215 USA300HOU_0216 USA300HOU_0375 USA300HOU_0426 USA300HOU_0432 USA300HOU_0558 USA300HOU_0710 USA300HOU_0711 USA300HOU_0712 USA300HOU_0773 USA300HOU_0822 USA300HOU_0833 USA300HOU_0940 USA300HOU_0962 USA300HOU_0963 USA300HOU_0964 USA300HOU_0965 USA300HOU_0966 USA300HOU_0967 USA300HOU_0971 USA300HOU_1035 USA300HOU_1050 USA300HOU_1092 USA300HOU_1373 USA300HOU_1497 USA300HOU_1716 USA300HOU_1828 USA300HOU_1829 USA300HOU_2105 USA300HOU_2106 USA300HOU_2107 USA300HOU_2166 USA300HOU_2300 USA300HOU_2406 USA300HOU_2422 USA300HOU_2503 USA300HOU_2504 USA300HOU_2540 USA300HOU_2588 USA300HOU_2596 USA300HOU_2671 USA300HOU_2517 USA300HOU_2339 USA300HOU_2088 USA300HOU_2613 USA300HOU_2614 USA300HOU_0754 USA300HOU_0755 USA300HOU_0756 USA300HOU_0511 USA300HOU_0512 USA300HOU_1008 USA300HOU_0017 USA300HOU_1909 USA300HOU_1009 USA300HOU_1010 USA300HOU_1011 USA300HOU_1012 USA300HOU_1013 USA300HOU_1014 USA300HOU_1015 USA300HOU_1016 USA300HOU_1017 USA300HOU_1018 USA300HOU_1137 USA300HOU_1138 USA300HOU_1139 USA300HOU_1140 USA300HOU_1141 USA300HOU_1142 USA300HOU_1143 USA300HOU_1144 USA300HOU_2632 USA300HOU_2633 USA300HOU_2634 USA300HOU_2635 USA300HOU_0195 USA300HOU_0196 USA300HOU_0197 USA300HOU_0198 USA300HOU_0919 USA300HOU_0920 USA300HOU_1521 USA300HOU_1522 USA300HOU_1852 USA300HOU_1853 USA300HOU_2610 USA300HOU_2631 USA300HOU_2362 USA300HOU_2037 USA300HOU_2038 USA300HOU_2637 USA300HOU_2407 USA300HOU_2408 USA300HOU_2409 USA300HOU_2410 USA300HOU_2411 USA300HOU_0823 USA300HOU_0163 USA300HOU_0164 USA300HOU_0165 USA300HOU_0167 USA300HOU_0168 USA300HOU_0170 USA300HOU_0171 USA300HOU_0172 USA300HOU_0173 USA300HOU_0174 USA300HOU_0175 USA300HOU_0176 USA300HOU_0177 USA300HOU_0178 USA300HOU_2556 USA300HOU_2557 USA300HOU_2558 USA300HOU_2559 USA300HOU_2560 USA300HOU_1808 USA300HOU_1809 USA300HOU_1810 USA300HOU_1811 USA300HOU_1812 USA300HOU_1813 USA300HOU_1814 USA300HOU_1815 USA300HOU_2089 USA300HOU_2090 USA300HOU_2091 USA300HOU_2314 USA300HOU_0583 USA300HOU_0584
Gene symbol lytS lytR pyrG USA300HOU_0213 USA300HOU_0214 USA300HOU_0215 ggt USA300HOU_0375 ssl4 ssl10 USA300HOU_0558 USA300HOU_0710 USA300HOU_0711 USA300HOU_0712 USA300HOU_0773 USA300HOU_0822 USA300HOU_0833 USA300HOU_0940 USA300HOU_0962 relQ ppnK USA300HOU_0965 mgtE cpaA USA300HOU_0971 USA300HOU_1035 USA300HOU_1050 flr norB USA300HOU_1497 USA300HOU_1716 ecsB ecsA hemK prfA tdk USA300HOU_2166 USA300HOU_2300 USA300HOU_2406 USA300HOU_2422 USA300HOU_2503 USA300HOU_2504 mvaS USA300HOU_2588 gabT lip srtA tcaR ywpF nrdG nrdD nrdI nrdE nrdF pdxS pdxT folD purA purB purE purK purC purS purQ purL purF purM purH purD uraA pyrB pyrC carA carB pyrF pyrE USA300HOU_1144 arcC arcD arcB arcA argB argJ argC argD argH argG recN argR artQ artM cudT arcR scrA scrK scrB aur bioW bioF bioB bioA bioD nuc cap5A cap5B cap5C cap5E cap5F cap5H cap5I cap5J cap5K cap5L cap5M cap5N cap5O cap5P crtN crtM crtQ crtI crtO epiG epiE epiF epiP epiD epiC epiB epiA fabZ murA1 USA300HOU_2091 hutG mvaK1 mvaD
log2-fold change NaOCl 1,24 0,71 -0,36 -1,34 -1,64 -1,18 -0,56 0,30 3,18 2,26 -0,33 0,13 -0,84 -1,00 0,10 0,79 -0,55 0,24 0,45 0,48 0,55 0,23 -0,37 -0,15 -0,17 0,72 0,28 6,23 -0,15 0,66 0,06 -0,61 -0,45 0,90 0,71 0,38 2,84 -0,50 -0,09 1,47 -1,20 -1,08 0,81 -0,39 -0,32 -0,18 -0,11 3,02 -0,61 -0,34 -0,43 0,27 0,62 -0,10 1,62 1,74 0,22 0,69 -1,03 0,67 0,74 0,77 0,91 0,86 0,75 1,46 1,65 1,57 1,10 1,91 2,38 2,26 2,30 1,61 1,13 1,12 -0,43 0,85 1,01 1,42 1,77 0,37 0,00 0,10 0,61 4,89 4,62 -0,71 -0,29 3,63 3,94 0,28 1,10 0,13 -0,08 -0,18 -0,84 -0,21 -0,16 -0,47 -0,55 -1,21 2,39 -0,19 -0,21 -0,37 0,08 0,71 0,42 0,28 0,45 0,43 0,43 0,54 0,50 0,16 0,12 -0,29 -0,43 0,12 0,70 0,78 0,61 0,72 0,82 0,53 -0,35 -0,98 -0,54 0,00 0,45 0,34 0,44 0,36 0,22 0,50
Function sensor histidine kinase LytS response regulator LytR CTP synthase oligopeptide ABC transporter, membrane protein oligopeptide ABC transporter, membrane protein RGD domain lipoprotein T3 family gamma-glutamyltransferase acetyl-CoA C-acetyltransferase superantigen-like protein superantigen-like protein glycosyltransferase possible cobalamin (vitamin B12) biosynthesis protein possible aldo/keto reductase hypothetical membrane protein diguanylate cyclase GGDEF domain protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein GTP diphosphokinase inorganic polyphosphate/ATP-NAD kinase ribosomal large subunit pseudouridine synthase D MgtE family magnesium (Mg2+)/cobalt (Co2+) transporter-E CPA2 family monovalent cation:proton (H+) antiporter-2 AGCS family alanine or glycine:sodium (Na+) or proton (H+) symporter hypothetical protein hypothetical protein hypothetical protein MFS family major facilitator transporter hypothetical protein S1 family peptidase ABC transporter, permease ABC transporter, ATP-binding protein HemK family methyltransferase peptide chain release factor RF1 thymidine kinase hypothetical membrane protein hypothetical membrane protein hypothetical membrane protein hypothetical protein ABC transporter, ATP-binding protein ABC transporter, membrane protein hydroxymethylglutaryl-CoA synthase TetR transcriptional regulator 4-aminobutyrate transaminase triacylglycerol lipase sortase transcriptional regulator TcaR hypothetical protein anaerobic ribonucleotide reductase small subunit anaerobic ribonucleotide reductase large subunit ribonucleotide-diphosphate reductase subunit gamma ribonuceloside diphosphate reductase subunit alpha ribonucleoside-diphosphate reductase subunit beta possible pyridoxine (vitamin B6) biosynthesis protein GMP synthase (glutamine-hydrolyzing) methylene-THF dehydrogenase (NADP(+))/methenyltetrahydrofolate cyclohydrolase adenylosuccinate synthase adenylosuccinate lyase 5-(carboxyamino)imidazole ribonucleotide mutase 5-(carboxyamino)imidazole ribonucleotide synthase phosphoribosylaminoimidazolesuccinocarboxamide synthase phosphoribosylformylglycinamidine synthase phosphoribosylformylglycinamidine synthase subunit I phosphoribosylformylglycinamidine synthase subunit II amidophosphoribosyltransferase phosphoribosylformylglycinamidine cyclo-ligase phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase phosphoribosylamine--glycine ligase NCS family uracil:cation symporter aspartate carbamoyltransferase dihydroorotase carbamoyl-phosphate synthase (glutamine-hydrolyzing), small subunit carbamoyl-phosphate synthase (glutamine-hydrolyzing), large subunit orotidine-5'-phosphate decarboxylase orotate phosphoribosyltransferase hypothetical protein carbamate kinase APC family amino acid-polyamine-organocation transporter ornithine carbamoyltransferase arginine deiminase acetylglutamate kinase glutamate N-acetyltransferase N-acetyl-gamma-glutamyl-phosphate reductase ornithine--oxo-acid transaminase argininosuccinate lyase argininosuccinate synthase DNA repair protein RecN arginine repressor glutamate ABC transporter, ATP-binding protein amino acid ABC transporter, membrane protein BCCT family betaine/carnitine/choline transporter Crp/FNR family transcriptional regulator PTS family sucrose porter component IIBC fructokinase beta-fructofuranosidase zinc metalloproteinase aureolysin 6-carboxyhexanoate--CoA ligase 8-amino-7-oxononanoate synthase biotin synthase adenosylmethionine--8-amino-7-oxononanoate transaminase dethiobiotin synthase thermonuclease precursor capsular polysaccharide biosynthesis protein Cap5A capsular polysaccharide biosynthesis protein Cap5B capsular polysaccharide biosynthesis protein Cap5C capsular polysaccharide biosynthesis protein Cap5E capsular polysaccharide biosynthesis protein Cap5F capsular polysaccharide biosynthesis protein Cap5H capsular polysaccharide biosynthesis protein Cap5I capsular polysaccharide biosynthesis protein Cap5J capsular polysaccharide synthesis protein Cap5K capsular polysaccharide biosynthesis protein Cap5L capsular polysaccharide biosynthesis protein Cap5M capsular polysaccharide biosynthesis protein Cap5N capsular polysaccharide biosynthesis protein Cap5O capsular polysaccharide biosynthesis protein Cap5P squalene synthase squalene desaturase glycosyltransferase phytoene dehydrogenase hypothetical membrane protein lantibiotic epidermin immunity protein F epidermin ABC transporter, membrane protein epidermin ABC transporter, ATP-binding protein S8A family lantibiotic epidermin serine protease lantibiotic epidermin biosynthesis protein EpiD lantibiotic epidermin biosynthesis protein EpiC lantibiotic epidermin biosynthesis protein EpiB lantibiotic epidermin EpiA (3R)-hydroxymyristoyl-[acyl carrier protein] dehydratase UDP-N-acetylglucosamine 1-carboxyvinyltransferase hypothetical protein formimidoylglutamase mevalonate kinase diphosphomevalonate decarboxylase
Regulon SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB SigB TcaR TraP TraP
Operon mvaK1 mvaD mvaK4 nagB hxlAB nagB hxlAB nagB hxlAB nixA pnbA rbfA truB ribC rbfA truB ribC rbfA truB ribC sigB rsbW rsbV rsbU sigB rsbW rsbV rsbU sigB rsbW rsbV rsbU sigB rsbW rsbV rsbU SACOL0085 SACOL0086 SACOL0085 SACOL0086 SACOL0089 SACOL0092 SACOL0155 SACOL0156 SACOL0257 SACOL0305 SACOL0306 SACOL0305 SACOL0306 SACOL0399 SACOL0444 SACOL0446 SACOL0455 SACOL0456 SACOL0457 SACOL0455 SACOL0456 SACOL0457 SACOL0455 SACOL0456 SACOL0457 SACOL0597 SACOL0630 SACOL0671 SACOL0736 SACOL0737 SACOL0738 SACOL0736 SACOL0737 SACOL0738 SACOL0736 SACOL0737 SACOL0738 SACOL0739 SACOL0740 SACOL0741 SACOL0742 SACOL0740 SACOL0741 SACOL0742 SACOL0740 SACOL0741 SACOL0742 SACOL0763 SACOL0764 queEDC queEDC queEDC SACOL0787 SACOL0830 SACOL0831 SACOL0832 SACOL0830 SACOL0831 SACOL0832 SACOL0830 SACOL0831 SACOL0832 SACOL0834 SACOL0835 SACOL0853 SACOL0854 SACOL0853 SACOL0854 SACOL0855 SACOL0862 SACOL0863 SACOL0862 SACOL0863 SACOL0868 SACOL0872 SACOL0880 SACOL0881 SACOL0880 SACOL0881 SACOL0912 SACOL0921 SACOL0922 SACOL0921 SACOL0922 SACOL1046 SACOL1089 SACOL1090 SACOL1089 SACOL1090 SACOL1183 SACOL1679 SACOL1680 SACOL1728 SACOL1788 SACOL1789 SACOL1788 SACOL1789 SACOL1802 SACOL1803 SACOL1804 SACOL1802 SACOL1803 SACOL1804 SACOL1802 SACOL1803 SACOL1804 SACOL1821 SACOL1911 SACOL1912 SACOL1911 SACOL1912 SACOL1933 SACOL1939 SACOL1940 SACOL1939 SACOL1940 SACOL1941 SACOL1987 SACOL2012 SACOL2013 SACOL2076 SACOL2077 SACOL2078 SACOL2076 SACOL2077 SACOL2078 SACOL2076 SACOL2077 SACOL2078 SACOL2114 SACOL2132 SACOL2136 SACOL2168 SACOL2169 SACOL2170 SACOL2168 SACOL2169 SACOL2170 SACOL2168 SACOL2169 SACOL2170 asp23 SACOL2174 amaP opuD2 asp23 SACOL2174 amaP opuD3 asp23 SACOL2174 amaP opuD4 asp23 SACOL2174 amaP opuD5 SACOL2197 SACOL2300 SACOL2301 SACOL2300 SACOL2301 SACOL2303 SACOL2321 SACOL2365 SACOL2433 SACOL2434 SACOL2461 SACOL2462 SACOL2461 SACOL2462 SACOL2481 SACOL2484 SACOL2519 SACOL2563 SACOL2593 SACOL2594 SACOL2595 SACOL2596 SACOL2597 SACOL2593 SACOL2594 SACOL2595 SACOL2596 SACOL2597 SACOL2593 SACOL2594 SACOL2595 SACOL2596 SACOL2597 SACOL2593 SACOL2594 SACOL2595 SACOL2596 SACOL2597 SACOL2605 SACOL2621 SACOL2625 SACOL2626 SACOL2631 gtfAB secA2 asp3 asp2 asp1 gtfAB secA2 asp3 asp2 asp2 gtfAB secA2 asp3 asp2 asp3 gtfAB secA2 asp3 asp2 asp4 gtfAB secA2 asp3 asp2 asp5 gtfAB secA2 asp3 asp2 asp6 SACOL2681 SACOL2682 SACOL2711 SACOL2717 SACOL2720 SACOL2723 sarA sarS sasF clfB gltS
SACOL-numbers SACOL0638 SACOL0616 SACOL0617 SACOL0618 SACOL2721 SACOL2459 SACOL1289 SACOL1290 SACOL1291 SACOL2054 SACOL2055 SACOL2056 SACOL2057 SACOL0085 SACOL0086 SACOL0089 SACOL0092 SACOL0155 SACOL0156 SACOL0257 SACOL0305 SACOL0306 SACOL0399 SACOL0444 SACOL0446 SACOL0455 SACOL0456 SACOL0457 SACOL0597 SACOL0630 SACOL0671 SACOL0736 SACOL0737 SACOL0738 SACOL0739 SACOL0740 SACOL0741 SACOL0742 SACOL0763 SACOL0764 SACOL0770 SACOL0771 SACOL0772 SACOL0787 SACOL0830 SACOL0831 SACOL0832 SACOL0834 SACOL0835 SACOL0853 SACOL0854 SACOL0855 SACOL0862 SACOL0863 SACOL0868 SACOL0872 SACOL0880 SACOL0881 SACOL0912 SACOL0921 SACOL0922 SACOL1046 SACOL1089 SACOL1090 SACOL1183 SACOL1679 SACOL1680 SACOL1728 SACOL1788 SACOL1789 SACOL1802 SACOL1803 SACOL1804 SACOL1821 SACOL1911 SACOL1912 SACOL1933 SACOL1939 SACOL1940 SACOL1941 SACOL1987 SACOL2012 SACOL2013 SACOL2076 SACOL2077 SACOL2078 SACOL2114 SACOL2132 SACOL2136 SACOL2168 SACOL2169 SACOL2170 SACOL2173 SACOL2174 SACOL2175 SACOL2176 SACOL2197 SACOL2300 SACOL2301 SACOL2303 SACOL2321 SACOL2365 SACOL2433 SACOL2434 SACOL2461 SACOL2462 SACOL2481 SACOL2484 SACOL2519 SACOL2563 SACOL2593 SACOL2594 SACOL2596 SACOL2597 SACOL2605 SACOL2621 SACOL2625 SACOL2626 SACOL2631 SACOL2669 SACOL2670 SACOL2671 SACOL2672 SACOL2673 SACOL2674 SACOL2681 SACOL2682 SACOL2711 SACOL2717 SACOL2720 SACOL2723 SACOL0672 SACOL0096 SACOL2668 SACOL2652 SACOL2340
USA300-numbers USA300HOU_0585 USA300HOU_0563 USA300HOU_0564 USA300HOU_0565 USA300HOU_2699 USA300HOU_2441 USA300HOU_1202 USA300HOU_1203 USA300HOU_1204 USA300HOU_2059 USA300HOU_2060 USA300HOU_2061 USA300HOU_2062 USA300HOU_0114 USA300HOU_0115 USA300HOU_0117 USA300HOU_0120 USA300HOU_0182 USA300HOU_0183 USA300HOU_0283 USA300HOU_0328 USA300HOU_0329 USA300HOU_0349 USA300HOU_0395 USA300HOU_0397 USA300HOU_0408 USA300HOU_0409 USA300HOU_0410 USA300HOU_0544 USA300HOU_0577 USA300HOU_0621 USA300HOU_0699 USA300HOU_0700 USA300HOU_0701 USA300HOU_0702 USA300HOU_0703 USA300HOU_0704 USA300HOU_0705 USA300HOU_0726 USA300HOU_0727 USA300HOU_0733 USA300HOU_0734 USA300HOU_0735 USA300HOU_0749 USA300HOU_0794 USA300HOU_0795 USA300HOU_0796 USA300HOU_0798 USA300HOU_0799 USA300HOU_0816 USA300HOU_0817 USA300HOU_0818 USA300HOU_0825 USA300HOU_0826 USA300HOU_0830 USA300HOU_0835 USA300HOU_0845 USA300HOU_0846 USA300HOU_0868 USA300HOU_0878 USA300HOU_0879 USA300HOU_0986 USA300HOU_1023 USA300HOU_1024 USA300HOU_1108 USA300HOU_1624 USA300HOU_1625 USA300HOU_1668 USA300HOU_1728 USA300HOU_1729 USA300HOU_1743 USA300HOU_1744 USA300HOU_1745 USA300HOU_1761 USA300HOU_1848 USA300HOU_1849 USA300HOU_1870 USA300HOU_1877 USA300HOU_1878 USA300HOU_1879 USA300HOU_1927 USA300HOU_2019 USA300HOU_2020 USA300HOU_2080 USA300HOU_2081 USA300HOU_2082 USA300HOU_2110 USA300HOU_2129 USA300HOU_2133 USA300HOU_2170 USA300HOU_2171 USA300HOU_2172 USA300HOU_2175 USA300HOU_2176 USA300HOU_2177 USA300HOU_2178 USA300HOU_2200 USA300HOU_2290 USA300HOU_2291 USA300HOU_2293 USA300HOU_2308 USA300HOU_2351 USA300HOU_2415 USA300HOU_2416 USA300HOU_2443 USA300HOU_2444 USA300HOU_2462 USA300HOU_2465 USA300HOU_2497 USA300HOU_2542 USA300HOU_2572 USA300HOU_2573 USA300HOU_2574 USA300HOU_2575 USA300HOU_2582 USA300HOU_2598 USA300HOU_2603 USA300HOU_2604 USA300HOU_2609 USA300HOU_2647 USA300HOU_2648 USA300HOU_2649 USA300HOU_2650 USA300HOU_2651 USA300HOU_2652 USA300HOU_2658 USA300HOU_2659 USA300HOU_2689 USA300HOU_2695 USA300HOU_2698 USA300HOU_2702 USA300HOU_0622 USA300HOU_0123 USA300HOU_2646 USA300HOU_2630 USA300HOU_2326
Gene symbol mvaK2 nagB hxlA hxlB nixA pnbA rbfA truB ribC sigB rsbW rsbV rsbU USA300HOU_0114 norC USA300HOU_0117 USA300HOU_0120 USA300HOU_0182 USA300HOU_0183 rbsR USA300HOU_0328 USA300HOU_0329 USA300HOU_0349 USA300HOU_0395 USA300HOU_0397 USA300HOU_0408 USA300HOU_0409 USA300HOU_0410 USA300HOU_0544 USA300HOU_0577 USA300HOU_0621 USA300HOU_0699 USA300HOU_0700 USA300HOU_0701 USA300HOU_0702 USA300HOU_0703 USA300HOU_0704 USA300HOU_0705 USA300HOU_0726 csbB queE queD queC bmrU USA300HOU_0794 USA300HOU_0795 whiA USA300HOU_0798 USA300HOU_0799 USA300HOU_0816 USA300HOU_0817 USA300HOU_0818 USA300HOU_0825 USA300HOU_0826 USA300HOU_0830 ohr USA300HOU_0845 trxA_3 USA300HOU_0868 USA300HOU_0878 USA300HOU_0879 USA300HOU_0986 USA300HOU_1023 USA300HOU_1024 arcD1 USA300HOU_1624 USA300HOU_1625 lysP USA300HOU_1728 USA300HOU_1729 USA300HOU_1743 USA300HOU_1744 USA300HOU_1745 USA300HOU_1761 USA300HOU_1848 USA300HOU_1849 USA300HOU_1870 ptpA USA300HOU_1878 USA300HOU_1879 USA300HOU_1927 USA300HOU_2019 USA300HOU_2020 USA300HOU_2080 USA300HOU_2081 USA300HOU_2082 aldA USA300HOU_2129 USA300HOU_2133 USA300HOU_2170 USA300HOU_2171 USA300HOU_2172 asp23 USA300HOU_2176 amaP opuD2 USA300HOU_2200 USA300HOU_2290 fdhA USA300HOU_2293 USA300HOU_2308 USA300HOU_2351 USA300HOU_2415 USA300HOU_2416 USA300HOU_2443 USA300HOU_2444 USA300HOU_2462 USA300HOU_2465 USA300HOU_2497 clpL USA300HOU_2572 USA300HOU_2573 USA300HOU_2574 USA300HOU_2575 USA300HOU_2582 USA300HOU_2598 USA300HOU_2603 USA300HOU_2604 USA300HOU_2609 gtfB gtfA secA2 asp3 asp2 asp1 USA300HOU_2658 USA300HOU_2659 yceI USA300HOU_2695 USA300HOU_2698 USA300HOU_2702 sarA sarS sasF clfB gltS
log2-fold change NaOCl 0,67 0,40 0,77 1,06 0,23 0,89 1,36 0,47 0,77 0,10 0,01 0,23 -0,65 0,84 0,84 1,19 0,34 0,63 1,50 -0,01 1,08 1,11 1,44 0,51 0,78 0,34 0,12 0,75 1,58 1,66 1,55 0,04 -0,15 0,55 0,20 1,09 1,17 1,00 1,51 1,28 1,21 1,07 0,73 0,36 0,27 0,87 0,95 0,58 0,57 0,21 0,48 0,68 1,28 1,08 1,03 0,77 0,62 0,78 -0,71 0,57 0,17 0,80 -0,88 0,45 0,86 0,37 0,44 0,15 0,65 0,62 0,93 0,06 -0,34 -0,64 0,51 0,44 0,91 0,69 0,88 0,56 0,78 0,13 0,04 1,11 0,16 0,25 1,23 1,24 0,99 -0,26 0,24 -0,18 0,80 0,82 0,86 1,48 0,83 0,19 0,01 0,13 0,89 0,19 -0,03 1,23 -0,45 0,11 1,20 1,46 0,10 2,54 -0,42 -0,19 0,70 0,88 0,94 1,11 1,38 1,03 0,79 -0,40 -0,29 0,25 -0,28 -0,19 0,19 0,34 0,47 2,20 0,66 0,51 0,38 0,63 -0,03 1,11 1,10 -0,11
Function phosphomevalonate kinase glucosamine-6-phosphate deaminase possible 3-hexulose-6-phosphate synthase glucose-6-phosphate isomerase NiCoT family nickel (Ni2+)-cobalt (Co2+) transporter carboxylesterase ribosome-binding factor A pseudouridylate synthase bifunctional riboflavin kinase/FAD synthase RibC DNA-directed RNA polymerase sigma subunit FliA anti-sigma B factor anti-sigma B factor antagonist sigma factor B regulator M20 family peptidase possible MFS family major facilitator transporter myosin-cross-reactive antigen hypothetical membrane protein CDF family cation diffusion facilitator hypothetical protein ribose operon repressor ABC transporter, membrane protein ABC transporter, binding protein possible dehydrogenase hypothetical protein hypothetical membrane protein hypothetical protein hypothetical protein hypothetical protein possible hydrolase APC family amino acid-polyamine-organocation transporter hydrolase possible GNAT family acetyltransferase possible lipoprotein hypothetical protein possible GNAT family acetyltransferase hypothetical protein hypothetical protein hypothetical protein dehydrogenase possible glycosyltransferase organic radical-activating protein possible 6-pyruvoyltetrahydropterin synthase ExsB family post-transcriptional regulator possible diacylglycerol kinase hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein acetyltransferase hypothetical protein hypothetical protein hypothetical protein OsmC/Ohr family protein TOPRIM domain topiosmerase/primase possible thioredoxin hypothetical protein CBS domain protein dioxygenase hypothetical protein hypothetical protein hypothetical protein arginine/ornithine APC family amino acid-polyamine-organocation antiporter hypothetical protein hypothetical protein APC family amino acid-polyamine-organocation transporter hypothetical protein possible general stress protein hypothetical protein pseudouridylate synthase polysaccharide biosynthesis protein hypothetical protein hypothetical protein glucosamine-6-phosphate isomerase C56 family endopeptidase PfpI protein-tyrosine-phosphatase hypothetical protein possible ribonuclease BN hypothetical protein GNAT family acetyltransferase hypothetical membrane protein hypothetical protein hypothetical protein hypothetical protein aldehyde dehydrogenase hypothetical protein hypothetical protein hypothetical protein possible Iuc family aerobactin synthesis protein MFS family major facilitator transporter alkaline shock protein 23 hypothetical membrane protein hypothetical protein BCCT family betaine/carnitine/choline transporter hypothetical protein hypothetical protein formate dehydrogenase alpha subunit inositol-phosphate phosphatase dehydrogenase hypothetical lipoprotein hypothetical protein hypothetical membrane protein ABC transporter, membrane protein ABC transporter, ATP-binding protein hypothetical protein alkylhydroperoxidase hypothetical protein S14 family endopeptidase Clp TetR family transcriptional regulator dehydrogenase hypothetical protein hydrolase hypothetical protein hypothetical membrane protein hypothetical protein hypothetical protein possible metallo-beta-lactamase hypothetical protein glycosyl transferase, group 1 family protein Sec family Type I general secretory pathway protein SecA2 accessory secretory protein Asp3 accessory secretory protein Asp2 accessory secretory protein Asp1 hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical protein hypothetical membrane protein staphylococcal accessory regulator A staphylococcal accessory regulator S LPXTG family cell wall surface anchor protein clumping factor B ESS family glutamate:sodium (Na+) symporter
Regulon Operon SACOL-numbers USA300-numbers Gene symbol log2-fold change NaOCl Function TraP nirR SACOL2399 USA300HOU_2383 nirR -0,39 transcriptional regulator NirR TraP SACOL0084 SACOL0084 USA300HOU_0113 USA300HOU_0113 -0,25 bifunctional AraC family transcriptional regulator/xylan 1,4-beta-xylosidase TraP SACOL1763 thiI nifZ SACOL1763 USA300HOU_1701 USA300HOU_1701 -0,20 hypothetical protein TraP SACOL1763 thiI nifZ SACOL1764 USA300HOU_1702 thiI -0,40 thiamine biosynthesis protein TraP SACOL1763 thiI nifZ SACOL1765 USA300HOU_1703 nifZ -0,69 cysteine desulfurase TraP SACOL1917 SACOL1917 USA300HOU_1854 USA300HOU_1854 0,29 hypothetical protein TraP sdrC SACOL0608 USA300HOU_0555 sdrC -0,25 Ser-Asp rich fibrinogen/bone sialoprotein-binding protein SdrC TraP sdrD SACOL0609 USA300HOU_0556 sdrD 0,03 Ser-Asp rich fibrinogen/bone sialoprotein-binding protein SdrD TraP spa SACOL0095 USA300HOU_0122 spa -1,27 immunoglobulin G binding protein A TraP agrBDCA SACOL2023 USA300HOU_2032 agrB -0,08 accessory gene regulator protein B TraP agrBDCA SACOL2024 USA300HOU_2033 agrD 0,01 accessory gene regulator protein D TraP agrBDCA SACOL2025 USA300HOU_2034 agrC 0,26 accessory gene regulator protein C TraP agrBDCA SACOL2026 USA300HOU_2035 agrA 0,26 accessory gene regulator protein A TraP hld SACOL2022 USA300HOU_2031 hld -0,47 delta-hemolysin TraP hysA SACOL2194 USA300HOU_2197 hysA -0,45 hyaluronate lyase TraP icaR SACOL2688 USA300HOU_2665 icaR -0,11 Ica operon transcriptional regulator R TraP plc SACOL0078 USA300HOU_0108 plc -0,54 phosphatidylinositol diacylglycerol-lyase TraP pyrR SACOL1210 USA300HOU_1136 pyrR 0,25 possible uracil phosphoribosyltransferase TraP rbsKDU SACOL0253 USA300HOU_0280 rbsK -0,31 ribokinase TraP rbsKDU SACOL0254 USA300HOU_0281 rbsD -0,43 ribose ABC transporter, membrane protein TraP rbsKDU SACOL0255 USA300HOU_0282 rbsU -0,32 DMT superfamily drug/metabolite transporter TraP SACOL0162 SACOL0162 USA300HOU_0190 fdh -0,52 formate dehydrogenase TraP SACOL0317 SACOL0317 USA300HOU_0340 geh 2,27 triacylglycerol lipase TraP SACOL0462 SACOL0462 USA300HOU_0415 USA300HOU_0415 0,15 hypothetical protein TraP SACOL0478 SACOL0479 SACOL0478 USA300HOU_0435 ssl11 -0,12 superantigen-like protein TraP SACOL0478 SACOL0479 SACOL0479 USA300HOU_0436 USA300HOU_0436 -0,30 hypothetical protein TraP SACOL0486 SACOL0487 SACOL0488 SACOL0489 SACOL0486 USA300HOU_0447 USA300HOU_0447 0,26 hypothetical lipoprotein TraP SACOL0486 SACOL0487 SACOL0488 SACOL0489 SACOL0487 USA300HOU_0448 USA300HOU_0448 -0,08 hypothetical protein TraP SACOL0486 SACOL0487 SACOL0488 SACOL0489 SACOL0488 USA300HOU_0449 USA300HOU_0449 -0,61 hypothetical protein TraP SACOL0486 SACOL0487 SACOL0488 SACOL0489 SACOL0489 USA300HOU_0450 USA300HOU_0450 -0,73 hypothetical protein TraP SACOL0678 mnhABCDEFG SACOL0678 USA300HOU_0642 USA300HOU_0642 0,72 possible bacteriophage integrase TraP SACOL0678 mnhABCDEFG SACOL0679 USA300HOU_0643 mnhA 0,72 CPA3 family monovalent cation (K+ or Na+):proton (H+) antiporter-3, MnhA subunit TraP SACOL0678 mnhABCDEFG SACOL0680 USA300HOU_0644 mnhB 0,47 CPA3 family monovalent cation (K+ or Na+):proton (H+) antiporter-3, MnhB subunit TraP SACOL0678 mnhABCDEFG SACOL0681 USA300HOU_0645 mnhC 0,55 CPA3 family monovalent cation (K+ or Na+):proton (H+) antiporter-3, MnhC subunit TraP SACOL0678 mnhABCDEFG SACOL0682 USA300HOU_0646 mnhD 1,09 CPA3 family monovalent cation (K+ or Na+):proton (H+) antiporter-3, MnhD subunit TraP SACOL0678 mnhABCDEFG SACOL0684 USA300HOU_0647 mnhE 1,23 CPA3 family monovalent cation (K+ or Na+):proton (H+) antiporter-3, MnhE subunit TraP SACOL0678 mnhABCDEFG SACOL0685 USA300HOU_0648 mnhF 1,15 CPA3 family monovalent cation (K+ or Na+):proton (H+) antiporter-3, MnhF subunit TraP SACOL0678 mnhABCDEFG SACOL0686 USA300HOU_0649 mnhG 1,29 CPA3 family monovalent cation (K+ or Na+):proton (H+) antiporter-3, MnhG subunit TraP psmß1 SACOL1186 USA300HOU_1112 psmß1 -0,15 antibacterial protein TraP psmß2 SACOL1187 USA300HOU_1113 psmß2 -0,29 antibacterial protein TraP citM SACOL2636 USA300HOU_2615 citM -0,75 CitMHS citrate-magnesium :proton/ citrate-calcium:proton symporter TreR trePCR SACOL0516 USA300HOU_0474 treP -0,87 PTS family trehalose (tre) porter component IIBC TreR trePCR SACOL0517 USA300HOU_0475 treC -0,45 alpha, alpha-phosphotrehalase VraSR murAB SACOL2116 USA300HOU_2112 murZ 0,19 UDP-N-acetylglucosamine 1-carboxyvinyltransferase VraSR proP SACOL0620 USA300HOU_0567 proP 1,13 MFS family major facilitator transporter, proline/betaine:cation symporter VraSR vraABC SACOL0624 SACOL0621 USA300HOU_0568 vraA -0,41 long-chain-fatty-acid--CoA ligase VraSR vraABC SACOL0624 SACOL0622 USA300HOU_0569 vraB -0,40 acetyl-CoA C-acetyltransferase VraSR vraABC SACOL0624 SACOL0623 USA300HOU_0570 vraC -0,91 hypothetical protein VraSR vraABC SACOL0624 SACOL0624 USA300HOU_0571 USA300HOU_0571 -1,33 hypothetical protein VraSR SACOL1705 SACOL1705 USA300HOU_1650 USA300HOU_1650 1,81 hypothetical protein VraSR SACOL1895 SACOL1895 USA300HOU_1831 USA300HOU_1831 1,01 hypothetical protein VraSR SACOL1896 SACOL1896 USA300HOU_1832 USA300HOU_1832 -0,23 hypothetical membrane protein VraSR SACOL1897 SACOL1897 USA300HOU_1833 prsA 1,56 peptidylprolyl isomerase SACOL1932 SACOL1932 USA300HOU_1869 USA300HOU_1869 0,56 transglycosylase VraSR VraSR SACOL2435 SACOL2436 SACOL2435 USA300HOU_2418 USA300HOU_2418 0,56 glycerate kinase SACOL2435 SACOL2436 SACOL2436 USA300HOU_2419 USA300HOU_2419 0,76 hypothetical protein VraSR VraSR SACOL2571 SACOL2571 USA300HOU_2551 USA300HOU_2551 2,28 hypothetical protein VraSR vraRSTU SACOL1942 USA300HOU_1880 vraR 0,30 response regulator VraR VraSR vraRSTU SACOL1943 USA300HOU_1881 vraS 0,07 sensor histidine kinase VraS VraSR vraRSTU SACOL1944 USA300HOU_1882 vraT 0,23 hypothetical membrane protein VraSR vraRSTU SACOL1945 USA300HOU_1883 vraU 0,13 hypothetical protein YtrA ytrA pmtABCD SACOL1993 USA300HOU_1933 pmtD 0,50 hypothetical membrane protein YtrA ytrA pmtABCD SACOL1994 USA300HOU_1934 pmtC 0,46 ABC transporter, ATP-binding protein YtrA ytrA pmtABCD SACOL1995 USA300HOU_1935 pmtB 0,27 hypothetical membrane protein YtrA ytrA pmtABCD SACOL1996 USA300HOU_1936 pmtA 0,18 ABC transporter, ATP-binding protein YtrA ytrA pmtABCD SACOL1997 USA300HOU_1937 ytrA 0,00 GntR family transcriptional regulator Table S2: RNA-Seq transcriptome analysis of S. aureus USA300 wild type cells 30 min after exposure to NaOCl stress. S. aureus USA300 wild type cells were grown in 3 biological replicates and harvested before and 30 min after exposure to 150 µM NaOCl stress. The RNA-isolation and RNA-Seq transcriptome analysis was performed as described in the Methods section. Transcripts were analyzed for differential expression using the software DEseq2 included in the ReadXplorer v2.2 software. The signal intensity value (a-value) was calculated by log2 mean of normalized read counts and the signal intensity ratio (m-value) by log2 fold change. The evaluation of the differential RNAseq data was performed using an adjusted p-value cut-off of P ≤ 0.05 and a signal intensity ratio (m-value) cut-off of ≥ 1.99 or ≤ - 1.99. Genes were classified into regulons according to the RegPrecise database and those published previously (Mäder et al., 2016). Only the most interesting regulons are shown with significant induced or repressed genes under NaOCl-treatment in S. aureus .
Table S3: Bacterial strains Strain Escherichia coli DH5α
BL21(DE3)plysS
Description
Reference
F-φ80dlacZ Δ(lacZYA-argF) U169 (7) deoRsupE44ΔlacU169 (f80lacZDM15) hsdR17 recA1 endA1 (rk- mk+) supE44gyrA96 thi1 gyrA69 relA1 F- ompT hsdS gal (rb- mb+) (7) DE3(Sam7 Δnin5 lacUV5-T7 Gen1)
Staphylococcus aureus RN4220
USA300 COL COL-hypR COL-merA COL-hypR::pRB473-hypR COL-hypR::pRB473-hypRC33A COL-hypR::pRB473-hypRC99A COL-hypR::pRB473-hypRC142A COL-merA::pRB473-merA COL-merA::pRB473-merAC43S COL pRB473-hypR COL pRB473
restriction negative strain/MSSA cloning intermediate derived from 8325-4 CA-MRSA strain Archaic HA-MRSA strain COL hypR deletion mutant COL merA deletion mutant
Staphylococcus phage 80
(2)
(3) (6) This study This study This study This study This study This study This study This study This study This study
(5)
1
Table S4: Plasmids Plasmid
Description
Reference
pET11b pRB473
E. coli expression plasmid pRB373-derivative, E. coli/ S. aureus shuttle vector, Ampr, Cmr pRB373-derivative, E. coli/ S. aureus shuttle vector, containing xyloseinducible PXyl promoter Ampr, Cmr pET11b-derivative for overexpression of His-tagged HypR pET11b-derivative for overexpression of His-tagged HypRC33A pET11b-derivative for overexpression of His-tagged HypRC99A pET11b-derivative for overexpression of His-tagged HypRC99S pET11b-derivative for overexpression of His-tagged HypRC142A pRB473-derivative expressing hypR under PXyl pRB473-derivative expressing hypRC33A under PXyl pRB473-derivative expressing hypRC99A under PXyl pRB473-derivative expressing hypRC142A under PXyl pET11b-derivative for overexpression of His-tagged MerA pET11b-derivative for overexpression of His-tagged MerAC43S pRB473-derivative expressing merA under PXyl pRB473-derivative expressing merAC43S under PXyl
Novagen (1)
pRB473-XylR
pET11b-hypR pET11b-hypRC33A pET11b-hypRC99A pET11b-hypRC99S pET11b-hypRC142A pRB473-XylR-hypR pRB473-XylR- hypRC33A pRB473-XylR- hypRC99A pRB473-XylR- hypRC142A pET11b-merA pET11b-merAC43S pRB473-XylR-merA pRB473-XylR-merAC43S
2
(4)
This study This study This study This study This study This study This study This study This study This study This study This study This study
Table S5. Oligonucleotide primers
Primer name
Sequence (5’ to 3’)
0641-pET-for-NheI 0641-pET-rev-BamHI
CTAGCTAGCTTGAATTTAGAATTTAACATTGCC CGCGGATCCTTAGTGATGGTGATGGTGATGTATGTTTTCATGAC ATAAATCCTC GAACAGGATTTAACGCAGTTAATTCTGCTAATG CATTAGCAGAATTAACTGCGTTAAATCCTGTTC TTACGAGCAATTTGCGCGTGACTGCCTTCGTCG CGACGAAGGCAGTCACGCGCAAATTGCTCGTAA TTACGAGCAATTTGAGAGTGACTGCCTTCGTCG CGACGAAGGCAGTCACTCTCAAATTGCTCGTAA CGCGGATCCTTAGTGATGGTGATGGTGATGTATGTTTTCATGCG CTAAATCCTC CGCAGATCTATGCAGGTAAATTGAGATAACATG GAATGTCTTCAATGACATCTTTGGGCAATGTTAAATTCTAAATTC AA TTGAATTTAGAATTTAACATTGCCCAAAGATGTCATTGAAGACAT TC CCAGTCGACATATAACCGCCACCTACAATAAC TAGGGATCCGTTACAATTATGAGGTGAGAAACATTGAATTTAGAA TTTAACA CTCGGTACCTTATATGTTTTCATGACATAAATCCTC CTCGGTACCTTATATGTTTTCATGCGCTAAATCCTC CTAGCTAGCATGAAAACATATGATTTAATTGTAAT CGCGGATCCCTAGTGATGGTGATGGTGATGGAAATTAAATAAAT CATTAAATGATTC GTGTCTTCGAAGGTATACATCCTATGTTTATAGAAGTGCC GGCACTTCTATAAACATAGGATGTATACCTTCGAAGACAC CGCAGATCTAGGTGAGAAACATTGAATTTAGA CGTAATACGGTATATGGAATGTCGCTAAAGTTTTACCAGCTT AAGCTGGTAAAACTTTAGCGACATTCCATATACCGTATTACG CCAGTCGACTGATAAAGAAAGGTGGGTAGC TAGGGATCCACATTCAAAAGGAGGATTTATGTCATGAAAACATAT GATTTAATTGTAA CTCGGTACCCTAGAAATTAAATAAATCATTAAATG TCAATTGTGCAATCTCACCGT AAGCTAATACATGCACGGCAA TAATTTTACCTAATACAGTTACAATTATGAGGTGAG CTCACCTCATAATTGTAACTGTATTAGGTAAAATTA TAATTGTAACTAATACAGGTAAAATTATGAGGTGAG CTCACCTCATAATTTTACCTGTATTAGTTACAATTA GTGGCGGTTATATCGCCTTA CTAATACGACTCACTATAGGGAGAAAATGATTCGGCCATCGTAG TGCCGTGCATGTATTAGCTT CTAATACGACTCACTATAGGGAGACCTCCTTTTGAATGTCTTCAA TG GCAACATGGTGTGGTCCAT CTAATACGACTCACTATAGGGAGATGGTTGGAAACCAACAACTT GAAGGAGTGATTTCAATGGCAC CTAATACGACTCACTATAGGGAGACTGAGTCCAAGGAAACTAAC TC
0641-pET-C33A-rev 0641-pET-C33A-for 0641-pET-C99A-rev 0641-pET-C99A-for 0641-pET-C99S-rev 0641-pET-C99S-for 0641-pET-C142A-rev-BamHI 0641-pMAD-for-BglII 0641-pMAD-f1-rev 0641-pMAD-f2-for 0641-pMAD-rev-SalI 0641-pRB-for-BamHI 0641-pRB-REV-KpnI 0641-pRB-REV-KpnI-C2-3A 0640-pET-for-NheI 0640-pET-rev-BamHI 0640-pET-C43S-f1-rev 0640-pET-C43S-f2-for 0640-pMAD-for-BglII 0640-pMAD-f1-rev 0640-pMAD-f2-for 0640-pMAD-rev-SalI 0640-pRB-for-BamHI 0640-pRB-rev-KpnI emsa0641-for emsa0641-rev emsa0641-m1-for emsa0641-m1-rev emsa0641-m2-for emsa0641-m2-rev SACOL0640-for SACOL0640-rev SACOL0641-for SACOL0641-rev trxA-for trxA-rev rnaIII-for rnaIII-rev
Restriction sites are underlined and bold bases indicate point mutations
3
Supplementary References 1.
2.
3.
4.
5. 6. 7.
Brückner R, Wagner E, Gotz F. Characterization of a sucrase gene from Staphylococcus xylosus. J Bacteriol 175: 851-7, 1993. Kreiswirth BN, Lofdahl S, Betley MJ, O'Reilly M, Schlievert PM, Bergdoll MS, Novick RP. The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305: 709-12, 1983. Posada AC, Kolar SL, Dusi RG, Francois P, Roberts AA, Hamilton CJ, Liu GY, Cheung A. Importance of bacillithiol in the oxidative stress response of Staphylococcus aureus. Infect Immun 82: 316-32, 2014. Pöther DC, Gierok P, Harms M, Mostertz J, Hochgrafe F, Antelmann H, Hamilton CJ, Borovok I, Lalk M, Aharonowitz Y, Hecker M. Distribution and infection-related functions of bacillithiol in Staphylococcus aureus. Int J Med Microbiol 303: 114-23, 2013. Rosenblum ED, Tyrone S. Serology, Density, and Morphology of Staphylococcal Phages. J Bacteriol 88: 1737-42, 1964. Shafer WM, Iandolo JJ. Genetics of staphylococcal enterotoxin B in methicillin-resistant isolates of Staphylococcus aureus. Infect Immun 25: 902-11, 1979. Studier FW, Moffatt BA. Use of Bacteriophage-T7 RNA-Polymerase to Direct Selective HighLevel Expression of Cloned Genes. Journal of Molecular Biology 189: 113-130, 1986.
4