Stem Cell Reports Article
Far Upstream Element-Binding Protein 1 Regulates LSD1 Alternative Splicing to Promote Terminal Differentiation of Neural Progenitors Inah Hwang,1 Dongqing Cao,3 Yoonmi Na,1 Do-Yeon Kim,5 Tuo Zhang,2 Jun Yao,6 Hwanhee Oh,1 Jian Hu,7 Hongwu Zheng,8 Yu Yao,3,4,* and Jihye Paik1,* 1Department
of Pathology and Laboratory Medicine, Weill Cornell Medicine, New York, NY 10065, USA Resources Core Facility, Weill Cornell Medicine, New York, NY 10065, USA 3Neurosurgical Immunology Laboratory, Neurosurgical Institute of Fudan University, Shanghai, China 4Department of Neurosurgery, Huashan Hospital, Fudan University, Shanghai, China 5Department of Pharmacology, School of Dentistry, Kyungpook National University, Daegu, Korea 6Department of Molecular and Cellular Oncology, University of Texas MD Anderson Cancer Center, Houston, TX 77054, USA 7Department of Cancer Biology, University of Texas MD Anderson Cancer Center, Houston, TX 77054, USA 8Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 11724, USA *Correspondence:
[email protected] (Y.Y.),
[email protected] (J.P.) https://doi.org/10.1016/j.stemcr.2018.02.013 2Genomics
SUMMARY Loss of a cell’s ability to terminally differentiate because of mutations is a selected genetic event in tumorigenesis. Genomic analyses of low-grade glioma have reported recurrent mutations of far upstream element-binding protein 1 (FUBP1). Here, we show that FUBP1 expression is dynamically regulated during neurogenesis and that its downregulation in neural progenitors impairs terminal differentiation and promotes tumorigenesis collaboratively with expression of IDH1R132H. Mechanistically, collaborative action between SRRM4 and FUBP1 is necessary for mini-exon splicing of the neurospecific LSD1+8a isoform. LSD1+8a was downregulated upon loss of FUBP1 in neural progenitors, thereby impairing terminal neuronal differentiation and maturation. Reinforcing LSD1+8a expression in FUBP1downregulated neural progenitors restored terminal differentiation and suppressed tumorigenesis; hence, LSD1+8a is an obligatory effector of FUBP1-dependent neuronal differentiation. These findings establish a direct role for FUBP1 in neuronal differentiation and also explain its tumor-suppressor function in the nervous system.
INTRODUCTION Neural stem cells in the mammalian brain both self-renew and differentiate to produce neurons in a controlled manner (Kriegstein and Alvarez-Buylla, 2009). These cells follow the developmental hierarchy and differentiate into replication-arrested mature cells (Gage, 2000). Aberrant regulation of cellular differentiation may underlie various human developmental disorders, pathological conditions, and diseases including cancer. Glioma cells often exhibit anomalous developmental programs that disable terminal differentiation and sustain self-renewal (Jackson et al., 2006; Sanai et al., 2005). Restoration of differentiation capacities of glioma cells reduces tumorigenic potential, supporting the idea that impaired terminal differentiation contributes to glioma pathogenesis (Zheng et al., 2008, 2010). Far upstream element-binding protein 1 (FUBP1) is a single-strand DNA- and RNA-binding protein. It regulates transcription, mRNA stability and translation, and splicing (Zhang and Chen, 2013). It is frequently overexpressed in several types of cancer, including hepatocellular carcinoma, non-small cell lung carcinoma, and gastric cancer; thus, it is considered a proto-oncogene (Baumgarten et al., 2014; Li et al., 2013; Malz et al., 2009; Rabenhorst et al., 2009; Singer et al., 2009; Zhang et al., 2013). Paradoxically, recent genomic studies on 1p19q co-deleted
low-grade gliomas uncovered a frequent loss of FUBP1 functions in oligodendrogliomas (ODGs) by loss of heterozygosity of 1p and inactivating mutations, suggesting the potential of FUBP1 as a tumor-suppressor gene (Bettegowda et al., 2011; Sahm et al., 2012; Yip et al., 2012). Existing genetic studies point to the role of FUBP1 in maintaining hematopoietic stem cells and supporting proliferation of neoplastic cells (Rabenhorst et al., 2009, 2015; Zhang et al., 2013). A Fubp1 germline knockout (Fubp1/) mouse was shown to be embryonic lethal starting at embryonic day 10.5. Phenotypically, these animals displayed a small body size associated with hypoplasia of multiple tissues with the exception of cerebral hyperplasia, suggesting a context-specific function of Fubp1 (Zhou et al., 2016). Fubp1/ embryos presented notable overall brain parenchymal hypercellularity without the normal lobation of the cerebellum and obvious organization of the diencephalic cortical layers (Zhou et al., 2016). LSD1 (also known as KDM1A) is necessary for selfrenewal of neural progenitor cells (NPCs) by repressing TLX target genes including CDKN1A and PTEN (Sun et al., 2010). It represses and activates transcription by mediating histone H3K4me1/2 and H3K9me1/2 or H4K20me3 demethylation, respectively (Laurent et al., 2015; Wang et al., 2007, 2015). Its expression is post-translationally downregulated by ubiquitin-mediated degradation during neurogenesis (Han et al., 2014). Sustaining its
1208 Stem Cell Reports j Vol. 10 j 1208–1221 j April 10, 2018 j ª 2018 The Authors. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Figure 1. Expression of FUBP1 Is Dynamically Regulated during Adult Neurogenesis (A–C) Immunofluorescence analysis of FUBP1 co-stained with NESTIN (A), NeuN (B), or DCX (C) in the adult mouse hippocampal dentate gyrus. White-boxed regions are presented in higher magnification on the right (C0 and C00 for C). Scale bars, 50 mm. (D) Quantitative analysis of FUBP1-positive cells from a marker-expressing cell (n = 50 cells from 3 different adult animals were scored). Error bars denote mean ± SEM. (E) Summary of FUBP1 expression changes during adult hippocampal neurogenesis. (legend continued on next page) Stem Cell Reports j Vol. 10 j 1208–1221 j April 10, 2018 1209
transcription during neurogenic differentiation is necessary, as its neuron-specific isoform LSD1+8a is essential for terminal differentiation and maturation of neurons. Silencing of the neurospecific splice variant LSD1+8a delays neurite maturation in cortical neuronal cultures (Zibetti et al., 2010). Similarly, LSD1+8a promotes terminal neuronal differentiation by demethylating H3K9me1/2, which then derepresses neuronal gene expression (Laurent et al., 2015). In addition, it regulates neuronal activityregulated transcription that is necessary for long-term memory formation by demethylating H4K20 (Wang et al., 2015). FUBP1 is frequently overexpressed in many human cancers and strongly correlated with disease progression (Baumgarten et al., 2014; Li et al., 2013; Malz et al., 2009; Rabenhorst et al., 2009; Singer et al., 2009; Zhang et al., 2013). However, how it serves uniquely as a tumor suppressor in the brain is so far left unanswered. In this study, we hypothesized that FUBP1 plays an indispensable role in promoting terminal differentiation of neurons, and that lack of FUBP1 interferes with early-born neuronal cells exiting the cell cycle and predisposes these cells for transformation. Our study provides insights into the mechanism of how FUBP1 and isocitrate dehydrogenase (IDH) mutations together may converge on epigenetic aberrations and impair differentiation.
RESULTS Expression of FUBP1 Is Regulated during Neurogenesis FUBP1 is broadly expressed throughout the adult brain, primarily observed in the nucleus of neurons (Figure S1A). The glia-rich corpus callosum lacks FUBP1-positive cells, indicating neuronally enriched expression of FUBP1 in the adult brain. Consistently, double immunostaining of FUBP1 with a neuronal marker NeuN was strongly positive. In contrast, with an oligodendrocyte marker, Olig2+, or an astrocyte marker, glial fibrillary acidic protein (GFAP)+, cells showed a very low expression of FUBP1 (Figure S1B). We examined the expression of FUBP1 in neurogenic areas of the adult brain in order to understand its role during brain development. It is highly expressed in NESTIN-positive progenitors and NeuN-positive mature neurons (Figures 1A and 1B). Notably, doublecortin (DCX)-positive neuroblasts in the subgranular zone showed low to no signals while migrating ones in the granular cell layer increased
its expression to intermediate to strong levels (Figures 1C and 1D). These results suggest that the expression of FUBP1 is dynamically regulated during neurogenesis and may control key steps in committing to neuronal lineage and maturing into terminally differentiated neurons (Figure 1E). Next, we tested whether this expression pattern is recapitulated in our neural progenitor cell cultures. Homozygous deletion or silencing of Ink/Arf locus is one of the most frequent genetic lesions of gliomas (Cancer Genome Atlas Research Network et al., 2015). We therefore used immortalized Ink/Arf/ NPCs that maintain their multi-lineage differentiation capability (Bruggeman et al., 2005). Consistent with the tissue expression pattern, FUBP1 is highly expressed in NESTIN+ NPC and terminally differentiated NeuN+ cells (Figures S1C and S1D). In contrast, its expression is low to undetectable during early differentiation, as shown in DCX+ or TUBB3+ neuronal precursors. We generated a doxycyclineinducible NeuroD1-expressing NPC line (NPCND1), which terminally differentiates to NeuN-positive neurons in an expedited manner (Figure S2A). NPCND1 cells effectively differentiate to DCX-expressing neuroblasts (30%), within 2 days, in the presence of doxycycline (Figure S2B). In this system, almost all cells become quiescent within 5–7 days, as evidenced by a lack of 5-bromo-20 -deoxyuridine (BrdU)-positive cells following extended exposure (Figure S2C). During the early differentiation, the expression of FUBP1 declined followed by a progressive increase, while the neuronal marker NeuN continued to increase at mRNA and protein levels (Figures 1F and 1G). These results corroborate our findings that FUBP1 expression is regulated during neuronal differentiation. Loss of FUBP1 Inhibits Terminal Neuronal Differentiation Given that FUBP1 is precisely controlled in multiple steps during neuronal differentiation, we queried the role of FUBP1 in terminal neuronal differentiation and maturation. We knocked down the expression of FUBP1 in the NPCND1 line (NPCND1 FUBP1KD). Two independent short hairpins for FUBP1 effectively decreased its expression (Figure S2D). Because both hairpins elicited indistinguishable biological outcomes (Figure S3A), we present detailed results from cultures generated from hairpin 1 for the current study. Clearly, the frequency of NeuN- or MAP2a/b-positive cells was significantly decreased in NPCND1 FUBP1KD
(F) qRT-PCR analysis of neuronal markers and FUBP1 expression by NPCs at indicated times after the onset of differentiation (mean ± SEM from 3 independent cultures). (G) Representative western blot analysis of proliferating and differentiating NPCND1 (+doxycycline) cells. Band intensities are indicated below each blot. SGZ, subgranular zone; GCL, granular cell layer. See also Figure S1. 1210 Stem Cell Reports j Vol. 10 j 1208–1221 j April 10, 2018
Figure 2. Loss of FUBP1 Expression Impairs Terminal Neuronal Differentiation (A–C) Immunofluorescence analysis for (A) NeuN, (B) MAP2a/b, and (C) bromodeoxyuridine (BrdU) of differentiated NPCND1 NTKD or NPCND1 FUBP1KD in the presence (+DOX) or absence (DOX) of doxycycline. Scale bars, 50 mm. Quantitation of representative experiments is plotted below (mean ± SEM from 3–4 independent cultures). (D and E) Relative mRNA expression levels of SRRM4 and FUBP1 during NPCND1 differentiation (D) or NPCND1 NTKD versus NPCND1 FUBP1KD (E) were determined by qPCR (mean ± SEM from 3 independent cultures). Statistical significance was determined by one-way ANOVA. *p < 0.05; **p < 0.01; ***p < 0.001. See also Figures S2 and S3. compared with non-targeted (NPCND1 NTKD) cells under doxycycline (p < 0.001) (Figures 2A and 2B). To determine whether impaired terminal differentiation resulted from a failure to exit the cell cycle, we performed a DNA synthesis-based cell proliferation assay. The number of BrdUpositive NPCND1 cells declined within 48 hr of differentiation initiation and became undetectable after prolonged (5–7 days) differentiation (Figure 2C). Surprisingly, a fraction of NPCND1 FUBP1KD continued to incorporate BrdU at 7 days after differentiation induction under doxycycline, indicating sustained proliferation. Even without enforced expression of NeuroD1, FUBP1KD cells showed higher BrdU incorporation compared with NTKD cells (Figures 2C and S3A). However, FUBP1 knockdown in the background of NeuroD1 induction elicited much greater
increase of BrdU incorporation. This is due to generally increased cell survival with NeuroD1 expression under differentiation induction (data not shown). These results suggest that FUBP1 is necessary for a complete cell-cycle exit for terminal neuronal differentiation. To better define the molecular mechanism of the cellcycle exit impaired by FUBP1 loss, we performed RNA sequencing (RNA-seq) analyses of differentiated NTKD and FUBP1KD cultures. Gene ontology analyses of differentially expressed genes under differentiation conditions indicated that cell-cycle genes (i.e., CCNB1, CCNB2, CCND1, PLK1, BUB1, BUB1B, CDC20, and MCM5) are the most represented category (Figure S3B). We further tested the role of cell-cycle deregulation in sustained mitotic phenotype of FUBP1KD cells. Treatment of PD0332991, a Stem Cell Reports j Vol. 10 j 1208–1221 j April 10, 2018 1211
CDK4/6 inhibitor, suppressed BrdU incorporation but failed to restore neuronal differentiation (Figure S3A and data not shown). These results together suggest that sustained proliferation is due to the impaired terminal differentiation rather than the direct role of FUBP1 in cell-cycle regulation. FUBP1 Promotes the Expression of LSD1+8a during Neuronal Differentiation Recent studies suggested a context-dependent splicingregulatory function of FUBP1 (Jacob et al., 2014; Li et al., 2013; Miro et al., 2015). In agreement, many interacting proteins identified by mass spectrometry and confirmatory co-immunoprecipitation analysis belong to components of spliceosomes (e.g., PTBP2, NOVA1 and NOVA2, and SRRM4) (Table S1 and Figure S4), raising the possibility that FUBP1 could have a functional role in splicing control during neuronal differentiation. In particular, the interaction between FUBP1 and SRRM4 appears indirect and RNA dependent as it is abolished by RNase A treatment (Figure S4). Notably, our analysis of RNA-seq experiments for global alternative splicing (AS) events occurring in differentiating FUBP1KD NPC showed increased exon skipping consistent with its reported function in exon inclusions (Jacob et al., 2014; Miro et al., 2015) (Figure S5). In addition, we calculated Z score of differential exon usage focusing on transcripts with little to no expression changes between NTKD and FUBP1KD cells. From the analysis, 838 differentially used exons with Z score of larger than 2 corresponding to 689 genes were identified, further supporting the role of FUBP1 in AS control (Table S2). Among those neuron-specific splicing factors, we noted that the expression of SRRM4 is gradually increased in differentiating NPCND1 cells (Figure 2D), consistent with its role in neuronal differentiation and maturation (Quesnel-Vallie`res et al., 2015). However, it failed to increase beginning from differentiation day 3 in NPCND1 FUBP1KD cells (Figure 2E). These results suggest that loss of FUBP1 affects SRRM4 expression, likely due to impaired neuronal differentiation. Previously, several lines of evidence have suggested that LSD1 has a critical role in NPC differentiation and neuronal maturation. The LSD1 gene, which is highly conserved among vertebrates, consists of 19 exons. However, due to the existence of two additional exons (exon 2a and exon 8a) that can be included in mature LSD1 mRNA, four different LSD1 transcripts can be generated. Among these isoforms, LSD1+8a, which contains miniexon 8a, is exclusively expressed in the nervous system (Zibetti et al., 2010). In addition, the expression of the LSD1+8a isoforms is upregulated during neuronal differentiation and throughout cortical development (Laurent 1212 Stem Cell Reports j Vol. 10 j 1208–1221 j April 10, 2018
et al., 2015; Zibetti et al., 2010). Downregulation of LSD1+8a strongly inhibited neurite outgrowth and abrogated the establishment of the neurite network. A previous study reported that neuron-specific splicing factors such as SRRM4 and NOVA1 are necessary for LSD1+8a expression (Rusconi et al., 2015). Because (1) loss of FUBP1, SRRM4, or LSD1+8a impaired neuronal differentiation (Laurent et al., 2015; Raj et al., 2011) (Figures 2A and 2B), (2) FUBP1 and SRRM4 are functionally associated (Figure 2E), and (3) AS of LSD1 is critical during neuronal maturation, we hypothesized that FUBP1 along with SRRM4 may be required for the splicing of LSD1 to include mini-exon 8a. First, we analyzed the expression of LSD1+8a and LSD18a by using specific primers that detect each isoform (Figure 3A). Neuronal differentiation by NeuroD1 induction time-dependently increased the mRNA expression level of LSD1+8a in NPCND1 while the levels of total LSD1 or LSD18a were only modestly increased (Figure 3B). It is noteworthy that LSD18a is much more abundant than LSD1+8a and accounts for the majority of LSD1 transcripts. Next, we tested whether loss of FUBP1 can influence the production of alternatively spliced isoforms of LSD1. Interestingly, the expression of LSD1+8a was significantly decreased in NPCND1 FUBP1KD NPCs, compared with NPCND1 NTKD cells (p = 0.0005, Figures 3C and 3D). On the contrary, the expression of LSD18a was increased and that of total LSD1 remained constant. These results suggest that splicing of LSD1+8a might be regulated by FUBP1 in NPC during differentiation. To gauge the contribution of SRRM4 to LSD1+8a expression, we expressed human SRRM4 in NPCND1 NTKD and NPCND1 FUBP1KD cells. Endogenous SRRM4 expression was low on day 1 of differentiation (Figure 2D) and further decreased in NPCND1 FUBP1KD cells. However, enforced SRRM4 at this stage was sufficient to elevate LSD1+8a expression to detectable levels in both NPCND1 NTKD and NPCND1 FUBP1KD cells (Figure 3E). In contrast, it failed to increase LSD1+8a expression and NeuN expression on day 3 of differentiation in NPCND1 FUBP1KD cells (Figure 3F). These results together suggest that SRRM4 expression at early stages and FUBP1 levels in later stages of differentiation play a role as rate-limiting factors of LSD1+8a expression. To test whether FUBP1 or SRRM4 physically associate with LSD1+8a pre-mRNA and regulate the splicing of mini-exon 8a during neuronal differentiation, we performed an RNA-immunoprecipitation (RNA-IP) experiment with differentiating NPCND1. We conducted the experiment 2.5 days after the onset of differentiation, when the expression of FUBP1, SRRM4, and LSD1+8a increases as the majority of NPCND1 cells transit through late DCX stages (Figures 2D, 3B, 4A, and S2B). We searched
Figure 3. FUBP1 Promotes Inclusion of Neuron-Specific Exon 8a (A) Schematic representation of primer sets that specifically detect total LSD1, LSD1+8a, and LSD18a. (B and C) Relative expression levels of specific LSD1 isoforms during NPCND1 differentiation by doxycycline (Dox) induction (B) or NPCND1 NTKD versus NPCND1 FUBP1KD (C) were determined by qPCR (mean ± SEM from 3 independent cultures). (D–F) RT-PCR detection of alternatively spliced LSD1+8a and LSD18a in Doxinduced NPCND1 NTKD versus NPCND1 FUBP1KD. A set of PCR primers with their location depicted as green arrows in (A) were used. Band intensity was plotted (mean ± SEM from 3 independent cultures). Statistical significance was determined by unpaired t tests. Relative mRNA levels of indicated genes were determined from NPCND1 NTKD versus NPCND1 FUBP1KD with human SRRM4 expression under proliferation (E) or on day 3 of differentiation (F) (mean ± SEM from 3 independent cultures). *p < 0.05; **p < 0.01; ***p < 0.001. Statistical significance was determined by one-way ANOVA. See also Figure S4.
for the TG-rich FUBP1-binding motif (Miro et al., 2015) in intron 8 and 8a of LSD1, and designed multiple pairs of primers that span the putative FUBP1-binding sites (Figures 4B and S6). We identified two strong binding sites (R1 and R5) among five candidates (Figures 4C, 4D, and S4). Similarly, SRRM4 showed strong binding near the 30 end of intron 8, where the polypyrimidine tract preceding the putative UGC motif is present (Figures 4D and S6). The set of primers designed for a gene desert region failed to amplify RNA pulled down by immunoglobulin G (IgG), FUBP1, or SRRM4 antibodies, demonstrating the specificity of RNA-IP (Figures 4C and 4D). Primers amplifying the exonic region of GAPDH, which is not subject to FUBP1- or SRRM4-mediated splicing, failed to be enriched by the pull-down (Figure 4D).
To define the functional interaction between FUBP1 and SRRM4 in exon 8a inclusion, we performed a mini-gene reporter analysis (Cooper, 2005) (Figure 4E). Enforcing the expression of either FUBP1 or SRRM4 synergistically enhanced exon 8a inclusion (Figure 4F). Consistent with the RNA-IP result, mutations of either SRRM4 binding site or R5 (Figure 4E) abolished exon 8a inclusion (Figure 4G). Together, our results suggest that FUBP1 and SRRM4 bind to different regions within the introns 8 and 8a of LSD1 pre-mRNA and promote the inclusion of mini-exon 8a by AS in differentiating neurons. The LSD1+8a isoform may promote neuronal gene expression and generation of mature neurons as previously demonstrated (Laurent et al., 2015; Wang et al., 2015; Zibetti et al., 2010) (Figure 4H). Stem Cell Reports j Vol. 10 j 1208–1221 j April 10, 2018 1213
Figure 4. FUBP1 and SRRM4 Functionally Interact to Include Exon 8a (A) Representative western blot analysis of NPCND1 cells differentiated for 3 days. (B) Schematic presentation of relative location of candidate FUBP1-binding sites tested by RNA-IP. (C) A representative PCR amplification of RNA-IP. Primers for gene desert region were used to determine background genomic DNA contamination. (D) qPCR analysis of IgG versus anti-FUBP1 or anti-FLAG (SRRM4) antibody RNA-IP for R1 through R5 (mean ± SEM from 5 independent experiments). Statistical significance was determined by two-way ANOVA. ***p < 0.001; ****p < 0.0001. (E) Schematic representation of the hybrid LSD1 exon 8a mini-gene used in transient transfection splicing assay. a-Globin and fibronectin EDB exons are indicated in shaded boxes. The primer pairs used in RT-PCR assay are shown as blue (8a included only) and red (total transcript) arrows. Specific mutations introduced in R4, SRRM4 binding site, and R5 are indicated in red. (legend continued on next page)
1214 Stem Cell Reports j Vol. 10 j 1208–1221 j April 10, 2018
Restoration of LSD1+8a Expression Overcomes Impaired Terminal Neuronal Differentiation of FUBP1KD Cells To validate LSD1+8a as an obligatory downstream effector of FUBP1, we tested whether reinforcing its expression rescues terminal neuronal differentiation in NPCND1 FUBP1KD cells. First, we determined the expression of FUBP1 upon induction of LSD1 (+/ 8a) on differentiation day 3 when the expression of FUBP1 begins to increase in NPCND1 cells with NeuroD1 induction (Figure 5A). Unexpectedly, FUBP1 expression was further increased when LSD18a or LSD1+8a was induced. This suggests that both LSD1 isoforms enhanced early neurogenic differentiation as evidenced by high levels of DCX expression. Next, aberrantly elevated BrdU incorporation was suppressed in response to LSD1+8a induction in NPCND1 FUBP1KD cells (Figure 5B). Notably, the expression of NeuN and the frequency of MAP2a/b-positive terminally differentiated neurons were restored in LSD1+8a-, but not in LSD18a-expressed NPCND1 FUBP1KD to the level of NPCND1 NTKD (Figures 5C and 5D). These observations suggest that expression of LSD1+8a is necessary for timely coordination of differentiation and cell-cycle exit to complete neurogenesis. Collectively, our results support the hypothesis that FUBP1 is a rate-limiting factor for the expression of necessary levels of LSD1+8a isoform and therefore essential for terminal neuronal differentiation. Next, we queried whether LSD1+8a expression depends on FUBP1 under pathological conditions. Frequent loss of heterozygosity (LOH) of FUBP1 in 1p19q co-deleted ODG has been reported (Bettegowda et al., 2011; Cancer Genome Atlas Research Network et al., 2015). We have identified 8 tumors with FUBP1 LOH out of 12 ODGs (Figure 6A). Notably, these tumors showed significantly reduced expression of LSD1+8a but not LSD18a, corroborating our mechanistic findings (p = 0.0238, Figure 6B). Loss of FUBP1 in the Background of IDH1R132HExpressing NPCs Promotes Tumorigenesis In Vivo FUBP1 mutations are associated with neomorphic IDH1 or 2 mutations (R132H or R172K, respectively) and inactivating mutations in capicua (CIC) on 19q13 (Bettegowda et al., 2011; Hartmann et al., 2010; Ichimura et al., 2009; Parsons et al., 2008; Reitman and Yan, 2010; Sahm et al., 2012; Yan et al., 2009; Yip et al., 2012) in ODGs. Despite abundant genetic evidence, the mechanism of how loss-of-function mutations of FUBP1 contribute to gliomagenesis remains
unclear. On this basis, we first tested the combined effect of FUBP1 knockdown and expression of IDH1R132H in NPC culture. NTKD IDH1R132H NPCs lost BrdU incorporation, while FUBP1KD IDH1R132H NPCs continued to incorporate BrdU under differentiation conditions, suggesting that FUBP1 is necessary for a complete cell-cycle exit of NPCs (Figure 6C). Next, to determine the oncogenic potential caused by loss of FUBP1, we performed a tumorigenesis analysis of control or FUBP1-downregulated IDH1R132H PIK3CAH1047R (IP) NPC (Figure 6D). PIK3CAH1047R has one of the activating mutations of PIK3CA (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit a) and accelerated tumorigenesis in our experiments. However, its expression alone or with IDH1R132H was not sufficient to drive gliomagenesis (not shown). Notably, intracranial injection of FUBP1KD IP NPCs resulted in tumor growth and reduced overall survival of tumor-bearing animals. NTKD IP NPCs failed to grow tumors (Figures 6E and 6F), suggesting that loss of FUBP1 is necessary to initiate the tumorigenesis. Lastly, we enforced LSD1+8a expression in FUBP1KD IP NPCs to test whether restoring terminal differentiation suppresses tumorigenesis. Consistent with our mechanistic model, LSD1+8a expression prevented the outgrowth of FUBP1KD IP NPCs in vivo (Figure 6G). Taken together, we find that loss of FUBP1 critically contributes to the initiation of tumorigenesis by sustaining the proliferation of IP NPCs in vivo.
DISCUSSION The importance and non-redundant role of FUBP1 in the development of the mammalian brain has been demonstrated (Zhou et al., 2016). Nevertheless, the role of FUBP1 in lineage commitment and terminal differentiation of NPCs is uncharted. Our study demonstrated that FUBP1 expression is dynamically regulated during NPC differentiation and is indispensable for terminal neuronal maturation. Similarly, a recent study reported that loss of FUBP1 expression in embryonic stem cells delayed differentiation into the mesoderm germ layer, or diminished differentiation into the erythroid lineage, further corroborating its context-specific function in cell-fate regulation (Wesely et al., 2017). Similar to several other neuronal differentiation splicing factors such as PTBP2 and RBFOX1, its loss critically contributes to gliomagenesis through trapping NPCs in a slowly proliferating progenitor-like state
(F and G) Mini-gene reporter assay following the transient transfection of indicated reporters and exogenous SRRM4 and FUBP1 (mean ± SEM from 3 independent experiments). Statistical significance was determined by one-way ANOVA. **p < 0.01; ****p < 0.0001. (H) A schema for FUBP1 regulation of LSD1+8a expression and differentiation. See also Figures S4–S6. Stem Cell Reports j Vol. 10 j 1208–1221 j April 10, 2018 1215
Figure 5. Expression of LSD1+8a Restores Terminal Neuronal Differentiation of FUBP1KD NPCs (A) Representative western blot analysis of induced LSD18a and LSD+8a, FUBP1, and DCX expressions in NPCND1 cells differentiated for 3 days (50,000 cells/lane). (B–D) Immunofluorescence analysis for MAP2a/b (B), NeuN (C), or BrdU (D) incorporation of differentiated NPCND1 cells with indicated knockdown or overexpression. Scale bars, 50 mm. Quantitation of representative experiments is plotted on the right (mean ± SEM from 3 independent cultures). Statistical significance was determined by one-way ANOVA. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.
in the background of IDH1R132H expression. Prior to our study, the majority of biological functions of FUBP1 was paradoxically attributed to promoting proliferation. In agreement with this assumption, most human cancers were shown to express high levels of FUBP1, which predict poor prognosis (Baumgarten et al., 2014; Li et al., 2013; Malz et al., 2009; Rabenhorst et al., 2009; Singer et al., 2009; Zhang et al., 2013). Our identification of LSD1+8a as a downstream effector of FUBP1 action in neuronal differentiation may explain the molecular mechanism of how FUBP1 and IDH1 muta1216 Stem Cell Reports j Vol. 10 j 1208–1221 j April 10, 2018
tions collaborate during gliomagenesis. LSD1+8a acts as demethylase of H3K9me2 that is required for derepression of gene expression for terminal neuronal differentiation (Laurent et al., 2015). Previous studies showed that IDH1R132H-expressing NPCs failed to differentiate to the astrocytic marker GFAP or neuronal marker MAP2- and Synapsin 1-positive cells (Lu et al., 2012; Rosiak et al., 2016). Impaired lineage differentiation was in part explained by 2-hydroxyglutarate (2-HG) produced by IDH1R132H, which inhibits histone demethylases including H3K9me2/3-demethylating KDM4C. This leads to the
Figure 6. Loss of FUBP1 Collaboratively with IDH1R132H and PIK3CAH1047R Expression in NPCs Promotes Orthotopic Tumor Growth (A) Representative western blot (WB) analysis of FUBP1 in ODG patient samples (n = 12) with 1p19q co-deletion. (B) qPCR analysis of LSD1+8a and LSD18a mRNA levels from tumors from (A). *p < 0.05; ns, not significant. (C) Immunofluorescence analysis of BrdU incorporation in differentiated IDH1R132H NTKD versus IDH1R132H FUBP1KD NPCs (day 1–5). Scale bar, 50 mm. Quantitation of BrdU-positive cells from a representative experiment is plotted in the graph on the right (mean ± SEM from 5 independent experiments). Statistical significance was determined by unpaired t tests. *p < 0.05; ***p < 0.001. (legend continued on next page) Stem Cell Reports j Vol. 10 j 1208–1221 j April 10, 2018 1217
deregulation of gene expression subject to H3K9me2/ 3-mediated repression. Decreased expression of H3K9 demethylase LSD1+8a and accumulation of its inhibitory 2-HG in FUBP1KD IDH1R132H NPC may together synergistically block terminal differentiation. Sequential actions of splicing factors in neuronal differentiation could be deduced based on their expression patterns and phenotypic consequences of their loss. Among those we surveyed, expression of NOVA2 and SRRM4 was increased by NeuroD1 and as differentiation progresses in NPCND1 cells (data not shown). NOVA1 and NOVA2 double-knockout mice showed delayed neuronal migration without neuronal differentiation defects in the developing brain (Leggere et al., 2016). SRRM4 mutant mice showed increased early-born immature TBR1+ neurons and a decrease in NeuN+ mature neurons and PAX6+ neural progenitors. In addition, neuritogenesis defects were noted (Quesnel-Vallie`res et al., 2015). This phenotype is likely to be the most similar to the FUBP1 null defect, given the decline in NeuN+ populations in vitro and the increase in early neurons in vivo. These may serve as limiting factors for neuronal maturation and their expression is also regulated by the action of differentiation stage-specific factors including FUBP1. We suspect that decreased SRRM4 expression in FUBP1KD NPC is largely due to impaired neuronal differentiation and in part direct transcriptional regulation, based on our RNA-seq data showing a decrease even before the onset of differentiation. Our molecular model supports the differentiation cascade controlled by these factors (Figure 4H). What tethers FUBP1 to the transcriptional regulator complex in proliferating cells as reported by others, and to spliceosomes responsible for the inclusion of exon 8a to the LSD1 transcript during terminal differentiation of neurons, remains to be further defined. Interestingly, our mass spectrometry analysis of FUBP1-interacting proteins identified SWI/SNF chromatin remodeling factors and histone subunits (Table S1). This is in agreement with the previously demonstrated role of FUBP1 as a transcriptional regulator. In particular, FUBP1 was shown to bind to the far upstream sequence element, only in proliferating cells, and upregulate c-Myc expression. It is plausible that specific epigenetic modifications or transcription machineries are required for FUBP1-mediated transcriptional regulation. We also noted that mRNA levels and protein expression of FUBP1 are not always collinear. For example, FUBP1 protein levels are deeply reduced by a 20%–30% knockdown of
its mRNA levels (Figure S2D). A previous study also reported such a discrepancy, suggesting possible regulation at post-translational levels (Wesely et al., 2017). Indeed, FUBP1 was identified as an authentic PARKIN E3 ligase substrate (Ko et al., 2006). How protein stability plays a role in FUBP1-dependent biological functions including neurogenic differentiation warrants further study. Our mechanistic findings of FUBP1 action in glioma suppression warrant future investigations. Currently ODG is incurable despite the favorable prognosis. Our study may strengthen the rationale for novel mechanism-driven therapeutic strategies. Re-expression of key effector genes necessary for terminal differentiation may reduce undifferentiated progenitor state cells. One such approach would be normalization of aberrantly marked repressive H3K9me2/3 by inhibitors of H3K9 methyltransferases G9a or GLP. In a recent study, a dual G9a/GLP inhibitor UNC0642 was effective in restoring ATM expression and its function in IDH1-mutant hematopoietic cells where H3K9 methylation at the ATM promoter was elevated and transcriptionally repressive (Inoue et al., 2016). Similarly, an inhibitor of mutant IDH was shown to reverse blocked differentiation in gliomas and reduced tumor burdens in patient-derived xenografts (Rohle et al., 2013). Strategic combination of these inhibitors may prove effective in releasing cells trapped in early differentiation stages. In conclusion, our results reveal that these molecular mechanisms outlining how FUBP1 regulates NPC fate can help our understanding of ODG pathogenesis and facilitate the development of novel therapeutic strategies.
EXPERIMENTAL PROCEDURES Animal experiments This study was conducted in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals. All procedures were approved by the Institutional Animal Care and Use Committee.
NPC Cultures and Induction into Terminally Differentiated Neurons Ink/Arf/ NPCs isolated from the subventricular zone of P1 neonatal mouse brain were transduced with viral particles of pLenti-CMV-rtTA3-hygro (Addgene #26730) and Tet-O-Neurod1puro (Addgene #52052) (NPCND1). After selecting the culture with 50 mg/mL hygromycin and 1 mg/mL puromycin for 3 days, the cells were divided and transduced with virus encoding short
(D) Western blot analysis to confirm the genotype of experimental cultures. (E and G) BLI of representative animals orthotopically injected with indicated genotypes of NPCs. **p < 0.01. (F and H) Kaplan-Meier survival curves (n = 5–6 for each group). Note that curves for NTKD, FUBP1KD, and IP overlap in (F). p Values were calculated by log-rank (Mantel-Cox) test. 1218 Stem Cell Reports j Vol. 10 j 1208–1221 j April 10, 2018
hairpin RNA (shRNA) for FUBP1 (shFUBP1-1, TRCN0000013293 or shFUBP1-7, TRCN0000230197) or non-targeting shRNA for control (NTKD, SH016, pLKO.1-puro). LSD18a and LSD1+8a vectors were provided by Dr. Yang Shi. LSD18a and LSD1+8a were gateway cloned to pINDUCER vector (Addgene #44012). For the induction of terminally differentiated neurons, NPCND1 were plated on fibronectin- and poly-L-ornithine-coated surface. On day 0, culture medium was replaced with N2 containing BDNF (10 ng/mL, PeproTech), NT-3 (10 ng/mL, PeproTech), B27 (Invitrogen #17504044), and/or doxycycline (2 mg/mL). On day 2, 1% fetal bovine serum was added to the medium to support the fitness of the culture.
Mini-Gene Reporter Analysis A mouse genomic fragment (780 bp) encompassing LSD1 exon 8a was PCR amplified and cloned into pTBNde(min) (Addgene #15125) using the NdeI site. The reporter was further mutagenized on R4, R5, and SRRM4 binding sites by a site-directed mutagenesis kit (Agilent QuikChange Lightning Site-Directed Mutagenesis Kit, #210518). NPCND1 cells on differentiation day 1 were transfected with 1.2 mg of reporter constructs by Lipofectamine 3000 (Thermo Fisher #L3000008) as previously described (Kim et al., 2015) and harvested for qRT-PCR analysis after 24 hr. Transcript including exon 8a was measured and normalized by the level of total a-globin and fibronectin EDB transcripts. Sequences of oligos used are listed in Supplemental Experimental Procedures.
Statistical Analysis We determined experimental sample sizes on the basis of preliminary data. All results are expressed as mean ± SEM. GraphPad Prism software (version 7; GraphPad, San Diego, CA) was used for all statistical analysis. Normal distribution of the sample sets was determined before applying unpaired Student’s two-tailed t test for two-group comparisons. ANOVA was used to assess the differences between multiple groups. The mean values of each group were compared by the Bonferroni’s post hoc procedure. Differences were considered significant when p < 0.05.
constructing databases), I.H., H.Z., Y.Y., and J.P.; Study Supervision: Y.Y. and J.P.
ACKNOWLEDGMENTS We thank Drs. Yimeng Zhao and Guoan Zhang at the Proteomics and Metabolomics Core Facility of The Weill Cornell Medicine for mass spectrometry analysis. This work was supported by the National Key Research and Development Program for Precision Medicine 2017YFC0909800 (to Qj.Q.), the Irma T. Hirschl Award, the Feldstein Medical Foundation, the Anna Maria and the Kellen foundation, and NIH grant AG048284 (to J.P.). Received: September 22, 2017 Revised: February 26, 2018 Accepted: February 28, 2018 Published: March 29, 2018
REFERENCES Baumgarten, P., Harter, P.N., To¨njes, M., Capper, D., Blank, A.E., Sahm, F., von Deimling, A., Kolluru, V., Schwamb, B., Rabenhorst, U., et al. (2014). Loss of FUBP1 expression in gliomas predicts FUBP1 mutation and is associated with oligodendroglial differentiation, IDH1 mutation and 1p/19q loss of heterozygosity. Neuropathol. Appl. Neurobiol. 40, 205–216. Bettegowda, C., Agrawal, N., Jiao, Y., Sausen, M., Wood, L.D., Hruban, R.H., Rodriguez, F.J., Cahill, D.P., McLendon, R., Riggins, G., et al. (2011). Mutations in CIC and FUBP1 contribute to human oligodendroglioma. Science 333, 1453–1455. Bruggeman, S.W., Valk-Lingbeek, M.E., van der Stoop, P.P., Jacobs, J.J., Kieboom, K., Tanger, E., Hulsman, D., Leung, C., Arsenijevic, Y., Marino, S., and van Lohuizen, M. (2005). Ink4a and Arf differentially affect cell proliferation and neural stem cell self-renewal in Bmi1-deficient mice. Genes Dev. 19, 1438–1443.
ACCESSION NUMBERS
Cancer Genome Atlas Research Network, Brat, D.J., Verhaak, R.G., Aldape, K.D., Yung, W.K., Salama, S.R., Cooper, L.A., Rheinbay, E., Miller, C.R., Vitucci, M., Morozova, O., et al. (2015). Comprehensive, integrative genomic analysis of diffuse lower-grade gliomas. N. Engl. J. Med. 372, 2481–2498.
The accession number for the RNA-seq data reported in this paper is GEO: GSE108537.
Cooper, T.A. (2005). Use of minigene systems to dissect alternative splicing elements. Methods 37, 331–340.
SUPPLEMENTAL INFORMATION Supplemental Information includes Supplemental Experimental Procedures, six figures, and two tables and can be found with this article online at https://doi.org/10.1016/j.stemcr.2018.02.013.
AUTHOR CONTRIBUTIONS Conception and Design, I.H. and J.P.; Development of Methodology, I.H. and T.Z.; Acquisition of Data, I.H., D.C., Y.N., D.-Y.K., H.O., and J.P.; Analysis and Interpretation of Data (e.g., statistical analysis, biostatistics, computational analysis), I.H., T.Z., H.O., J.Y., H.Z., Y.Y., and J.P.; Writing, Review, and/or Revision of the Manuscript, I.H., D.-Y.K., J.H., J.Y., Y.Y., and J.P.; Administrative, Technical, or Material Support (e.g., reporting or organizing data,
Gage, F.H. (2000). Mammalian neural stem cells. Science 287, 1433–1438. Han, X., Gui, B., Xiong, C., Zhao, L., Liang, J., Sun, L., Yang, X., Yu, W., Si, W., Yan, R., et al. (2014). Destabilizing LSD1 by Jade-2 promotes neurogenesis: an antibraking system in neural development. Mol. Cell 55, 482–494. Hartmann, C., Hentschel, B., Wick, W., Capper, D., Felsberg, J., Simon, M., Westphal, M., Schackert, G., Meyermann, R., Pietsch, T., et al. (2010). Patients with IDH1 wild type anaplastic astrocytomas exhibit worse prognosis than IDH1-mutated glioblastomas, and IDH1 mutation status accounts for the unfavorable prognostic effect of higher age: implications for classification of gliomas. Acta Neuropathol. 120, 707–718. Ichimura, K., Pearson, D.M., Kocialkowski, S., Ba¨cklund, L.M., Chan, R., Jones, D.T., and Collins, V.P. (2009). IDH1 mutations
Stem Cell Reports j Vol. 10 j 1208–1221 j April 10, 2018 1219
are present in the majority of common adult gliomas but rare in primary glioblastomas. Neuro Oncol. 11, 341–347. Inoue, S., Li, W.Y., Tseng, A., Beerman, I., Elia, A.J., Bendall, S.C., Lemonnier, F., Kron, K.J., Cescon, D.W., Hao, Z., et al. (2016). Mutant IDH1 downregulates ATM and alters DNA repair and sensitivity to DNA damage independent of TET2. Cancer Cell 30, 337–348. Jackson, E.L., Garcia-Verdugo, J.M., Gil-Perotin, S., Roy, M., Quinones-Hinojosa, A., VandenBerg, S., and Alvarez-Buylla, A. (2006). PDGFR alpha-positive B cells are neural stem cells in the adult SVZ that form glioma-like growths in response to increased PDGF signaling. Neuron 51, 187–199. Jacob, A.G., Singh, R.K., Mohammad, F., Bebee, T.W., and Chandler, D.S. (2014). The splicing factor FUBP1 is required for the efficient splicing of oncogene MDM2 pre-mRNA. J. Biol. Chem. 289, 17350–17364. Kim, D.Y., Hwang, I., Muller, F.L., and Paik, J.H. (2015). Functional regulation of FoxO1 in neural stem cell differentiation. Cell Death Differ. 22, 2034–2045. Ko, H.S., Kim, S.W., Sriram, S.R., Dawson, V.L., and Dawson, T.M. (2006). Identification of far upstream element-binding protein-1 as an authentic Parkin substrate. J. Biol. Chem. 281, 16193–16196. Kriegstein, A., and Alvarez-Buylla, A. (2009). The glial nature of embryonic and adult neural stem cells. Annu. Rev. Neurosci. 32, 149–184. Laurent, B., Ruitu, L., Murn, J., Hempel, K., Ferrao, R., Xiang, Y., Liu, S., Garcia, B.A., Wu, H., Wu, F., et al. (2015). A specific LSD1/ KDM1A isoform regulates neuronal differentiation through H3K9 demethylation. Mol. Cell 57, 957–970. Leggere, J.C., Saito, Y., Darnell, R.B., Tessier-Lavigne, M., Junge, H.J., and Chen, Z. (2016). NOVA regulates Dcc alternative splicing during neuronal migration and axon guidance in the spinal cord. Elife 5. https://doi.org/10.7554/eLife.14264. Li, H., Wang, Z., Zhou, X., Cheng, Y., Xie, Z., Manley, J.L., and Feng, Y. (2013). Far upstream element-binding protein 1 and RNA secondary structure both mediate second-step splicing repression. Proc. Natl. Acad. Sci. USA 110, E2687–E2695. Lu, C., Ward, P.S., Kapoor, G.S., Rohle, D., Turcan, S., Abdel-Wahab, O., Edwards, C.R., Khanin, R., Figueroa, M.E., Melnick, A., et al. (2012). IDH mutation impairs histone demethylation and results in a block to cell differentiation. Nature 483, 474–478. Malz, M., Weber, A., Singer, S., Riehmer, V., Bissinger, M., Riener, M.O., Longerich, T., Soll, C., Vogel, A., Angel, P., et al. (2009). Overexpression of far upstream element binding proteins: a mechanism regulating proliferation and migration in liver cancer cells. Hepatology 50, 1130–1139.
Quesnel-Vallie`res, M., Irimia, M., Cordes, S.P., and Blencowe, B.J. (2015). Essential roles for the splicing regulator nSR100/SRRM4 during nervous system development. Genes Dev. 29, 746–759. Rabenhorst, U., Beinoraviciute-Kellner, R., Brezniceanu, M.L., Joos, S., Devens, F., Lichter, P., Rieker, R.J., Trojan, J., Chung, H.J., Levens, D.L., and Zo¨rnig, M. (2009). Overexpression of the far upstream element binding protein 1 in hepatocellular carcinoma is required for tumor growth. Hepatology 50, 1121–1129. Rabenhorst, U., Thalheimer, F.B., Gerlach, K., Kijonka, M., Bo¨hm, S., Krause, D.S., Vauti, F., Arnold, H.H., Schroeder, T., Schnutgen, F., et al. (2015). Single-stranded DNA-binding transcriptional regulator FUBP1 is essential for fetal and adult hematopoietic stem cell self-renewal. Cell Rep. 11, 1847–1855. Raj, B., O’Hanlon, D., Vessey, J.P., Pan, Q., Ray, D., Buckley, N.J., Miller, F.D., and Blencowe, B.J. (2011). Cross-regulation between an alternative splicing activator and a transcription repressor controls neurogenesis. Mol. Cell 43, 843–850. Reitman, Z.J., and Yan, H. (2010). Isocitrate dehydrogenase 1 and 2 mutations in cancer: alterations at a crossroads of cellular metabolism. J. Natl. Cancer Inst. 102, 932–941. Rohle, D., Popovici-Muller, J., Palaskas, N., Turcan, S., Grommes, C., Campos, C., Tsoi, J., Clark, O., Oldrini, B., Komisopoulou, E., et al. (2013). An inhibitor of mutant IDH1 delays growth and promotes differentiation of glioma cells. Science 340, 626–630. Rosiak, K., Smolarz, M., Stec, W.J., Peciak, J., Grzela, D., WinieckaKlimek, M., Stoczynska-Fidelus, E., Krynska, B., Piaskowski, S., and Rieske, P. (2016). IDH1R132H in neural stem cells: differentiation impaired by increased apoptosis. PLoS One 11, e0154726. Rusconi, F., Paganini, L., Braida, D., Ponzoni, L., Toffolo, E., Maroli, A., Landsberger, N., Bedogni, F., Turco, E., Pattini, L., et al. (2015). LSD1 neurospecific alternative splicing controls neuronal excitability in mouse models of epilepsy. Cereb. Cortex 25, 2729–2740. Sahm, F., Koelsche, C., Meyer, J., Pusch, S., Lindenberg, K., Mueller, W., Herold-Mende, C., von Deimling, A., and Hartmann, C. (2012). CIC and FUBP1 mutations in oligodendrogliomas, oligoastrocytomas and astrocytomas. Acta Neuropathol. 123, 853–860. Sanai, N., Alvarez-Buylla, A., and Berger, M.S. (2005). Neural stem cells and the origin of gliomas. N. Engl. J. Med. 353, 811–822. Singer, S., Malz, M., Herpel, E., Warth, A., Bissinger, M., Keith, M., Muley, T., Meister, M., Hoffmann, H., Penzel, R., et al. (2009). Coordinated expression of stathmin family members by far upstream sequence element-binding protein-1 increases motility in non-small cell lung cancer. Cancer Res. 69, 2234–2243. Sun, G., Alzayady, K., Stewart, R., Ye, P., Yang, S., Li, W., and Shi, Y. (2010). Histone demethylase LSD1 regulates neural stem cell proliferation. Mol. Cell. Biol. 30, 1997–2005.
Miro, J., Laaref, A.M., Rofidal, V., Lagrafeuille, R., Hem, S., Thorel, D., Me´chin, D., Mamchaoui, K., Mouly, V., Claustres, M., and Tuffery-Giraud, S. (2015). FUBP1: a new protagonist in splicing regulation of the DMD gene. Nucleic Acids Res. 43, 2378–2389.
Wang, J., Scully, K., Zhu, X., Cai, L., Zhang, J., Prefontaine, G.G., Krones, A., Ohgi, K.A., Zhu, P., Garcia-Bassets, I., et al. (2007). Opposing LSD1 complexes function in developmental gene activation and repression programmes. Nature 446, 882–887.
Parsons, D.W., Jones, S., Zhang, X., Lin, J.C., Leary, R.J., Angenendt, P., Mankoo, P., Carter, H., Siu, I.M., Gallia, G.L., et al. (2008). An integrated genomic analysis of human glioblastoma multiforme. Science 321, 1807–1812.
Wang, J., Telese, F., Tan, Y., Li, W., Jin, C., He, X., Basnet, H., Ma, Q., Merkurjev, D., Zhu, X., et al. (2015). LSD1n is an H4K20 demethylase regulating memory formation via transcriptional elongation control. Nat. Neurosci. 18, 1256–1264.
1220 Stem Cell Reports j Vol. 10 j 1208–1221 j April 10, 2018
¨ tgen, F., Kaulich, M., Rieger, M.A., and Wesely, J., Steiner, M., Schnu ¨ rnig, M. (2017). Delayed mesoderm and erythroid differentiaZo tion of murine embryonic stem cells in the absence of the transcriptional regulator FUBP1. Stem Cells Int. 2017, 12.
Zheng, H., Ying, H., Wiedemeyer, R., Yan, H., Quayle, S.N., Ivanova, E.V., Paik, J.H., Zhang, H., Xiao, Y., Perry, S.R., et al. (2010). PLAGL2 regulates Wnt signaling to impede differentiation in neural stem cells and gliomas. Cancer Cell 17, 497–509.
Yan, H., Parsons, D.W., Jin, G., McLendon, R., Rasheed, B.A., Yuan, W., Kos, I., Batinic-Haberle, I., Jones, S., Riggins, G.J., et al. (2009). IDH1 and IDH2 mutations in gliomas. N. Engl. J. Med. 360, 765–773.
Zheng, H., Ying, H., Yan, H., Kimmelman, A.C., Hiller, D.J., Chen, A.J., Perry, S.R., Tonon, G., Chu, G.C., Ding, Z., et al. (2008). p53 and Pten control neural and glioma stem/progenitor cell renewal and differentiation. Nature 455, 1129–1133.
Yip, S., Butterfield, Y.S., Morozova, O., Chittaranjan, S., Blough, M.D., An, J., Birol, I., Chesnelong, C., Chiu, R., Chuah, E., et al. (2012). Concurrent CIC mutations, IDH mutations, and 1p/19q loss distinguish oligodendrogliomas from other cancers. J. Pathol. 226, 7–16. Zhang, F., Tian, Q., and Wang, Y. (2013). Far upstream elementbinding protein 1 (FUBP1) is overexpressed in human gastric cancer tissue compared to non-cancerous tissue. Onkologie 36, 650–655. Zhang, J., and Chen, Q.M. (2013). Far upstream element binding protein 1: a commander of transcription, translation and beyond. Oncogene 32, 2907–2916.
Zhou, W., Chung, Y.J., Parrilla Castellar, E.R., Zheng, Y., Chung, H.J., Bandle, R., Liu, J., Tessarollo, L., Batchelor, E., Aplan, P.D., and Levens, D. (2016). Far upstream element binding protein plays a crucial role in embryonic development, hematopoiesis, and stabilizing Myc expression levels. Am. J. Pathol. 186, 701–715. Zibetti, C., Adamo, A., Binda, C., Forneris, F., Toffolo, E., Verpelli, C., Ginelli, E., Mattevi, A., Sala, C., and Battaglioli, E. (2010). Alternative splicing of the histone demethylase LSD1/KDM1 contributes to the modulation of neurite morphogenesis in the mammalian nervous system. J. Neurosci. 30, 2521–2532.
Stem Cell Reports j Vol. 10 j 1208–1221 j April 10, 2018 1221
Stem Cell Reports, Volume 10
Supplemental Information
Far Upstream Element-Binding Protein 1 Regulates LSD1 Alternative Splicing to Promote Terminal Differentiation of Neural Progenitors Inah Hwang, Dongqing Cao, Yoonmi Na, Do-Yeon Kim, Tuo Zhang, Jun Yao, Hwanhee Oh, Jian Hu, Hongwu Zheng, Yu Yao, and Jihye Paik
DAPI
B
FUBP1
OLIG2
NeuN
Corpus Callosum
GFAP
Cortex
A
NESTIN
FUBP1
DAPI Merged
D
D0
C
dcx DCX+
FUBP1
NeuN
DAPI Merged
D7-9
yubb3 TUBB3+
Nestin NESTIN+
FUBP1
DAPI Merged
4
3
Strong
D3-5
DCX
Intermediate
Expression Level of FUBP1
2
neuN NeuN+
Weak1
DAPI Merged
None0
FUBP1
-1
TUBB3
Figure S1. Expression of FUBP1 in the adult mouse brain and differentiating NPC cultures. Related to Figure 1. (A) A representative FUBP1 IHC analysis of brain cortex, corpus callosum, and hippocampus is shown. Note FUBP1 expression is exclusive to neurons in cortex and hippocampus while completely negative for glia-rich corpus callosum. Boxed areas are presented as higher magnification on the right or below. Scale bar= 100 µm (B) Co-IF staining for FUBP1 (green) and lineage markers (red) and DAPI (light blue). Yellow arrow heads point to same nuclei in different channels. Scale bar= 10 µm (C) IF analysis of FUBP1 co-stained with markers at indicated stages of NPCs during differentiation. Arrowheads point to typical marker-positive cells. Scale bar = 50 µm (D) Quantitative analysis of FUBP1-positive cells from a specific marker-expressing cell (n=50 cells from 3 independent cultures). Error bars, mean ± s.e.m.
A
D3 NeuroD1 DAPI -Dox
NPCND1
NeuroD1/ACTB
+Dox
10-3 20 15 10 5 0
0 0.2 0.5 1
C
NPCND1
D3 DCX DAPI -Dox +Dox
2 dox (µg/ml)
BrdU DAPI -Dox +Dox
BrdU+/DAPI (%)
B
D0 LSD1+8a
NTKD
LSD1-8a
FUBP1KD
D3
80
***
60
Dox 0 Dox 2
40 20 0
D0
D3
0.04 0.03 0.02 0.01 0.00 (7
B
FUBP1KD
FU
B FU
P1
(1
)
(7)
)
(1)
P1
NTKD TR C
ACTB
Relative FUBP1 mRNA expression
FUBP1
FUBP1KD (7)
NTKD
D
FUBP1KD (1)
NPCND1
Figure S2. Characterization of NPCND1. Related to Figure 2. (A) NeuroD1 expression analysis by IF (left) and qPCR (right) on day 3 of Dox treatment (mean ± s.e.m from 3 independent cultures). (B) IF analysis for DCX+. (left) Doxycycline treatment condition shows >70 % neuroblasts after 3 day differentiation. (right) No differences in DCX+ neuroblast production in NTKD, FUBP1KD with or without the expression of LSD1 or LSD1+8a on day 3 of differentiation in NPCND1 on Dox. (C) Dramatic decrease of BrdU incorporation in NPCND1 cells after 3 days of differentiation (mean ± s.e.m from 5 independent cultures). ***P < 0.001. Statistical significance was determined by one way ANOVA. Scale bar= 50 µm (D) A representative FUBP1 immunoblot and qPCR analysis of FUBP1 mRNA (mean ± s.e.m from 4 independent cultures) of two independent hairpin-infected NPCs.
A
BrdU DAPI D3
D5
NTKD
D0
FUBP1KD(7)
FUBP1KD(1)
BrdU positive cells (%)
60
**
NTKD FUBP1KD(1) FUBP1KD(7)
40
*** *** ** ***
20 0
- - - +++ - - - +++ - - - +++
D0
D3
D5
PD
B Term mmu04110: mmu00350: mmu05322: mmu00360: mmu00340: mmu04114: mmu00010: mmu00460: mmu04914: mmu04974:
Cell cycle Tyrosine metabolism Systemic lupus erythematosus Phenylalanine metabolism Histidine metabolism Oocyte meiosis Glycolysis / Gluconeogenesis Cyanoamino acid metabolism Oocyte maturation Protein digestion and absorption
P-Value 1.85E-03 7.75E-03 1.88E-02 2.39E-02 2.58E-02 2.81E-02 3.17E-02 6.13E-02 6.30E-02 6.47E-02
Genes CCNB1, CCNB2, PLK1, BUB1, BUB1B, CDC20, MCM5 IL4I1, ALDH3B2, ADH7, ALDH3A1 HIST1H4K, HIST1H2BE, FCGR4, HIST2H3C2, C2, HIST1H4I IL4I1, ALDH3B2, ALDH3A1 HDC, ALDH3B2, ALDH3A1 PLK1, SGOL1, BUB1, CDC20, AURKA HKDC1, ALDH3B2, ADH7, ALDH3A1 GGT6, GGT1 CCNB1, CCNB2, PLK1, BUB1 KCNN4, SLC8A1, KCNK5, COL22A1
Figure S3. FUBP1 knockdown sustains the proliferation of differentiating NPCs. Related to Figure 2. (A) IF analysis of BrdU incorporation in NTKD vs FUBP1KD cells on indicated days during differentiation. Independent cultures were scored (D0, n=3; D3, n=8; D5, n=7, PD0332991 (1 µM) treated, n=3). Percent of BrdU-positive cells is plotted on the right . (B) DAVID KEGG category analysis of differentially up- or down-regulated genes comparing NTKD vs FUBP1KD cells after 5 days of differentiation. **P < 0.01; ***P < 0.001. Statistical significance was determined by unpaired t-test. Scale bar= 50 µm
FUBP1
FUBP1
HA
HA
pIND-PTBP2-HA
HA
IP IgG
HA
FUBP1
HA
pIND-NOVA2-HA
pIND-NOVA1-HA
50
-
+
FUBP1
FUBP1
RNase
FUBP1
FUBP1 SRRM4
40 % of input
IgG
IP Input (5%)
Input (4%)
IP IgG
Input (4%)
HA
IgG
Input (4%)
IP
30 20 10
SRRM4 pLDPuro-mnSRRM4
0
R1
R2
R3
R4
R5
Figure S4. Splicing factors for neuronal differentiation co-immunoprecipitate with FUBP1. Related to Figure 3 and 4. Co-immunoprecipitation analysis of FUBP1 and splicing factors identified from the mass spectrometry. Lower left, interaction of FUBP1 with SRRM4 is mainly RNAdependent as removal of RNA by RNase A treatment interfered with their co-immnunoprecipitation. Lower right, RNA-IP results from Figure 4D were confirmed by an independent method using UV crosslinked (150 mJoule/cm2) cells.
# of AS event
Skipped exon (SE) Alternative 5’ splice site (A5SS) Alternative 3’ splice site (A3SS) Mutually exclusive exons (MXE) Retained intron (RI) Constitutive exon
Alternatively spliced exon
Differentiation
Proliferation
Figure S5. Changes in alternative splicing events in FUBP1KD cells. Related to Figure 4. Global AS events corresponding to all five basic types of AS patterns (left) were analyzed. The summary of the total count of each AS event detected is plotted on the right.
Exon 8 34621 CAAGGGTAGGCTGACTTTGTTTGAGTTTTTTCCTAGGAGGGAATCCCATGGCTGTCGTCA
34680 34740
34681 GCAAACAAGTAAATATGGAACTGGCCAAGATCAAGCAAAAATGCCCACTTTATGAAGCCA R1 34741 ATGGACAAGCTGTAAGTTGATGACAAA·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙CAGGGGACATCTGTCTCTGGGCTTTGT
35580
35581 GGGCTTCAGATCAGAAAGAGGCTGATGTTAAGGAAACGCCTTGGGTTATGTCTACCAGAT
35640
35641 GTGCAGATTTCTTTCCAGGGCTTATTTGTGAGAGACATCTAACAAAATAAGAATGGAATG
35700
35701 AGAGAGAAGGGATATAATTGATGCTAACTTATTAGTAACTTATAAAAAGTTA·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙ R2 37801 CTACATAGCAAGTTCCAGGACAGACAAGGCTATATAATAGAGAGACCCTGTTTCAAAACA
37860
37861 AAACAAACAAAATAGTTTCCCTTGGAGCCAGCAAGGCCCACCCAGAGTAGAAATTACTCA
37920
37921 ACCATTAAGATTTCTTACTGTTTAAAAAATGAGATTCTATGTTCTCTTATGT·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙ R3 38521 TTGTAGATATCACAGGTGGTGCTTGCTTAAGGACACAGCTCCTTACCTAGCCACTTTTTG
38580
38581 CTAGGAAAAAAATGTAAATAGATGGTGTTTGTTGTTACTATTCATTTTTTGTGTACGTGT
38640
38641 ACTTCTGTGTACGTGTATGTCTGGTGTGTATTGTGTTTGGAGTGTAAATGTACATAAGTT
38700
38701 GATGTCTTTCATTCTTTGTCTTATTTCTGAGACAGGGTCTCTCACAGAACCT·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙·∙ 39661 CTGGCCATTTCTATGCCTTGACTCTCCCATTTTGGTCTCTGTATAGTCTGTTCCTTATTT R4 39721 CTCCAGTGGTTGCAGCTTCTAAGCTAACAGAATGCTTCTGTCATGCTATGTGTTTAAAGC 39781 CTTGATTTTACTGCTGTCATACAAAACTAAACTCTACGTGGCTGTTGGGCTGTTATTTAC Exon 8a 39841 AGTTTATTTCTCCCTCTGCTGCACTGATTAAAAGGACACTGTCAAGGTATTTTTTCATAA 39901 TTTTTCAAATCATTTTCTTCACTGTTTACAGTAACCCATTAAAAGCTTAACACTTAAATC
R5
39720 39780 39840 39900 39960
39961 TTTTCCTTTCAATGATCCTCTCCATCACACATTCACACTGGTTTGTTGTTGTAGAGTTGC
40020
40021 GCCTATATGTTGGGCTGGTGCGTTTAGTTTTTGTCATTGAAAGCGCATGTAAAACATCAG
40080
Figure S6. Selection of putative FUBP1 or SRRM4 binding regions in LSD1 intron 8 and 8a. Related to Figure 4. Mouse LSD1 intron 8 to 8a region is shown. Coordinate starts at 600 bp upstream of exon 1. Exons 8 and 8a are marked in burgundy and polypyrimidine tract is marked in blue. R1 to R5 PCR amplicons are underlined. Putative SRRM4 binding UGC motif is shown in red and FUBP1 motif is in bold.
Supplemental Experimental Procedures RNAseq and data analysis. Total RNAs were isolated from the NPC cultures either under proliferation or after 7 days of differentiation induction, and subjected to RNA sequencing at the Genomics Resources Core facility of Weill Cornell Medicine. RNA-seq libraries were prepared using the Illumina TruSeq stranded mRNA library preparation kit and sequenced on HiSeq4000 sequencer. The Tophat was used to align raw sequencing reads to the UCSC mm9 mouse reference genome, and Cufflinks was used to measure transcript abundances in Reads Per Kilobase of exon model per Million mapped reads (RPKM). RNAseq data is GSE108537 (GSM2902880-2902883) Mass Spectrometry Analysis. In-gel digestion was performed according to a previous published protocol (Shevchenko et al., 1996). Briefly, gel pieces were excised and distained, followed by reduction, alkylation and digestion with trypsin (Promega, Madison, WI). The peptides were then extracted from the gels, desalted and analyzed by liquid chromatography-tandem mass spectrometry (LC-MS/MS). An EASY-nLC 1200 (Thermo Fisher Scientific) coupled on-line to a Fusion Lumos mass spectrometer (Thermo Fisher Scientific) was used for LC-MS/MS analysis. Buffer A (0.1% formic acid in water) and buffer B (0.1% formic acid and 80% acetonitrile in water) were used as mobile phases for gradient separation. A 75 µm x 15 cm chromatography column (ReproSil-Pur C18-AQ, 3 µm, Dr. Maisch GmbH, German) was packed inhouse for peptide separation. Peptides were separated with a gradient of 5–40% buffer B over 20 min, 40100% B over 5 min at a flow rate of 300 nL/min. The Fusion Lumos mass spectrometer was operated in data dependent mode with 1 s cycle time. Survey scans were acquired in the Orbitrap mass analyzer over a range of 300-1500 m/z with resolution 120,000 at m/z 200. The most abundant precursors from the survey scan were selected with an isolation window of 1.6 Thomsons and fragmented by higher-energy collisional dissociation with normalized collision energy of 35. MS/MS scans were acquired in the ion trap mass analyzer with rapid scan rate. The automatic gain control target value was 1e6 for MS scans and 1e4 for MS/MS scans respectively, and the maximum ion injection time was 60 ms for both. The raw files were processed using the MaxQuant computational proteomics platform (Cox and Mann, 2008)(version 1.5.5.1). The fragmentation spectra were searched against the UniProt mouse protein database (contain 80,593 sequences), and allowed up to two missed tryptic cleavages. Oxidation of methionine and protein Nterminal acetylation were used as variable modifications for database searching. Carbamidomethylation of cysteine was used as a fixed modification. The precursor and fragment mass tolerances were set to 7 ppm and 0.5 Da, respectively. Both peptide and protein identifications were filtered at 1% false discovery rate (FDR). Immunohistochemistry. Formalin-fixed, paraffin-embedded 5 micron sections were used. For stains of brain, sections were processed in standard method and incubated with primary antibodies to mouse antiNESTIN (1:200, Millipore #MAB353), rabbit anti-PDGFRα (1:200, CST #3174), rabbit anti-OLIG2 (1:500, Millipore #AB9610), rabbit anti-Ki67 (1:300, Vector Laboratories, VP-K451), and rabbit antiFUBP1 (1:200, Abcam #181111) antibodies and further processed by Vector Elite ABC peroxidase kit followed by developing with DAB substrate and counterstained with hematoxylin. Immunofluorescence. Cells were fixed with 4% paraformaldehyde for 10 min at room temperature followed by permeabilization with 0.2% triton X-100 in PBS. The cells were subjected to immunofluorescence staining with anti-NESTIN (1:200), anti-OLIG2 (1:500), anti-GFAP (1:500, Origene #TA336707), anti-NeuN (1:200, CST #24307), anti-MAP2a/b (1:200, Abcam #36447), anti-DCX (1:400, Santa Cruz Biotechnology #SC-8066), and anti-β-III tubulin (1:300, Abcam #78078) antibodies overnight at 4°C. The cells were then washed with cold PBS, and incubated with Alexa 488-labeled anti-rabbit and Alexa 568-labeled anti-mouse secondary antibodies (Thermo Fisher Scientific) at room temperature for 1 h. For BrdU immunofluorescence staining, cells were incubated with 0.5 mg/ml of BrdU (Sigma-aldrich #B5002) for 3 h. Then cells were washed 2 times with cold PBS and fixed with 4% paraformaldehyde. Cells were incubated in 1N HCl for 10 min on ice and 2N HCl at 37°C 20 min followed by neutralization with 0.1 M sodium borate buffer pH 8.5 for 10 min at room temperature. Immunofluorescence staining with anti-BrdU (1:500, Dako #M0744) and anti-FUBP1 (1:500, Abcam #181111) antibodies was performed by overnight incubation at 4°C followed by secondary antibody incubation with Alexa 488labeled anti-rabbit or Alexa 568-labeled anti-mouse secondary antibodies (Thermo Fisher Scientific) at room temperature for 1 h. Images were acquired by fluorescence microscopy with EVOS FL Cell Auto
Imaging System. For scoring of marker positive cells for FUBP1 expression levels we used the corrected total cell fluorescence (CTCF = Integrated Density – (area of selected cell X mean fluorescence of background readings)) using ImageJ (Burgess et al., 2010). Expression level was defined as weak (20,000) based on CTCF values. Western Blot Analysis. Cells were lysed in TNT buffer (0.1 m Tris-HCl, pH 7.5. 0.15 m NaCl. 0.05% (v/v) Tween 20) supplemented with a protease and phosphatase inhibitor cocktail. Ten µg of cell lysates were fractionated by SDS-PAGE and transferred to a PVDF membrane. After incubation with 5% non-fat dried milk in TBST (10 mM Tris, pH 8.0, 150 mM NaCl, 0.5% Tween 20) for 1 h, the membrane was washed once with TBST and incubated with antibodies against β-actin (1:5,000, Sigma-Aldrich #A3853), FUBP1 (1:2,000), OLIG2 (1:2,000), MAP2 (CST #8707), GFAP (1:5,000), β-III tubulin (1:1,000), and LSD1 (1:1,000, Abcam #17721) at 4 °C for 16 h. Membranes were washed three times for 10 min and incubated with a 1:10,000 dilution of horseradish peroxidase-conjugated anti-mouse or anti-rabbit antibodies for 1 h. Blots were washed with TBST three times and developed with the SuperSignal™ West Femto substrate (Thermo Fisher Scientific). Alternative splicing analysis. We used rMATS v3.0.9 (http://rnaseq-mats.sourceforge.net) (Shen et al., 2014) to identify differential alternative splicing events from single end RNA-seq data corresponding to all five basic types of alternative splicing patterns (Figure S6). For each alternative splicing event, we used the reads alignment against genome as the input for rMATS and set the cutoff splicing difference to be 0.05. Intracranial orthotopic grafting and bioluminescence imaging. This study was conducted in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals. All procedures on mice were approved by the Institutional Animal Care and Use Committee. Above described Ink/Arf-/- NPCs with TRC or shFUBP1-1 were further transduced with viral particles made by packaging pBabe-IDH1R132H or pLP-LNCX-PIK3CAH1047R (a gift from Todd Waldman, Addgene # 25635), along with mCherryluciferase expressing vector. Ten thousand of these NPCs were injected into front-lobe caudate nucleus of 4–6 week-old immunodeficient NOD/scid-IL2Rgc knockout (NSG) mice (JAX) for Figure 6E-F or NCG (#572, Charles River) for Figure 6G-H using a stereotaxic injector as previously described (Klingler et al., 2015). Mice were subjected to weekly bioluminescent imaging for tumor development. Briefly, mice were given intraperitoneal injections of D-Luciferin (150 mg/kg, Goldbio) and imaged 5 min after the injection using the IVIS® Spectrum in vivo imaging system following the manufacturer’s instructions. Mice were monitored daily, and sacrificed at onset of neurological symptoms. At the time of sacrifice, tumor tissues were collected for histological evaluations. qRT-PCR analysis. RNA was harvested using NucleoSpin® RNA (MACHEREY-NAGEL). Then, one microgram of total RNA was reverse transcribed into cDNA utilizing RevertAit RT kit (Thermo #K1691). Quantitative RT-PCR was performed on cDNA samples using the Power SYBR® Green Master mix (Applied Biosystems) and was performed the qPCR on Applied Biosystem 7500 Fast Real-Time PCR system. Primer sequences are as below. Each samples were run as duplicates (triplicates) and the mRNA level of each samples was normalized to that of the β-actin mRNA. The relative mRNA level was presented as unit values of 2^[Ct(β-actin) – Ct(gene of interest)]. mACTB mDCX mFUBP1 mLSD1-total mLSD1-8a
F
TGTGATGGACTCCGGAGACGG
R
ACAGCTTCTCTTTGATGTCACGC
F
CATTTTGACGAACGAGACAAAGC
R
TGGAAGTCCATTCATCCGTGA
F
CCTCTTAGGATTACGGGTGACC
R
TCCGCACTTCTCTGAAACCACC
F
CGATACTGTGCTTGTCCACCGA
R
CCAAGCCAGAAACACCTGAACC
F
GCTGTTCCAAAAGAAAAAGATG
R
TGCAGCTGAATGACAACCTC
mLSD1+8a mNeuN mNeuroD1 mSRRM4 hLSD1 hLSD1-8a hLSD1+8a hFUBP1
F
GCTGACACTGTCAAGGTT
R
TGCAGCTGAATGACAACCTC
F
ATCGTAGAGGGACGGAAAATTGA
R
GTTCCCAGGCTTCTTATTGGTC
F
CCTTGCTACTCCAAGACCCAGA
R
TTGCAGAGCGTCTGTACGAAGG
F
CCAGTGTGCAGAGGTGAAGA
R
GTAGCTGGGACTTCGACGAG
F
GAGATGGATGAAAGCTTGG
R
GAAGTCATCCGGTCATGAGG
F
GCCAACGGACAAGCTGTTCC
R
GCCTGGCCAAGGGACACAGGC
F
GCTGTGGTCAGCAAACAAG
R
CTCTTTAGGAACCTTGACAGTGTC
F
AACAGGACCTCCAGACCGATGT
R
TCCAGTTGCCTTGACCTCTACC
F
GGACACGGACAGGATTGACA
18S
R ACCCACGGAATCGAGAAAGA For semi-quantitative RT-PCR of LSD1 isoforms we used primer set of LSD1 (E8) F: ATCAAGCAAAAATGCCCACT and LSD1 (E9) R: GCAACCGGTTAAATTCTTGTTC. PCR products of 29 cycle amplification were resolved on 3.5% TBE gel. RNA-immunoprecipitation. NPCND1 cells were differentiated for 2.5 days in the presence of 1 µg/ml of doxycycline. 8x106 cells were cross-linked for 5 min with 1% paraformaldehyde (Thermo #28906) and quenched with 120 mM glycine for 5 min. After nucleus isolation, the total RNA was sheared using the Covaris M220 Focused-ultrasonicator according to the manufacturer’s instructions. Immunoprecipitation was performed with 4 µg of anti-FUBP1 antibody (Abcam #181111), 4 µg of anti-Flag antibody (GeneScript #A00187), or 4 µg of normal IgG antibody. After purification of RNA with Trizol® (Thermo #15596026), the samples were treated with RNase-free DNaseI (Sigma-aldrich #AMPD1-1KT) for 30 min to remove genomic DNA. cDNA was synthesized with RevertAit RT kit (Thermo #K1691). Quantitative RT-PCR was performed on cDNA samples using the Power SYBR® Green Master mix (Applied Biosystems) and was performed the qPCR on Applied Biosystem 7500 Fast Real-Time PCR system. Primers for RNA-IP analysis Region1 Region2 Region3 Region4 Region5
F
GACATCTGTCTCTGGGCTTTG
R
CCCTGGAAAGAAATCTGCAC
F
AGCAAGTTCCAGGACAGACA
R
CTACTCTGGGTGGGCCTTG
F
TCACAGGTGGTGCTTGCTTA
R
TCCAAACACAATACACACCAGA
F
CTCCAGTGGTTGCAGCTT
R
TTTTAATCAGTGCAGCAGAGG
F
TCCTTTCAATGATCCTCTCCA
R
GTTCCTTAGCTCTGCCCAAA
Desert
F
TCTTCAGGTAGAAGATTTGGAGGT
R
GTTCCTTAGCTCTGCCCAAA
Primers for mouse LSD1 exon 8a minigene cloning 8a-For
GATCATATGTGATTTTGTTGTTGTTGTTGTT
8a-Rev
GATCATATGTTTGCAACTAGGATGACAATC
Primers for mutagenesis of minigene construct FUBP1(R4)-F
TCTGTCATGCTATATATTTAAAGCCTTG
FUBP1(R4)-R
CAAGGCTTTAAATATATAGCATGACAGA
FUBP1(R5)-F
ATTCACACTGGTTTATTATTATAGAGTTGCGCCT
FUBP1(R5)-R
AGGCGCAACTCTATAATAATAAACCAGTGTGAAT
SRRM4(R4)-F
GTTTATTTCTCTCTCTACTACACTGGTTAAA
SRRM4(R4)-R
TTTAACCAGTGTAGTAGAGAGAGAAATAAAC
Primers for qRT-PCR of nLSD1 minigene reporter E8a included-F CAACTTCAAGCTCCTAAGCCACTGC E8a included-R
AGGAACAGCTTGACAGTGTCCT
minigene EDB Control-F
GTGGACGACATGCCCAAC
minigene EDB Control-R
CCGGGACTCAGGTTATCAAA
Supplemental References Burgess, A., Vigneron, S., Brioudes, E., Labbe, J.C., Lorca, T., and Castro, A. (2010). Loss of human Greatwall results in G2 arrest and multiple mitotic defects due to deregulation of the cyclin B-Cdc2/PP2A balance. Proc Natl Acad Sci U S A 107, 12564-12569. Cox, J., and Mann, M. (2008). MaxQuant enables high peptide identification rates, individualized p.p.b.range mass accuracies and proteome-wide protein quantification. Nat Biotechnol 26, 1367-1372. Klingler, S., Guo, B., Yao, J., Yan, H., Zhang, L., Vaseva, A.V., Chen, S., Canoll, P., Horner, J.W., Wang, Y.A., et al. (2015). Development of Resistance to EGFR-Targeted Therapy in Malignant Glioma Can Occur through EGFR-Dependent and -Independent Mechanisms. Cancer Res 75, 2109-2119. Shen, S., Park, J.W., Lu, Z.X., Lin, L., Henry, M.D., Wu, Y.N., Zhou, Q., and Xing, Y. (2014). rMATS: robust and flexible detection of differential alternative splicing from replicate RNA-Seq data. Proc Natl Acad Sci U S A 111, E5593-5601. Shevchenko, A., Wilm, M., Vorm, O., and Mann, M. (1996). Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal Chem 68, 850-858.