Fast and reliable DNA extraction protocol for

Open Agriculture. 2017; 2: 469–472

Research Article Pavel Espinoza Alvarado, Ramón Miguel Molina Barrios, Javier Arturo Munguía Xóchihua, Juan Francisco Chávez Hernández*

Fast and reliable DNA extraction protocol for identification of species in raw and processed meat products sold on the commercial market https://doi.org/10.1515/opag-2017-0051 received December 2, 2016; accepted May 3, 2017

Abstract: In this work a protocol for the extraction of DNA from the meat of different animals (beef, pork, and horse) was established. The protocol utilized TE lysis buffer with varying concentrations of phenol and chloroform as a base reagent. Reactions were carried out for verying time periods and under differing temperatures. All samples analyzed were obtained from commercial grade meat sourced from the local region. 12 samples were used for methodological optimization with 30 repetitions per sample. Once optimized, purity results for the three species were 1.7 with a concentration (determined spectrophotometrically at 260 nm) of 100 µl/ml of DNA. The protocol was tested using 465 different meat samples from different animal species. All meat used was fresh and processed. Results showed a purity of 1.35 ± 0.076 and a DNA concentration of 70 ± 0.31 μl for a time duration of 1.5 hours. These results were tested by polymerase chain reaction (PCR) as reported by several authors. The extracts were tested using different PCR reactions using specific primers for horses. Results suggest that there was 39 positive samples. The proposed methodology provides an efficient way to detect DNA concentration and purity, suitable for amplification with PCR. Keywords: DNA extraction Standardization meat products

*Corresponding author: Juan Francisco Chávez Hernández, Departamento de Ciencias Agronómicas y Veterinarias, Instituto Tecnológico de Sonora, Av. Antonio Caso S/N Colonia Villa ITSON, Ciudad Obregón, Sonora, México, E-mail: [email protected] Pavel Espinoza Alvarado, Ramón Miguel Molina Barrios, Javier Arturo Munguía Xóchihua, Departamento de Ciencias Agronómicas y Veterinarias, Instituto Tecnológico de Sonora, Av. Antonio Caso S/N Colonia Villa ITSON, Ciudad Obregón, Sonora, México

1 Introduction Animal cells have a greater amount of integral proteins in their lipid layer, therefore implement reagents necessary to generate a cell lysis, turn as the implementation of some nucleases; It is important to control the volume of reagents and not to degrade the genetic material. Currently the use of molecular DNA analysis techniques for identification and detection of disease in animal species has become conventional, because of its ease of operation, high accuracy and efficiency. In Mexico, meat products have wide acceptance and there are several companies that make up the meat industry and are in charge of processing these foods (Hernández-Chávez et al. 2011). Extracting genetic material is a key part in different molecular techniques to address the aforementioned problem. As a result of their protein structure, meat tissues exhibit much greater resistance to some buffers and/or reagents for cell lysis, and contain large amounts of lipid that impedes DNA purity. This has lead to much research to develop robust extraction techniques (Carlos et al. 2001). Some commercial kits allow for an easy and simple extraction though some are too expensive. Other standard extraction protocols require large amounts of time and yield low purity results (Klein et al. 1998). To extract nucleic acids from biological material cell lysis must ensue, cellular nucleases must be inactivated and nucleic acids must be separated from the cell debris. The ideal lysis procedure usually consists of a balance of techniques and must be strong enough to break the complex starting material (a meat tissue), but gentle enough to preserve the nucleic acid (Hargin et al. 1996). The wavelength of 260 nm is the peak absorbance for both DNA and RNA. It is done with 230/260 and 260/280 relations to assess DNA purity with respect to contaminating proteins as phenol and the resulting DNA extraction (Maniatis et al.1992). Therefore the aim of this study was to standardize a protocol for extracting DNA samples in fresh meat and processed using homogenization buffer and organic solvents.

Open Access. © 2017 Pavel Espinoza Alvarado, et al., published by De Gruyter Open. Attribution-NonCommercial-NoDerivs 3.0 License.

This work is licensed under the Creative Commons

Unauthenticated Download Date | 9/2/17 2:39 PM

470

P.E. Alvarado, et al.

2 Materials and Methods The meat samples of the first part of the work (optimization) were obtained from commercial establishments in the region. 465 samples were provided as a service to a private institution in the center of the country. All samples were processed at the Laboratory of Food Quality and Authenticity of Animal Origin from the Department of Agricultural and Veterinary Sciences (ITSON). The samples were handled and transported on ice under enclosed conditions in order to prevent crosscontamination. The cell lysis buffer used was Tris-HCl, EDTA, SDS and NaCl, with different concentrations (Table 1). Phenol was used to help break the cell wall, chloroform and isoamyl alcohol to precipitate the DNA, and proteinase K to provide improved purity. For DNA extraction, a sample between 90-110 mg of lean meat was weighed. It was ground in 250µl of lysis buffer. All samples were then crushed and placed in Eppendorf tubes with 750 µl of buffer. Samples were then vortexed for 2min at 3000rpm to allow for homogenization to take place. It was incubated at 50-60°C for 30min. Table 1: Concentration and reagents of the lysis buffer Reagent

Concentration

Tris-HCl pH 8.0

10mM

SDS

0.1%

EDTA NaCl

1mM

10mM

600µl of phenol-chloroform-isoamyl alcohol proportions 25:24:1 were subsequently added and vortexed for 10 min at 3000rpm. Samples were then vortexed ay 14, 000 rpm for 10 min at 4 ⁰C. The supernatant was transferred to a new vial and 10µl of proteinase K was added. Then the sample at 20-50°C was incubated for 15 to 30 minutes depending on the species. Processed meat lysis temperature was 60°C. A solution (600µl) of phenol-chloroform-isoamyl alcohol (24: 1 25) was again added. It was vortexed for 10 min at 3000 rpm. It was centrifuged at 14,000 rpm for 10 min at 4°C. The supernatant was transferred to a new vial. Isopropanol (500µl) was added, mixing with gentle agitation. It was centrifuged at 14,000 rpm for 10 min at 4°C. The DNA pellet was recovered by pouring the liquid and inverting vials on absorbent paper. After eliminating waste alcohol, DNA was rehydrated with 50mL of Milli-Q water or TE buffer (Tris10 mM, 1 mM EDTA, pH 7.5). Samples were stored at -20°C for further analysis. Quantification of DNA extract obtained was performed using a 1800 model spectrophotometer

SHIMADZU with a quartz cell. 5 µl of the DNA sample was taken which was diluted with 495µl of pure milli-Q water, with a dilution factor of 1:100 (Clark et al. 2001) at a wavelength of 280nm and absorbance of 260nm. Subsequently, the extract was analyzed by conventional electrophoresis to verify the extraction yield and approximate size of the purified nucleic acids (Rivas et al. 1997)

3 Results and discussions DNA purity was measured to determine the effectiveness of the protocol and the amount extracted was quantified using a spectrophotometer. A total of 25 samples were analyzed statistically to determine the effectiveness of the protocol. The purity was 1.75±0.035 for horse, beef 1.79±0.031, pork 1.77±0.035 and processed meats was 1.23±0.026 (30 for each of the samples). The purity in 3 tissues gave suitable values 1.75 to 1.79, with 1.8 being the perfect purity value (Somma 2004). For 465 samples results of 1.35±0.076 purity and a concentration of 70 ± 0.31 µl/ml were obtained, in a time of 1.5 hours. This demonstrates that the effectiveness of the protocol is excellent for molecular studies. It was found that values for processed meats were of very low purity (average 1.2), although the minimum amplification is 1.0 (Bourke et al. 1999). This is therefore a robust protocol for meat analysis in poor conditions. Once the procedure had been optimized, gel electrophoresis analysis was conducted yielding the following results 4 tests were conducted for pork at different incubation times with lysis buffer (15min, 30min, 45min, and 60min). This is due to the high amount of fat in the cell structure in pork, giving a better result at 45min (Figure 1). Once the best time had been selected, samples were extracted 30 times to check the effectiveness of the protocol statistically.

Figure 1: Different incubation times in cell lysis for pork was; Molecular market 1kb Plus (M); (15min (P1), 30min (P2) 45min (P3), 60min (P4)


Fast and reliable DNA extraction protocol for identification of species...

For horse meat and beef, 3 tests were implemented incubated with proteinase K, because these tissues contain less fat, likewise, the cells that make these muscle tissues contain more structural protein which is necessary to promote protease activity, favoring the time of 30min for horse and 15min for beef (Figure 2 and 3). Once the best

M M

C1

C2

C3

6000 bp

550 bp 200 bp 100 bp

471

time was selected, the sample was extracted 30 times to check the effectiveness of the protocol. In processed meats due to cell damage caused by high cooking temperatures and other treatments in the flesh that alter the pH of the sample, it was decided not to marinate the meat, as it is degraded in the mortar. In addition the incubation temperature was decreased (Figure 3). Once the best time was selected , samples were extracted 10 times to check the effectiveness of the protocol statistically. PCR was developed to assess the effectiveness of the protocol in processed meats performing a statistical quantity of 24 tests, using Eqqus1 and Eqqus2 primers (Table 2), which amplify a conserved sequence in the mtDNA region of cytochrome B (Figure 4). Although the amount of DNA is very low just a single molecule can be used in molecular studies.

4 Conclusions

Figure 2: Extractions with different incubation temperatures with proteinase K, horse: Molecular market 1kb Plus (MM); 15min (C1), 30min (C2), 45min (C3)

MM M

R1

R2

R3

6000 bp

The results show that this DNA extraction protocol using phenol and chloroform, is fast and easy to perform, obtaining better results for fresh samples. This was not the case for processed samples as they had very low values of purity and concentration. Fat of some species (such as pigs), limit the ease of DNA extraction from the samples. However, the amounts obtained in this work can be used in molecular studies (PCR, sequencing, and genetic mapping, among others).

550 bp 200 bp 100 bp

Figure 3: Extractions with different incubation temperatures with proteinase K, beef: Molecular market 1kb Plus (MM); 5min (R1), 10min (R2), 15min (R3)

Figure 4: PCR meat products. Molecular market 1kb Plus (M); negative control with beef (1), the positive control on horseback (2), and lane 3 to 9 different processed samples

Table 2: Sequence of specific primers from horse Species

Primer

Sequence 5’-3’

Gene

Horse

PFw1-Eqca

CTACATCGGTACTACCCTCGTC 22 bp

Mitocondrial Cit-b

PRv-Eqca

AATGTACGACTACCAGGGCTG 21 bp


472

P.E. Alvarado, et al.

References Barbas III C.F., Burton D.R., Scott J.K., Silverman G., Quantitation of DNA and RNA. Cold Spring Harbor Protocols, NY, USA, 2001 Bourke M.T., Scherczinger C.A., Ladd C., Lee H.C., NaOH treatment to neutralize inhibitors of Taq polymerase. Journal of Forensic Science, 1999, 44(5), 1046-1050 Clark W.C., Christopher K., An introduction to DNA: Spectrophotometry, degradation, and the “Frankengel’ experiment. Pages 81-99, in tested studies for laboratory teaching, Volume 22 (S. J. Karcher, Editor). Proceedings of the 22nd Workshop/ Conference of the Association for Biology Laboratory Education (ABLE), 2000 Cota-Rivas M., Vallejo-Córdoba B., Capillary electrophoresis for meat species differentiation. Journal of capillary electrophoresis. J. Sep. Science, 1997, 28, 826-836

Klein J., Altenbucher J., Mattes R., Nucleic acid and protein elimination during the sugar manufacturing process of conventional and transgenic sugar beets. J. Biotechnol., 1998, 60, 145-153 Hargin K.D., Authenticity issues in meat and meat products, 1996 Heredia-Lobato J., Gárnica-Anguas R., Application of risk analysis, identification and control of critical points in the production of meat products, Mexico, D.F, 1994 Hernández-Chavez J.F., González-Córdova A.F., Rodríguez-Ramírez R., Vallejo-Cordoba B., Development of a polymerase chain reaction and capillary gel electrophoresis method for the detection of chicken or turkey meat in heat-treated pork meat mixtures. Analytica Chimica Acta, 2011, 708(1-2), 149-154 Maniatis T., Fritsch E.F., Sambrook J., Molecular Cloning. CSH press, 1992 Somma M., Analysis of food samples for the presence of Genetically Modified Organism. European commission, 2004
