Fig. S1

Recommend Documents

The progression pattern of male hyrax songs and the role of climactic ending ... 4. 6. 8. 10. 12. 14. 16. MON1. Num ber of vocal elem ents. â« Wail. â« Chuck. â« Snort ...

S1 Fig

Indicator. N. Odds ratio [95%CI]. Recommended prescribing. Intensify GLD. 56 ... Medication burden. MRCI. 1035 ... MRCI: medication regimen complexity index.

Fig. S1

Mycale (Mycale) lingua. Phakellia bowerbanki. Polymastia hemisphaerica. Forcepia (Forcepia) forcipula lophon cf. piceum. Polymastia cf. uberrima. Weberella ...

Fig. S1

B8-B9. A8-A9 C9-C10. Core Breaks. M. /G. H o le. B. 5. 8 .0. 6 m. 1. 0. 4. G. 2. G .... 1,03. 41. 162-982-A-7H-3, 0. 58,70. 2,44. 3,08. 0,86. 42. 162-982-B-7H-6, 40.

Fig. S1

Sep 13, 2012 ... Platyhelminthes: Proseriata. Pseudomonocelis Monocelis lineate. Pse. 18S. 31. 9 . 2. 4. 3. 5. N/A. 1. 0.010. 0.06. G. Rotifera: Bdelloidea. Rotaria.

Fig S1

8.6e-4. Free Ca+2 [mM] ns. Figure S1. A: Scheme of the micro-fluidic device used ... a representative experiment out of two is shown with its standard deviation.

S1 Fig

Potosia angustata. (063PA_GR). Potosia cuprina. (076CU_TR). 1/3. 3/1. 4/0. 5/0. 4/1. 5/0. 6/4. 6/0. 710. 8/0. 9/2. 10/0. 11/3. 12/3. 15/0. 16/0. 8/3. 9/3. 10/3. 11/3.

S1 Fig

Oct 4, 2018 - Dec-14 34. 23. 5. 38. 5. 10. 7. 7. 4. 4. Table 2. Comparison Sp. for Table 2. Month Sp. J Sp. K Sp. L Sp. M Sp. N Sp. O. Jan-04 35 2 14 0 25 55.

S1 Fig

GCTGAATGTC AAAAGGGAAG TGAGGTCCCTGGGTGAGTAA GGGACGTGCA ... +1. CCCACAGCCC CCGGCAGATG CATGGGGAGG TGGGGCTGTC CTTGGCCCCC ... CGGCTGCTCC AGATCCCCGG GAGACGATGG GGGTTTTCCA ...

Fig S1

f1: R1=H, R2=rha, R3=rha f2: R1=H, R2=glc, R3=rha f3: R1=H, R2=rha(1â2)glc, R3=rha f4: R1=H, R2=glc(1â6)glc, R3=rha f5: R1=OH, R2=rha, R3=rha.

Fig. S1

(CFTR/MRP), member 3. 1.1527. 0.73. 1.1234. 0.71. 1.8241. 0.34. NM_005845. ABCC4. ATP-binding cassette, sub-family C. (CFTR/MRP), member 4. -1.0153.

Fig S1 LasA 23Feb.pptx

Supplementary Figure 1. Accumulation of anthocyanins in response to exogenous treatment with JA, LasA or COR.! Wild-type (Col-0) mutant seedlings (N ...

fig S1.tif - PLOS

Ü© Ü¤ ÜÜ¢ Ü Ü Ü Ü Ü¢ Ü Ü. 0 0.01 0. 1 1 5 10. mBCD (MM). UU. T. 1.2 cell viability (arb. units) . : : : : 0.6. 0.4. 0.2. b.g. 0 0.01 0. 1 1 5 10. mBCD (mm)

S1 Fig. - PLOS

A Gorilla gorilla gorilla (233). A Pan paniscus (242). - A Pongo abeli (230). âA Nomascus leucogenys (224). - A Chlorocebus sabaeus (226). âA Macaca ...

S1 Fig. - PLOS

V. harveyi Luxo. AMRHGSQOFLIKPCEADRLAVfVNNAIRKAtKIK--- NEaDNPgNQNYGGFIGSSQTMQQVYRTIDSAASSKASIFITGESGTGKEVCAEAIHAASKRG.

Fig. S1

Insm1 flox/lacZ. Insm1 flox/+; RIPCreER Insm1 flox/lacZ; RIPCreER min. B. 0. 50. 100. 150. 0.0. 0.2. 0.4. 0.6. 0.8. 1.0. )l m/ g n( nil u s. nI. Glucose stimulated.

Fig. S1. - ScienceCentral

-4.21. Hey1. -3.67. -3.64. Lrp4. -3.59. -6.53. Sulf2. -2.88. -2.19. Ncam1. -2.82. -17.57. Nfatc4. -2.56. -3.11. Pparg. 3.23. 2.52. Signaling. Itga11. -6.00. -4.26. Cthrc1.

Fig. S1

r217I. rMga. rDs. rDb. r104V. r104I. 15: 8-13 m. r104V. r104I. 25: 3 m. 2. 5. 10. 20. 30. r217I. rMga. rDs. rDb. r104V. r104I. r104V. r104I. 8: 2-5 m. 21: 2-6 m. r104I.

Fig S1 GnfM_align_motif - CiteSeerX

Figure S3. GnfR. .... encoding a putative radical SAM domain protein and a ... Table S3. Conservation of EBPs in Geobacter species. Presence and absence of ...

S1 Fig - PLOS

Methanothermobacter__15679382. Pyrobaculum_calidif_126460684. Arabidopsis_tha_AT5G20850_1_P. AAA011_D5_ASMP01000001_1_1_4.

Fig S1

Figure S1: Michaelis-Menten kinetics of HEWL.The figure shows the variation observed in initial rate of 136 nM hen egg white lysozyme against substrate ...

Fig S1 - PLOS

knockdown: Upf1 Upf2 Upf3b. Upf1 Upf2 Upf3b scr scr reporter: miniÂµ C3/C4 WT. miniÂµ C3/C4 WT +1200. Upf1 mRNA. Upf3b mRNA. Upf2 mRNA.

ABEFCD Fig. S1 - Hindawi

A5441, Sigma-Aldrich, St. Louis, MO, USA. 1:5000. CX3CR1 rabbit sc-30030, Santa Cruz BiotechnologyÂ®, CA, USA 1:100. MFG-E8 rabbit sc-33546, Santa Cruz ...

S1 Fig. - PLOS

Candida mattosa (strain Xu316). Candide tropicalis (strain ATCC MYA-3404/T1). Lodderomyces elongisporus (strain ATCC 11503/CBS 2605/JCM 1781/NBRC ...

Fig. S1

Download PDF

3 downloads 0 Views 23KB Size Report

Comment

5! sequence. 502 bp. 515 bp. 3! sequence. porA promoter. CmR. FAM20 genome. DUS. 842 bp. 1649 bp. pDONR P4-P1R 5-porA-pro. pDONR P2R-P3 CmR-3.

N M

C 00 80 N M (h C yp 00 ot 81 he (h yp tica l ot he pro te tic in al pr ) ot ei n)

6) 10 1 ( IS 00 75 C N M

FAM20 genome 502 bp 5! sequence

DUS

porA promoter

515 bp 3! sequence

CmR

842 bp

1649 bp

pDONR P4-P1R 5-porA-pro

pDONR P2R-P3 CmR-3

Fig. S1

Fig. S1

Fig. S1

Suggest Documents

Fig. S1

S1 Fig

Fig. S1

Fig. S1

Fig. S1

Fig S1

S1 Fig

S1 Fig

S1 Fig

Fig S1

Fig. S1

Fig S1 LasA 23Feb.pptx

fig S1.tif - PLOS

S1 Fig. - PLOS

S1 Fig. - PLOS

Fig. S1

Fig. S1. - ScienceCentral

Fig. S1

Fig S1 GnfM_align_motif - CiteSeerX

S1 Fig - PLOS

Fig S1

Fig S1 - PLOS

ABEFCD Fig. S1 - Hindawi

S1 Fig. - PLOS