Filamin A regulates the organization and ... - The FASEB Journal

The FASEB Journal article fj.201600354RR. Published online July 12, 2016. THE

JOURNAL

• RESEARCH •

www.fasebj.org

Filamin A regulates the organization and remodeling of the pericellular collagen matrix Masaru Mezawa,*,1 Vanessa I. Pinto,†,1 Mwayi P. Kazembe,† Wilson S. Lee,† and Christopher A. McCulloch†,2

*Department of Periodontology, Nihon University School of Dentistry at Matsudo, Matsudo, Japan; and †Matrix Dynamics Group, Faculty of Dentistry, University of Toronto, Toronto, Ontario, Canada

ABSTRACT: Extracellular matrix remodeling by cell adhesion–related processes is critical for proliferation and tissue

homeostasis, how adhesions and the cytoskeleton interact to organize the pericellular matrix (PCM) is not understood. We examined the role of the actin-binding protein, filamin A (FLNa), in pericellular collagen remodeling. Compared with wild-type (WT), mice with fibroblast-specific deletion of FLNa exhibited higher density but reduced organization of collagen fibers after increased loading of the periodontal ligament for 2 wk. In cultured fibroblasts, FLNa knockdown (KD) did not affect collagen mRNA but after 24 h of culture, FLNa WT cells exhibited ∼2-fold higher cell-surface collagen KD cells and 13-fold higher levels of activated b1 integrins. In FLNa WT cells there was 3-fold more colocalization of talin with pericellular cleaved collagen than in FLNa KD cells. MMP-9 mRNA and protein expression were >2-fold higher in FLNa KD cells than in WT. Cathepsin B, which is necessary for intracellular collagen digestion, was >3-fold higher in FLNa WT cells than in KD cells. FLNa WT cells exhibited 2-fold more collagen phagocytosis than KD cells, which involved the FLNa actin-binding domain. Evidently, FLNa regulates PCM remodeling through its effects on degradation pathways that affect the abundance and organization of collagen.—Mezawa, M., Pinto, V. I., Kazembe, M. P., Lee, W. S., McCulloch, C. A. Filamin A regulates the organization and remodeling of the pericellular collagen matrix. FASEB J. 30, 000–000 (2016). www.fasebj.org KEY WORDS:

phagocytosis

•

matrix metalloproteinases

The extracellular matrix (ECM) is necessary for the mechanical support, attachment, proliferation, differentiation and adhesion-dependent signaling systems of cells, processes that enable homeostasis of a large and diverse group of connective tissues (1–4). The adhesion systems that anchor cells to the matrix are critical for cell metabolism but also mediate continuous remodeling of the ECM, a property that defines the structure and dynamics of many connective tissues (5, 6). Matrix remodeling involves tightly coordinated communication between cells and the ECM, which enables the physiologic balancing of synthesis and degradation and the reorganization of matrix molecules to maintain tissue structure and function. In the ECM that immediately surrounds connective tissue cells, a protein and proteoglycan-rich glycocalyx or pericellular matrix (PCM) (7) contributes to several cell functions, ABBREVIATIONS: ABDD, actin-binding domain; BSA, bovine serum al-

bumin; CKO, conditional knockout; FA, focal adhesion; FLNa, filamin A; KD, knockdown; LAMP, lysosomal-associated membrane protein; MMP, matrix metalloproteinase; PCM, pericellular matrix; PL, periodontal ligament; shRNA, short hairpin RNA; TIRF, total internal reflection fluorescence; WT, wild-type 1 2

These authors contributed equally to this work. Correspondence: Fitzgerald Building, Room 244, University of Toronto 150 College St., Toronto, ON M5S 3E2 Canada. E-mail: christopher. [email protected]

doi: 10.1096/fj.201600354RR

0892-6638/16/0030-0001 © FASEB

•

lysosomes

•

degradation

including the protection of cells from injury in response to applied forces. The PCM also serves as an interface into which nascent collagens (8, 9) and other matrix proteins, such as fibronectin, proteoglycans, and enzymes, are secreted that establish the structure and ultimately affect the function of the more globally distributed ECM (10–12). The PCM has been examined in endothelial cells that were subjected to high levels of fluid shear stress in vivo (13, 14). In these cells the PCM participates in the sensing of exogenous forces and contributes to the generation of signals that maintain cell orientation with respect to blood flow and the integrity of the cellular lining of the endothelium (14). When subjected to exogenous shear or cellgenerated forces, a broad range of cultured cells including fibroblasts (15, 16), endothelial cells, and vascular smooth cells, exhibit marked alteration of matrix assembly or align and elongate in the direction of the applied forces (17). However, when the PCM is degraded, cells exhibit phenotypes that are associated with nonshear conditions, which underlines the contributions of the PCM to mechanosensing (13, 17, 18). The mechanosensitivity of cells to the structure and organization of the PCM is dependent on the actin cytoskeleton, a multifunctional structural and sensory network that enables transmission of external mechanical signals and contributes to the generation of cellular responses to force (14, 19). Currently, it is not known how the actin cytoskeleton 1

participates in mechanosensing and in the organization of the PCM. The actin-binding protein filamin A (FLNa) contributes to the organization, function, stability, and signaling functions of the actin cytoskeletal network (20–22). FLNa cross-links actin filaments into orthogonal arrays and interacts with a large number of proteins that regulate cell-directed, adhesion-dependent processes, including the stabilization of focal adhesions (FAs), mechanoprotection, and wound healing (23–29). As a result of competition with the actin-binding protein talin for binding to integrins (30), FLNa strongly affects the activation state of integrins and, as a result, the affects the binding of collagen fibrils to b1 integrin-containing collagen adhesions. In many types of connective tissue cells, b1 integrinenriched adhesions provide focal sites for ECM remodeling by matrix metalloproteinases (MMPs), a process that is thought to be partly dependent on FLNa (31). Collagen fibrils are also remodeled by phagocytosis (32), an intracellular digestion route for collagen fibrils that involves pericellular fibril fragmentation, internalization, and intracellular digestion by lysosomal cysteine proteinases, such as cathepsins (33, 34). Although collagen phagocytosis is strongly dependent on affinity regulation of b1 integrin-containing adhesions and their subsequent binding to collagen fibrils (35), the role of FLNa in this process and in the structural organization and function of the PCM has not been defined. We examined how FLNa regulates the remodeling of collagen in the PCM and collagen degradation by matrix MMPs or phagocytosis. The data show that FLNa expression strongly affects collagen abundance on the cell surface and the route of collagen degradation, indicating that discrete components of the cytoskeleton may be important determinants of the structure and metabolism of PCM proteins.

MATERIALS AND METHODS Antibodies and reagents Mouse monoclonal antibodies (talin 1/2-clone 8d4, vinculinclone hVIN-1, and a-SMA-clone 1A4) and bovine serum albumin (BSA) were purchased from Sigma-Aldrich (Oakville, ON, Canada). Rat monoclonal antibodies against activated mouse b1 integrin (clone 9EG7) and nonactivated b1 integrin (clone KMI6) were obtained from Pharmingen (Mississauga, ON, Canada). Rabbit polyclonal antibodies recognizing FLNa were obtained from Abcam (Toronto, ON, Canada); antibodies to type I collagen were purchased from MD Bioproducts (St. Paul, MN, USA); and antibodies to type I collagen 3/4 fragment were purchased from ImmunoGlobe (Himmelstadt, Germany). Mouse monoclonal antibodies to b-actin were purchased from Sigma-Aldrich. Lysosomalassociated membrane protein (LAMP)-1 and -2 (clones 1D4B and ABL-93, respectively) were purchased from Developmental Studies Hybridoma Bank (Iowa City, IA, USA). Goat anti-rabbit Alexa 488 and goat anti-mouse Alexa 568 were obtained from Thermo Fisher Scientific (Waltham, MA, USA). Plasmids containing the sequence of full-length-FLNa cloned into dsRED-pcDNA3 vector were a gift of Miguel Del 2

Vol. 30

October 2016

Pozzo (Melchor Ferna´ ndez Almagro, Madrid, Spain). PolyJet In Vitro Transfection Reagent was purchased from FroggaBio (Toronto, ON, Canada); bovine type 1 dermal collagen from PureCol (Carlsbad, CA, USA); and fibronectin from bovine plasma from Sigma-Aldrich.

Filamin A conditional mice and genotyping As deletion of FLNa is embryonic lethal (at embryonic d 12) (36), we used the Cre-Lox system to generate tissue-conditional knockoutS (CKOs) in which FLNa is deleted from fibroblasts and osteoblasts. We obtained type I collagen Cre mice from Dr. Barbara Kream (University of Connecticut, Farmington, CT, USA) in which the Cre-recombinase is expressed under the control of the collagen a1(I) promoter (3.6 kb), a construct that is expressed in connective tissues, but not in other tissues (37). The floxed FLNa allele mouse was obtained from Dr. David Kwiatkowski (Harvard University, Cambridge, MA, USA). For the production of conditional mice, we performed crosses to obtain ideal breeders (males-FilAcCol-3.6cre/+ and females- ilAc/+Col-3.6cre/+) who produced wild-type (WT), heterozygous, or null mice. PCR lysis reagent (Viagen Biotech, Los Angeles, CA, USA) was used to prepare mouse tails for PCR genotypic analysis according to the manufacturer’s instructions. A primer pair (forward 59-CTGCATTACCGGTCGATGCA-39; reverse 59-ACGTCCACCGGCATCAACGT-39) was used to detect the present of LysM-Cre (product size, 300 bp). A primer pair (forward 59TCTTCCTCTTTCAGCTGG-39; reverse 59-ACAACTGCTGCTCCAGAG-39) was used to amplify the conditional (floxed) (product size, 200–300 bp) and WT (100 bp) FLNa alleles. All animal experiments were conducted according to the directives of an animal care protocol that was reviewed and approved by the Animal Care Committee, Faculty of Medicine (University of Toronto).

Force loading of mouse molar teeth The mandibular incisors of mice, which normally bear much of the muscle-generated masticatory forces, were either maintained in contact (normal occlusal function; control group) or were trimmed on their incisal edges to focus all masticatory muscle forces on the molar teeth (experimental group). After 1 or 2 wk of treatment, the mice were euthanized, and the mandibles were dissected and fixed in formalin before decalcification. The jaws were trimmed, embedded in paraffin, sectioned sagittally, and stained with Masson’s trichrome or Picrosirius Red (Mount Sinai Hospital Histology Service, Toronto, ON, Canada). Quantification of images was performed with ImageJ (National Institutes of Health, Bethesda, MD, USA). The orientation of collagen fibers was measured with the directionality plugin in Fiji– ImageJ (38).

Cell culture and transfection NIH 3T3 cells that express constitutively FLNa or that were transfected with short hairpin (sh)RNA for FLNa (gift of David Calderwood, Yale University, New Haven, CT, USA), which depletes cells of FLNa, were grown at 37°C in DMEM, supplemented with 10% fetal bovine serum and antibiotics (146 U/ml penicillin G, 50 mg/ml gentamicin, and 0.25 mg/ml amphotericin), and with 50 mM ascorbic acid. NIH 3T3 cells stably transfected with shRNA against FLNa were grown in the presence of puromycin (1 mg/ml). In separate experiments, 3T3 cells were

The FASEB Journal x www.fasebj.org

MEZAWA ET AL.

treated with siRNA to filamin A or with control siRNA (GE Health Care/Thermo Fisher Scientific). Collagenase treatment For experiments in which cell-surface collagen was digested, cell suspensions prepared by trypsinization were incubated with 0.5 mg/ml bacterial collagenase (Clostridium histolyticum, Worthington Biochemical Corp., NJ, USA) for 30 min at 37°C with agitation before replating. For analyses of soluble collagen secreted into the medium, cells were plated for 24, 48, or 72 h. To analyze de novo collagen synthesis, before trypsinization, cells were treated with 0.5 mg/ml collagenase for 10 min at 37°C; control samples were not subjected to collagenase treatment. Immunoblot analysis, immunostaining, immunoprecipitation, and mass spectrometry Cells were lysed and equal amounts of protein were loaded. Proteins were separated on 8% SDS/PAGE gels and transferred to nitrocellulose membranes. The membranes were blocked and probed with the various primary antibodies at 4°C overnight, followed by fluorescent secondary antibody incubation for 1 h at room temperature. Odyssey (Li-Cor Biosciences, Lincoln, NE, USA) and Image Studio software (Li-Cor) were used for detection and analysis of the immunoblots. In some experiments, lysates prepared from 3T3 cells were lysed in RIPA buffer, and FLNa was immunoprecipitated with antibody to FLNa. The FLNa and FLNa-associated proteins adherent to the beads were eluted and analyzed with liquid chromatography and tandem mass spectrometry (39). The UniProt mouse protein data base was used for peptide analysis (http://www.uniprot.org). Functional studies For MMP inhibition studies, we used 100 mM MT1-MMP1 (MMP14) inhibitor (Calbiochem, Etobicoke, ON, Canada) or 10 mM MMP1 inhibitor (batimastat; Sigma-Aldrich). For inhibition of intracellular collagen degradation, we used the cathepsin inhibitor (E-64; 10 mM; Sigma-Aldrich). Analysis of PCM For assessment of collagen in the PCM, in some experiments, cells were incubated with ferric oxide beads (modal diameter = 5 mm) for 1 h, well before internalization occurred. The cells were lysed in Triton-X 100 buffer. The beads were separated magnetically, and bead-associated proteins were analyzed by immunoblot analysis (bead-associated fraction). In some experiments cells were fixed (0.5% PFA for 8 min), blocked, and immunostained (40). Cells were visualized with an Eclipse TE300 inverted fluorescence microscope (Nikon, Melville, NY, USA) images were captured using Simple PCI software (Sherpa Software, Bridgeville, PA, USA). In some experiments, confocal images were obtained using a SP-8 confocal microscope (Leica, Heidelberg, Germany). For immunostaining of FA markers, cells were plated for 6 h on fibronectin-coated (10 mg/ml) glass coverslips (MatTek, Ashland, MA, USA) to enable spreading and formation of focal adhesions. Cultured cells were fixed with 4% paraformaldehyde, permeabilized with 0.2% PBS-Triton-X, blocked, and stained with primary antibody for 2 h at room temperature. Samples were incubated with FITC- or TRITC-conjugated secondary antibodies for 1 h at RT. Immunostained cells were visualized by total internal reflection fluorescence (TIRF) microscopy (Leica). PERICELLULAR COLLAGEN

Flow cytometry Cell surface expression of b1 integrin was measured (41, 42). The cells were quickly (,15 s) detached from dishes with Versene (Thermo Fisher Scientific), fixed, immunostained with KMI6 antibody (for b1 integrin), counterstained with FITC-conjugated anti-rat IgG, and analyzed by flow cytometry. For measuring b1 integrin activation, cells were seeded on plasma-treated, collagen-coated (1 mg/ml) plastic dishes for 1 h. They were quickly (,15 s) harvested in ice-cold Versene, fixed in 1% paraformaldehyde, immunostained with 9EG7 [a neoepitope antibody that recognizes activated b1 integrin (43)], followed by staining with FITC-conjugated anti-rat IgG2a antibody. The fluorescence of single cells was analyzed by flow cytometry (Altra; Beckman-Coulter, Burlington, ON, Canada), and integrin activation was estimated (41). Collagen binding to activated b1 integrin-containing collagen adhesions was estimated from the percentage of cells that bound polystyrene beads (2 mm diameter) that had been coated with type I fibrillar collagen or, in some experiments, with BSA or fibronectin. Cells spread for 24 h on tissue culture plastic followed by dorsal loading of beads (10 beads/cell) and incubated for 3 h at 37°C. Bead binding was analyzed by flow cytometry.

Endocytosis and phagocytosis Fluid-phase endocytosis was examined in cells spread for 24 h before adding rhodamine-dextran (5 kDa) for 3 h. After removal of dextran, cells were incubated in complete growth medium for 1 h before trypsinization and assessed by flow cytometry. For estimating collagen internalization, collagen-coated fluorescent beads (2 mm diameter; 1 mg/ml collagen coating) were added to cells for 3 h. After incubation, the cells were trypsinized, replated, and allowed to spread for an additional 24 h (to enable complete collagen bead internalization), followed by trypsinization and assessment by flow cytometry. Real-time quantitative PCR Total RNA was extracted from cells with the RNeasy Mini Kit (Qiagen, Mississauga, ON, Canada) according to the manufacturer’s protocol. With the use of iScriptTM cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA), total RNA (1 mg) was reverse transcribed according to the manufacturer’s instructions. Real-Time quantitative PCR was performed on a CFX96 real-time PCR system, with SsoFastTM Eva Green Supermix (Bio-Rad) with validated mouse primers for mouse GAPDH (forward 59-CACACCGACCTTCACCATTTT; reverse 59-GAGAGACAGCCGCATCTTCTTGT), mouse MMP-2 (forward 59AAGGATGGACTCCTGGCACATGCCTTT; reverse 59-ACCTGTGGGCTTGTCACGTGGTGT), mouse MMP-9 (forward 59AAGGACGGCCTTCTGGCACACGCCTTT; reverse 59-GTGGTATAGTGGGACACATAGTGG), mouse MMP-13 (forward 59CTTCTTCTTGTTGAGCTGGACTC; reverse 59-CTGTGGA GGTCACT), mouse MMP-14 (forward 59-GGATACCCAATGCCCATTGGCCA; reverse 59-CCATTGGGCATCCAGAAGAGAGC), mouse collagen I (forward 59-TGACTGGAAGAGCGGAGAGT; reverse: 59-GTTCGTGATGTACCAGT), and mouse cathepsin B (forward 59-GCAGCCAACTCTTGGAACCTT; reverse 59-GGATTCCAGCCACAATTTCTG). Relative quantification was done using the DDC t method in which the target gene (MMP-2, 9, 13, 14, type I collagen, cathepsin B) was normalized to a reference gene (GAPDH). The fold differences were calculated relative to the controls of NIH 3T3 FLNa cells (WT). Data were plotted using the arithmetic average and SEM to express foldchanges derived from at least 3 independent experiments. 3

Microscopy Imaging of the orientation of collagen fibers in Picrosirius Red– stained sections was performed with polarizing light optics on an Upright BX51 (Olympus America, Hauppauge, NY, USA) microscope with a Q Imaging color camera and Image Pro Plus software. Analyses of FAs and cell–substrate contacts were performed with TIRF or confocal microscopy (27). The area of FAs was measured in binarized images (44). For assessment of pericellular collagen by morphometric analysis of immunostained cells, regions of interest were quantified by confocal microscopy, and the number of fluorescence units (above isotype control background staining) was normalized to the area of the region of interest. Statistics For all experiments, separate assays were repeated at least 3 times. For quantitative data, means 6 SEM was computed. Comparisons of multiple samples were analyzed with ANOVA followed by Tukey’s post hoc test. Statistical significance was set at P , 0.05.

RESULTS Collagen organization in periodontal ligament As global deletion of FLNa is embryonic lethal (36) we developed an FLNa CKO mouse (Fig. 1A) in which

deletion of FLNa expression was restricted to fibroblasts and osteoblasts (27). In FLNa WT and CKO young adult (2-mo-old) male mice, we examined whether FLNa expression affected the organization of collagen fibers in the periodontal ligament (PL), a tissue that exhibits rapid collagen turnover in rodents (collagen half-life 30 h) (45, 46). As the structure and organization of collagen fibrils in the PL is strongly affected by the magnitude of occlusal forces (47, 48), we increased force loading on molar teeth by eliminating all contact on the mandibular incisors for 1 or 2 wk. In histologic sections of mouse molar PL stained with Masson’s trichrome (Fig. 1B), there was histologic evidence for loss of cellularity in the CKO mice at 1 and 2 wk compared with WT mice, and there were apparent reductions of the integrity of collagen fiber bundles. The PL width was reduced in mice with FLNa deletion and with increased force loading (P , 0.05; Fig. 1C), suggesting a loss of homeostasis of matrix structure and function in these mice. We analyzed collagen fiber abundance and organization in sections that were stained with Picrosirius Red and imaged (Fig. 2A) with polarized light microscopy (49, 50). Quantification of collagen fiber density was performed at molar furcation regions of the PL, a site of particularly high-force loading in

Figure 1. In vivo characterization of conditional FLNa-knockout mice. A) Mice were genotyped by PCR to determine expression of the homozygous floxed FLNa product of 200 bp in CKO FLNa mice (FLNa CKO) compared with WT mice (FLNa WT) in which the FLNa amplicon is ;110 bp. B) Masson’s trichrome–stained sections of the interdental region between molars of FLNa WT and CKO adult mice that were untreated (control) or treated by reduction of mandibular incisor teeth for 1 or 2 wk to increase force loading on molar teeth. Yellow arrows: alteration of structure of collagen fibrils in CKO compared with WT mice. Scale bar, 100 mm. C ) Quantification of periodontal ligament width from Masson’s trichrome staining. Data are means 6 SEM of 24 measurements per mouse (n = 10/genotype). 4

Vol. 30

October 2016


MEZAWA ET AL.

mammalian molar teeth of limited eruption (51). There was no difference in collagen fiber density in untreated control FLNa WT and CKO mice but after 1 w of increased force loading, FLNa WT mice exhibited a 2-fold reduction in collagen density, whereas there was no change in FLNa CKO mice. Measurements at 2 wk of force-loading showed an ;2-fold increase in the amount of collagen for both FLNa WT and CKO mice

compared with that in controls (1.9 and 2.43, respectively; Fig. 2B), but there were no differences in the abundance of collagen in the alveolar bone (P . 0.2; bottom). Quantification of the directionality of collagen fibers showed that in FLNa CKO mice, and independent of force loading, there was a 40% reduction of fiber directionality compared with that in FLNa WT mice (P . 0.05; Fig. 2C, D).

Figure 2. Collagen remodeling in vivo. A) Representative polarized-light images of Picrosirius Red–stained molars. Collagen fibers in PL of the furcation region are bound by dashed blue lines. Scale bar, 25 mm. B) Quantification of relative collagen density in molar furcations (top) and alveolar bone adjacent to PL (bottom) of FLNa WT and CKO mice. ***P , 0.001. C ) Quantification of collagen fiber directionality. Using the directionality plugin on Fiji–ImageJ, collagen fiber orientation was quantified. D) Quantification of collagen fiber directionality at 0°. B–D) Data are means 6 SEM of 24 measurements per mouse (n = 10/ genotype). *P , 0.05; **P , 0.01. PERICELLULAR COLLAGEN

5

Collagen expression and degradation The differences in collagen fiber organization and density in mouse PL in FLNa WT and CKO mice indicated that the organization and remodeling of collagen fibers were influenced by FLNa expression in fibroblasts. Accordingly, we studied collagen metabolism in NIH 3T3 fibroblasts that expressed WT levels of FLNa expression (FLNa WT) or reduced FLNa [by shRNA; FLNa knockdown (KD); Fig. 3A] (52). Flow cytometric analysis of cell viability with propidium iodide exclusion showed no difference between cell types (WT = 94.5 6 4.0%; KD = 93.2 6 4.3%; P . 0.2) and the doubling time of these cells in culture was similar (26 h for WT and KD cells). Measurements of secreted collagen a1 chain protein and mRNA in FLNa WT and KD cells (collagen mRNA was normalized to GAPDH mRNA) over 72 h of culture

showed that for all sampling times, collagen-a1 chain protein and mRNA were similar in FLNa WT and FLNa KD cells (Fig. 3B, C). However, there was a progressive increase in PCM-associated collagen over time of culture, and there was more collagen in the PCM of FLNa WT cells than in FLNa KD cells (Fig. 3D). We immunoblotted separate samples of PCM with an antibody that recognizes a neoepitope at the 1/4–3/4 collagen cleavage site (53), a marker for degraded collagen. There was more degraded collagen in cultures of FLNa KD cells than in those of FLNa WT cells (Fig. 3E). As trypsinization alone did not effectively remove collagen from the cell surface (by immunostaining and flow cytometry analyses of cell suspensions, data not shown), we developed an alternative, quantitative method to measure the abundance of PCM collagen in intact cells. Cell suspensions were incubated with a low concentration

Figure 3. Cell characterization and collagen production in cultured cells. A) Immunoblot characterization of FLNa in WT and KD NIH 3T3 cells cultured for 3 d. Lanes were loaded with equal amounts of protein and probed for FLNa. b-Actin was used as a loading control. The data are representative of 3 separate experiments. B) Quantification of collagen 1 protein and (C ) mRNA expression of collagen-a1 chain in FLNa WT and KD cells that were allowed to spread for 24, 48 or 72 hr prior to cell lysis. Data are representative of 3 separate experiments. As described in the Materials and Methods section, pericellular fractions were prepared from FLNa WT and KD cells spread over 72 hr and immunoblotted for collagen protein (D) and 3/4 collagen. Lanes were loaded with equal amounts of protein, and b-actin from whole cells was used as a loading control. The data are representative of 3 separate experiments. 6

Vol. 30

October 2016


MEZAWA ET AL.

of bacterial collagenase (0.5 mg/ml) to remove cell surface collagen. In cells that were not fixed or permeabilized, we found, by immunostaining and flow cytometry to quantify cell-surface collagen, that collagenase treatment reduced immunodetectable cell-surface collagen by .5-fold (P , 0.01; controls = 13.0 6 0.6 fluorescence units; collagenase treatment = 2.8 6 0.3 fluorescence units; n = 4 samples each). With this method, we examined FLNa WT cells, FLNa KD cells, or FLNa KD cells transfected with a shRNA-resistant, dsRED-tagged, full-length, FLNaexpressing plasmid (FLNa rescue) or with an FLNaexpressing plasmid in which the actin-binding domain of FLNa was deleted (FLNa ABDD). Collagenase-treated cells were plated, and, after 24 h in culture, collagen was immunostained in the PCM of nonpermeabilized cells, quantified on a single-cell basis by confocal microscopy (pixels per region of interest) and normalized to individual cell area. FLNa WT cells exhibited .5-fold more relative pericellular collagen than FLNa KD cells (P , 0.01; Fig. 4B), which was consistent with the immunoblot analysis data of collagen in the bead-associated fractions (Fig. 3D). In FLNa KD cells transfected with the shRNAresistant dsRED-tagged full length FLNa, there was 4.5fold more cell-surface collagen (P , 0.01) than FLNa KD cells. In contrast, FLNa KD cells transfected with the ABDD FLNa construct showed cell-surface collagen

staining that was similar to FLNa KD cells (P . 0.2), suggesting that the ability of FLNa to bind actin filaments is important in the assembly and retention of pericellular collagen. We examined whether differences in cell-associated collagen were due in part to variations of the abundance of collagen adhesion proteins that could bind and retain collagen fibers in the PCM. Discoidin domain receptors (which bind collagen fibers) are expressed at low levels in these cells (54) but the a2b1 integrin, which also binds fibrillar collagen, is strongly expressed (35, 53). We first examined expression of whole cell b1 integrin by immunoblot analysis in reducing conditions to analyze cell lysates, but we found no difference between FLNa WT and KD cells (Fig. 5A). Using an antibody that recognizes a cell surface epitope of the b1 integrin (clone KMI6), we found by immunostaining and flow cytometry of nonpermeabilized cells that there was ;4-fold higher cellsurface b1 integrin staining in FLNa WT cells than FLNa KD cells, which did not change over 72 h of culture (Fig. 5B). We examined the levels of activated cell-surface b1 integrins on the cell surface with a neoepitope antibody (clone 9EG7) (22). FLNa WT cells exhibited ;13-fold higher activated b1 integrins than FLNa KD cells (Fig. 5C). To assess whether this difference in activated b1 integrins affected collagen binding, we measured the percentage of

Figure 4. FLNa promotes the production of collagen to form the ECM. A) Representative microscopic images of FLNa WT, FLNa KD, or FLNa KD cells transfected with full-length FLNa or with FLNa in which the ABDD was deleted (FLNa ABDD). Cells were collagenase treated before they were allowed to spread for 24 h. They were then fixed and immunostained for collagen I without permeabilization. B) Histograms of cell-surface collagen (pixels per standardized area of region of interest 3 104) for indicated cell types. Images were obtained by confocal microscopy. Data were adjusted for variations of cell surface area. For each experimental group, 30 different cells were imaged and analyzed. FLNa KD and FLNa ABDD cells exhibit significantly less collagen than their respective controls. ***P , 0.001. PERICELLULAR COLLAGEN

7

cells that bound and internalized fluorescent collagencoated beads after 1 h of incubation. FLNa WT cells bound ;2-fold more beads than FLNa null cells (Fig. 5D). In soft connective tissues fibroblasts form adhesions to matrix proteins that enable spreading, the formation of cell extensions and the remodeling of the ECM (5). We examined the effect of FLNa on collagen remodeling by first analyzing FAs in cultured fibroblasts. FAs undergo progressive maturation from the time of cell attachment (55). With TIRF microscopy we examined the FA markers talin, vinculin, and a-smooth muscle actin (aSMA) as indicators of early, mid- and mature FAs, respectively, after 6 h of spreading (Fig. 6A). FLNa WT and KD cells exhibited no differences in the number of talin and vinculin-stained adhesions per cell in the first 6 h of culture (Fig. 6A, B). In

contrast, the number of aSMA-stained FAs was reduced ;2-fold in FLNa KD cells compared with FLNa WT cells (P , 0.01). The area of FAs was measured from binarized digital images (44), and these data showed that for talin, vinculin, and aSMA, the FAs were larger in FLNa WT cells (Table 1). In cells that were immunostained for 3/4 collagen fragments with the neoepitope antibody described above, we found discrete staining in isolated “spots” on the ventral cell surface by TIRF, indicating that these sites of collagen degradation were restricted to the PCM underlying the cell (Fig. 6A). There were more 3/4 collagenstained spots in FLNa WT cells than in FLNa KD cells (P , 0.01; Fig. 6B) We examined whether FAs at various stages of maturation are spatially related to 3/4 collagen

Figure 5. FLNa and collagen receptors. A) Immunoblot of b1 integrin protein levels in FLNa WT and FLNa KD cells allowed to spread for 24 h. Lanes were loaded with equal amounts of protein, and b-actin was used as a loading control. Cell lysates were prepared in reducing conditions. Clone 9EG7 was used to immunoblot b1 integrin. The data are representative of 3 separate experiments. B) Quantification of cell surface b1 integrin by flow cytometry of FLNa WT and KD cells, as assessed by KMI6 immunostaining. Cells were not permeabilized before analysis. Data are means 6 SEM of cells in each sample that were above threshold (i.e., background) staining for b1 integrin. C ) Activated b1 integrins were assessed by 9EG7 immunostaining and flow cytometry. Data are means 6 SEM from 3 individual experiments. B, C ) ***P , 0.001, significant difference between the 2 groups. D) FLNa WT and KD cells spread for 24 h and then were incubated with fluorescent collagen-coated beads for 1 h to estimate the relative abundance of activated collagen-binding integrins that could bind beads. Cells with bound beads were measured by flow cytometry. Data are means 6 SEM of percentage of cells that bound collagen beads from 3 independent experiments. **P , 0.01. 8

Vol. 30

October 2016


MEZAWA ET AL.

Figure 6. FLNa and cell adhesion formation. A) Representative TIRF images of FLNa WT and KD cells spread for 6 h before immunostaining for talin, vinculin, a-smooth muscle actin (aSMA) or 3/4 collagen fragments. Scale bar, 25 mm. B) Quantification of the number of FAs per cell. At least 30 cells were measured for each marker and cell type. C ) ImageJ Pearson coefficients were calculated to determine the colocalization of 3/4 collagen stained FAs with respect to the indicated FA markers. Data are means 6 SEM of 30 individual cells. **P , 0.01; ***P , 0.001.

fragments on the ventral surface of cells as a means of estimating whether collagen degradation in the PCM is restricted to cell adhesions. Cells were coimmunostained for 3/4 collagen fragments and FA markers; the extent of colocalization was quantified by Pearson correlation analysis (56). In talin-stained (early) adhesions, degraded collagen was 3-fold more likely to be colocalized with 3/4 collagen fragments in FLNa WT cells than in FLNa KD cells (P , 0.01), whereas aSMA (late adhesions) were more likely to be colocalized with 3/4 collagen fragments in FLNa KD cells (P , 0.01; Fig. 6C). These data indicate that FLNa expression impacts the spatial relationship of collagen degradation with developing adhesions in cultured fibroblasts and suggests that FLNa contributes to early phases of cell-directed remodelling of the PCM. PERICELLULAR COLLAGEN

We determined whether the observed differences in collagen remodelling at cell–matrix adhesions were related to the abundance of collagen-degrading enzymes. As cathepsin B is important for intracellular collagen degradation by the phagocytic pathway (32, 33), by qRT-PCR and immunoblot analysis, we measured mRNA and protein expression levels of cathepsin B in FLNa WT and KD cells that were cultured over a time course of 72 h. FLNa WT cells exhibited .3-fold more cathepsin B mRNA than did FLNa KD cells, a difference that was maintained over time in culture (Fig. 7A). The differences in cathepsin B mRNA were consistent with protein measurements as the levels of cathepsin B protein were .5-fold higher in FLNa WT cells than FLNa KD cells (Fig. 7B). We also found that in cell lysates derived from cultured fibroblasts grown 9

TABLE 1. Focal adhesion size Marker

Talin Vinculin aSMA 3/4 Collagen

FLNa WT cells (mm2)

0.9 6 0.10* 1.1 6 0.11* 1.2 6 0.12* 0.9 6 0.10 (no difference)

FLNa KD cells (mm2)

0.5 0.6 0.8 0.8

6 6 6 6

0.08 0.09 0.09 0.11

Data were measured in binarized TIRF images of immunostained cells for the indicated proteins. The size of individual, binarized adhesions is shown as means 6 SEM in square micrometers. For each marker protein, 30 cells were imaged for each cell type. *P , 0.05; **P , 0.01. FLNa WT vs. FLNa KD cells.

from explant cultures of periodontal tissues (from filamin A WT and CKO mice) and in lysates of cultured 3T3 fibroblasts treated with filamin A or control siRNAs, cathepsin B protein expression was markedly reduced by inhibition of FLNa expression compared with controls. We examined MMP-2 and -9 expression as a measure of the extracellular collagen-degradation pathway and found that in FLNa KD cells, there was ;1.5-fold lower mRNA for MMP-2 (at 48 and 72 h) and ;2-fold higher mRNA for MMP-9 than FLNa WT cells (Fig. 7C, D). MMP-9 protein expression was undetectable in FLNa WT cells but was strongly expressed in FLNa KD cells (Fig. 7E), whereas MMP-2 protein was expressed at very low levels in both cell types (data not shown). The collagen phagocytic degradation pathway is very reliant on MMP-14 for initial cleavage of collagen fibrils before internalization (57). Similar to cathepsin B mRNA levels, we found that at all time points, MMP-14 mRNA levels were higher in FLNa WT cells than in FLNa KD cells (.2 fold; Fig. 7F), but this difference in mRNA did not manifest at the protein level, because MMP14 protein levels were similar in the 2 cell types (Fig. 7G). Cell-bound collagen fibrils in the PCM are initially degraded by MMP-14 (57) and the fragmented collagen is then internalized by receptor-mediated phagocytosis (58). As FLNa cross-links actin filaments, especially in the subcortical space (59), we examined whether FLNa KD would affect phagocytosis. FLNa WT and KD cells were spread for 24 h before incubation with collagen-coated fluorescent beads. Beads were incubated for 3 h, followed by collagenase to remove loosely bound surface beads, replated for an additional 24 h to allow completion of phagocytosis (58), and assessed by flow cytometry. We found ;2-fold more internalized collagen-coated beads in FLNa WT cells than in FLNa KD cells (P , 0.01; Fig. 8A). As phagocytosis requires stabilization of subcortical actin filaments, we determined whether the actin cross-linking function of FLNa affects phagocytosis. Comparisons of cells transfected with FLNa ABDD or full-length FLNa showed a ;2-fold reduction of phagocytosed collagencoated beads in cells expressing FLNa ABDD (P , 0.01; Fig. 8B). There was no difference in the phagocytosis of beads coated with BSA by FLNa WT and FLNa KD cells (P . 0.2; Fig. 8C). We also assessed whether FLNa affects fluid phase endocytosis by measuring rhodamine dextran uptake in FLNa WT and FLNa KD cells by flow cytometry. FLNa KD cells exhibited 1.4-fold more dextran uptake than FLNa WT cells (P , 0.01; Fig. 8D). 10

Vol. 30 October 2016

After fragmented collagen fibrils are internalized, collagen degradation is mediated by lysosomal hydrolases (32). We assessed whether FLNa expression affects expression of the lysosomal markers LAMP-1 and -2 (Fig. 8E). FLNa WT cells expressed abundant LAMP-1 and -2, whereas FLNa KD cells exhibited LAMP1 expression but very low levels of LAMP2 protein. In view of the marked reduction in LAMP2 expression by these cells, we also examined cell lysates that had been prepared from cultured fibroblasts grown from explant cultures of periodontal tissues (from filamin A WT and CKO mice) and in lysates of cultured 3T3 fibroblasts that had been treated with filamin A or control siRNAs. In both of these samples, the expression of LAMP2 protein was markedly inhibited after reduction of FLNa expression compared with controls. Because these data indicated that FLNa expression facilitates collagen degradation by phagocytosis, we compared the relative abundance of pericellular collagen in cells that had been preincubated with inhibitors of the phagocytic or MMP collagen digestion pathways. Pericellular matrix proteins were immunoblotted and assayed for collagen-a1 chain abundance. Consistent with the earlier assays (Figs. 3C and 4B), FLNa WT cells exhibited more abundant pericellular collagen than FLNa KD cells. Treatment with the cathepsin inhibitor E64 increased the abundance of pericellular collagen in FLNa WT cells (P , 0.05) but not in FLNa KD cells. The broad spectrum MMP inhibitor batimastat caused no change in either cell population, whereas an inhibitor of MMP-14 (the cell surface protease that cleaves pericellular collagen) strongly increased the abundance of pericellular collagen in FLNa WT and FLNa KD cells (Fig. 8F). These data suggest the possibility that FLNa affects the expression of certain proteins that are associated with the fibroblastic phenotype (i.e., remodeling of the collagen matrix). Accordingly, we conducted mass spectrometry analysis of FLNa immunoprecipitates prepared from 3T3 cells and analyzed the immunoprecipitates by tandem mass spectrometry. In the FLNa-associated proteins eluted from the beads, we found a large number of peptides that predicted several proteins found in the UniProt mouse protein data base. Among the more than 60 predicted proteins that were reported in the mass spectrometry analysis, we found several predicted cytoplasmic proteins (.5 cognate peptides; .99% confidence limits) with predicted sequences that were consistent with the sequences of the cytoplasmic proteins non-muscle myosin IIA, vimentin, vinculin, b actin, plectin, annexin I, Na+- and H+-coupled glutamine transporter protein, and b1-integrin. We also found evidence of several nuclear-associated proteins (.6 cognate peptides; .99% confidence limits) with predicted sequences that were consistent with eukaryotic translation elongation factor a, high-mobility group protein 1, high-mobility group protein 2, splicing factor Sc35 heterogeneous nuclear ribonucleoprotein K, and nucleolar phosphoprotein B23.1. Based on these data and the role of these nuclear proteins in the control of protein translation, filamin A may be involved in the appropriate regulation of expression of certain proteins that are associated with a fibroblastic phenotype.


MEZAWA ET AL.

Figure 7. FLNa expression regulates collagen digestion pathways. Quantification of mRNA expression of cathepsin B (A), MMP-2 (C), MMP-9 (D), and MMP-14 (F) in FLNa WT and KD cells that were allowed to spread for 24, 48, or 72 h before RNA extraction. Data are means 6 SEM from 3 separate experiments. Immunoblots of cathepsin B protein (B), MMP-9 (E), and MMP14 (G) from FLNa WT and KD cells spread for 24, 48, or 72 h before lysis. In immunoblot analysis for cathepsin B protein (B, bottom inset), lysates from fibroblasts from control WT mice (C) or small interfering RNA control 3T3 fibroblasts (siC), or fibroblasts obtained from CKO mice or from 3T3 cells treated with siRNA to FLNa (siF) were analyzed. Lanes were loaded with equal amounts of protein, and b-actin was used as a loading control. The data are representative of 3 separate experiments. *P , 0.05; **P , 0.01; ***P , 0.001.

PERICELLULAR COLLAGEN

11

Figure 8. Effect of FLNa on collagen phagocytosis. A, B) Collagen-coated bead phagocytosis was measured in FLNa WT or FLNa KD cells (A) or for FLNa KD cells transfected with full-length FLNa (B; rescue) or with an FLNa plasmid with deletion of the ABDD. Phagocytosis was assessed by flow cytometry. Cells were first incubated with collagen-coated beads for 3 h. Surface-bound beads that had not been internalized were detached, and the cells were replated overnight to enable completion of phagocytosis before flow cytometry. The data are representative of 3 separate experiments. ***P , 0.001. C ) FLNa WT or FLNa KD cells were incubated with BSA-coated fluorescent beads for 3 hours, trypsinized, replated overnight, and analyzed by flow cytometry. D) Fluid phase endocytosis was conducted. FLNa WT and KD cells were cultured for 24 h before adding rhodamine dextran and (continued on next page)

12



MEZAWA ET AL.

DISCUSSION The actin cytoskeleton is part of a functional continuum that engages PCM molecules. This continuum is attributable in part to the molecular linkages provided by cell adhesion proteins (60). Currently, the critical determinants and interacting proteins of the actin cytoskeleton that regulate remodeling of the PCM are not well-defined, an important concept for describing key regulators of cell migration, fibrosis, and cancer invasion (9). Our major finding is that the actin crosslinking protein filamin A exerts important influences on the organization and abundance of the PCM, in part through its impact on the phagocytosis of collagen and the subsequent intracellular digestion of collagen from the cell surface. In earlier work, Baldassarre and colleagues (31) showed that deletion of FLNa in cultured cells was associated with enhanced gelatinolytic activity of the ECM, which was also evident in the experiments reported herein with FLNa KD cells, which showed greatly increased expression of MMP-9. This is an unexpected result as MMP-2, which was virtually undetectable at the protein level, has been associated with collagen phagocytosis by fibroblasts, because MMP-9 is not normally expressed at measureable levels by these cells. We focused in this study on remodeling of the PCM (7) that surrounds cells and is functionally continuous with the ECM at large. We found that FLNa strongly affected the internalization of collagen, in part through the ability of FLNa to regulate the cell-surface abundance and activation of collagenbinding integrins (30). Indeed, different levels of FLNa expression were associated with differences in the collagen degradation pathway: extracellular degradation by MMPs was prominent when FLNa expression was very low (in FLNa KD cells), whereas collagen degradation by the intracellular pathway was observed when FLNa expression was higher (in FLNa WT cells). These FLNadependent shifts of extracellular (MMP) or phagocytic (cathepsin B) collagen degradation were accompanied by marked variations of the expression of MMP-9 and by cathepsin B and LAMP2, prominent proteins in lysosomes that play roles in lysosomal maturation and intracellular hydrolysis of collagen fibrils (32, 61). The marked regulation of LAMP2 expression (but not LAMP1) by FLNa suggests that the maturation of lysosomes and the repertoire of enzymes in these organelles is regulated by actin cytoskeletal-associated factors.

We examined remodeling of collagen in the PL of forceloaded mouse molar and found that FLNa expression markedly affected the organization and density of collagen fibers stained with picrosirius red. Because the rate of collagen remodeling in the rodent PL is remarkably rapid (45, 46) and is largely dependent on the phagocytic pathway (32), our observations in intact animals suggest that FLNa expression has an important effect on the organization and degradation of collagen through the phagocytic pathway. Further, our finding of enhanced collagen degradation by phagocytosis in cultured fibroblasts and the increased abundance of pericellular collagen in FLNa WT cells was consistent with the notion that collagen in the PCM is tightly bound to the cell periphery, possibly by the enhanced activation of b1 integrins in FLNa-expressing cells. Notably, in experiments in which FLNa was restored in FLNa KD cells, it was evident that the ABDD of FLNa is important for mediating collagen phagocytosis, possibly by enhancing the stability of the submembrane cortex (59) and thereby the attachment of collagen fibrils that are undergoing internalization. Collagen phagocytosis requires extracellular cleavage and fragmentation of fibrils before internalization (62), a process that is dependent on MMP-14 (63). We used a neoepitope antibody that recognizes degraded collagen (53) and TIRF microscopy of immunostained cell adhesions to examine the spatial relationship between sites of cell attachment and initial collagen cleavage in the pericellular space. The application of TIRF microscopy with a very narrow imaging field (;50 nm in the z axis), ensured that our observations on collagen degradation were restricted to the immediate PCM on the ventral cell surface. These data indicate that FLNa strongly affects the ability of cells to degrade extracellular collagen at early stages of the maturation of cell adhesions (stained for talin). These data, combined with the increased pericellular collagen observed in cells treated with the MMP-14 inhibitor, suggest that FLNa regulates early steps in extracellular collagen fragmentation before internalization. Further, the finding that 6 separate nuclear proteins that are associated with the control of protein translation are also associated with FLNa, suggest that FLNa is involved in regulating the expression of discrete proteins that define a fibroblastic phenotype that is associated with remodeling of the pericellular collagen matrix. In summary, we conclude that FLNa regulates remodeling of the PCM in part through its ability to regulate the function of collagen adhesion and in part through

assessing by flow cytometry. Data are means 6 SEM of percentage of cells with internalized dextran from 3 separate experiments. E ) Immunoblots of FLNa WT and FLNa KD cells cultured for up to 48 h before lysis. Lanes were loaded with equal amounts of protein and probed for LAMP-1 and -2. b-Actin was used as a loading control. The data are representative of 3 separate experiments. In immunoblot analysis for LAMP2 protein (E; bottom inset), lysates from fibroblasts from WT mice (C ) or from siRNA control treated 3T3 cells (siC) or fibroblasts obtained from CKO mice or from 3T3 cells treated with siRNA to FLNa (siF) were analyzed. F ) Abundance of collagen in PCM as evaluated by immunoblot analysis of bead-associated proteins. Beads were incubated with cells for 1 hour before detachment and elution of bead-associated proteins followed by immunoblot analysis for collagen. The density of the intact collagen-a1 chain from the immunoblot was normalized to the density of b-actin. Data are from 3 independent experiments. In the indicated groups, cells were pretreated with the inhibitors of cathepsin (E64), broadspectrum MMPs (batimastat), or an inhibitor of MMP-14 (MTI inhibitor) at the concentrations indicated in Materials and Methods. PERICELLULAR COLLAGEN

13

its effects on the degradation pathways that impact the abundance and organization of collagen. ACKNOWLEDGMENTS Christopher McCulloch is supported by a Canada Research Chair (Tier 1) in Matrix Dynamics. The research was supported by a Canadian Institutes of Health operating grant, MOP-11106 (to C.M.). The authors declare no conflicts of interest.

AUTHOR CONTRIBUTIONS M. Mezawa, V. Pinto, M. Kazembe, and W. Lee performed the experiments and analyzed the data; and V. Pinto and C. McCulloch designed the experiments, analyzed the data, and wrote the paper. REFERENCES 1. Theocharis, A. D., Skandalis, S. S., Gialeli, C., and Karamanos, N. K. (2016) Extracellular matrix structure. Adv. Drug Deliv. Rev. 97, 4–27 2. Klamer, S., and Voermans, C. (2014) The role of novel and known extracellular matrix and adhesion molecules in the homeostatic and regenerative bone marrow microenvironment. Cell Adhes. Migr. 8, 563–577 3. Pickup, M. W., Mouw, J. K., and Weaver, V. M. (2014) The extracellular matrix modulates the hallmarks of cancer. EMBO Rep. 15, 1243–1253 4. Humphrey, J. D., Dufresne, E. R., and Schwartz, M. A. (2014) Mechanotransduction and extracellular matrix homeostasis. Nat. Rev. Mol. Cell Biol. 15, 802–812 5. Lukashev, M. E., and Werb, Z. (1998) ECM signalling: orchestrating cell behaviour and misbehaviour. Trends Cell Biol. 8, 437–441 6. Bonnans, C., Chou, J., and Werb, Z. (2014) Remodelling the extracellular matrix in development and disease. Nat. Rev. Mol. Cell Biol. 15, 786–801 7. Lee, G. M., Johnstone, B., Jacobson, K., and Caterson, B. (1993) The dynamic structure of the pericellular matrix on living cells. J. Cell Biol. 123, 1899–1907 8. Vincent, T. L. (2013) Targeting mechanotransduction pathways in osteoarthritis: a focus on the pericellular matrix. Curr. Opin. Pharmacol. 13, 449–454 9. Von Nandelstadh, P., Gucciardo, E., Lohi, J., Li, R., Sugiyama, N., Carpen, O., and Lehti, K. (2014) Actin-associated protein palladin promotes tumor cell invasion by linking extracellular matrix degradation to cell cytoskeleton. Mol. Biol. Cell 25, 2556–2570 10. Monslow, J., Govindaraju, P., and Puré, E. (2015) Hyaluronan: a functional and structural sweet spot in the tissue microenvironment. Front. Immunol. 6, 231 11. Zhang, Z. (2015) Chondrons and the pericellular matrix of chondrocytes. Tissue Eng. Part B Rev. 21, 267–277 12. Sardone, F., Traina, F., Tagliavini, F., Pellegrini, C., Merlini, L., Squarzoni, S., Santi, S., Neri, S., Faldini, C., Maraldi, N., and Sabatelli, P. (2014) Effect of mechanical strain on the collagen VI pericellular matrix in anterior cruciate ligament fibroblasts. J. Cell. Physiol. 229, 878–886 13. Sill, H. W., Chang, Y. S., Artman, J. R., Frangos, J. A., Hollis, T. M., and Tarbell, J. M. (1995) Shear stress increases hydraulic conductivity of cultured endothelial monolayers. Am. J. Physiol. 268, H535–H543 14. Yao, Y., Rabodzey, A., and Dewey, C. F., Jr. (2007) Glycocalyx modulates the motility and proliferative response of vascular endothelium to fluid shear stress. Am. J. Physiol. Heart Circ. Physiol. 293, H1023–H1030 15. Evanko, S. P., Potter-Perigo, S., Petty, L. J., Workman, G. A., and Wight, T. N. (2015) Hyaluronan controls the deposition of fibronectin and collagen and modulates TGF-b1 induction of lung myofibroblasts. Matrix Biol. 42, 74–92 14


16. Carraher, C. L., and Schwarzbauer, J. E. (2013) Regulation of matrix assembly through rigidity-dependent fibronectin conformational changes. J. Biol. Chem. 288, 14805–14814 17. Shi, Z. D., and Tarbell, J. M. (2011) Fluid flow mechanotransduction in vascular smooth muscle cells and fibroblasts. Ann. Biomed. Eng. 39, 1608–1619 18. Dewey, C. F., Jr., Bussolari, S. R., Gimbrone, M. A., Jr., and Davies, P. F. (1981) The dynamic response of vascular endothelial cells to fluid shear stress. J. Biomech. Eng. 103, 177–185 19. Gasparski, A. N., and Beningo, K. A. (2015) Mechanoreception at the cell membrane: more than the integrins. Arch. Biochem. Biophys. 586, 20–26 20. Zhou, A. X., Hartwig, J. H., and Akyürek, L. M. (2010) Filamins in cell signaling, transcription and organ development. Trends Cell Biol. 20, 113–123 21. Nakamura, F., Stossel, T. P., and Hartwig, J. H. (2011) The filamins: organizers of cell structure and function. Cell Adhes. Migr. 5, 160–169 22. Kim, H., and McCulloch, C. A. (2011) Filamin A mediates interactions between cytoskeletal proteins that control cell adhesion. FEBS Lett. 585, 18–22 23. Campbell, I. D. (2008) Studies of focal adhesion assembly. Biochem. Soc. Trans. 36, 263–266 24. Popowicz, G. M., Schleicher, M., Noegel, A. A., and Holak, T. A. (2006) Filamins: promiscuous organizers of the cytoskeleton. Trends Biochem. Sci. 31, 411–419 25. Feng, Y., and Walsh, C. A. (2004) The many faces of filamin: a versatile molecular scaffold for cell motility and signalling. Nat. Cell Biol. 6, 1034–1038 26. Shifrin, Y., Pinto, V. I., Hassanali, A., Arora, P. D., and McCulloch, C. A. (2012) Force-induced apoptosis mediated by the Rac/Pak/p38 signalling pathway is regulated by filamin A. Biochem. J. 445, 57–67 27. Pinto, V. I., Senini, V. W., Wang, Y., Kazembe, M. P., and McCulloch, C. A. (2014) Filamin A protects cells against force-induced apoptosis by stabilizing talin- and vinculin-containing cell adhesions. FASEB J. 28, 453–463 28. Mohammadi, H., Pinto, V. I., Wang, Y., Hinz, B., Janmey, P. A., and McCulloch, C. A. (2015) Filamin A mediates wound closure by promoting elastic deformation and maintenance of tension in the collagen matrix. J. Invest. Dermatol. 135, 2852–2861 29. Kainulainen, T., Pender, A., D’Addario, M., Feng, Y., Lekic, P., and McCulloch, C. A. (2002) Cell death and mechanoprotection by filamin a in connective tissues after challenge by applied tensile forces. J. Biol. Chem. 277, 21998–22009 30. Kiema, T., Lad, Y., Jiang, P., Oxley, C. L., Baldassarre, M., Wegener, K. L., Campbell, I. D., Ylänne, J., and Calderwood, D. A. (2006) The molecular basis of filamin binding to integrins and competition with talin. Mol. Cell 21, 337–347 31. Baldassarre, M., Razinia, Z., Brahme, N. N., Buccione, R., and Calderwood, D. A. (2012) Filamin A controls matrix metalloproteinase activity and regulates cell invasion in human fibrosarcoma cells. J. Cell Sci. 125, 3858–3869 32. Everts, V., van der Zee, E., Creemers, L., and Beertsen, W. (1996) Phagocytosis and intracellular digestion of collagen, its role in turnover and remodelling. Histochem. J. 28, 229–245 33. Burleigh, M. C., Barrett, A. J., and Lazarus, G. S. (1974) Cathepsin B1: a lysosomal enzyme that degrades native collagen. Biochem. J. 137, 387–398 34. Lecaille, F., Brömme, D., and Lalmanach, G. (2008) Biochemical properties and regulation of cathepsin K activity. Biochimie 90, 208–226 35. Arora, P. D., Conti, M. A., Ravid, S., Sacks, D. B., Kapus, A., Adelstein, R. S., Bresnick, A. R., and McCulloch, C. A. (2008) Rap1 activation in collagen phagocytosis is dependent on nonmuscle myosin II-A. Mol. Biol. Cell 19, 5032–5046 36. Feng, Y., Chen, M. H., Moskowitz, I. P., Mendonza, A. M., Vidali, L., Nakamura, F., Kwiatkowski, D. J., and Walsh, C. A. (2006) Filamin A (FLNA) is required for cell–cell contact in vascular development and cardiac morphogenesis. Proc. Natl. Acad. Sci. USA 103, 19836–19841 37. Liu, F., Woitge, H. W., Braut, A., Kronenberg, M. S., Lichtler, A. C., Mina, M., and Kream, B. E. (2004) Expression and activity of osteoblast-targeted Cre recombinase transgenes in murine skeletal tissues. Int. J. Dev. Biol. 48, 645–653 38. Liu, Z. Q. (1991) Scale space approach to directional analysis of images. Appl. Opt. 30, 1369–1373 39. Mohammad, I., Arora, P. D., Naghibzadeh, Y., Wang, Y., Li, J., Mascarenhas, W., Janmey, P. A., Dawson, J. F., and McCulloch, C. A. (2012) Flightless I is a focal adhesion-associated actin-capping protein that regulates cell migration. FASEB J. 26, 3260–3272


MEZAWA ET AL.

40. Van Duyn Graham, L., Sweetwyne, M. T., Pallero, M. A., and Murphy-Ullrich, J. E. (2010) Intracellular calreticulin regulates multiple steps in fibrillar collagen expression, trafficking, and processing into the extracellular matrix. J. Biol. Chem. 285, 7067–7078 41. Kim, H., Nakamura, F., Lee, W., Hong, C., Pérez-Sala, D., and McCulloch, C. A. (2010) Regulation of cell adhesion to collagen via beta1 integrins is dependent on interactions of filamin A with vimentin and protein kinase C epsilon. Exp. Cell Res. 316, 1829–1844 42. Kim, H., Nakamura, F., Lee, W., Shifrin, Y., Arora, P., and McCulloch, C. A. (2010) Filamin A is required for vimentin-mediated cell adhesion and spreading. Am. J. Physiol. Cell Physiol. 298, C221–C236 43. Lenter, M., Uhlig, H., Hamann, A., Jenö, P., Imhof, B., and Vestweber, D. (1993) A monoclonal antibody against an activation epitope on mouse integrin chain beta 1 blocks adhesion of lymphocytes to the endothelial integrin alpha 6 beta 1. Proc. Natl. Acad. Sci. USA 90, 9051–9055 44. Steffen, A., Ladwein, M., Dimchev, G. A., Hein, A., Schwenkmezger, L., Arens, S., Ladwein, K. I., Margit Holleboom, J., Schur, F., Victor Small, J., Schwarz, J., Gerhard, R., Faix, J., Stradal, T. E., Brakebusch, C., and Rottner, K. (2013) Rac function is crucial for cell migration but is not required for spreading and focal adhesion formation. J. Cell Sci. 126, 4572–4588 45. Rippin, J. W. (1976) Collagen turnover in the periodontal ligament under normal and altered functional forces. I, young rat molars. J. Periodontal Res. 11, 101–107 46. Sodek, J. (1977) A comparison of the rates of synthesis and turnover of collagen and non-collagen proteins in adult rat periodontal tissues and skin using a microassay. Arch. Oral Biol. 22, 655–665 47. Perera, K. A., and Tonge, C. H. (1981) Metabolic turnover of collagen in the mouse molar periodontal ligament during tooth eruption. J. Anat. 133, 359–370 48. Ten Cate, A. R., and Deporter, D. A. (1974) The role of the fibroblast in collagen turnover in the functioning periodontal ligament of the mouse. Arch. Oral Biol. 19, 339–340 49. Nazac, A., Bancelin, S., Teig, B., Ibrahim, B. H., Fernandez, H., Schanne-Klein, M. C., and De Martino, A. (2015) Optimization of Picrosirius red staining protocol to determine collagen fiber orientations in vaginal and uterine cervical tissues by Mueller polarized microscopy. Microsc. Res. Tech. 78, 723–730 50. Navab, R., Strumpf, D., To, C., Pasko, E., Kim, K. S., Park, C. J., Hai, J., Liu, J., Jonkman, J., Barczyk, M., Bandarchi, B., Wang, Y. H., Venkat, K., Ibrahimov, E., Pham, N. A., Ng, C., Radulovich, N., Zhu, C. Q., Pintilie, M., Wang, D., Lu, A., Jurisica, I., Walker, G. C., Gullberg, D., and Tsao, M. S. (2015) Integrin alpha11beta1 regulates cancer stromal stiffness and promotes tumorigenicity and metastasis in nonsmall cell lung cancer. Oncogene 35, 1899–1908

PERICELLULAR COLLAGEN

51. Jeon, P. D., Turley, P. K., Moon, H. B., and Ting, K. (1999) Analysis of stress in the periodontium of the maxillary first molar with a threedimensional finite element model. Am. J. Orthod. Dentofacial Orthop. 115, 267–274 52. Shifrin, Y., Arora, P. D., Ohta, Y., Calderwood, D. A., and McCulloch, C. A. (2009) The role of FilGAP-filamin A interactions in mechanoprotection. Mol. Biol. Cell 20, 1269–1279 53. Arora, P. D., Wang, Y., Bresnick, A., Dawson, J., Janmey, P. A., and McCulloch, C. A. (2013) Collagen remodeling by phagocytosis is determined by collagen substrate topology and calcium-dependent interactions of gelsolin with nonmuscle myosin IIA in cell adhesions. Mol. Biol. Cell 24, 734–747 54. Staudinger, L. A., Spano, S. J., Lee, W., Coelho, N., Rajshankar, D., Bendeck, M. P., Moriarty, T., and McCulloch, C. A. (2013) Interactions between the discoidin domain receptor 1 and b1 integrin regulate attachment to collagen. Biol. Open 2, 1148–1159 55. Schiller, H. B., and Fässler, R. (2013) Mechanosensitivity and compositional dynamics of cell-matrix adhesions. EMBO Rep. 14, 509–519 56. Bolte, S., and Cordelières, F. P. (2006) A guided tour into subcellular colocalization analysis in light microscopy. J. Microsc. 224, 213–232 57. Lee, H., Sodek, K. L., Hwang, Q., Brown, T. J., Ringuette, M., and Sodek, J. (2007) Phagocytosis of collagen by fibroblasts and invasive cancer cells is mediated by MT1-MMP. Biochem. Soc. Trans. 35, 704–706 58. Arora, P. D., Manolson, M. F., Downey, G. P., Sodek, J., and McCulloch, C. A. (2000) A novel model system for characterization of phagosomal maturation, acidification, and intracellular collagen degradation in fibroblasts. J. Biol. Chem. 275, 35432–35441 59. Stossel, T. P., Condeelis, J., Cooley, L., Hartwig, J. H., Noegel, A., Schleicher, M., and Shapiro, S. S. (2001) Filamins as integrators of cell mechanics and signalling. Nat. Rev. Mol. Cell Biol. 2, 138–145 60. Sugrue, S. P., and Hay, E. D. (1981) Response of basal epithelial cell surface and cytoskeleton to solubilized extracellular matrix molecules. J. Cell Biol. 91, 45–54 61. Panwar, P., Du, X., Sharma, V., Lamour, G., Castro, M., Li, H., and Brömme, D. (2013) Effects of cysteine proteases on the structural and mechanical properties of collagen fibers. J. Biol. Chem. 288, 5940–5950 62. Melcher, A. H., and Chan, J. (1981) Phagocytosis and digestion of collagen by gingival fibroblasts in vivo: a study of serial sections. J. Ultrastruct. Res. 77, 1–36 63. Lee, H., Overall, C. M., McCulloch, C. A., and Sodek, J. (2006) A critical role for the membrane-type 1 matrix metalloproteinase in collagen phagocytosis. Mol. Biol. Cell 17, 4812–4826 Received for publication March 14, 2016. Accepted for publication July 5, 2016.

15